#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAM33	80332	ucsc.edu;bcgsc.ca	37	20	3655233	3655233	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr20:3655233A>G	ENST00000356518.2	-	6	759	c.518T>C	c.(517-519)cTc>cCc	p.L173P	ADAM33_ENST00000350009.2_Missense_Mutation_p.L173P|ADAM33_ENST00000466620.1_5'Flank|ADAM33_ENST00000379861.4_Missense_Mutation_p.L173P	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	173					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						TTTCCAGGTGAGCAGCTGCTC	0.607																																					p.L173P		.											.	ADAM33	291	0			c.T518C						.						80.0	88.0	85.0					20																	3655233		2203	4300	6503	SO:0001583	missense	80332	exon6			CAGGTGAGCAGCT	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.518T>C	20.37:g.3655233A>G	ENSP00000348912:p.Leu173Pro	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	47.0	5.0	NM_025220	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	ENST00000356518.2	37	CCDS13058.1	.	.	.	.	.	.	.	.	.	.	A	3.070	-0.191332	0.06299	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000439201	T;T;T	0.01560	4.77;4.77;4.81	4.98	2.52	0.30459	.	.	.	.	.	T	0.01222	0.0040	N	0.17082	0.46	0.21675	N	0.999598	B;B;B;B;B	0.20459	0.045;0.001;0.0;0.0;0.0	B;B;B;B;B	0.12837	0.008;0.006;0.005;0.002;0.002	T	0.48736	-0.9009	9	0.29301	T	0.29	.	2.9568	0.05880	0.4796:0.0:0.3317:0.1887	.	173;185;173;173;173	B4DTZ3;B4E1Y6;Q9BZ11-2;Q9BZ11;A2A2L3	.;.;.;ADA33_HUMAN;.	P	173	ENSP00000348912:L173P;ENSP00000369190:L173P;ENSP00000322550:L173P	ENSP00000322550:L173P	L	-	2	0	ADAM33	3603233	0.020000	0.18652	0.064000	0.19789	0.041000	0.13682	1.330000	0.33781	0.898000	0.36418	0.533000	0.62120	CTC	.		0.607	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220	
ARHGAP18	93663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	129927037	129927037	+	Silent	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr6:129927037G>A	ENST00000368149.2	-	10	1438	c.1350C>T	c.(1348-1350)aaC>aaT	p.N450N		NM_033515.2	NP_277050.2			Rho GTPase activating protein 18											NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		GTGTGTCCCTGTTTGCATCAG	0.363																																					p.N450N		.											.	ARHGAP18	230	0			c.C1350T						.						156.0	161.0	160.0					6																	129927037		2203	4300	6503	SO:0001819	synonymous_variant	93663	exon10			GTCCCTGTTTGCA	AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000368149.2:c.1350C>T	6.37:g.129927037G>A		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	65.0	NM_033515		Silent	SNP	ENST00000368149.2	37	CCDS34535.1																																																																																			.		0.363	ARHGAP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042185.2	NM_033515	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27106893	27106894	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr1:27106893_27106894insT	ENST00000324856.7	+	20	6875_6876	c.6504_6505insT	c.(6505-6507)gtafs	p.V2169fs	ARID1A_ENST00000374152.2_Frame_Shift_Ins_p.V1786fs|ARID1A_ENST00000540690.1_Frame_Shift_Ins_p.V497fs|ARID1A_ENST00000457599.2_Frame_Shift_Ins_p.V1952fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2169					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGATGGCTGTGGTACTGCTGGC	0.609			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.V2168fs		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	584	0			c.6504_6505insT						.																																			SO:0001589	frameshift_variant	8289	exon20			GGCTGTGGTACTG	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	Exception_encountered	1.37:g.27106893_27106894insT	ENSP00000320485:p.Val2169fs	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	16.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Ins	INS	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.609	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	27105550	27105550	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr1:27105550C>T	ENST00000324856.7	+	20	5532	c.5161C>T	c.(5161-5163)Cga>Tga	p.R1721*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.R1338*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.R49*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.R1504*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1721					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.R1721*(3)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGAATATTTCCGACGATGCCT	0.443			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.R1721X		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,NS,carcinoma,0	ARID1A	584	3	Substitution - Nonsense(3)	ovary(1)|large_intestine(1)|endometrium(1)	c.C5161T						.						184.0	203.0	196.0					1																	27105550		2203	4300	6503	SO:0001587	stop_gained	8289	exon20			TATTTCCGACGAT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5161C>T	1.37:g.27105550C>T	ENSP00000320485:p.Arg1721*	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	234.0	117.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	9.126146|9.126146	0.99073|0.99073	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	.|.	.|.	.|.	4.71|4.71	4.71|4.71	0.59529|0.59529	.|.	.|0.060827	.|0.64402	.|D	.|0.000007	T|.	0.34745|.	0.0908|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.15954|.	-1.0419|.	4|.	.|0.02654	.|T	.|1	-6.2012|-6.2012	13.2131|13.2131	0.59836|0.59836	0.159:0.841:0.0:0.0|0.159:0.841:0.0:0.0	.|.	.|.	.|.	.|.	L|X	617|1721;1504;1338;49	.|.	.|ENSP00000320485:R1721X	P|R	+|+	2|1	0|2	ARID1A|ARID1A	26978137|26978137	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.413000|2.413000	0.44618|0.44618	2.622000|2.622000	0.88805|0.88805	0.591000|0.591000	0.81541|0.81541	CCG|CGA	.		0.443	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ASAH2	56624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	52008360	52008360	+	Missense_Mutation	SNP	C	C	T	rs376205298		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr10:52008360C>T	ENST00000395526.4	-	1	10	c.11G>A	c.(10-12)cGc>cAc	p.R4H	ASAH2_ENST00000447815.1_Missense_Mutation_p.R4H|ASAH2_ENST00000329428.6_5'Flank	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	4					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)			large_intestine(1)|lung(9)|urinary_tract(1)	11						AGAGAAGGTGCGTTTGGCCAT	0.438																																					p.R4H		.											.	ASAH2	90	0			c.G11A						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	94.0	91.0	92.0		11,11	4.1	0.9	10		92	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ASAH2	NM_001143974.1,NM_019893.2	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	4/746,4/781	52008360	1,13005	2203	4300	6503	SO:0001583	missense	56624	exon1			AAGGTGCGTTTGG	AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.11G>A	10.37:g.52008360C>T	ENSP00000378897:p.Arg4His	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	37.0	NM_001143974	Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	ENST00000395526.4	37	CCDS7239.2	.	.	.	.	.	.	.	.	.	.	C	13.80	2.346638	0.41599	0.0	1.16E-4	ENSG00000188611	ENST00000395526;ENST00000447815	T;T	0.34859	1.38;1.34	5.94	4.1	0.47936	.	0.271361	0.30593	U	0.009284	T	0.26122	0.0637	L	0.31926	0.97	0.58432	D	0.999999	B;B	0.21821	0.061;0.036	B;B	0.13407	0.009;0.004	T	0.04307	-1.0961	10	0.40728	T	0.16	.	9.5095	0.39067	0.0:0.8371:0.0:0.1629	.	4;4	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	H	4	ENSP00000378897:R4H;ENSP00000388206:R4H	ENSP00000378897:R4H	R	-	2	0	ASAH2	51678366	0.002000	0.14202	0.876000	0.34364	0.987000	0.75469	0.461000	0.21940	0.852000	0.35287	0.563000	0.77884	CGC	.		0.438	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048061.3	NM_019893	
AXIN1	8312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	347071	347072	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr16:347071_347072insG	ENST00000262320.3	-	7	2310_2311	c.1939_1940insC	c.(1939-1941)cgcfs	p.R647fs	AXIN1_ENST00000354866.3_Frame_Shift_Ins_p.R647fs|AXIN1_ENST00000481769.1_5'Flank	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	647	Interaction with PPP2CA.|Interaction with RNF111.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.R647C(1)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GCCGGTCCTGCGGTGCCTGCTG	0.639																																					p.R647fs		.											.	AXIN1	684	1	Substitution - Missense(1)	endometrium(1)	c.1940_1941insC						.																																			SO:0001589	frameshift_variant	8312	exon7			GTCCTGCGGTGCC	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1940dupC	16.37:g.347073_347073dupG	ENSP00000262320:p.Arg647fs	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	49.0	NM_003502	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Frame_Shift_Ins	INS	ENST00000262320.3	37	CCDS10405.1																																																																																			.		0.639	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
BRD7	29117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	50357576	50357576	+	Nonsense_Mutation	SNP	A	A	C			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr16:50357576A>C	ENST00000394688.3	-	12	1524	c.1365T>G	c.(1363-1365)taT>taG	p.Y455*	BRD7_ENST00000394689.2_Nonsense_Mutation_p.Y455*			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	455					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				TGACATACGGATAATCTTGGC	0.443																																					p.Y455X		.											.	BRD7	90	0			c.T1365G						.						108.0	91.0	97.0					16																	50357576		2198	4300	6498	SO:0001587	stop_gained	29117	exon12			ATACGGATAATCT	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1365T>G	16.37:g.50357576A>C	ENSP00000378180:p.Tyr455*	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	46.0	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Nonsense_Mutation	SNP	ENST00000394688.3	37	CCDS10742.1	.	.	.	.	.	.	.	.	.	.	A	37	6.084326	0.97267	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	.	.	.	5.53	-0.728	0.11162	.	0.187371	0.48767	D	0.000165	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.8448	7.115	0.25411	0.3973:0.0:0.4736:0.129	.	.	.	.	X	455	.	ENSP00000378180:Y455X	Y	-	3	2	BRD7	48915077	0.990000	0.36364	0.914000	0.36105	0.920000	0.55202	0.345000	0.19979	-0.161000	0.10983	0.533000	0.62120	TAT	.		0.443	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
C11orf16	56673	broad.mit.edu;bcgsc.ca	37	11	8947522	8947522	+	Missense_Mutation	SNP	C	C	T	rs148052847		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr11:8947522C>T	ENST00000326053.5	-	5	798	c.692G>A	c.(691-693)aGg>aAg	p.R231K	C11orf16_ENST00000525780.1_Missense_Mutation_p.R231K|C11orf16_ENST00000528998.1_5'Flank	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	231										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		GGGGTGCTCCCTGGTGAAAGA	0.592													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14580	0.0		0.0	False		,,,				2504	0.0				p.R231K		.											.	C11orf16	92	0			c.G692A						.	C	LYS/ARG	4,4398	8.1+/-20.4	0,4,2197	62.0	68.0	66.0		692	3.7	0.1	11	dbSNP_134	66	0,8592		0,0,4296	no	missense	C11orf16	NM_020643.2	26	0,4,6493	TT,TC,CC		0.0,0.0909,0.0308	benign	231/468	8947522	4,12990	2201	4296	6497	SO:0001583	missense	56673	exon5			TGCTCCCTGGTGA	AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.692G>A	11.37:g.8947522C>T	ENSP00000318999:p.Arg231Lys	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	5.0	NM_020643	Q53FB2|Q8N6Y9	Missense_Mutation	SNP	ENST00000326053.5	37	CCDS7794.1	.	.	.	.	.	.	.	.	.	.	C	7.114	0.576571	0.13686	9.09E-4	0.0	ENSG00000176029	ENST00000525780;ENST00000326053	T;T	0.30448	1.54;1.53	5.6	3.73	0.42828	.	0.268462	0.33057	N	0.005331	T	0.24967	0.0606	L	0.55481	1.735	0.09310	N	1	P;P	0.42296	0.775;0.775	B;B	0.39660	0.306;0.306	T	0.11275	-1.0594	10	0.10111	T	0.7	-15.9868	9.4688	0.38829	0.0:0.6592:0.2686:0.0722	.	231;231	Q9NQ32-2;Q9NQ32	.;CK016_HUMAN	K	231	ENSP00000436818:R231K;ENSP00000318999:R231K	ENSP00000318999:R231K	R	-	2	0	C11orf16	8904098	0.000000	0.05858	0.077000	0.20336	0.374000	0.29953	0.250000	0.18235	0.717000	0.32145	0.655000	0.94253	AGG	C|1.000;T|0.000		0.592	C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385626.1	NM_020643	
C11orf74	119710	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	36669639	36669642	+	Frame_Shift_Del	DEL	CCAG	CCAG	-	rs369480679|rs570540394		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	CCAG	CCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr11:36669639_36669642delCCAG	ENST00000334307.5	+	5	547_550	c.432_435delCCAG	c.(430-435)gcccagfs	p.AQ144fs	C11orf74_ENST00000446510.2_Frame_Shift_Del_p.AQ144fs|C11orf74_ENST00000347206.4_Frame_Shift_Del_p.AQ70fs|C11orf74_ENST00000534635.1_Frame_Shift_Del_p.AQ70fs	NM_138787.2	NP_620142.2	Q86VG3	CK074_HUMAN	chromosome 11 open reading frame 74	144										breast(1)|kidney(1)|large_intestine(1)|lung(5)	8	all_lung(20;0.226)	all_hematologic(20;0.0118)				CTTTTGTGGCCCAGCCTCCTACCT	0.48																																					p.144_145del		.											.	C11orf74	68	0			c.432_435del						.																																			SO:0001589	frameshift_variant	119710	exon5			TGTGGCCCAGCCT	AK095997, BC009561	CCDS7904.1, CCDS60762.1	11p12	2012-08-10			ENSG00000166352	ENSG00000166352			25142	protein-coding gene	gene with protein product						12477932	Standard	NM_001276722		Approved	FLJ38678, HEPIS	uc031pzr.1	Q86VG3	OTTHUMG00000166397	ENST00000334307.5:c.432_435delCCAG	11.37:g.36669639_36669642delCCAG	ENSP00000334848:p.Ala144fs	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	14.0	NM_138787	D3DR18|Q96DD6	Frame_Shift_Del	DEL	ENST00000334307.5	37	CCDS7904.1																																																																																			.		0.480	C11orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389567.1	NM_138787	
C11orf74	119710	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	36669648	36669649	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr11:36669648_36669649insC	ENST00000334307.5	+	5	556_557	c.441_442insC	c.(442-444)accfs	p.T148fs	C11orf74_ENST00000446510.2_Frame_Shift_Ins_p.T148fs|C11orf74_ENST00000347206.4_Frame_Shift_Ins_p.T74fs|C11orf74_ENST00000534635.1_Frame_Shift_Ins_p.T74fs	NM_138787.2	NP_620142.2	Q86VG3	CK074_HUMAN	chromosome 11 open reading frame 74	148										breast(1)|kidney(1)|large_intestine(1)|lung(5)	8	all_lung(20;0.226)	all_hematologic(20;0.0118)				CCCAGCCTCCTACCTGTGAAGT	0.475																																					p.D147fs		.											.	C11orf74	68	0			c.441_442insC						.																																			SO:0001589	frameshift_variant	119710	exon5			GCCTCCTACCTGT	AK095997, BC009561	CCDS7904.1, CCDS60762.1	11p12	2012-08-10			ENSG00000166352	ENSG00000166352			25142	protein-coding gene	gene with protein product						12477932	Standard	NM_001276722		Approved	FLJ38678, HEPIS	uc031pzr.1	Q86VG3	OTTHUMG00000166397	Exception_encountered	11.37:g.36669648_36669649insC	ENSP00000334848:p.Thr148fs	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	18.0	NM_138787	D3DR18|Q96DD6	Frame_Shift_Ins	INS	ENST00000334307.5	37	CCDS7904.1																																																																																			.		0.475	C11orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389567.1	NM_138787	
COL12A1	1303	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	75893307	75893307	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr6:75893307G>T	ENST00000322507.8	-	10	1659	c.1350C>A	c.(1348-1350)agC>agA	p.S450R	COL12A1_ENST00000483888.2_Missense_Mutation_p.S450R|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.S450R	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	450	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CAATCCCAATGCTATAGGAGC	0.338																																					p.S450R		.											.	COL12A1	142	0			c.C1350A						.						79.0	76.0	77.0					6																	75893307		1825	4081	5906	SO:0001583	missense	1303	exon10			CCCAATGCTATAG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1350C>A	6.37:g.75893307G>T	ENSP00000325146:p.Ser450Arg	Somatic	88.0	1.0		WXS	Illumina HiSeq	Phase_I	94.0	58.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.088645	0.55968	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	D;D;D	0.90844	-2.74;-2.74;-2.74	5.34	3.54	0.40534	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.94318	0.8174	M	0.91972	3.26	0.46678	D	0.999154	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93983	0.7260	10	0.59425	D	0.04	.	7.9235	0.29861	0.3006:0.0:0.6994:0.0	.	450;450	D6RGG3;Q99715	.;COCA1_HUMAN	R	450	ENSP00000325146:S450R;ENSP00000412864:S450R;ENSP00000421216:S450R	ENSP00000325146:S450R	S	-	3	2	COL12A1	75950027	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.570000	0.36439	1.386000	0.46466	0.655000	0.94253	AGC	.		0.338	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
COL25A1	84570	ucsc.edu;bcgsc.ca	37	4	109740482	109740482	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr4:109740482A>G	ENST00000399132.1	-	36	2379	c.1849T>C	c.(1849-1851)Ttc>Ctc	p.F617L		NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		ACGCCACGGAATCCCTGTTTG	0.463																																					p.F617L		.											.	COL25A1	92	0			c.T1849C						.						64.0	65.0	65.0					4																	109740482		1875	4105	5980	SO:0001583	missense	84570	exon35			CACGGAATCCCTG	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1849T>C	4.37:g.109740482A>G	ENSP00000382083:p.Phe617Leu	Somatic	20.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_198721		Missense_Mutation	SNP	ENST00000399132.1	37	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	A	17.62	3.433716	0.62955	.	.	ENSG00000188517	ENST00000399132;ENST00000333642	D	0.93307	-3.2	5.6	5.6	0.85130	.	0.135029	0.52532	D	0.000063	D	0.87513	0.6196	N	0.02403	-0.565	0.80722	D	1	B	0.29301	0.241	B	0.44163	0.443	D	0.84734	0.0747	9	.	.	.	0.4862	15.7654	0.78123	1.0:0.0:0.0:0.0	.	617	Q9BXS0	COPA1_HUMAN	L	617;619	ENSP00000382083:F617L	.	F	-	1	0	COL25A1	109959931	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.121000	0.77160	2.129000	0.65627	0.377000	0.23210	TTC	.		0.463	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518	
DCSTAMP	81501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	105361088	105361088	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr8:105361088C>A	ENST00000297581.2	+	2	357	c.308C>A	c.(307-309)aCa>aAa	p.T103K	DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000517991.1_Missense_Mutation_p.T103K	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	103					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											GCAGCTGGCACAGGGATCGTC	0.443																																					p.T103K		.											.	.	.	0			c.C308A						.						65.0	63.0	64.0					8																	105361088		2203	4300	6503	SO:0001583	missense	81501	exon2			CTGGCACAGGGAT	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.308C>A	8.37:g.105361088C>A	ENSP00000297581:p.Thr103Lys	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	222.0	89.0	NM_001257317	B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481689	0.84747	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T	0.34859	1.34	5.84	5.84	0.93424	.	0.097167	0.64402	D	0.000001	T	0.59945	0.2231	M	0.66939	2.045	0.58432	D	0.999997	D	0.89917	1.0	D	0.77004	0.989	T	0.55679	-0.8103	9	.	.	.	-18.0528	18.3185	0.90229	0.0:1.0:0.0:0.0	.	103	Q9H295	TM7S4_HUMAN	K	103	ENSP00000297581:T103K	.	T	+	2	0	TM7SF4	105430264	0.991000	0.36638	0.993000	0.49108	0.993000	0.82548	2.937000	0.48979	2.779000	0.95612	0.655000	0.94253	ACA	.		0.443	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788	
EIF4G2	1982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10821282	10821282	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr11:10821282C>T	ENST00000526148.1	-	19	2651	c.2141G>A	c.(2140-2142)cGc>cAc	p.R714H	EIF4G2_ENST00000396525.2_Missense_Mutation_p.R676H|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000525681.1_Missense_Mutation_p.R714H|EIF4G2_ENST00000339995.5_Missense_Mutation_p.R714H|RP11-685M7.5_ENST00000532365.1_RNA	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2									p.R714H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CTCCAACATGCGGTCCTTATT	0.418																																					p.R714H		.											.	EIF4G2	91	1	Substitution - Missense(1)	large_intestine(1)	c.G2141A						.						103.0	99.0	100.0					11																	10821282		2201	4294	6495	SO:0001583	missense	1982	exon19			AACATGCGGTCCT	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.2141G>A	11.37:g.10821282C>T	ENSP00000433664:p.Arg714His	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	18.0	NM_001172705		Missense_Mutation	SNP	ENST00000526148.1	37	CCDS31428.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270710	0.80469	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000379653	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.71	5.71	0.89125	Armadillo-type fold (1);	0.107006	0.64402	D	0.000005	T	0.58293	0.2112	M	0.62266	1.93	0.47308	D	0.999387	D;D	0.89917	0.999;1.0	P;P	0.55508	0.665;0.777	T	0.57700	-0.7766	9	0.52906	T	0.07	-4.1326	19.8493	0.96733	0.0:1.0:0.0:0.0	.	714;787	P78344;B4DZF2	IF4G2_HUMAN;.	H	714;714;714;676;787;96	ENSP00000433664:R714H;ENSP00000433371:R714H;ENSP00000340281:R714H;ENSP00000379778:R676H	ENSP00000340281:R714H	R	-	2	0	EIF4G2	10777858	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.022000	0.70839	2.701000	0.92244	0.563000	0.77884	CGC	.		0.418	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
EPN3	55040	hgsc.bcm.edu;ucsc.edu	37	17	48614425	48614425	+	Missense_Mutation	SNP	C	C	T	rs146173668	byFrequency	TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr17:48614425C>T	ENST00000268933.3	+	2	1087	c.508C>T	c.(508-510)Cgc>Tgc	p.R170C	EPN3_ENST00000537145.1_Missense_Mutation_p.R225C|RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000541226.1_Missense_Mutation_p.R114C	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	170						clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GGGCTTCAGCCGCCGCTACGG	0.682													C|||	4	0.000798722	0.0015	0.0	5008	,	,		15206	0.0		0.002	False		,,,				2504	0.0				p.R170C		.											.	EPN3	91	0			c.C508T						.	C	CYS/ARG	0,4292		0,0,2146	17.0	15.0	16.0		508	5.2	1.0	17	dbSNP_134	16	1,8445		0,1,4222	no	missense	EPN3	NM_017957.2	180	0,1,6368	TT,TC,CC		0.0118,0.0,0.0079	probably-damaging	170/633	48614425	1,12737	2146	4223	6369	SO:0001583	missense	55040	exon2			TTCAGCCGCCGCT	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.508C>T	17.37:g.48614425C>T	ENSP00000268933:p.Arg170Cys	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	19.0	NM_017957	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	ENST00000268933.3	37	CCDS11570.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171748	0.78452	0.0	1.18E-4	ENSG00000049283	ENST00000268933;ENST00000442715;ENST00000537145;ENST00000541226;ENST00000411703	T;T;T	0.50813	2.33;2.22;0.73	5.24	5.24	0.73138	.	0.659654	0.11791	N	0.529152	T	0.68210	0.2976	L	0.58810	1.83	0.48901	D	0.999725	D;D;D	0.89917	1.0;1.0;0.961	D;D;P	0.91635	0.972;0.999;0.586	T	0.64799	-0.6322	10	0.49607	T	0.09	-18.696	18.4459	0.90683	0.0:1.0:0.0:0.0	.	225;225;170	B4DK18;F6QWW5;Q9H201	.;.;EPN3_HUMAN	C	170;225;225;114;170	ENSP00000268933:R170C;ENSP00000439512:R225C;ENSP00000440540:R114C	ENSP00000268933:R170C	R	+	1	0	EPN3	45969424	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.620000	0.36976	2.457000	0.83068	0.561000	0.74099	CGC	C|1.000;T|0.000		0.682	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
FAM186A	121006	ucsc.edu;bcgsc.ca	37	12	50745924	50745924	+	Missense_Mutation	SNP	T	T	C	rs34283706		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr12:50745924T>C	ENST00000327337.5	-	4	4690	c.4691A>G	c.(4690-4692)gAg>gGg	p.E1564G	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.E1564G	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1564																	GAGAGGGATCTCCAATTCCTG	0.662																																					p.E1564G	NSCLC(138;1796 1887 12511 19463 37884)	.											.	FAM186A	68	0			c.A4691G						.						10.0	10.0	10.0					12																	50745924		692	1590	2282	SO:0001583	missense	121006	exon4			GGGATCTCCAATT		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4691A>G	12.37:g.50745924T>C	ENSP00000329995:p.Glu1564Gly	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	157.0	27.0	NM_001145475		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	t	0.010	-1.770041	0.00645	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.04706	3.57;3.57	2.95	-0.0897	0.13667	.	.	.	.	.	T	0.01695	0.0054	N	0.02916	-0.46	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.48456	-0.9034	9	0.10902	T	0.67	.	3.4777	0.07590	0.0:0.4085:0.2:0.3915	rs34283706	1564;1564	F5GYN0;A6NE01	.;F186A_HUMAN	G	1564	ENSP00000441337:E1564G;ENSP00000329995:E1564G	ENSP00000329995:E1564G	E	-	2	0	FAM186A	49032191	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	-0.299000	0.08254	-0.295000	0.08960	-1.383000	0.01170	GAG	.		0.662	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	127681089	127681089	+	Silent	SNP	A	A	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr5:127681089A>T	ENST00000508053.1	-	30	4151	c.3177T>A	c.(3175-3177)gcT>gcA	p.A1059A	FBN2_ENST00000262464.4_Silent_p.A1059A|FBN2_ENST00000508989.1_Silent_p.A1026A			P35556	FBN2_HUMAN	fibrillin 2	1059					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCCCTCGGTTAGCAAAGCCAG	0.607																																					p.A1059A		.											.	FBN2	146	0			c.T3177A						.						79.0	85.0	83.0					5																	127681089		2203	4300	6503	SO:0001819	synonymous_variant	2201	exon24			TCGGTTAGCAAAG	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3177T>A	5.37:g.127681089A>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	26.0	NM_001999	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1																																																																																			.		0.607	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
GMEB2	26205	broad.mit.edu;bcgsc.ca	37	20	62221645	62221645	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr20:62221645C>G	ENST00000266068.1	-	9	1868	c.1390G>C	c.(1390-1392)Gac>Cac	p.D464H	GMEB2_ENST00000370077.1_Missense_Mutation_p.D464H|GMEB2_ENST00000370069.1_Missense_Mutation_p.D413H			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	464					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			GTGCTACCGTCCTGCACGGCG	0.672																																					p.D464H		.											.	GMEB2	90	0			c.G1390C						.						39.0	33.0	35.0					20																	62221645		2203	4297	6500	SO:0001583	missense	26205	exon10			TACCGTCCTGCAC	AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.1390G>C	20.37:g.62221645C>G	ENSP00000266068:p.Asp464His	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	6.0	NM_012384	E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Missense_Mutation	SNP	ENST00000266068.1	37	CCDS13528.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703881	0.88924	.	.	ENSG00000101216	ENST00000370069;ENST00000370077;ENST00000266068	T;T;T	0.73469	-0.75;-0.15;-0.15	5.4	5.4	0.78164	.	0.113992	0.64402	D	0.000020	D	0.85120	0.5624	M	0.63843	1.955	0.53688	D	0.999978	D	0.89917	1.0	D	0.77557	0.99	D	0.86332	0.1699	10	0.87932	D	0	-17.0474	18.7944	0.91988	0.0:1.0:0.0:0.0	.	464	Q9UKD1	GMEB2_HUMAN	H	413;464;464	ENSP00000359086:D413H;ENSP00000359094:D464H;ENSP00000266068:D464H	ENSP00000266068:D464H	D	-	1	0	GMEB2	61692089	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	5.021000	0.64072	2.532000	0.85374	0.655000	0.94253	GAC	.		0.672	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080166.1	NM_012384	
HIVEP1	3096	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	12125147	12125148	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr6:12125147_12125148insA	ENST00000379388.2	+	4	5451_5452	c.5119_5120insA	c.(5119-5121)gaafs	p.E1707fs	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1707					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ATTTCTATGTGAAAATGTTTTT	0.376																																					p.E1707fs		.											.	HIVEP1	139	0			c.5119_5120insA						.																																			SO:0001589	frameshift_variant	3096	exon4			CTATGTGAAAATG	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.5123dupA	6.37:g.12125151_12125151dupA	ENSP00000368698:p.Glu1707fs	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	246.0	43.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Frame_Shift_Ins	INS	ENST00000379388.2	37	CCDS43426.1																																																																																			.		0.376	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
IL18RAP	8807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	103068506	103068506	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr2:103068506G>T	ENST00000264260.2	+	12	2254	c.1665G>T	c.(1663-1665)atG>atT	p.M555I	IL18RAP_ENST00000409369.1_Missense_Mutation_p.M413I	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	555	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						GGGCCAAAATGCGCTACCACA	0.453																																					p.M555I		.											.	IL18RAP	95	0			c.G1665T						.						138.0	149.0	145.0					2																	103068506		2203	4300	6503	SO:0001583	missense	8807	exon12			CAAAATGCGCTAC	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.1665G>T	2.37:g.103068506G>T	ENSP00000264260:p.Met555Ile	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	61.0	NM_003853	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.300447	0.01364	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.02103	4.45;4.45	6.02	-6.57	0.01842	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.758254	0.13065	N	0.416553	T	0.00936	0.0031	N	0.11313	0.125	0.09310	N	0.999997	B	0.02656	0.0	B	0.06405	0.002	T	0.45086	-0.9285	10	0.35671	T	0.21	.	0.2591	0.00216	0.2796:0.1562:0.2495:0.3148	.	555	O95256	I18RA_HUMAN	I	555;413	ENSP00000264260:M555I;ENSP00000387201:M413I	ENSP00000264260:M555I	M	+	3	0	IL18RAP	102434938	0.000000	0.05858	0.044000	0.18714	0.081000	0.17604	-0.750000	0.04808	-0.699000	0.05077	-0.158000	0.13435	ATG	.		0.453	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853	
INHBA	3624	bcgsc.ca;mdanderson.org	37	7	41729607	41729607	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr7:41729607G>A	ENST00000242208.4	-	3	1168	c.922C>T	c.(922-924)Cgt>Tgt	p.R308C	INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_Missense_Mutation_p.R308C	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	308					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CCCCGCCGACGCCGGCGATGA	0.557										TSP Lung(11;0.080)																											p.R308C		.											.	INHBA	703	0			c.C922T						.						102.0	107.0	106.0					7																	41729607		2203	4300	6503	SO:0001583	missense	3624	exon3			GCCGACGCCGGCG		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.922C>T	7.37:g.41729607G>A	ENSP00000242208:p.Arg308Cys	Somatic	32.0	1.0		WXS	Illumina HiSeq	Phase_1	65.0	38.0	NM_002192	Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	14.88	2.667375	0.47677	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.81078	-1.45;-1.45	5.82	3.97	0.46021	Transforming growth factor-beta, C-terminal (1);	0.169098	0.53938	D	0.000059	D	0.89252	0.6662	M	0.87269	2.87	0.80722	D	1	D	0.76494	0.999	P	0.61275	0.886	D	0.90438	0.4429	10	0.87932	D	0	-20.4552	13.9132	0.63881	0.0:0.0:0.6004:0.3996	.	308	P08476	INHBA_HUMAN	C	308	ENSP00000242208:R308C;ENSP00000397197:R308C	ENSP00000242208:R308C	R	-	1	0	INHBA	41696132	0.898000	0.30612	0.799000	0.32177	0.986000	0.74619	2.807000	0.47955	0.762000	0.33152	0.484000	0.47621	CGT	.		0.557	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
IQCA1	79781	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	237300683	237300683	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr2:237300683delT	ENST00000409907.3	-	11	1623	c.1349delA	c.(1348-1350)aacfs	p.N450fs	IQCA1_ENST00000465621.1_5'Flank|IQCA1_ENST00000309507.5_Frame_Shift_Del_p.N446fs|IQCA1_ENST00000431676.2_Frame_Shift_Del_p.N409fs|AC019068.2_ENST00000413353.1_RNA	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	450	Lys-rich.						ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						TAGCTTTAAGTTTTTAAGTTC	0.438																																					p.N457fs		.											.	IQCA1	23	0			c.1370delA						.						169.0	171.0	170.0					2																	237300683		1868	4103	5971	SO:0001589	frameshift_variant	79781	exon11			TTTAAGTTTTTAA	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.1349delA	2.37:g.237300683delT	ENSP00000387347:p.Asn450fs	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	344.0	149.0	NM_001270585	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Frame_Shift_Del	DEL	ENST00000409907.3	37	CCDS46549.1																																																																																			.		0.438	IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
IRF2	3660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	185320192	185320192	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr4:185320192C>A	ENST00000393593.3	-	7	778	c.571G>T	c.(571-573)Gag>Tag	p.E191*		NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	191					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		GTGACAATCTCTTGATTCTCA	0.493																																					p.E191X		.											.	IRF2	91	0			c.G571T						.						135.0	112.0	120.0					4																	185320192		2203	4300	6503	SO:0001587	stop_gained	3660	exon7			CAATCTCTTGATT		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.571G>T	4.37:g.185320192C>A	ENSP00000377218:p.Glu191*	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	88.0	NM_002199	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Nonsense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.1|24.1	4.494998|4.494998	0.85069|0.85069	.|.	.|.	ENSG00000168310|ENSG00000168310	ENST00000393593;ENST00000502750|ENST00000505067	.|.	.|.	.|.	5.9|5.9	5.06|5.06	0.68205|0.68205	.|.	0.652135|.	0.15902|.	N|.	0.239008|.	.|T	.|0.53465	.|0.1798	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.61486	.|-0.7053	.|3	0.06891|.	T|.	0.86|.	-10.9067|-10.9067	10.0205|10.0205	0.42039|0.42039	0.0:0.8011:0.0:0.1989|0.0:0.8011:0.0:0.1989	.|.	.|.	.|.	.|.	X|I	191;48|124	.|.	ENSP00000377218:E191X|.	E|R	-|-	1|2	0|0	IRF2|IRF2	185557186|185557186	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.855000|0.855000	0.48748|0.48748	0.884000|0.884000	0.28214|0.28214	2.806000|2.806000	0.96561|0.96561	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.		0.493	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
ITGB3	3690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	45387555	45387555	+	Silent	SNP	G	G	C	rs565628822		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr17:45387555G>C	ENST00000559488.1	+	15	2368	c.2352G>C	c.(2350-2352)acG>acC	p.T784T	RP11-290H9.4_ENST00000575039.1_RNA|ITGB3_ENST00000560629.1_Intron|ITGB3_ENST00000435993.2_Intron	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	784					activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	CCAATATCACGTACCGGGGCA	0.468																																					p.T784T		.											.	ITGB3	714	0			c.G2352C						.						177.0	137.0	151.0					17																	45387555		2203	4300	6503	SO:0001819	synonymous_variant	3690	exon15			TATCACGTACCGG		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.2352G>C	17.37:g.45387555G>C		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	100.0	NM_000212	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Silent	SNP	ENST00000559488.1	37	CCDS11511.1																																																																																			.		0.468	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
LCE1B	353132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152785040	152785040	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr1:152785040G>T	ENST00000360090.3	+	1	594	c.118G>T	c.(118-120)Gtc>Ttc	p.V40F		NM_178349.1	NP_848126.1	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	40					keratinization (GO:0031424)					breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|skin(2)	18	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTGTCCTCCAGTCTCTTCCTG	0.647																																					p.V40F		.											.	LCE1B	68	0			c.G118T						.						92.0	95.0	94.0					1																	152785040		2203	4300	6503	SO:0001583	missense	353132	exon1			CCTCCAGTCTCTT	BI670515	CCDS1027.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000196734	ENSG00000196734		"""Late cornified envelopes"""	16611	protein-coding gene	gene with protein product		612604	"""small proline rich-like (epidermal differentiation complex) 2A"""	SPRL2A		11698679	Standard	NM_178349		Approved	LEP2	uc001faq.3	Q5T7P3	OTTHUMG00000014402	ENST00000360090.3:c.118G>T	1.37:g.152785040G>T	ENSP00000353203:p.Val40Phe	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	839.0	180.0	NM_178349	A4IF40	Missense_Mutation	SNP	ENST00000360090.3	37	CCDS1027.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696611	0.30142	.	.	ENSG00000196734	ENST00000360090;ENST00000439693	T	0.04862	3.54	4.34	4.34	0.51931	.	0.856987	0.09501	N	0.793570	T	0.06735	0.0172	L	0.51422	1.61	0.27140	N	0.961677	D	0.54207	0.965	P	0.50708	0.648	T	0.16158	-1.0412	10	0.87932	D	0	.	12.5252	0.56083	0.0:0.0:1.0:0.0	.	40	Q5T7P3	LCE1B_HUMAN	F	40	ENSP00000353203:V40F	ENSP00000353203:V40F	V	+	1	0	LCE1B	151051664	0.397000	0.25270	0.932000	0.37286	0.872000	0.50106	2.780000	0.47742	2.398000	0.81561	0.650000	0.86243	GTC	.		0.647	LCE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040060.1	NM_178349	
MAPK4	5596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	18	48190630	48190630	+	Missense_Mutation	SNP	C	C	T	rs556250636		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr18:48190630C>T	ENST00000400384.2	+	2	1338	c.302C>T	c.(301-303)gCg>gTg	p.A101V	MAPK4_ENST00000592595.1_Missense_Mutation_p.A101V|MAPK4_ENST00000540640.1_Intron|MAPK4_ENST00000588540.1_Missense_Mutation_p.A101V	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	101	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		TTCAGCGTGGCGTACATCGTC	0.592																																					p.A101V		.											.	MAPK4	1404	0			c.C302T						.						78.0	80.0	79.0					18																	48190630		2199	4293	6492	SO:0001583	missense	5596	exon2			GCGTGGCGTACAT	X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.302C>T	18.37:g.48190630C>T	ENSP00000383234:p.Ala101Val	Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	14.0	NM_002747	A1A4C4|Q0VG04	Missense_Mutation	SNP	ENST00000400384.2	37	CCDS42437.1	.	.	.	.	.	.	.	.	.	.	C	8.290	0.817600	0.16607	.	.	ENSG00000141639	ENST00000400384	T	0.63744	-0.06	5.87	4.08	0.47627	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.112351	0.45126	D	0.000386	T	0.19725	0.0474	N	0.00332	-1.63	0.38982	D	0.95897	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.35025	-0.9805	10	0.02654	T	1	-4.275	6.5478	0.22416	0.0:0.6886:0.0:0.3114	.	101;101	Q0VG04;P31152	.;MK04_HUMAN	V	101	ENSP00000383234:A101V	ENSP00000383234:A101V	A	+	2	0	MAPK4	46444628	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	4.845000	0.62853	1.491000	0.48482	0.561000	0.74099	GCG	.		0.592	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448631.2	NM_002747	
MYO7A	4647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	76917166	76917166	+	Silent	SNP	G	G	A	rs375627342		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr11:76917166G>A	ENST00000409709.3	+	41	5933	c.5661G>A	c.(5659-5661)ccG>ccA	p.P1887P	MYO7A_ENST00000605744.1_3'UTR|MYO7A_ENST00000409619.2_Silent_p.P1838P|MYO7A_ENST00000458637.2_Silent_p.P1849P	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1887	MyTH4 2. {ECO:0000255|PROSITE- ProRule:PRU00359}.		P -> L (in USH1B). {ECO:0000269|PubMed:10930322}.		actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AGTACCCTCCGCACCTGGTGG	0.607																																					p.P1887P		.											.	MYO7A	138	0			c.G5661A						.		,	1,4047		0,1,2023	62.0	70.0	68.0		5661,5547	-9.1	0.5	11		68	0,8338		0,0,4169	no	coding-synonymous,coding-synonymous	MYO7A	NM_000260.3,NM_001127180.1	,	0,1,6192	AA,AG,GG		0.0,0.0247,0.0081	,	1887/2216,1849/2176	76917166	1,12385	2024	4169	6193	SO:0001819	synonymous_variant	4647	exon41			CCCTCCGCACCTG	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5661G>A	11.37:g.76917166G>A		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	32.0	NM_000260	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																			.		0.607	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
NCAPD3	23310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134029862	134029862	+	Silent	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr11:134029862G>A	ENST00000534548.2	-	29	3856	c.3792C>T	c.(3790-3792)gtC>gtT	p.V1264V		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1264					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CCTGCTCCTGGACCAGCTGTT	0.552																																					p.V1264V		.											.	NCAPD3	229	0			c.C3792T						.						143.0	115.0	124.0					11																	134029862		2201	4297	6498	SO:0001819	synonymous_variant	23310	exon29			CTCCTGGACCAGC	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.3792C>T	11.37:g.134029862G>A		Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	60.0	NM_015261	A6NFS2|Q4KMQ9	Silent	SNP	ENST00000534548.2	37	CCDS31723.1																																																																																			.		0.552	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
NFIA	4774	broad.mit.edu;bcgsc.ca	37	1	61920983	61920983	+	Silent	SNP	C	C	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr1:61920983C>T	ENST00000403491.3	+	11	2005	c.1521C>T	c.(1519-1521)taC>taT	p.Y507Y	NFIA_ENST00000371187.3_Missense_Mutation_p.P477S|NFIA_ENST00000371185.2_Silent_p.Y485Y|NFIA_ENST00000485903.2_Silent_p.Y464Y|NFIA_ENST00000371184.2_Silent_p.Y378Y|NFIA_ENST00000407417.3_Silent_p.Y499Y|NFIA_ENST00000371191.1_Silent_p.Y530Y|NFIA_ENST00000357977.5_Silent_p.Y155Y|NFIA_ENST00000371189.4_Silent_p.Y552Y	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A	507					DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						AGTCCTGGTACCTGGGATAAA	0.438																																					p.P477S		.											.	NFIA	92	0			c.C1429T						.						183.0	165.0	171.0					1																	61920983		2203	4300	6503	SO:0001819	synonymous_variant	4774	exon10			CTGGTACCTGGGA	U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618	ENST00000403491.3:c.1521C>T	1.37:g.61920983C>T		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	8.0	NM_005595	B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	Missense_Mutation	SNP	ENST00000403491.3	37	CCDS44156.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.886035	0.33348	.	.	ENSG00000162599	ENST00000485903	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	T	0.71643	0.3364	.	.	.	0.80722	D	1	P	0.51449	0.945	P	0.56648	0.803	T	0.62964	-0.6742	7	0.17832	T	0.49	.	20.4238	0.99064	0.0:1.0:0.0:0.0	.	477	Q12857-2	.	S	477	.	ENSP00000419785:P477S	P	+	1	0	NFIA	61693571	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.078000	0.57606	2.834000	0.97654	0.650000	0.86243	CCT	.		0.438	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023799.3	NM_005595	
NOL11	25926	ucsc.edu;bcgsc.ca	37	17	65720207	65720207	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr17:65720207A>G	ENST00000253247.4	+	6	677	c.562A>G	c.(562-564)Atc>Gtc	p.I188V	NOL11_ENST00000535137.1_Missense_Mutation_p.I6V	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	188					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			TAACTCACGTATCTTAACCAA	0.303																																					p.I188V		.											.	NOL11	90	0			c.A562G						.						104.0	103.0	103.0					17																	65720207		2203	4300	6503	SO:0001583	missense	25926	exon6			TCACGTATCTTAA	AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.562A>G	17.37:g.65720207A>G	ENSP00000253247:p.Ile188Val	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_015462	B7Z5V9|Q7L5S1|Q9UG18	Missense_Mutation	SNP	ENST00000253247.4	37	CCDS11671.1	.	.	.	.	.	.	.	.	.	.	A	0.217	-1.031818	0.02029	.	.	ENSG00000130935	ENST00000253247;ENST00000535137	T	0.53423	0.62	4.54	1.06	0.20224	.	0.963596	0.08605	N	0.920913	T	0.35480	0.0933	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25606	-1.0127	10	0.30078	T	0.28	2.8558	7.4965	0.27492	0.6167:0.0:0.3833:0.0	.	188	Q9H8H0	NOL11_HUMAN	V	188;6	ENSP00000253247:I188V	ENSP00000253247:I188V	I	+	1	0	NOL11	63150669	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.034000	0.12225	-0.043000	0.13513	-0.621000	0.04028	ATC	.		0.303	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448074.1	NM_015462	
NXF1	10482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62566040	62566040	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr11:62566040G>C	ENST00000532297.1	-	12	1653	c.1024C>G	c.(1024-1026)Cgc>Ggc	p.R342G	NXF1_ENST00000531709.2_3'UTR|NXF1_ENST00000533048.1_5'Flank|NXF1_ENST00000294172.2_Missense_Mutation_p.R342G			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	342					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AATCGTTCGCGAATGGCGCTG	0.493																																					p.R342G		.											.	NXF1	228	0			c.C1024G						.						143.0	133.0	136.0					11																	62566040		2201	4299	6500	SO:0001583	missense	10482	exon11			GTTCGCGAATGGC	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.1024C>G	11.37:g.62566040G>C	ENSP00000436679:p.Arg342Gly	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	49.0	NM_006362	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	37	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999048	0.74818	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875	T;T;T	0.55760	0.5;0.5;0.5	5.77	5.77	0.91146	U2A&apos (1);/phosphoprotein 32 family A, C-terminal (1);	0.127200	0.53938	D	0.000042	T	0.77025	0.4070	M	0.89904	3.07	0.80722	D	1	P;D	0.89917	0.954;1.0	P;D	0.78314	0.612;0.991	T	0.76038	-0.3105	10	0.26408	T	0.33	-7.8345	17.535	0.87827	0.0:0.0:1.0:0.0	.	385;342	E9PIN3;Q9UBU9	.;NXF1_HUMAN	G	342;342;385	ENSP00000294172:R342G;ENSP00000436679:R342G;ENSP00000435742:R385G	ENSP00000294172:R342G	R	-	1	0	NXF1	62322616	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	5.605000	0.67634	2.751000	0.94390	0.650000	0.86243	CGC	.		0.493	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
OCSTAMP	128506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	45174216	45174216	+	Missense_Mutation	SNP	C	C	T	rs76943342	byFrequency	TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr20:45174216C>T	ENST00000279028.2	-	2	810	c.797G>A	c.(796-798)cGg>cAg	p.R266Q		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	266					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						CTGTGCCAACCGCTGGGTCAG	0.597													C|||	8	0.00159744	0.0	0.0	5008	,	,		20262	0.0069		0.0	False		,,,				2504	0.001				p.R266Q		.											.	.	.	0			c.G797A						.						94.0	106.0	103.0					20																	45174216		692	1591	2283	SO:0001583	missense	128506	exon2			GCCAACCGCTGGG	AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.797G>A	20.37:g.45174216C>T	ENSP00000279028:p.Arg266Gln	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	25.0	NM_080721		Missense_Mutation	SNP	ENST00000279028.2	37	CCDS54468.1	7	0.003205128205128205	0	0.0	0	0.0	7	0.012237762237762238	0	0.0	C	1.642	-0.516170	0.04200	.	.	ENSG00000149635	ENST00000279028	T	0.28666	1.6	5.11	-4.16	0.03869	Dendritic cell-specific transmembrane protein-like (1);	2.855870	0.01227	N	0.008248	T	0.08714	0.0216	N	0.02916	-0.46	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.15292	-1.0442	10	0.25751	T	0.34	-5.8007	6.1334	0.20217	0.2714:0.3612:0.0:0.3674	.	266	Q9BR26	CT123_HUMAN	Q	266	ENSP00000279028:R266Q	ENSP00000279028:R266Q	R	-	2	0	C20orf123	44607623	0.000000	0.05858	0.091000	0.20842	0.051000	0.14879	-2.178000	0.01260	-0.599000	0.05798	-0.312000	0.09012	CGG	C|0.997;T|0.003		0.597	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079573.2	XM_496476	
OR2M3	127062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248366773	248366773	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr1:248366773T>C	ENST00000456743.1	+	1	442	c.404T>C	c.(403-405)cTc>cCc	p.L135P		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TACACCAATCTCATGAGCCCT	0.438																																					p.L135P		.											.	OR2M3	70	0			c.T404C						.						218.0	219.0	218.0					1																	248366773		2203	4300	6503	SO:0001583	missense	127062	exon1			CCAATCTCATGAG		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.404T>C	1.37:g.248366773T>C	ENSP00000389625:p.Leu135Pro	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	911.0	202.0	NM_001004689	B9EH06|Q6IEY0	Missense_Mutation	SNP	ENST00000456743.1	37	CCDS31107.1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.249464	0.39797	.	.	ENSG00000228198	ENST00000456743	T	0.33654	1.4	2.55	2.55	0.30701	GPCR, rhodopsin-like superfamily (1);	0.321128	0.17282	U	0.179973	T	0.65091	0.2658	M	0.93241	3.395	0.29984	N	0.817421	D	0.65815	0.995	D	0.66716	0.946	T	0.66280	-0.5963	10	0.87932	D	0	.	10.4551	0.44546	0.0:0.0:0.0:1.0	.	135	Q8NG83	OR2M3_HUMAN	P	135	ENSP00000389625:L135P	ENSP00000389625:L135P	L	+	2	0	OR2M3	246433396	0.007000	0.16637	0.077000	0.20336	0.007000	0.05969	1.217000	0.32455	1.168000	0.42723	0.333000	0.21579	CTC	.		0.438	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689	
OR4N3P	390539	bcgsc.ca;mdanderson.org	37	15	22413859	22413859	+	IGR	SNP	C	C	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr15:22413859C>G								RP11-69H14.6 (30051 upstream) : RP11-2F9.4 (20030 downstream)																							CTGCAGTATTCAACTGTCATG	0.507																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	390539	.			AGTATTCAACTGT																													15.37:g.22413859C>G		Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_1	1233.0	233.0	.		RNA	SNP		37																																																																																				.	0	0.507								
OR6B1	135946	ucsc.edu;bcgsc.ca	37	7	143701970	143701970	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr7:143701970A>G	ENST00000408922.2	+	1	949	c.881A>G	c.(880-882)gAg>gGg	p.E294G		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					AGAAACCGAGAGGTCAAGGAA	0.428																																					p.E294G		.											.	OR6B1	91	0			c.A881G						.						60.0	57.0	58.0					7																	143701970		1885	4104	5989	SO:0001583	missense	135946	exon1			ACCGAGAGGTCAA		CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.881A>G	7.37:g.143701970A>G	ENSP00000386151:p.Glu294Gly	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	68.0	6.0	NM_001005281	A4D2G2|B9EH47|Q6IFP6|Q96R38	Missense_Mutation	SNP	ENST00000408922.2	37	CCDS43667.1	.	.	.	.	.	.	.	.	.	.	A	14.83	2.652191	0.47362	.	.	ENSG00000221813	ENST00000408922	T	0.40225	1.04	5.11	5.11	0.69529	.	0.000000	0.37219	U	0.002189	T	0.46639	0.1403	M	0.75447	2.3	0.38395	D	0.945504	B	0.25441	0.126	B	0.29598	0.104	T	0.54721	-0.8251	10	0.87932	D	0	.	12.9087	0.58166	1.0:0.0:0.0:0.0	.	294	O95007	OR6B1_HUMAN	G	294	ENSP00000386151:E294G	ENSP00000386151:E294G	E	+	2	0	OR6B1	143332903	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.929000	0.75852	2.151000	0.67156	0.533000	0.62120	GAG	.		0.428	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349566.1		
OR8U1	219417	ucsc.edu;bcgsc.ca	37	11	56143699	56143699	+	Missense_Mutation	SNP	T	T	G	rs4990121	byFrequency	TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr11:56143699T>G	ENST00000302270.1	+	1	600	c.600T>G	c.(598-600)ttT>ttG	p.F200L		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					TCTGGATCTTTGCCTGTGCTG	0.458													G|||	696	0.138978	0.1286	0.1614	5008	,	,		25344	0.1617		0.1312	False		,,,				2504	0.1217				p.F200L		.											.	OR8U1	72	0			c.T600G						.						203.0	201.0	202.0					11																	56143699		2060	4226	6286	SO:0001583	missense	219417	exon1			GATCTTTGCCTGT	AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.600T>G	11.37:g.56143699T>G	ENSP00000304188:p.Phe200Leu	Somatic	164.0	2.0		WXS	Illumina HiSeq	.	910.0	98.0	NM_001005204		Missense_Mutation	SNP	ENST00000302270.1	37	CCDS41647.1	.	.	.	.	.	.	.	.	.	.	t	4.622	0.115613	0.08831	.	.	ENSG00000172199	ENST00000302270	T	0.00042	8.84	5.78	-10.9	0.00192	GPCR, rhodopsin-like superfamily (1);	0.586313	0.15401	N	0.264323	T	0.00073	0.0002	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.20384	0.029	T	0.42599	-0.9442	10	0.22109	T	0.4	.	6.835	0.23931	0.0796:0.1799:0.5443:0.1962	rs4990121	200	Q8NH10	OR8U1_HUMAN	L	200	ENSP00000304188:F200L	ENSP00000304188:F200L	F	+	3	2	OR8U1	55900275	0.000000	0.05858	0.003000	0.11579	0.000000	0.00434	-5.414000	0.00124	-1.148000	0.02847	-2.056000	0.00403	TTT	T|0.500;G|0.500		0.458	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204	
PACS2	23241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105858084	105858084	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr14:105858084G>A	ENST00000325438.8	+	21	2695	c.2191G>A	c.(2191-2193)Gga>Aga	p.G731R	PACS2_ENST00000547217.1_Missense_Mutation_p.G701R|PACS2_ENST00000430725.2_Missense_Mutation_p.G656R|PACS2_ENST00000551743.1_Missense_Mutation_p.G245R|PACS2_ENST00000551801.1_5'UTR|PACS2_ENST00000447393.1_Missense_Mutation_p.G735R|PACS2_ENST00000458164.2_Missense_Mutation_p.G746R			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	731					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		GTCGGTGAGCGGAGGCCTGTC	0.682																																					p.G746R		.											.	PACS2	69	0			c.G2236A						.						15.0	16.0	16.0					14																	105858084		2190	4289	6479	SO:0001583	missense	23241	exon22			GTGAGCGGAGGCC	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.2191G>A	14.37:g.105858084G>A	ENSP00000321834:p.Gly731Arg	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	28.0	NM_001100913	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	ENST00000325438.8	37	CCDS32168.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482761	0.63962	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217;ENST00000551743	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	4.71	2.84	0.33178	.	0.477834	0.22074	N	0.064997	T	0.38852	0.1056	N	0.14661	0.345	0.31163	N	0.70415	D;D;D;D	0.71674	0.985;0.982;0.998;0.985	P;P;D;P	0.64506	0.647;0.592;0.926;0.498	T	0.34254	-0.9836	10	0.17832	T	0.49	-12.5467	9.7367	0.40392	0.1761:0.0:0.8239:0.0	.	735;746;731;732	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	R	656;731;746;735;701;245	ENSP00000393524:G656R;ENSP00000321834:G731R;ENSP00000399732:G746R;ENSP00000393559:G735R;ENSP00000449525:G701R;ENSP00000449254:G245R	ENSP00000321834:G731R	G	+	1	0	PACS2	104929129	0.678000	0.27586	0.894000	0.35097	0.938000	0.57974	1.005000	0.29834	0.389000	0.25086	0.462000	0.41574	GGA	.		0.682	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355	
PLA2R1	22925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	160833216	160833216	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr2:160833216A>G	ENST00000283243.7	-	16	2623	c.2417T>C	c.(2416-2418)aTt>aCt	p.I806T	PLA2R1_ENST00000392771.1_Missense_Mutation_p.I806T	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	806					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						CCAGAACGGAATCTTGGGTTT	0.353																																					p.I806T		.											.	PLA2R1	93	0			c.T2417C						.						88.0	81.0	84.0					2																	160833216		2203	4300	6503	SO:0001583	missense	22925	exon16			AACGGAATCTTGG	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2417T>C	2.37:g.160833216A>G	ENSP00000283243:p.Ile806Thr	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	250.0	115.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	A	1.441	-0.567640	0.03910	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.06218	3.37;3.33	4.77	3.62	0.41486	.	0.335919	0.30528	N	0.009440	T	0.06554	0.0168	L	0.60455	1.87	0.28249	N	0.925339	B;P;B	0.36959	0.004;0.575;0.265	B;B;B	0.33620	0.011;0.167;0.116	T	0.21245	-1.0251	10	0.14252	T	0.57	.	9.3311	0.38023	0.913:0.0:0.087:0.0	.	806;806;806	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	T	806	ENSP00000283243:I806T;ENSP00000376524:I806T	ENSP00000283243:I806T	I	-	2	0	PLA2R1	160541462	0.985000	0.35326	0.894000	0.35097	0.968000	0.65278	1.144000	0.31565	0.798000	0.33994	0.459000	0.35465	ATT	.		0.353	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
PSMC5	5705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61908431	61908431	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr17:61908431C>T	ENST00000310144.6	+	8	1023	c.715C>T	c.(715-717)Cgg>Tgg	p.R239W	PSMC5_ENST00000375812.4_Missense_Mutation_p.R231W|PSMC5_ENST00000580864.1_Missense_Mutation_p.R231W|PSMC5_ENST00000581882.1_Missense_Mutation_p.R231W|FTSJ3_ENST00000580295.1_5'Flank	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5	239	May mediate interaction with PRPF9. {ECO:0000250|UniProtKB:P62196}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						TGTCATGGCACGGGAACATGC	0.567																																					p.R239W		.											.	PSMC5	178	0			c.C715T						.						84.0	81.0	82.0					17																	61908431		2203	4300	6503	SO:0001583	missense	5705	exon8			ATGGCACGGGAAC	L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195		ENST00000310144.6:c.715C>T	17.37:g.61908431C>T	ENSP00000310572:p.Arg239Trp	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	34.0	NM_002805	A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Missense_Mutation	SNP	ENST00000310144.6	37	CCDS11645.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.525518	0.64860	.	.	ENSG00000087191	ENST00000310144;ENST00000375812	D;D	0.93859	-3.3;-3.3	5.64	5.64	0.86602	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97704	0.9247	H	0.94925	3.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.98241	1.0488	10	0.87932	D	0	.	17.243	0.87019	0.0:1.0:0.0:0.0	.	231;239	A8K3Z3;P62195	.;PRS8_HUMAN	W	239;231	ENSP00000310572:R239W;ENSP00000364970:R231W	ENSP00000310572:R239W	R	+	1	2	PSMC5	59262163	0.089000	0.21612	0.993000	0.49108	0.817000	0.46193	0.559000	0.23485	2.937000	0.99478	0.650000	0.86243	CGG	.		0.567	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444404.1	NM_002805	
RBM27	54439	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	145641135	145641135	+	Silent	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr5:145641135G>A	ENST00000265271.5	+	13	2122	c.1956G>A	c.(1954-1956)agG>agA	p.R652R	RBM27_ENST00000506502.1_Silent_p.R597R	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	652	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGAGGCCAGGAAAGCCATTT	0.418																																					p.R652R		.											.	RBM27	70	0			c.G1956A						.						142.0	129.0	133.0					5																	145641135		1568	3582	5150	SO:0001819	synonymous_variant	54439	exon13			GGCCAGGAAAGCC	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1956G>A	5.37:g.145641135G>A		Somatic	95.0	1.0		WXS	Illumina HiSeq	Phase_I	236.0	83.0	NM_018989	Q8IYW9	Silent	SNP	ENST00000265271.5	37	CCDS43378.1																																																																																			.		0.418	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
ROBO4	54538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124763622	124763622	+	Silent	SNP	C	C	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr11:124763622C>A	ENST00000306534.3	-	10	1994	c.1509G>T	c.(1507-1509)ctG>ctT	p.L503L	ROBO4_ENST00000533054.1_Silent_p.L358L|ROBO4_ENST00000526899.1_5'Flank	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	503					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		TATATCTGTACAGACCTGGGA	0.547																																					p.L503L		.											.	ROBO4	92	0			c.G1509T						.						153.0	131.0	139.0					11																	124763622		2201	4299	6500	SO:0001819	synonymous_variant	54538	exon10			TCTGTACAGACCT	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1509G>T	11.37:g.124763622C>A		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	283.0	106.0	NM_019055	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	ENST00000306534.3	37	CCDS8455.1																																																																																			.		0.547	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055	
RPS6KA3	6197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	20252926	20252926	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chrX:20252926G>A	ENST00000379565.3	-	2	283	c.76C>T	c.(76-78)Cag>Tag	p.Q26*	RPS6KA3_ENST00000540702.1_5'UTR|RPS6KA3_ENST00000544447.1_5'UTR	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	26					axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	ATAATTTGCTGTCCATTCTGT	0.338																																					p.Q26X		.											.	RPS6KA3	1504	0			c.C76T						.						93.0	77.0	83.0					X																	20252926		2203	4300	6503	SO:0001587	stop_gained	6197	exon2			TTTGCTGTCCATT	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.76C>T	X.37:g.20252926G>A	ENSP00000368884:p.Gln26*	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	243.0	204.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Nonsense_Mutation	SNP	ENST00000379565.3	37	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	G	37	6.183972	0.97357	.	.	ENSG00000177189	ENST00000379565	.	.	.	5.31	5.31	0.75309	.	0.484849	0.20103	N	0.099190	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	13.3469	0.60578	0.0:0.0:1.0:0.0	.	.	.	.	X	26	.	ENSP00000368884:Q26X	Q	-	1	0	RPS6KA3	20162847	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.349000	0.66010	2.213000	0.71641	0.594000	0.82650	CAG	.		0.338	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
RTL1	388015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	101348750	101348750	+	Silent	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr14:101348750G>A	ENST00000534062.1	-	1	2434	c.2376C>T	c.(2374-2376)aaC>aaT	p.N792N	MIR432_ENST00000606207.1_RNA|MIR136_ENST00000385207.1_RNA|MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	792					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TGGTCATGACGTTCTTGTTCA	0.547																																					p.N792N		.											.	RTL1	46	0			c.C2376T						.						195.0	182.0	186.0					14																	101348750		692	1591	2283	SO:0001819	synonymous_variant	388015	exon1			CATGACGTTCTTG		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2376C>T	14.37:g.101348750G>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	69.0	NM_001134888	E9PKS8	Silent	SNP	ENST00000534062.1	37	CCDS53910.1																																																																																			.		0.547	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
SI	6476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	164750329	164750329	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr3:164750329G>A	ENST00000264382.3	-	24	2779	c.2717C>T	c.(2716-2718)aCt>aTt	p.T906I		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	906	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AGCATCATAAGTGAAATTGGA	0.313										HNSCC(35;0.089)																											p.T906I		.											.	SI	104	0			c.C2717T						.						136.0	132.0	133.0					3																	164750329		2202	4300	6502	SO:0001583	missense	6476	exon24			TCATAAGTGAAAT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.2717C>T	3.37:g.164750329G>A	ENSP00000264382:p.Thr906Ile	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	35.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	9.509	1.105222	0.20632	.	.	ENSG00000090402	ENST00000264382	T	0.13901	2.55	4.88	1.8	0.24995	.	0.881571	0.10133	N	0.711840	T	0.21347	0.0514	M	0.85197	2.74	0.23930	N	0.996436	B	0.18863	0.031	B	0.16289	0.015	T	0.22591	-1.0212	10	0.72032	D	0.01	.	9.0727	0.36502	0.0:0.4573:0.3861:0.1566	.	906	P14410	SUIS_HUMAN	I	906	ENSP00000264382:T906I	ENSP00000264382:T906I	T	-	2	0	SI	166233023	0.996000	0.38824	0.364000	0.25888	0.701000	0.40568	0.488000	0.22371	0.720000	0.32209	0.655000	0.94253	ACT	.		0.313	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
SLC26A4	5172	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	107315471	107315471	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr7:107315471G>T	ENST00000265715.3	+	6	906	c.682G>T	c.(682-684)Gcc>Tcc	p.A228S		NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	228					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						AACAGCTGCTGCCTTCCAAGT	0.418									Pendred syndrome																												p.A228S		.											.	SLC26A4	96	0			c.G682T	GRCh37	CD073698	SLC26A4	D		.						251.0	232.0	238.0					7																	107315471		2203	4300	6503	SO:0001583	missense	5172	exon6	Familial Cancer Database	Goiter-Deafness syndrome	GCTGCTGCCTTCC	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.682G>T	7.37:g.107315471G>T	ENSP00000265715:p.Ala228Ser	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	310.0	23.0	NM_000441	B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	37	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017519	0.93404	.	.	ENSG00000091137	ENST00000265715	D	0.96365	-3.99	5.41	5.41	0.78517	Sulphate transporter (1);	0.000000	0.64402	D	0.000001	D	0.97448	0.9165	L	0.53780	1.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96871	0.9639	10	0.35671	T	0.21	.	19.1848	0.93639	0.0:0.0:1.0:0.0	.	228	O43511	S26A4_HUMAN	S	228	ENSP00000265715:A228S	ENSP00000265715:A228S	A	+	1	0	SLC26A4	107102707	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.494000	0.81503	2.536000	0.85505	0.650000	0.86243	GCC	.		0.418	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441	
SPATA3	130560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	231865207	231865207	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr2:231865207A>T	ENST00000452881.1	+	2	536	c.428A>T	c.(427-429)cAg>cTg	p.Q143L	SPATA3_ENST00000433428.2_Missense_Mutation_p.Q143L|SPATA3_ENST00000424440.1_Missense_Mutation_p.Q143L|SPATA3_ENST00000455816.1_Missense_Mutation_p.Q143L|SPATA3_ENST00000409956.1_Intron			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	143										endometrium(2)|lung(1)	3						CGGGACTGGCAGATGGCGCCA	0.657																																					p.Q143L		.											.	.	.	0			c.A428T						.						25.0	25.0	25.0					2																	231865207		692	1591	2283	SO:0001583	missense	130560	exon2			ACTGGCAGATGGC	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.428A>T	2.37:g.231865207A>T	ENSP00000388895:p.Gln143Leu	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	53.0	NM_139073	Q86WX5|Q8N9Y6	Missense_Mutation	SNP	ENST00000452881.1	37	CCDS2481.1	.	.	.	.	.	.	.	.	.	.	A	9.227	1.034914	0.19590	.	.	ENSG00000173699	ENST00000424440;ENST00000452881;ENST00000433428;ENST00000455816;ENST00000355662	.	.	.	4.25	0.837	0.18896	.	0.717913	0.12081	N	0.501350	T	0.22513	0.0543	N	0.14661	0.345	0.09310	N	0.99999	B	0.12013	0.005	B	0.08055	0.003	T	0.16660	-1.0395	9	0.41790	T	0.15	-3.66	5.5896	0.17293	0.3449:0.5134:0.0:0.1416	.	134	Q8NHX4	SPTA3_HUMAN	L	143;143;143;143;134	.	ENSP00000347884:Q134L	Q	+	2	0	SPATA3	231573451	0.026000	0.19158	0.236000	0.24074	0.474000	0.32979	-0.081000	0.11321	0.150000	0.19136	0.533000	0.62120	CAG	.		0.657	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
STON2	85439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	81744756	81744756	+	Missense_Mutation	SNP	G	G	A	rs201611443		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr14:81744756G>A	ENST00000267540.2	-	4	1099	c.899C>T	c.(898-900)aCg>aTg	p.T300M	STON2_ENST00000556280.1_5'Flank|STON2_ENST00000555447.1_Missense_Mutation_p.T300M	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	300					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		TACAGAAGGCGTGCGGTTTAA	0.468																																					p.T300M		.											.	STON2	95	0			c.C899T						.	G	MET/THR	0,4406		0,0,2203	112.0	115.0	114.0		899	4.3	0.0	14		114	2,8598	2.2+/-6.3	0,2,4298	yes	missense	STON2	NM_033104.2	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	300/906	81744756	2,13004	2203	4300	6503	SO:0001583	missense	85439	exon6			GAAGGCGTGCGGT	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.899C>T	14.37:g.81744756G>A	ENSP00000267540:p.Thr300Met	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	15.0	NM_001256430	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	G	1.425	-0.571785	0.03882	0.0	2.33E-4	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.48836	0.8;0.8	6.17	4.34	0.51931	Stonin-2, N-terminal (1);	0.666605	0.15615	N	0.253176	T	0.23572	0.0570	N	0.14661	0.345	0.09310	N	1	P;P	0.44344	0.711;0.833	B;B	0.34093	0.175;0.109	T	0.09122	-1.0689	10	0.46703	T	0.11	-10.8204	4.5608	0.12160	0.1776:0.0:0.5212:0.3011	.	300;300	Q8WXE9;G3V2T7	STON2_HUMAN;.	M	300;312;300	ENSP00000450857:T300M;ENSP00000267540:T300M	ENSP00000267540:T300M	T	-	2	0	STON2	80814509	0.011000	0.17503	0.032000	0.17829	0.013000	0.08279	0.914000	0.28624	0.918000	0.36919	-0.126000	0.14955	ACG	.		0.468	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
SZT2	23334	ucsc.edu;bcgsc.ca	37	1	43893354	43893354	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr1:43893354A>G	ENST00000562955.1	+	25	3581	c.3581A>G	c.(3580-3582)gAa>gGa	p.E1194G	SZT2_ENST00000372442.1_Missense_Mutation_p.E352G	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1251					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GCGCTGAGGGAACAAATGGTT	0.622																																					p.E1194G		.											.	SZT2	144	0			c.A3581G						.						45.0	49.0	48.0					1																	43893354		2203	4300	6503	SO:0001583	missense	23334	exon25			TGAGGGAACAAAT	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.3581A>G	1.37:g.43893354A>G	ENSP00000457168:p.Glu1194Gly	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	A	16.13	3.034539	0.54896	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.70753	0.3260	L	0.56769	1.78	0.33868	D	0.634581	D	0.89917	1.0	D	0.85130	0.997	T	0.74355	-0.3692	9	0.21540	T	0.41	.	15.3531	0.74405	1.0:0.0:0.0:0.0	.	1194	Q5T011-5	.	G	352	.	ENSP00000361519:E352G	E	+	2	0	SZT2	43665941	1.000000	0.71417	1.000000	0.80357	0.292000	0.27327	6.585000	0.74062	2.207000	0.71202	0.533000	0.62120	GAA	.		0.622	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
TJP1	7082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	30012108	30012108	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr15:30012108G>A	ENST00000346128.6	-	20	3350	c.2876C>T	c.(2875-2877)cCc>cTc	p.P959L	TJP1_ENST00000356107.6_Missense_Mutation_p.P959L|TJP1_ENST00000545208.2_Intron|TJP1_ENST00000400011.2_Intron	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	959					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		AGCTGGGGTGGGCTCCTCCAG	0.443																																					p.P959L	Melanoma(77;681 1843 6309 6570)	.											.	TJP1	95	0			c.C2876T						.						139.0	135.0	136.0					15																	30012108		1923	4119	6042	SO:0001583	missense	7082	exon20			GGGGTGGGCTCCT		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.2876C>T	15.37:g.30012108G>A	ENSP00000281537:p.Pro959Leu	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	268.0	119.0	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.328456	0.41197	.	.	ENSG00000104067	ENST00000346128;ENST00000545208	T	0.07444	3.19	6.03	4.17	0.49024	.	0.111162	0.64402	N	0.000007	T	0.10465	0.0256	L	0.55103	1.725	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.04229	-1.0967	10	0.41790	T	0.15	.	13.0562	0.58982	0.13:0.0:0.87:0.0	.	952;959	A9CQZ8;Q07157	.;ZO1_HUMAN	L	959	ENSP00000281537:P959L	ENSP00000281537:P959L	P	-	2	0	TJP1	27799400	1.000000	0.71417	0.814000	0.32528	0.996000	0.88848	3.536000	0.53582	0.890000	0.36211	0.655000	0.94253	CCC	.		0.443	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
TNS1	7145	hgsc.bcm.edu;ucsc.edu	37	2	218696257	218696257	+	Silent	SNP	C	C	T	rs545831386		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr2:218696257C>T	ENST00000171887.4	-	20	3371	c.2919G>A	c.(2917-2919)ccG>ccA	p.P973P	TNS1_ENST00000419504.1_Silent_p.P973P|TNS1_ENST00000430930.1_Silent_p.P973P	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	973					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGGCCAGACCCGGGGGGGACC	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		15732	0.001		0.0	False		,,,				2504	0.0				p.P973P		.											.	TNS1	156	0			c.G2919A						.																																			SO:0001819	synonymous_variant	7145	exon20			CAGACCCGGGGGG	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.2919G>A	2.37:g.218696257C>T		Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	18.0	NM_022648	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	37	CCDS2407.1																																																																																			C|1.000;T|0.000		0.632	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
TOM1L1	10040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	52991114	52991114	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr17:52991114G>C	ENST00000575882.1	+	5	731	c.378G>C	c.(376-378)tgG>tgC	p.W126C	TOM1L1_ENST00000572405.1_Missense_Mutation_p.W91C|TOM1L1_ENST00000348161.4_Missense_Mutation_p.W49C|TOM1L1_ENST00000572158.1_Missense_Mutation_p.W119C|TOM1L1_ENST00000540336.1_Missense_Mutation_p.W49C|TOM1L1_ENST00000445275.2_Missense_Mutation_p.W126C|TOM1L1_ENST00000570371.1_Missense_Mutation_p.W126C|TOM1L1_ENST00000575333.1_Missense_Mutation_p.W126C|TOM1L1_ENST00000536554.1_Missense_Mutation_p.W49C	NM_005486.2	NP_005477.2	O75674	TM1L1_HUMAN	target of myb1 (chicken)-like 1	126	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				activation of protein kinase activity (GO:0032147)|intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|positive regulation of protein autophosphorylation (GO:0031954)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	clathrin binding (GO:0030276)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|ubiquitin binding (GO:0043130)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	15						TTCAGACTTGGTCACAGGGCT	0.403																																					p.W126C		.											.	TOM1L1	91	0			c.G378C						.						99.0	96.0	97.0					17																	52991114		2203	4300	6503	SO:0001583	missense	10040	exon5			GACTTGGTCACAG	AJ010071	CCDS11582.1	17q23.2	2008-01-03	2007-01-12			ENSG00000141198			11983	protein-coding gene	gene with protein product		604701	"""target of myb1 (chicken) homolog-like 1"""			10329004, 15611048, 17977829	Standard	NM_005486		Approved	SRCASM	uc002iud.2	O75674		ENST00000575882.1:c.378G>C	17.37:g.52991114G>C	ENSP00000460823:p.Trp126Cys	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	69.0	NM_005486	Q53G06|Q8N749	Missense_Mutation	SNP	ENST00000575882.1	37	CCDS11582.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.765230	0.49574	.	.	ENSG00000141198	ENST00000445275;ENST00000540336;ENST00000348161;ENST00000536554	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.44	4.48	0.54585	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.000000	0.64402	D	0.000006	T	0.71247	0.3317	M	0.92784	3.345	0.80722	D	1	B;P;P;P;D;P	0.89917	0.44;0.869;0.685;0.869;1.0;0.473	B;P;B;P;D;B	0.97110	0.209;0.621;0.347;0.545;1.0;0.347	T	0.78700	-0.2102	10	0.66056	D	0.02	-6.0111	13.5452	0.61699	0.0:0.0:0.8428:0.1572	.	49;119;49;126;126;49	B4DUW5;B4E1N0;B7Z9E2;O75674;Q8N749;B4E1M9	.;.;.;TM1L1_HUMAN;.;.	C	126;49;49;49	ENSP00000408958:W126C;ENSP00000441242:W49C;ENSP00000343901:W49C;ENSP00000443099:W49C	ENSP00000343901:W49C	W	+	3	0	TOM1L1	50346113	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	4.082000	0.57635	1.305000	0.44909	-0.224000	0.12420	TGG	.		0.403	TOM1L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439029.2	NM_005486	
TPD52L1	7164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	125584076	125584076	+	Missense_Mutation	SNP	C	C	T	rs559154046		TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr6:125584076C>T	ENST00000534000.1	+	7	879	c.583C>T	c.(583-585)Cgg>Tgg	p.R195W	TPD52L1_ENST00000304877.13_Missense_Mutation_p.R200W|TPD52L1_ENST00000534199.1_3'UTR|HDDC2_ENST00000608456.1_Intron|TPD52L1_ENST00000368388.2_3'UTR|TPD52L1_ENST00000524679.1_3'UTR|TPD52L1_ENST00000530868.1_3'UTR|TPD52L1_ENST00000528193.1_3'UTR|TPD52L1_ENST00000392482.2_3'UTR|TPD52L1_ENST00000532429.1_Missense_Mutation_p.R166W|TPD52L1_ENST00000527711.1_Missense_Mutation_p.R182W|TPD52L1_ENST00000368402.5_3'UTR	NM_003287.2	NP_003278.1	Q16890	TPD53_HUMAN	tumor protein D52-like 1	195					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|prostate(1)	5			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		AGGAGGCTCCCGGCGGACCAA	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14409	0.0		0.0	False		,,,				2504	0.0				p.R195W		.											.	TPD52L1	90	0			c.C583T						.						37.0	35.0	36.0					6																	125584076		2203	4300	6503	SO:0001583	missense	7164	exon7			GGCTCCCGGCGGA	U44427	CCDS5130.1, CCDS34527.1, CCDS34528.1, CCDS43502.1, CCDS75513.1, CCDS75514.1	6q22-q23	2008-07-29			ENSG00000111907	ENSG00000111907			12006	protein-coding gene	gene with protein product		604069				8812487, 16112108	Standard	NM_003287		Approved	D53, hD53	uc003pzu.1	Q16890	OTTHUMG00000015505	ENST00000534000.1:c.583C>T	6.37:g.125584076C>T	ENSP00000434142:p.Arg195Trp	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	10.0	NM_003287	A8K757|A8K772|A8MUD2|A8MUJ7|A8MW70|F6V707|O43397|Q5TC99|Q5TDQ0|Q9BUQ6|Q9C054	Missense_Mutation	SNP	ENST00000534000.1	37	CCDS5130.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.896287	0.33442	.	.	ENSG00000111907	ENST00000304877;ENST00000534000;ENST00000527711;ENST00000532429;ENST00000392484	T;T;T;T	0.48201	1.4;1.39;1.77;0.82	5.53	2.67	0.31697	.	1.108680	0.06628	N	0.758775	T	0.10981	0.0268	N	0.08118	0	0.22666	N	0.998871	B	0.02656	0.0	B	0.01281	0.0	T	0.31806	-0.9930	10	0.66056	D	0.02	-3.2296	5.1614	0.15064	0.1497:0.627:0.1444:0.0789	.	195	Q16890	TPD53_HUMAN	W	200;195;182;166;195	ENSP00000306285:R200W;ENSP00000434142:R195W;ENSP00000436953:R182W;ENSP00000435447:R166W	ENSP00000306285:R200W	R	+	1	2	TPD52L1	125625775	0.004000	0.15560	0.012000	0.15200	0.850000	0.48378	1.103000	0.31062	0.253000	0.21552	-0.133000	0.14855	CGG	.		0.612	TPD52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042065.2		
TRPM6	140803	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	77339554	77339554	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr9:77339554G>T	ENST00000360774.1	-	39	6281	c.6044C>A	c.(6043-6045)tCc>tAc	p.S2015Y	TRPM6_ENST00000376872.3_Missense_Mutation_p.S970Y|TRPM6_ENST00000361255.3_Missense_Mutation_p.S2010Y|TRPM6_ENST00000449912.2_Missense_Mutation_p.S2010Y|TRPM6_ENST00000451710.3_Missense_Mutation_p.S2019Y|TRPM6_ENST00000376871.3_Missense_Mutation_p.S852Y	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	2015					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ATCTTCTGGGGAATTTCTACC	0.443																																					p.S2015Y		.											.	TRPM6	335	0			c.C6044A						.						125.0	112.0	117.0					9																	77339554		2203	4300	6503	SO:0001583	missense	140803	exon39			TCTGGGGAATTTC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.6044C>A	9.37:g.77339554G>T	ENSP00000354006:p.Ser2015Tyr	Somatic	107.0	1.0		WXS	Illumina HiSeq	Phase_I	265.0	98.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686569	0.68157	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870	T;T;T;T;T;T	0.55930	0.53;0.53;0.49;0.69;0.53;0.53	5.62	3.66	0.41972	.	1.102400	0.06798	N	0.788272	T	0.64778	0.2629	L	0.40543	1.245	0.19300	N	0.99997	P;D;D;P;P;D	0.71674	0.786;0.998;0.998;0.845;0.904;0.965	P;D;D;B;P;P	0.70487	0.542;0.954;0.969;0.36;0.563;0.568	T	0.52403	-0.8580	10	0.72032	D	0.01	.	10.5203	0.44914	0.0:0.1446:0.7053:0.1502	.	562;848;966;2015;2010;2010	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;.;TRPM6_HUMAN;.;.	Y	2015;2019;970;852;2010;2010;561	ENSP00000354006:S2015Y;ENSP00000407341:S2019Y;ENSP00000366068:S970Y;ENSP00000366067:S852Y;ENSP00000396672:S2010Y;ENSP00000354962:S2010Y	ENSP00000354006:S2015Y	S	-	2	0	TRPM6	76529374	0.045000	0.20229	0.022000	0.16811	0.484000	0.33280	2.458000	0.45014	1.370000	0.46153	0.609000	0.83330	TCC	.		0.443	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
UBE2J1	51465	ucsc.edu;bcgsc.ca	37	6	90053415	90053415	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr6:90053415G>T	ENST00000435041.2	-	2	370	c.92C>A	c.(91-93)gCg>gAg	p.A31E		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	31					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		TAAAGGCTGCGCATGGTAATG	0.274																																					p.A31E		.											.	UBE2J1	226	0			c.C92A						.						58.0	58.0	58.0					6																	90053415		2203	4297	6500	SO:0001583	missense	51465	exon2			GGCTGCGCATGGT	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.92C>A	6.37:g.90053415G>T	ENSP00000451261:p.Ala31Glu	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_016021	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Missense_Mutation	SNP	ENST00000435041.2	37	CCDS5021.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406973	0.83230	.	.	ENSG00000198833	ENST00000435041;ENST00000536477	T	0.49139	0.79	5.4	5.4	0.78164	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.088967	0.85682	D	0.000000	T	0.78323	0.4265	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85457	0.1164	10	0.87932	D	0	-1.6547	19.5511	0.95322	0.0:0.0:1.0:0.0	.	31	Q9Y385	UB2J1_HUMAN	E	31;16	ENSP00000451261:A31E	ENSP00000354684:A31E	A	-	2	0	UBE2J1	90110134	1.000000	0.71417	0.999000	0.59377	0.800000	0.45204	8.087000	0.89521	2.704000	0.92352	0.650000	0.86243	GCG	.		0.274	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82833574	82833574	+	Silent	SNP	C	C	T			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr5:82833574C>T	ENST00000265077.3	+	8	5317	c.4752C>T	c.(4750-4752)ccC>ccT	p.P1584P	VCAN_ENST00000512590.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Silent_p.P597P|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1584	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CATACACTCCCACTATAGTTC	0.408																																					p.P1584P		.											.	VCAN	238	0			c.C4752T						.						89.0	91.0	90.0					5																	82833574		2203	4300	6503	SO:0001819	synonymous_variant	1462	exon8			CACTCCCACTATA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.4752C>T	5.37:g.82833574C>T		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	30.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																			.		0.408	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
VPS13A	23230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	79867172	79867172	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr9:79867172G>A	ENST00000360280.3	+	22	2452	c.2192G>A	c.(2191-2193)cGa>cAa	p.R731Q	VPS13A_ENST00000357409.5_Missense_Mutation_p.R731Q|VPS13A_ENST00000376636.3_Missense_Mutation_p.R731Q|VPS13A_ENST00000376634.4_Missense_Mutation_p.R731Q	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	731					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AGAGAAGCACGAAAACTCAGT	0.353																																					p.R731Q		.											.	VPS13A	161	0			c.G2192A						.						193.0	183.0	186.0					9																	79867172		2203	4300	6503	SO:0001583	missense	23230	exon22			AAGCACGAAAACT	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.2192G>A	9.37:g.79867172G>A	ENSP00000353422:p.Arg731Gln	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	64.0	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	G	31	5.085841	0.94100	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.46	5.46	0.80206	.	0.148405	0.45606	D	0.000352	T	0.73305	0.3570	M	0.81802	2.56	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.95;0.997;1.0;1.0	T	0.69172	-0.5215	10	0.17369	T	0.5	.	18.9119	0.92489	0.0:0.0:1.0:0.0	.	731;731;731;731	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	Q	731	ENSP00000365821:R731Q;ENSP00000365823:R731Q;ENSP00000353422:R731Q;ENSP00000349985:R731Q	ENSP00000349985:R731Q	R	+	2	0	VPS13A	79056992	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.938000	0.87678	2.552000	0.86080	0.561000	0.74099	CGA	.		0.353	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
ZBTB1	22890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64989700	64989700	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr14:64989700A>G	ENST00000554015.1	+	4	1909	c.1478A>G	c.(1477-1479)aAt>aGt	p.N493S	ZBTB1_ENST00000358738.3_Missense_Mutation_p.N493S|RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000394712.2_Missense_Mutation_p.N493S			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	493					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		TTGGAAGAGAATCCTGATGAG	0.418																																					p.N493S		.											.	ZBTB1	91	0			c.A1478G						.						107.0	107.0	107.0					14																	64989700		2203	4300	6503	SO:0001583	missense	22890	exon2			AAGAGAATCCTGA	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1478A>G	14.37:g.64989700A>G	ENSP00000451000:p.Asn493Ser	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	44.0	NM_014950	A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000554015.1	37	CCDS45126.1	.	.	.	.	.	.	.	.	.	.	A	9.080	0.999089	0.19121	.	.	ENSG00000126804	ENST00000554015;ENST00000358738;ENST00000394712	T;T;T	0.10288	2.89;3.45;2.89	6.03	6.03	0.97812	.	0.754534	0.13075	N	0.415753	T	0.08492	0.0211	N	0.24115	0.695	0.31274	N	0.691353	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.04427	-1.0952	10	0.62326	D	0.03	-25.5236	7.5825	0.27974	0.7872:0.1426:0.0702:0.0	.	493;493	Q9Y2K1-2;Q9Y2K1	.;ZBTB1_HUMAN	S	493	ENSP00000451000:N493S;ENSP00000351587:N493S;ENSP00000378201:N493S	ENSP00000351587:N493S	N	+	2	0	ZBTB1	64059453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.408000	0.59761	2.308000	0.77769	0.533000	0.62120	AAT	.		0.418	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1		
ZDHHC22	283576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	77606003	77606003	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr14:77606003G>A	ENST00000319374.4	-	2	281	c.79C>T	c.(79-81)Ctc>Ttc	p.L27F	RP11-463C8.4_ENST00000557752.1_Intron|AC007375.1_ENST00000600936.1_5'Flank	NM_174976.2	NP_777636.2	Q8N966	ZDH22_HUMAN	zinc finger, DHHC-type containing 22	27					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(1)|lung(1)|urinary_tract(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0277)		AAGAGGAAGAGCTGCAGCACG	0.667											OREG0022834	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L27F		.											.	.	.	0			c.C79T						.						10.0	13.0	12.0					14																	77606003		2096	4206	6302	SO:0001583	missense	283576	exon2			GGAAGAGCTGCAG	AK095612	CCDS45140.1	14q24.3	2008-08-06	2004-03-05	2004-03-10	ENSG00000177108	ENSG00000177108		"""Zinc fingers, DHHC-type"""	20106	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 59"""	C14orf59			Standard	NM_174976		Approved		uc010asp.3	Q8N966		ENST00000319374.4:c.79C>T	14.37:g.77606003G>A	ENSP00000318222:p.Leu27Phe	Somatic	26.0	0.0	1177	WXS	Illumina HiSeq	Phase_I	57.0	20.0	NM_174976	A6NH02|B7Z2L5|Q149P4	Missense_Mutation	SNP	ENST00000319374.4	37	CCDS45140.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.765692	0.49574	.	.	ENSG00000177108	ENST00000319374;ENST00000555389;ENST00000555327	T	0.58652	0.32	5.67	5.67	0.87782	.	0.128302	0.53938	D	0.000046	T	0.36717	0.0977	N	0.08118	0	0.40340	D	0.979024	B	0.17038	0.02	B	0.10450	0.005	T	0.25082	-1.0142	10	0.21540	T	0.41	.	13.8634	0.63574	0.0:0.0:0.8382:0.1617	.	27	Q8N966	ZDH22_HUMAN	F	27	ENSP00000318222:L27F	ENSP00000318222:L27F	L	-	1	0	ZDHHC22	76675756	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.584000	0.53936	2.677000	0.91161	0.561000	0.74099	CTC	.		0.667	ZDHHC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414289.1	NM_174976	
ZNF107	51427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	64167564	64167564	+	Silent	SNP	T	T	C			TCGA-DD-A1EH-01A-11D-A12Z-10	TCGA-DD-A1EH-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9f03936-1de5-4330-8b0f-6d0ab533876e	47c44a9a-cfe6-4305-a9ea-b0fb5f2b5137	g.chr7:64167564T>C	ENST00000395391.1	+	4	2257	c.882T>C	c.(880-882)caT>caC	p.H294H	ZNF107_ENST00000423627.1_Silent_p.H294H|ZNF107_ENST00000344930.3_Silent_p.H294H			Q9UII5	ZN107_HUMAN	zinc finger protein 107	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				AGAAAATTCATACTGGAGGGA	0.358																																					p.H294H		.											.	ZNF107	69	0			c.T882C						.						41.0	46.0	45.0					7																	64167564		2195	4298	6493	SO:0001819	synonymous_variant	51427	exon7			AATTCATACTGGA	AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.882T>C	7.37:g.64167564T>C		Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	40.0	NM_016220		Silent	SNP	ENST00000395391.1	37	CCDS5527.1																																																																																			.		0.358	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220	
