#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA6	23460	hgsc.bcm.edu;bcgsc.ca	37	17	67110945	67110945	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:67110945delA	ENST00000284425.2	-	13	1914	c.1740delT	c.(1738-1740)tttfs	p.F580fs		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	580	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TTATTTTAGCAAACAGGCTGA	0.403																																					p.F580fs		.											.	ABCA6	159	0			c.1740delT						.						184.0	163.0	170.0					17																	67110945		2203	4300	6503	SO:0001589	frameshift_variant	23460	exon13			TTTAGCAAACAGG	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.1740delT	17.37:g.67110945delA	ENSP00000284425:p.Phe580fs	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	286.0	81.0	NM_080284	Q6NSH9|Q8N856|Q8WWZ6	Frame_Shift_Del	DEL	ENST00000284425.2	37	CCDS11683.1																																																																																			.		0.403	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
AK7	122481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96875279	96875279	+	Splice_Site	SNP	G	G	A	rs377123131		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr14:96875279G>A	ENST00000267584.4	+	4	542		c.e4+1		AK7_ENST00000554313.1_Splice_Site	NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7						axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		CCTGGACCCCGTAAGTAGAGC	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		19210	0.0		0.001	False		,,,				2504	0.0				.		.											.	AK7	228	0			c.498+1G>A						.	G		0,4406		0,0,2203	66.0	65.0	66.0			4.9	0.7	14		66	1,8599	1.2+/-3.3	0,1,4299	no	splice-5	AK7	NM_152327.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077			96875279	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	122481	exon4			GACCCCGTAAGTA	AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.498+1G>A	14.37:g.96875279G>A		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	8.0	NM_152327	Q8IYP6	Splice_Site	SNP	ENST00000267584.4	37	CCDS9945.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.150997	0.57151	0.0	1.16E-4	ENSG00000140057	ENST00000267584	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3768	0.74610	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AK7	95945032	1.000000	0.71417	0.733000	0.30861	0.687000	0.40016	6.236000	0.72339	2.432000	0.82394	0.655000	0.94253	.	.		0.473	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413340.1		Intron
ANKLE1	126549	ucsc.edu;bcgsc.ca	37	19	17396254	17396254	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr19:17396254T>C	ENST00000394458.3	+	7	1667	c.1391T>C	c.(1390-1392)cTg>cCg	p.L464P	ANKLE1_ENST00000404085.1_Missense_Mutation_p.L460P|ANKLE1_ENST00000598347.1_Missense_Mutation_p.L438P|ANKLE1_ENST00000433424.2_Missense_Mutation_p.C433R|ANKLE1_ENST00000594072.1_Missense_Mutation_p.L427P	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	464	GIY-YIG. {ECO:0000255|PROSITE- ProRule:PRU00977}.									large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						ACTCAGGACCTGCCAGCCCGA	0.562																																					p.L464P		.											.	.	.	0			c.T1391C						.						110.0	122.0	118.0					19																	17396254		2203	4300	6503	SO:0001583	missense	126549	exon7			AGGACCTGCCAGC	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.1391T>C	19.37:g.17396254T>C	ENSP00000377971:p.Leu464Pro	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_152363	A8VU82|Q8N8J8	Missense_Mutation	SNP	ENST00000394458.3	37	CCDS12354.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.85|18.85	3.711927|3.711927	0.68730|0.68730	.|.	.|.	ENSG00000160117|ENSG00000160117	ENST00000433424|ENST00000404261;ENST00000404085;ENST00000394458;ENST00000438921	T|D	0.73258|0.82167	-0.73|-1.58	4.44|4.44	4.44|4.44	0.53790|0.53790	.|.	.|0.000000	.|0.64402	.|D	.|0.000007	D|D	0.91768|0.91768	0.7396|0.7396	M|M	0.90082|0.90082	3.085|3.085	0.46701|0.46701	D|D	0.999163|0.999163	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;1.0;0.998;0.998	D|D	0.92987|0.92987	0.6411|0.6411	7|10	0.87932|0.87932	D|D	0|0	-0.5862|-0.5862	11.7152|11.7152	0.51647|0.51647	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|438;424;464;427	.|E7ETZ9;Q8NAG6-1;Q8NAG6;A0JLW0	.|.;.;ANKL1_HUMAN;.	R|P	433|464;460;427;438	ENSP00000394460:C433R|ENSP00000384008:L460P	ENSP00000394460:C433R|ENSP00000377971:L427P	C|L	+|+	1|2	0|0	ANKLE1|ANKLE1	17257254|17257254	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.760000|0.760000	0.43138|0.43138	6.971000|6.971000	0.76105|0.76105	1.865000|1.865000	0.54081|0.54081	0.459000|0.459000	0.35465|0.35465	TGC|CTG	.		0.562	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325392.2	NM_152363	
ANKRD12	23253	broad.mit.edu;bcgsc.ca	37	18	9258431	9258431	+	Silent	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr18:9258431C>A	ENST00000262126.4	+	9	5406	c.5166C>A	c.(5164-5166)gcC>gcA	p.A1722A	RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000383440.2_Silent_p.A1699A|ANKRD12_ENST00000400020.3_Silent_p.A1699A	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1722						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AAGAAAATGCCGAAGATGATA	0.343																																					p.A1722A		.											.	ANKRD12	92	0			c.C5166A						.						71.0	69.0	70.0					18																	9258431		2203	4300	6503	SO:0001819	synonymous_variant	23253	exon9			AAATGCCGAAGAT	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.5166C>A	18.37:g.9258431C>A		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	5.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	37	CCDS11843.1																																																																																			.		0.343	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ANKRD24	170961	ucsc.edu;bcgsc.ca	37	19	4216326	4216326	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr19:4216326A>G	ENST00000600132.1	+	17	1592	c.1316A>G	c.(1315-1317)gAa>gGa	p.E439G	ANKRD24_ENST00000595096.1_3'UTR|ANKRD24_ENST00000318934.4_Missense_Mutation_p.E439G|ANKRD24_ENST00000262970.5_Missense_Mutation_p.E529G	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	439										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		TCGGCCCAGGAACACCTGGCC	0.642																																					p.E439G		.											.	ANKRD24	68	0			c.A1316G						.						26.0	29.0	28.0					19																	4216326		1991	4150	6141	SO:0001583	missense	170961	exon17			CCCAGGAACACCT	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.1316A>G	19.37:g.4216326A>G	ENSP00000471252:p.Glu439Gly	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_133475	O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	37	CCDS45925.1	.	.	.	.	.	.	.	.	.	.	a	4.366	0.067456	0.08388	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.47869	0.97;0.83	4.58	2.4	0.29515	.	0.000000	0.34268	N	0.004111	T	0.31670	0.0804	L	0.34521	1.04	0.25064	N	0.991041	B;B	0.13594	0.002;0.008	B;B	0.16289	0.003;0.015	T	0.24333	-1.0163	10	0.62326	D	0.03	-4.4158	4.3444	0.11126	0.7278:0.0:0.0979:0.1743	.	439;529	Q8TF21;Q8TF21-2	ANR24_HUMAN;.	G	439;529	ENSP00000321731:E439G;ENSP00000262970:E529G	ENSP00000262970:E529G	E	+	2	0	ANKRD24	4167326	0.975000	0.34042	0.027000	0.17364	0.030000	0.12068	2.446000	0.44908	0.133000	0.18654	0.260000	0.18958	GAA	.		0.642	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
ARHGEF28	64283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	73048919	73048919	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:73048919G>T	ENST00000426542.2	+	3	387	c.367G>T	c.(367-369)Gcc>Tcc	p.A123S	ARHGEF28_ENST00000545377.1_Missense_Mutation_p.A123S|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.A123S|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.A123S|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.A123S|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.A123S			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	123					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										GACCCCATTTGCCTTGACGGC	0.597																																					p.A123S		.											.	.	.	0			c.G367T						.						38.0	41.0	40.0					5																	73048919		2144	4265	6409	SO:0001583	missense	64283	exon4			CCATTTGCCTTGA		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.367G>T	5.37:g.73048919G>T	ENSP00000412175:p.Ala123Ser	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	36.0	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.737841	0.30774	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542	T;T;T;T;T;T	0.09073	3.26;3.26;3.26;3.02;3.26;3.26	5.82	5.82	0.92795	.	.	.	.	.	T	0.07593	0.0191	N	0.25647	0.755	0.27325	N	0.956933	B;B;B;B	0.29988	0.068;0.068;0.264;0.112	B;B;B;B	0.27715	0.013;0.013;0.082;0.029	T	0.21965	-1.0230	9	0.39692	T	0.17	.	12.9148	0.58200	0.078:0.0:0.922:0.0	.	123;123;123;123	Q8N1W1;E9PC75;Q8N1W1-2;Q8N1W1-4	RGNEF_HUMAN;.;.;.	S	123	ENSP00000296794:A123S;ENSP00000441913:A123S;ENSP00000441436:A123S;ENSP00000287898:A123S;ENSP00000411459:A123S;ENSP00000412175:A123S	ENSP00000287898:A123S	A	+	1	0	RP11-428C6.1	73084675	1.000000	0.71417	1.000000	0.80357	0.255000	0.26057	4.806000	0.62569	2.757000	0.94681	0.561000	0.74099	GCC	.		0.597	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
ASH1L	55870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155308071	155308071	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:155308071T>G	ENST00000368346.3	-	27	9266	c.8627A>C	c.(8626-8628)aAt>aCt	p.N2876T	ASH1L_ENST00000392403.3_Missense_Mutation_p.N2871T			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2876					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGGTATCTCATTGGCTGCTTG	0.517																																					p.N2871T		.											.	ASH1L	234	0			c.A8612C						.						150.0	139.0	143.0					1																	155308071		2203	4300	6503	SO:0001583	missense	55870	exon27			ATCTCATTGGCTG	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.8627A>C	1.37:g.155308071T>G	ENSP00000357330:p.Asn2876Thr	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	192.0	57.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	T	5.808	0.333387	0.11013	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.88124	-2.34;-2.34	5.65	0.582	0.17412	.	0.699661	0.15155	N	0.277477	T	0.44912	0.1316	N	0.02011	-0.69	0.80722	D	1	B;B	0.15473	0.008;0.013	B;B	0.16289	0.007;0.015	T	0.16600	-1.0397	10	0.12103	T	0.63	.	8.8976	0.35474	0.0:0.4142:0.0:0.5858	.	2876;2871	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	T	2876;2871	ENSP00000357330:N2876T;ENSP00000376204:N2871T	ENSP00000357330:N2876T	N	-	2	0	ASH1L	153574695	0.000000	0.05858	0.958000	0.39756	0.387000	0.30353	-0.141000	0.10327	-0.051000	0.13334	-1.139000	0.01908	AAT	.		0.517	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
ASRGL1	80150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62159568	62159568	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:62159568G>A	ENST00000415229.2	+	7	954	c.739G>A	c.(739-741)Gct>Act	p.A247T	CTD-2531D15.5_ENST00000526045.1_RNA|ASRGL1_ENST00000301776.5_Missense_Mutation_p.A247T	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	247					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	GGTAGAAGAGGCTGCGGACCT	0.453											OREG0021023	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A247T		.											.	ASRGL1	90	0			c.G739A						.						123.0	121.0	122.0					11																	62159568		2202	4299	6501	SO:0001583	missense	80150	exon7			GAAGAGGCTGCGG		CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.739G>A	11.37:g.62159568G>A	ENSP00000400057:p.Ala247Thr	Somatic	88.0	0.0	1059	WXS	Illumina HiSeq	Phase_I	142.0	28.0	NM_001083926	B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Missense_Mutation	SNP	ENST00000415229.2	37	CCDS8019.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994551	0.93167	.	.	ENSG00000162174	ENST00000415229;ENST00000301776	D;D	0.89050	-2.46;-2.46	5.24	5.24	0.73138	.	0.050242	0.85682	D	0.000000	D	0.96346	0.8808	H	0.96518	3.835	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97615	1.0132	10	0.87932	D	0	-19.3664	16.3389	0.83075	0.0:0.0:1.0:0.0	.	247	Q7L266	ASGL1_HUMAN	T	247	ENSP00000400057:A247T;ENSP00000301776:A247T	ENSP00000301776:A247T	A	+	1	0	ASRGL1	61916144	1.000000	0.71417	0.977000	0.42913	0.949000	0.60115	8.389000	0.90172	2.424000	0.82194	0.655000	0.94253	GCT	.		0.453	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394865.1	NM_001083926	
PTCD1	26024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99032672	99032672	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr7:99032672C>T	ENST00000292478.4	-	2	444	c.194G>A	c.(193-195)aGc>aAc	p.S65N	ATP5J2-PTCD1_ENST00000437572.1_5'UTR|PTCD1_ENST00000555673.1_Missense_Mutation_p.S114N|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.S114N|PTCD1_ENST00000485746.1_5'Flank	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	65					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			AGAGCCCAGGCTGCCCGTGTT	0.642																																					p.S114N		.											.	.	.	0			c.G341A						.						33.0	35.0	34.0					7																	99032672		2203	4300	6503	SO:0001583	missense	100526740	exon3			CCCAGGCTGCCCG	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.194G>A	7.37:g.99032672C>T	ENSP00000292478:p.Ser65Asn	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	15.0	NM_001198879	Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	37	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448360	0.63178	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000555673;ENST00000430982;ENST00000430029;ENST00000419981;ENST00000437572;ENST00000413834	T;T;D;D;D;D;T	0.86030	-0.18;-0.16;-1.76;-1.76;-2.06;-1.84;-0.16	5.57	3.76	0.43208	.	0.389764	0.27682	N	0.018300	D	0.83764	0.5325	M	0.73962	2.25	0.09310	N	1	P;P	0.44816	0.844;0.608	P;B	0.44359	0.447;0.261	T	0.73313	-0.4022	10	0.18710	T	0.47	-14.0754	9.9101	0.41399	0.0:0.8368:0.0:0.1632	.	114;65	G3V325;O75127	.;PTCD1_HUMAN	N	65;114;65;65;65;65;114	ENSP00000292478:S65N;ENSP00000450995:S114N;ENSP00000390530:S65N;ENSP00000408059:S65N;ENSP00000401600:S65N;ENSP00000410697:S65N;ENSP00000400168:S114N	ENSP00000400168:S114N	S	-	2	0	ATP5J2-PTCD1;PTCD1	98870608	0.014000	0.17966	0.003000	0.11579	0.001000	0.01503	0.822000	0.27352	1.361000	0.45981	-0.251000	0.11542	AGC	.		0.642	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
ATP7B	540	broad.mit.edu;bcgsc.ca	37	13	52511519	52511519	+	Missense_Mutation	SNP	A	A	G	rs377144951		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr13:52511519A>G	ENST00000242839.4	-	19	4070	c.3914T>C	c.(3913-3915)cTg>cCg	p.L1305P	ATP7B_ENST00000418097.2_Missense_Mutation_p.L1240P|ATP7B_ENST00000400366.3_Missense_Mutation_p.L1194P|ATP7B_ENST00000448424.2_Missense_Mutation_p.L1227P|ATP7B_ENST00000344297.5_Missense_Mutation_p.L1098P|ATP7B_ENST00000417240.2_Missense_Mutation_p.L516P|ATP7B_ENST00000400370.3_Missense_Mutation_p.L875P	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1305			L -> P (in WD). {ECO:0000269|PubMed:11180609, ECO:0000269|PubMed:15967699}.		cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CACCACATCCAGCAAATCATT	0.537									Wilson disease																												p.L1305P		.											.	ATP7B	92	0			c.T3914C	GRCh37	CM003306	ATP7B	M		.	A	PRO/LEU,PRO/LEU	0,4282		0,0,2141	97.0	103.0	101.0		3914,3293	5.2	0.0	13		101	1,8503		0,1,4251	no	missense,missense	ATP7B	NM_000053.3,NM_001005918.2	98,98	0,1,6392	GG,GA,AA		0.0118,0.0,0.0078	probably-damaging,probably-damaging	1305/1466,1098/1259	52511519	1,12785	2141	4252	6393	SO:0001583	missense	540	exon19	Familial Cancer Database		ACATCCAGCAAAT	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.3914T>C	13.37:g.52511519A>G	ENSP00000242839:p.Leu1305Pro	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	5.0	NM_000053	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	37	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.091463	0.55968	0.0	1.18E-4	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000417240;ENST00000448424;ENST00000400370;ENST00000418097	D;D;D;D;D;D;D	0.99376	-5.79;-5.79;-5.79;-5.79;-5.79;-5.79;-5.79	5.25	5.25	0.73442	HAD-like domain (2);	0.000000	0.64402	D	0.000001	D	0.99275	0.9747	M	0.72353	2.195	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.971;0.999;0.986;0.999;0.997;0.999;0.993	D	0.99360	1.0917	10	0.87932	D	0	-18.5835	15.4544	0.75302	1.0:0.0:0.0:0.0	.	1227;1257;1240;516;875;1194;1098;1305	E7ET55;B7ZLR4;F5H748;E7EQQ2;F5H562;P35670-3;P35670-2;P35670	.;.;.;.;.;.;.;ATP7B_HUMAN	P	1305;1194;1098;516;1227;875;1240	ENSP00000242839:L1305P;ENSP00000383217:L1194P;ENSP00000342559:L1098P;ENSP00000390360:L516P;ENSP00000416738:L1227P;ENSP00000383221:L875P;ENSP00000393343:L1240P	ENSP00000242839:L1305P	L	-	2	0	ATP7B	51409520	1.000000	0.71417	0.020000	0.16555	0.183000	0.23260	9.281000	0.95811	2.106000	0.64143	0.482000	0.46254	CTG	.		0.537	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
BCL11A	53335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	60688821	60688821	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr2:60688821A>C	ENST00000335712.6	-	4	1453	c.1226T>G	c.(1225-1227)cTg>cGg	p.L409R	BCL11A_ENST00000537768.1_Missense_Mutation_p.L78R|BCL11A_ENST00000356842.4_Missense_Mutation_p.L409R|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000538214.1_Missense_Mutation_p.L375R|BCL11A_ENST00000358510.4_Missense_Mutation_p.L375R	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	409					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GTGGTCGCACAGGTTGCACTT	0.597			T	IGH@	B-CLL																																p.L409R		.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	BCL11A	1149	0			c.T1226G						.						97.0	92.0	94.0					2																	60688821		2203	4300	6503	SO:0001583	missense	53335	exon4			TCGCACAGGTTGC	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1226T>G	2.37:g.60688821A>C	ENSP00000338774:p.Leu409Arg	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	29.0	NM_018014	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.113028	0.37242	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.20881	3.01;3.01;2.04;2.04;2.04	5.54	5.54	0.83059	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.083845	0.49305	D	0.000150	T	0.31136	0.0787	N	0.25201	0.72	0.80722	D	1	D;D;D;D;D	0.89917	0.973;0.998;1.0;0.999;0.999	D;D;D;D;D	0.87578	0.941;0.951;0.998;0.996;0.993	T	0.06643	-1.0815	10	0.18710	T	0.47	-1.1401	15.6768	0.77332	1.0:0.0:0.0:0.0	.	375;78;375;409;409	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	R	409;445;375;78;409;375	ENSP00000349300:L409R;ENSP00000438303:L375R;ENSP00000443712:L78R;ENSP00000338774:L409R;ENSP00000351307:L375R	ENSP00000338774:L409R	L	-	2	0	BCL11A	60542325	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.306000	0.78905	2.110000	0.64415	0.533000	0.62120	CTG	.		0.597	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
C1orf68	100129271	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	152692135	152692135	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:152692135delC	ENST00000368775.2	+	1	138	c.138delC	c.(136-138)ggcfs	p.G46fs		NM_001024679.2	NP_001019850.1	Q5T750	XP32_HUMAN	chromosome 1 open reading frame 68	46	Cys-rich.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|lung(2)|prostate(1)|stomach(3)	8						GTGTGACAGGCCCTGCTCCAT	0.542																																					p.G46fs		.											.	C1orf68	69	0			c.138delC						.						134.0	131.0	132.0					1																	152692135		692	1591	2283	SO:0001589	frameshift_variant	100129271	exon1			GACAGGCCCTGCT	AF005081	CCDS44226.1	1q21.3	2014-05-30			ENSG00000198854	ENSG00000198854			29468	protein-coding gene	gene with protein product						11698679	Standard	NM_001024679		Approved	LEP7	uc010pdu.2	Q5T750	OTTHUMG00000012401	ENST00000368775.2:c.138delC	1.37:g.152692135delC	ENSP00000357764:p.Gly46fs	Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	242.0	61.0	NM_001024679	O14634	Frame_Shift_Del	DEL	ENST00000368775.2	37	CCDS44226.1																																																																																			.		0.542	C1orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034521.2	NM_001024679	
CARD14	79092	broad.mit.edu;bcgsc.ca	37	17	78156589	78156589	+	Splice_Site	SNP	G	G	T	rs281875215		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:78156589G>T	ENST00000573882.1	+	5	885	c.349G>T	c.(349-351)Ggt>Tgt	p.G117C	CARD14_ENST00000392434.2_5'Flank|CARD14_ENST00000344227.2_Splice_Site_p.G117C|CARD14_ENST00000570421.1_Splice_Site_p.G117C			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	117			G -> S (in PSORS2; may result in altered splicing of exon 3; results in increased NF-kappa-B activation; dbSNP:rs281875215). {ECO:0000269|PubMed:22521418, ECO:0000269|PubMed:22521419}.		activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TAACTTTAGCGGTGAGAGCTC	0.587																																					p.G117C		.											.	CARD14	231	0			c.G349T						.						120.0	93.0	102.0					17																	78156589		2203	4300	6503	SO:0001630	splice_region_variant	79092	exon3			TTTAGCGGTGAGA	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.349+1G>T	17.37:g.78156589G>T		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	7.0	NM_024110	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	37	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.254732	0.39896	.	.	ENSG00000141527	ENST00000344227	T	0.26810	1.71	4.11	4.11	0.48088	.	0.132333	0.49916	D	0.000122	T	0.45716	0.1356	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.42649	-0.9439	10	0.54805	T	0.06	-29.4153	13.238	0.59982	0.0:0.0:1.0:0.0	.	117	Q9BXL6	CAR14_HUMAN	C	117	ENSP00000344549:G117C	ENSP00000344549:G117C	G	+	1	0	CARD14	75771184	1.000000	0.71417	0.997000	0.53966	0.034000	0.12701	5.681000	0.68175	1.839000	0.53478	0.591000	0.81541	GGT	.		0.587	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		Missense_Mutation
CD177	57126	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	43866283	43866283	+	RNA	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr19:43866283A>G	ENST00000607109.1	-	0	300				CD177_ENST00000378009.4_RNA|CD177_ENST00000607517.1_RNA																							GCGTGGCCCAACCTTCCAGCT	0.547																																					.		.											.	CD177	22	0			.						.						107.0	103.0	104.0					19																	43866283		2076	4212	6288			57126	.			GGCCCAACCTTCC																													19.37:g.43866283A>G		Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	19.0	.		RNA	SNP	ENST00000607109.1	37																																																																																				.		0.547	CTC-490G23.4-001	KNOWN	basic	antisense	antisense	OTTHUMT00000470165.1		
CD300LG	146894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41932594	41932594	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:41932594C>T	ENST00000317310.4	+	5	780	c.739C>T	c.(739-741)Cgc>Tgc	p.R247C	CD300LG_ENST00000586233.1_Missense_Mutation_p.R162C|CD300LG_ENST00000377203.4_Missense_Mutation_p.R213C|CD300LG_ENST00000539718.1_Missense_Mutation_p.R247C|CD300LG_ENST00000293396.8_Missense_Mutation_p.R162C	NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	247					immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CCCGATGGTCCGCATACTGGC	0.607																																					p.R247C		.											.	CD300LG	90	0			c.C739T						.						49.0	36.0	41.0					17																	41932594		2203	4299	6502	SO:0001583	missense	146894	exon5			ATGGTCCGCATAC	BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.739C>T	17.37:g.41932594C>T	ENSP00000321005:p.Arg247Cys	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	25.0	NM_145273	B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Missense_Mutation	SNP	ENST00000317310.4	37	CCDS11470.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.722740	0.68959	.	.	ENSG00000161649	ENST00000317310;ENST00000539718;ENST00000377203;ENST00000293396	T;T;T;T	0.17213	2.36;2.29;2.99;3.51	3.91	3.91	0.45181	.	0.138905	0.34046	N	0.004305	T	0.32585	0.0834	L	0.47190	1.495	0.40040	D	0.975638	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.988;0.996;0.988;0.974;0.997	T	0.04593	-1.0940	10	0.87932	D	0	-0.6434	11.7259	0.51710	0.0:1.0:0.0:0.0	.	213;162;247;247;162	F8W9M3;Q6UXG3-3;F5H7P9;Q6UXG3;Q6UXG3-2	.;.;.;CLM9_HUMAN;.	C	247;247;213;162	ENSP00000321005:R247C;ENSP00000442368:R247C;ENSP00000366408:R213C;ENSP00000293396:R162C	ENSP00000293396:R162C	R	+	1	0	CD300LG	39288120	0.201000	0.23410	0.738000	0.30950	0.240000	0.25518	1.213000	0.32407	2.484000	0.83849	0.561000	0.74099	CGC	.		0.607	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457646.1	NM_145273	
CECR2	27443	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18028982	18028982	+	Silent	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr22:18028982A>G	ENST00000400585.2	+	17	3951	c.3513A>G	c.(3511-3513)gcA>gcG	p.A1171A	CECR2_ENST00000400573.5_Silent_p.A1313A|CECR2_ENST00000262608.8_Silent_p.A1314A			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	1355					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GTTCATCTGCATTTCCACCCC	0.577																																					.		.											.	CECR2	70	0			.						.						86.0	90.0	89.0					22																	18028982		1979	4163	6142	SO:0001819	synonymous_variant	27443	.			ATCTGCATTTCCA	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.3513A>G	22.37:g.18028982A>G		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	22.0	.	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	ENST00000400585.2	37																																																																																				.		0.577	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413	
CHTF18	63922	broad.mit.edu;mdanderson.org	37	16	847042	847042	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr16:847042C>T	ENST00000262315.9	+	20	2746	c.2683C>T	c.(2683-2685)Cat>Tat	p.H895Y	CHTF18_ENST00000455171.2_Missense_Mutation_p.H923Y|CHTF18_ENST00000317063.6_Missense_Mutation_p.H1104Y	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	895					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CCCACGCAACCATGAGCAGCG	0.662																																					p.H895Y		.											.	CHTF18	227	0			c.C2683T						.						43.0	53.0	50.0					16																	847042		2036	4198	6234	SO:0001583	missense	63922	exon20			CGCAACCATGAGC	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2683C>T	16.37:g.847042C>T	ENSP00000262315:p.His895Tyr	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	6.0	NM_022092	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	ENST00000262315.9	37	CCDS45371.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.782439	0.49891	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	T;T;T	0.11712	2.75;2.8;2.78	4.42	3.47	0.39725	.	0.381500	0.28841	N	0.013962	T	0.25938	0.0632	M	0.67397	2.05	0.58432	D	0.999993	D;D	0.76494	0.999;0.989	D;P	0.63957	0.92;0.691	T	0.00735	-1.1588	10	0.45353	T	0.12	-14.6152	11.09	0.48110	0.0:0.9071:0.0:0.0929	.	923;895	Q8WVB6-2;Q8WVB6	.;CTF18_HUMAN	Y	1104;923;895	ENSP00000313029:H1104Y;ENSP00000406252:H923Y;ENSP00000262315:H895Y	ENSP00000262315:H895Y	H	+	1	0	CHTF18	787043	1.000000	0.71417	0.068000	0.19968	0.148000	0.21650	4.826000	0.62715	0.879000	0.35944	0.313000	0.20887	CAT	.		0.662	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
CYP4Z1	199974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47571829	47571829	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:47571829C>G	ENST00000334194.3	+	9	1100	c.1097C>G	c.(1096-1098)aCg>aGg	p.T366R	CYP4A22-AS1_ENST00000444042.2_lincRNA	NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	366						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						CCTTACACCACGATGTGCATC	0.517																																					p.T366R		.											.	CYP4Z1	91	0			c.C1097G						.						140.0	119.0	126.0					1																	47571829		2203	4300	6503	SO:0001583	missense	199974	exon9			ACACCACGATGTG	AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.1097C>G	1.37:g.47571829C>G	ENSP00000334246:p.Thr366Arg	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	308.0	107.0	NM_178134	Q5VVE4	Missense_Mutation	SNP	ENST00000334194.3	37	CCDS545.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658365	0.67586	.	.	ENSG00000186160	ENST00000334194	T	0.68331	-0.32	3.25	3.25	0.37280	.	0.000000	0.64402	U	0.000002	T	0.76870	0.4048	L	0.55834	1.745	0.42596	D	0.993266	D	0.89917	1.0	D	0.85130	0.997	T	0.80487	-0.1361	10	0.87932	D	0	.	13.8624	0.63569	0.0:1.0:0.0:0.0	.	366	Q86W10	CP4Z1_HUMAN	R	366	ENSP00000334246:T366R	ENSP00000334246:T366R	T	+	2	0	CYP4Z1	47344416	1.000000	0.71417	0.979000	0.43373	0.689000	0.40095	5.029000	0.64121	1.847000	0.53656	0.289000	0.19496	ACG	.		0.517	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022020.1	NM_178134	
COL11A1	1301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	103491141	103491141	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:103491141T>C	ENST00000370096.3	-	7	1238	c.926A>G	c.(925-927)tAc>tGc	p.Y309C	COL11A1_ENST00000512756.1_Intron|COL11A1_ENST00000353414.4_Missense_Mutation_p.Y270C|COL11A1_ENST00000358392.2_Missense_Mutation_p.Y321C	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	309	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TCCATAGTTGTATTCTTGAAA	0.353																																					p.Y321C		.											.	COL11A1	586	0			c.A962G						.						125.0	118.0	121.0					1																	103491141		2203	4299	6502	SO:0001583	missense	1301	exon7			TAGTTGTATTCTT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.926A>G	1.37:g.103491141T>C	ENSP00000359114:p.Tyr309Cys	Somatic	329.0	0.0		WXS	Illumina HiSeq	Phase_I	443.0	67.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.983984	0.35036	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000427239	D;T;D;T	0.88586	-2.38;-0.6;-2.4;-0.55	5.53	5.53	0.82687	.	0.480685	0.22400	N	0.060545	D	0.89413	0.6708	M	0.83953	2.67	0.43564	D	0.99588	D;D;P	0.54964	0.969;0.969;0.947	P;P;B	0.50378	0.54;0.639;0.339	D	0.89488	0.3755	10	0.42905	T	0.14	.	12.215	0.54402	0.0:0.0:0.1422:0.8578	.	270;321;309	P12107-3;P12107-2;P12107	.;.;COBA1_HUMAN	C	309;321;270;321	ENSP00000359114:Y309C;ENSP00000351163:Y321C;ENSP00000302551:Y270C;ENSP00000408640:Y321C	ENSP00000302551:Y270C	Y	-	2	0	COL11A1	103263729	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.758000	0.68776	2.106000	0.64143	0.519000	0.50382	TAC	.		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
DCHS1	8642	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	6662505	6662505	+	Missense_Mutation	SNP	G	G	A	rs200060711		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:6662505G>A	ENST00000299441.3	-	2	751	c.340C>T	c.(340-342)Cgc>Tgc	p.R114C		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	114	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAGCGGTAGCGGTCCCGCTGC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		19399	0.001		0.0	False		,,,				2504	0.0				p.R114C		.											.	DCHS1	73	0			c.C340T						.	G	CYS/ARG	0,4402		0,0,2201	82.0	64.0	70.0		340	5.4	1.0	11		70	1,8591	1.2+/-3.3	0,1,4295	yes	missense	DCHS1	NM_003737.2	180	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	114/3299	6662505	1,12993	2201	4296	6497	SO:0001583	missense	8642	exon2			GGTAGCGGTCCCG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.340C>T	11.37:g.6662505G>A	ENSP00000299441:p.Arg114Cys	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	5.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.77	3.694069	0.68386	0.0	1.16E-4	ENSG00000166341	ENST00000299441	T	0.38887	1.11	5.41	5.41	0.78517	Cadherin (3);Cadherin-like (1);	0.438424	0.19547	N	0.111649	T	0.68007	0.2954	M	0.80183	2.485	0.53688	D	0.999979	D	0.89917	1.0	D	0.79108	0.992	T	0.69639	-0.5091	10	0.52906	T	0.07	.	18.1884	0.89799	0.0:0.0:1.0:0.0	.	114	Q96JQ0	PCD16_HUMAN	C	114	ENSP00000299441:R114C	ENSP00000299441:R114C	R	-	1	0	DCHS1	6619081	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.348000	0.59379	2.536000	0.85505	0.643000	0.83706	CGC	G|0.999;A|0.000		0.622	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
DCLRE1C	64421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	14976379	14976379	+	Splice_Site	SNP	C	C	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr10:14976379C>T	ENST00000378278.2	-	8	715	c.678G>A	c.(676-678)caG>caA	p.Q226Q	DCLRE1C_ENST00000378255.1_Splice_Site_p.Q106Q|DCLRE1C_ENST00000378249.1_Splice_Site_p.Q111Q|DCLRE1C_ENST00000378289.4_Splice_Site_p.Q226Q|DCLRE1C_ENST00000357717.2_Splice_Site_p.Q111Q|DCLRE1C_ENST00000396817.2_Splice_Site_p.Q106Q|DCLRE1C_ENST00000453695.2_Splice_Site_p.Q106Q|DCLRE1C_ENST00000378254.1_Splice_Site_p.Q106Q|DCLRE1C_ENST00000378246.2_Splice_Site_p.Q111Q|DCLRE1C_ENST00000378258.1_Splice_Site_p.Q106Q			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	226					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						GTCACCATACCTGGACTCCTA	0.438								Non-homologous end-joining																													p.Q226Q		.											.	DCLRE1C	228	0			c.G678A						.						86.0	100.0	95.0					10																	14976379		2203	4300	6503	SO:0001630	splice_region_variant	64421	exon8			CCATACCTGGACT	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.678+1G>A	10.37:g.14976379C>T		Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	242.0	75.0	NM_001033855	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Silent	SNP	ENST00000378278.2	37	CCDS31149.1																																																																																			.		0.438	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046934.1	NM_022487	Silent
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	52393977	52393977	+	Nonsense_Mutation	SNP	C	C	T	rs200763734		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr3:52393977C>T	ENST00000420323.2	+	27	4714	c.4453C>T	c.(4453-4455)Cag>Tag	p.Q1485*		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1485	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTCCCGCATGCAGCGGGCAGT	0.577																																					p.Q1485X		.											.	DNAH1	67	0			c.C4453T						.						162.0	170.0	167.0					3																	52393977		2156	4253	6409	SO:0001587	stop_gained	25981	exon27			CGCATGCAGCGGG	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.4453C>T	3.37:g.52393977C>T	ENSP00000401514:p.Gln1485*	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	38.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Nonsense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	C	44	11.065208	0.99511	.	.	ENSG00000114841	ENST00000420323	.	.	.	5.13	5.13	0.70059	.	0.131609	0.34386	N	0.004003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	18.7672	0.91878	0.0:1.0:0.0:0.0	.	.	.	.	X	1485	.	ENSP00000401514:Q1485X	Q	+	1	0	DNAH1	52369017	1.000000	0.71417	1.000000	0.80357	0.514000	0.34195	2.306000	0.43673	2.677000	0.91161	0.561000	0.74099	CAG	C|0.998;G|0.002		0.577	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
FAM151A	338094	broad.mit.edu;ucsc.edu	37	1	55075294	55075294	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:55075294C>A	ENST00000302250.2	-	8	1565	c.1405G>T	c.(1405-1407)Gag>Tag	p.E469*	ACOT11_ENST00000371316.3_Intron|ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000343744.2_3'UTR|FAM151A_ENST00000371304.2_Intron	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	469						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						GGGAAGACCTCAGCCACAGCT	0.602																																					p.E469X		.											.	FAM151A	90	0			c.G1405T						.						38.0	39.0	39.0					1																	55075294		2203	4300	6503	SO:0001587	stop_gained	338094	exon8			AGACCTCAGCCAC	AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.1405G>T	1.37:g.55075294C>A	ENSP00000306888:p.Glu469*	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	3.0	NM_176782	Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Nonsense_Mutation	SNP	ENST00000302250.2	37	CCDS594.1	.	.	.	.	.	.	.	.	.	.	C	38	6.692140	0.97768	.	.	ENSG00000162391	ENST00000302250	.	.	.	4.17	4.17	0.49024	.	0.427784	0.23098	N	0.051954	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-20.5235	14.7984	0.69894	0.0:1.0:0.0:0.0	.	.	.	.	X	469	.	ENSP00000306888:E469X	E	-	1	0	FAM151A	54847882	0.027000	0.19231	0.919000	0.36401	0.986000	0.74619	0.999000	0.29757	2.608000	0.88229	0.655000	0.94253	GAG	.		0.602	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027342.1	NM_176782	
FAM208A	23272	broad.mit.edu;bcgsc.ca	37	3	56700338	56700338	+	Silent	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr3:56700338A>G	ENST00000493960.2	-	7	982	c.972T>C	c.(970-972)tcT>tcC	p.S324S	FAM208A_ENST00000431842.2_5'Flank|FAM208A_ENST00000355628.5_Silent_p.S324S	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	324							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TGTAAGTAAAAGACACAACTG	0.333																																					p.S324S		.											.	.	.	0			c.T972C						.						102.0	102.0	102.0					3																	56700338		692	1591	2283	SO:0001819	synonymous_variant	23272	exon7			AGTAAAAGACACA	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.972T>C	3.37:g.56700338A>G		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	7.0	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Silent	SNP	ENST00000493960.2	37	CCDS46853.1																																																																																			.		0.333	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
FAM63A	55793	hgsc.bcm.edu;broad.mit.edu	37	1	150974678	150974679	+	In_Frame_Ins	INS	-	-	GAG			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:150974678_150974679insGAG	ENST00000361936.5	-	3	1369_1370	c.415_416insCTC	c.(415-417)ctc>cCTCtc	p.138_139insP	FAM63A_ENST00000312210.5_5'UTR|FAM63A_ENST00000470877.1_Intron|FAM63A_ENST00000361738.6_In_Frame_Ins_p.186_187insP|FAM63A_ENST00000493834.2_In_Frame_Ins_p.43_44insP	NM_018379.4	NP_060849	Q8N5J2	FA63A_HUMAN	family with sequence similarity 63, member A	138						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(3)|large_intestine(4)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GATGGCAAGGAGAGGGCAAGGG	0.495																																					p.L187delinsPL		.											.	FAM63A	91	0			c.560_561insCTC						.																																			SO:0001652	inframe_insertion	55793	exon3			GCAAGGAGAGGGC	BC032321	CCDS976.1, CCDS30854.1, CCDS53361.1, CCDS55635.1	1q21.2	2008-02-05			ENSG00000143409	ENSG00000143409			25648	protein-coding gene	gene with protein product						10718198	Standard	NM_001040217		Approved	FLJ11280	uc010pcn.2	Q8N5J2	OTTHUMG00000035061	ENST00000361936.5:c.416_418dupCTC	1.37:g.150974679_150974681dupGAG	ENSP00000354814:p.Pro138_Pro138dup	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	268.0	63.0	NM_001163258	B3KWP4|B3KWV8|B4DXF2|B4E1S4|D3DV09|J3KP53|Q5SZF0|Q9NUL9|Q9P2F7	In_Frame_Ins	INS	ENST00000361936.5	37	CCDS976.1																																																																																			.		0.495	FAM63A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411753.1	NM_018379	
FANCA	2175	ucsc.edu;bcgsc.ca	37	16	89857938	89857938	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr16:89857938A>G	ENST00000389301.3	-	14	1262	c.1232T>C	c.(1231-1233)gTg>gCg	p.V411A	FANCA_ENST00000568369.1_Missense_Mutation_p.V411A	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	411					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CAAACGCGCCACCCAGTCTAG	0.572			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.V411A		.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	1130	0			c.T1232C						.						64.0	50.0	55.0					16																	89857938		2198	4300	6498	SO:0001583	missense	2175	exon14	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CGCGCCACCCAGT	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1232T>C	16.37:g.89857938A>G	ENSP00000373952:p.Val411Ala	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	A	15.25	2.777816	0.49786	.	.	ENSG00000187741	ENST00000389301	D	0.98876	-5.2	5.13	4.04	0.47022	.	0.142348	0.31685	N	0.007225	D	0.97065	0.9041	M	0.68317	2.08	0.80722	D	1	P;P	0.49090	0.919;0.919	B;B	0.41202	0.35;0.35	D	0.95125	0.8250	10	0.66056	D	0.02	-13.9378	8.8664	0.35289	0.9144:0.0:0.0856:0.0	.	411;411	B4DRI7;O15360	.;FANCA_HUMAN	A	411	ENSP00000373952:V411A	ENSP00000373952:V411A	V	-	2	0	FANCA	88385439	1.000000	0.71417	0.804000	0.32291	0.050000	0.14768	5.024000	0.64090	0.810000	0.34279	0.529000	0.55759	GTG	.		0.572	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
FLT3LG	2323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49979723	49979723	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr19:49979723G>A	ENST00000594009.1	+	4	321	c.242G>A	c.(241-243)cGc>cAc	p.R81H	FLT3LG_ENST00000595510.1_De_novo_Start_OutOfFrame|FLT3LG_ENST00000596435.1_Missense_Mutation_p.R81H|FLT3LG_ENST00000204637.2_De_novo_Start_OutOfFrame|FLT3LG_ENST00000344019.3_Missense_Mutation_p.R81H|CTD-3148I10.15_ENST00000595815.1_RNA|FLT3LG_ENST00000600429.1_Missense_Mutation_p.R81H|CTD-3148I10.9_ENST00000599536.1_Intron|FLT3LG_ENST00000597551.1_Missense_Mutation_p.R81H	NM_001204503.1	NP_001191432.1	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand	81					embryonic hemopoiesis (GO:0035162)|lymphocyte differentiation (GO:0030098)|positive regulation of cell proliferation (GO:0008284)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|membrane (GO:0016020)	receptor binding (GO:0005102)			large_intestine(2)|lung(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	10		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CTGGCACAGCGCTGGATGGAG	0.632											OREG0025623	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R81H		.											.	FLT3LG	115	0			c.G242A						.						44.0	41.0	42.0					19																	49979723		2203	4300	6503	SO:0001583	missense	2323	exon4			CACAGCGCTGGAT	U04806	CCDS12767.1, CCDS62753.1	19q13.3	2014-01-30				ENSG00000090554		"""Endogenous ligands"""	3766	protein-coding gene	gene with protein product		600007				8145851, 7824267	Standard	NM_001204502		Approved		uc010yau.2	P49771		ENST00000594009.1:c.242G>A	19.37:g.49979723G>A	ENSP00000469613:p.Arg81His	Somatic	48.0	0.0	966	WXS	Illumina HiSeq	Phase_I	68.0	16.0	NM_001204503	A0AVC2|B9EGH2|Q05C96	Missense_Mutation	SNP	ENST00000594009.1	37	CCDS12767.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258204	0.80246	.	.	ENSG00000090554	ENST00000204637;ENST00000344019	.	.	.	4.52	3.41	0.39046	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.418278	0.21683	N	0.070696	T	0.53400	0.1794	L	0.29908	0.895	0.37468	D	0.915471	D	0.76494	0.999	P	0.58970	0.849	T	0.60999	-0.7151	9	0.72032	D	0.01	-16.2833	10.318	0.43749	0.0:0.0:0.8041:0.1959	.	81	P49771	FLT3L_HUMAN	H	81	.	ENSP00000204637:R81H	R	+	2	0	FLT3LG	54671535	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.280000	0.33202	2.215000	0.71742	0.549000	0.68633	CGC	.		0.632	FLT3LG-007	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465305.1		
GNAT1	2779	broad.mit.edu;mdanderson.org	37	3	50231028	50231028	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr3:50231028G>A	ENST00000433068.1	+	4	437	c.381G>A	c.(379-381)tgG>tgA	p.W127*	GNAT1_ENST00000232461.3_Nonsense_Mutation_p.W127*|GNAT1_ENST00000481246.1_3'UTR	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	127					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		AGCGGCTGTGGAAGGACTCCG	0.672																																					p.W127X		.											.	GNAT1	417	0			c.G381A						.						42.0	37.0	39.0					3																	50231028		2203	4300	6503	SO:0001587	stop_gained	2779	exon4			GCTGTGGAAGGAC		CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.381G>A	3.37:g.50231028G>A	ENSP00000387555:p.Trp127*	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	6.0	NM_144499	Q4VBN2	Nonsense_Mutation	SNP	ENST00000433068.1	37	CCDS2812.1	.	.	.	.	.	.	.	.	.	.	G	36	5.843518	0.97016	.	.	ENSG00000114349	ENST00000232461;ENST00000433068;ENST00000440836	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.3737	0.90428	0.0:0.0:1.0:0.0	.	.	.	.	X	127;127;79	.	ENSP00000232461:W127X	W	+	3	0	GNAT1	50206032	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.596000	0.98267	2.653000	0.90120	0.561000	0.74099	TGG	.		0.672	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345957.1	NM_000172	
GPR162	27239	broad.mit.edu;bcgsc.ca	37	12	6934836	6934836	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:6934836A>G	ENST00000311268.3	+	3	1842	c.1055A>G	c.(1054-1056)gAc>gGc	p.D352G	LEPREL2_ENST00000251761.8_RNA|GPR162_ENST00000382315.3_Missense_Mutation_p.D48G|LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000606935.1_RNA|GPR162_ENST00000428545.2_Missense_Mutation_p.D68G	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	352						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						GATGGAGATGACGGTCAGAGG	0.617											OREG0021636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D352G		.											.	GPR162	92	0			c.A1055G						.						93.0	56.0	68.0					12																	6934836		2195	4292	6487	SO:0001583	missense	27239	exon3			GAGATGACGGTCA	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.1055A>G	12.37:g.6934836A>G	ENSP00000311528:p.Asp352Gly	Somatic	109.0	0.0	637	WXS	Illumina HiSeq	Phase_I	150.0	6.0	NM_019858	Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	ENST00000311268.3	37	CCDS8563.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.788163	0.90367	.	.	ENSG00000250510	ENST00000311268;ENST00000428545;ENST00000382315	T;T;T	0.53640	2.72;0.61;0.61	5.21	5.21	0.72293	.	.	.	.	.	T	0.45637	0.1352	L	0.55990	1.75	0.54753	D	0.999982	P;P;P	0.45044	0.728;0.59;0.849	B;B;B	0.39738	0.277;0.308;0.239	T	0.53056	-0.8492	9	0.72032	D	0.01	.	15.0885	0.72174	1.0:0.0:0.0:0.0	.	136;68;352	Q13513;Q16538-2;Q16538	.;.;GP162_HUMAN	G	352;68;48	ENSP00000311528:D352G;ENSP00000399670:D68G;ENSP00000371752:D48G	ENSP00000311528:D352G	D	+	2	0	GPR162	6805097	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	9.297000	0.96120	1.966000	0.57179	0.379000	0.24179	GAC	.		0.617	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	NM_019858	
GRM1	2911	broad.mit.edu;bcgsc.ca	37	6	146480536	146480536	+	Silent	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr6:146480536A>G	ENST00000282753.1	+	2	988	c.753A>G	c.(751-753)gaA>gaG	p.E251E	GRM1_ENST00000392299.2_Silent_p.E251E|GRM1_ENST00000355289.4_Silent_p.E251E|GRM1_ENST00000361719.2_Silent_p.E251E|GRM1_ENST00000507907.1_Silent_p.E251E|GRM1_ENST00000492807.2_Silent_p.E251E			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	251					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CTGCCCAGGAAGGCCTCTGTA	0.512																																					p.E251E		.											.	GRM1	1080	0			c.A753G						.						108.0	100.0	103.0					6																	146480536		2203	4300	6503	SO:0001819	synonymous_variant	2911	exon3			CCAGGAAGGCCTC	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.753A>G	6.37:g.146480536A>G		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	6.0	NM_000838	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	37	CCDS5209.1																																																																																			.		0.512	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
GSDMB	55876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38068752	38068752	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:38068752T>C	ENST00000394179.1	-	3	366		c.e3-2		GSDMB_ENST00000418519.1_Splice_Site|GSDMB_ENST00000394175.2_Splice_Site|GSDMB_ENST00000309481.7_Splice_Site|GSDMB_ENST00000520542.1_Splice_Site|GSDMB_ENST00000360317.3_Splice_Site			Q8TAX9	GSDMB_HUMAN	gasdermin B							cytoplasm (GO:0005737)				breast(2)|endometrium(3)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|stomach(2)	21						CCTTTTGACCTGGAAAGAGAA	0.478																																					.		.											.	GSDMB	153	0			c.236-2A>G						.						98.0	96.0	97.0					17																	38068752		2203	4300	6503	SO:0001630	splice_region_variant	55876	exon4			TTGACCTGGAAAG	AF119884	CCDS11354.1, CCDS42313.1, CCDS54119.1, CCDS54120.1	17q21.2	2008-07-31	2008-07-31	2008-07-31	ENSG00000073605	ENSG00000073605			23690	protein-coding gene	gene with protein product		611221	"""gasdermin-like"""	GSDML		12883658, 15010812, 17350798	Standard	NM_001042471		Approved	PRO2521	uc010cwj.3	Q8TAX9	OTTHUMG00000133248	ENST00000394179.1:c.236-2A>G	17.37:g.38068752T>C		Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	48.0	NM_001165958	B4DKK7|Q7Z377|Q8WY76|Q9NX71|Q9P163	Splice_Site	SNP	ENST00000394179.1	37		.	.	.	.	.	.	.	.	.	.	T	13.12	2.142078	0.37825	.	.	ENSG00000073605	ENST00000420491;ENST00000360317;ENST00000394175;ENST00000309481;ENST00000520542;ENST00000418519;ENST00000394179	.	.	.	3.18	3.18	0.36537	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1197	0.30963	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	GSDMB	35322278	0.141000	0.22595	0.454000	0.27019	0.457000	0.32468	2.645000	0.46621	1.686000	0.51046	0.421000	0.28195	.	.		0.478	GSDMB-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_018530	Intron
IFT140	9742	ucsc.edu;bcgsc.ca	37	16	1612054	1612054	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr16:1612054A>G	ENST00000426508.2	-	18	2494	c.2131T>C	c.(2131-2133)Ttc>Ctc	p.F711L	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	711					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				GGCCGGGGGAAGCTCTCATGA	0.493																																					p.F711L		.											.	IFT140	95	0			c.T2131C						.						73.0	71.0	72.0					16																	1612054		2199	4300	6499	SO:0001583	missense	9742	exon18			GGGGGAAGCTCTC	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2131T>C	16.37:g.1612054A>G	ENSP00000406012:p.Phe711Leu	Somatic	49.0	1.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_014714	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	A	8.713	0.912563	0.17907	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.68624	-0.34	5.12	5.12	0.69794	.	0.374230	0.30293	N	0.009956	T	0.67915	0.2944	M	0.81239	2.535	0.44611	D	0.997587	B;B	0.27286	0.057;0.174	B;B	0.29267	0.025;0.1	T	0.65393	-0.6179	10	0.16896	T	0.51	.	15.1997	0.73126	1.0:0.0:0.0:0.0	.	711;436	Q96RY7;B4DR58	IF140_HUMAN;.	L	711	ENSP00000406012:F711L	ENSP00000380562:F711L	F	-	1	0	IFT140	1552055	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	6.637000	0.74304	2.049000	0.60858	0.460000	0.39030	TTC	.		0.493	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
GTF3C1	2975	ucsc.edu;bcgsc.ca	37	16	27487845	27487845	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr16:27487845A>G	ENST00000356183.4	-	29	4295	c.4280T>C	c.(4279-4281)cTg>cCg	p.L1427P	GTF3C1_ENST00000561623.1_Missense_Mutation_p.L1427P	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1427					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CTGAAGCACCAGAAAGTGGAT	0.562																																					p.L1427P		.											.	GTF3C1	94	0			c.T4280C						.						59.0	51.0	54.0					16																	27487845		2197	4300	6497	SO:0001583	missense	2975	exon29			AGCACCAGAAAGT	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4280T>C	16.37:g.27487845A>G	ENSP00000348510:p.Leu1427Pro	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.259834	0.80246	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.25749	1.78	4.98	4.98	0.66077	.	0.166320	0.40818	N	0.001008	T	0.50854	0.1640	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.987;0.999	T	0.53697	-0.8402	10	0.52906	T	0.07	-17.4809	14.37	0.66833	1.0:0.0:0.0:0.0	.	1427;1427	Q12789;Q12789-3	TF3C1_HUMAN;.	P	1427;1423	ENSP00000348510:L1427P	ENSP00000348510:L1427P	L	-	2	0	GTF3C1	27395346	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.730000	0.91510	1.859000	0.53934	0.533000	0.62120	CTG	.		0.562	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
IL12RB2	3595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67787396	67787396	+	Missense_Mutation	SNP	C	C	A	rs149868445	byFrequency	TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:67787396C>A	ENST00000262345.1	+	3	828	c.188C>A	c.(187-189)tCc>tAc	p.S63Y	IL12RB2_ENST00000541374.1_Missense_Mutation_p.S63Y|IL12RB2_ENST00000371000.1_Missense_Mutation_p.S63Y|IL12RB2_ENST00000544434.1_Missense_Mutation_p.S63Y	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	63					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						TTTCACTATTCCAGACGTAAC	0.433																																					p.S63Y		.											.	IL12RB2	92	0			c.C188A						.						146.0	138.0	141.0					1																	67787396		2203	4300	6503	SO:0001583	missense	3595	exon3			ACTATTCCAGACG	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.188C>A	1.37:g.67787396C>A	ENSP00000262345:p.Ser63Tyr	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	204.0	65.0	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082057	0.55861	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21	5.11	5.11	0.69529	Immunoglobulin C2-set-like, ligand-binding (1);	0.644323	0.17020	N	0.190164	T	0.65821	0.2728	L	0.29908	0.895	0.09310	N	1	B;D;D;D	0.71674	0.171;0.998;0.975;0.995	B;D;P;D	0.65443	0.128;0.935;0.743;0.934	T	0.56565	-0.7958	10	0.02654	T	1	-0.6441	13.9166	0.63902	0.0:1.0:0.0:0.0	.	63;63;63;63	B4DGA4;F5H7L6;Q99665-2;Q99665	.;.;.;I12R2_HUMAN	Y	63	ENSP00000262345:S63Y;ENSP00000360039:S63Y;ENSP00000445276:S63Y;ENSP00000442443:S63Y	ENSP00000262345:S63Y	S	+	2	0	IL12RB2	67559984	0.017000	0.18338	0.691000	0.30163	0.016000	0.09150	3.545000	0.53648	2.657000	0.90304	0.650000	0.86243	TCC	C|1.000;T|0.000		0.433	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
KCNJ8	3764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	21926286	21926286	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:21926286T>C	ENST00000240662.2	-	2	610	c.265A>G	c.(265-267)Atc>Gtc	p.I89V		NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	89					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	CACCACATGATAGCGAAGAGC	0.517											OREG0021704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I89V		.											.	KCNJ8	90	0			c.A265G						.						139.0	117.0	125.0					12																	21926286		2203	4300	6503	SO:0001583	missense	3764	exon2			ACATGATAGCGAA	BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.265A>G	12.37:g.21926286T>C	ENSP00000240662:p.Ile89Val	Somatic	75.0	0.0	752	WXS	Illumina HiSeq	Phase_I	126.0	15.0	NM_004982	O00657	Missense_Mutation	SNP	ENST00000240662.2	37	CCDS8692.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.849044	0.32699	.	.	ENSG00000121361	ENST00000240662;ENST00000539350;ENST00000537950	D;D	0.95622	-3.76;-3.76	4.44	4.44	0.53790	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.051415	0.85682	D	0.000000	D	0.87434	0.6176	N	0.04669	-0.19	0.40690	D	0.982383	B	0.02656	0.0	B	0.04013	0.001	D	0.83479	0.0063	10	0.20046	T	0.44	.	13.8791	0.63672	0.0:0.0:0.0:1.0	.	89	Q15842	IRK8_HUMAN	V	89	ENSP00000240662:I89V;ENSP00000440012:I89V	ENSP00000240662:I89V	I	-	1	0	KCNJ8	21817553	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.854000	0.86942	1.868000	0.54150	0.383000	0.25322	ATC	.		0.517	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402226.1	NM_004982	
KCNT2	343450	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	196274453	196274458	+	In_Frame_Del	DEL	TAATAC	TAATAC	-			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	TAATAC	TAATAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:196274453_196274458delTAATAC	ENST00000294725.9	-	22	3416_3421	c.2501_2506delGTATTA	c.(2500-2508)agtattatc>atc	p.SI834del	KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000609185.1_In_Frame_Del_p.SI760del|KCNT2_ENST00000367431.4_In_Frame_Del_p.SI760del|KCNT2_ENST00000367433.5_In_Frame_Del_p.SI810del|KCNT2_ENST00000498426.1_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	834					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AGCTCTGTGATAATACTGAGACTGGA	0.364																																					p.834_836del		.											.	KCNT2	159	0			c.2501_2506del						.																																			SO:0001651	inframe_deletion	343450	exon22			CTGTGATAATACT	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2501_2506delGTATTA	1.37:g.196274453_196274458delTAATAC	ENSP00000294725:p.Ser834_Ile835del	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	17.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	In_Frame_Del	DEL	ENST00000294725.9	37	CCDS1384.1																																																																																			.		0.364	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
KRCC1	51315	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	88327723	88327723	+	Silent	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr2:88327723A>G	ENST00000347055.3	-	4	753	c.360T>C	c.(358-360)ttT>ttC	p.F120F		NM_016618.1	NP_057702.1	Q9NPI7	KRCC1_HUMAN	lysine-rich coiled-coil 1	120										cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	7						CTTGTTGATTAAAGTTCAGGG	0.433																																					p.F120F		.											.	KRCC1	69	0			c.T360C						.						110.0	113.0	112.0					2																	88327723		2203	4300	6503	SO:0001819	synonymous_variant	51315	exon4			TTGATTAAAGTTC	AF208845	CCDS2000.1	2p11.2	2008-02-05			ENSG00000172086	ENSG00000172086			28039	protein-coding gene	gene with protein product						12477932	Standard	XM_005264360		Approved	FLJ22333	uc002sso.1	Q9NPI7	OTTHUMG00000130315	ENST00000347055.3:c.360T>C	2.37:g.88327723A>G		Somatic	348.0	1.0		WXS	Illumina HiSeq	Phase_I	497.0	135.0	NM_016618	Q3B7J7	Silent	SNP	ENST00000347055.3	37	CCDS2000.1																																																																																			.		0.433	KRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252664.1	NM_016618	
LNPEP	4012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	96358073	96358073	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:96358073A>G	ENST00000231368.5	+	14	3138	c.2446A>G	c.(2446-2448)Atg>Gtg	p.M816V	LNPEP_ENST00000395770.3_Missense_Mutation_p.M802V	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	816					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CACTCCATCTATGCGAGAGCT	0.438																																					p.M816V		.											.	LNPEP	229	0			c.A2446G						.						102.0	96.0	98.0					5																	96358073		2203	4300	6503	SO:0001583	missense	4012	exon14			CCATCTATGCGAG	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.2446A>G	5.37:g.96358073A>G	ENSP00000231368:p.Met816Val	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	54.0	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	37	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.777424	0.31411	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.05025	3.51;3.51	5.9	-5.49	0.02584	.	0.693069	0.16311	N	0.220005	T	0.03564	0.0102	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25047	-1.0143	10	0.51188	T	0.08	.	17.7054	0.88308	0.2421:0.0:0.7579:0.0	.	816	Q9UIQ6	LCAP_HUMAN	V	816;802	ENSP00000231368:M816V;ENSP00000379117:M802V	ENSP00000231368:M816V	M	+	1	0	LNPEP	96383829	0.009000	0.17119	0.009000	0.14445	0.796000	0.44982	-0.148000	0.10219	-1.068000	0.03156	-0.256000	0.11100	ATG	.		0.438	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
MAGEC1	9947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	140993326	140993326	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chrX:140993326G>C	ENST00000285879.4	+	4	422	c.136G>C	c.(136-138)Gac>Cac	p.D46H	MAGEC1_ENST00000406005.2_5'UTR	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	46										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TGAGAGCGACGACACCCTGTA	0.587										HNSCC(15;0.026)																											p.D46H		.											.	MAGEC1	133	0			c.G136C						.						86.0	88.0	87.0					X																	140993326		2203	4300	6503	SO:0001583	missense	9947	exon4			AGCGACGACACCC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.136G>C	X.37:g.140993326G>C	ENSP00000285879:p.Asp46His	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	24.0	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	g	9.828	1.187711	0.21954	.	.	ENSG00000155495	ENST00000285879	T	0.03330	3.97	0.131	0.131	0.14755	.	.	.	.	.	T	0.02929	0.0087	N	0.08118	0	0.18873	N	0.999989	D	0.55605	0.972	P	0.48815	0.591	T	0.47674	-0.9099	9	0.87932	D	0	.	5.9545	0.19265	6.0E-4:0.0:0.9994:0.0	.	46	O60732	MAGC1_HUMAN	H	46	ENSP00000285879:D46H	ENSP00000285879:D46H	D	+	1	0	MAGEC1	140820992	0.002000	0.14202	0.008000	0.14137	0.008000	0.06430	0.141000	0.16076	0.157000	0.19338	0.158000	0.16466	GAC	.		0.587	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MFSD2B	388931	ucsc.edu;bcgsc.ca	37	2	24247135	24247135	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr2:24247135T>C	ENST00000406420.3	+	13	1500	c.1484T>C	c.(1483-1485)cTt>cCt	p.L495P	MFSD2B_ENST00000338315.4_Missense_Mutation_p.L495P	NM_001080473.1	NP_001073942.1	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing 2B	495					transport (GO:0006810)	integral component of membrane (GO:0016021)				cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10						CGGCTGAGCCTTCGGAGGTAA	0.657																																					p.L495P		.											.	MFSD2B	24	0			c.T1484C						.						23.0	26.0	25.0					2																	24247135		2033	4175	6208	SO:0001583	missense	388931	exon13			TGAGCCTTCGGAG		CCDS46228.1	2p23.3	2010-05-11			ENSG00000205639	ENSG00000205639			37207	protein-coding gene	gene with protein product						18694395	Standard	NM_001080473		Approved		uc002reo.2	A6NFX1	OTTHUMG00000090819	ENST00000406420.3:c.1484T>C	2.37:g.24247135T>C	ENSP00000385527:p.Leu495Pro	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	65.0	6.0	NM_001080473	B5MC32	Missense_Mutation	SNP	ENST00000406420.3	37	CCDS46228.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.381996	0.42207	.	.	ENSG00000205639	ENST00000406420;ENST00000338315	T;T	0.21734	2.06;1.99	4.97	4.97	0.65823	.	0.454051	0.17659	U	0.166404	T	0.30135	0.0755	L	0.47190	1.495	0.53688	D	0.999973	D	0.58970	0.984	P	0.55161	0.77	T	0.01202	-1.1420	10	0.30078	T	0.28	0.0069	11.3496	0.49579	0.0:0.0:0.0:1.0	.	495	A6NFX1	MFS2B_HUMAN	P	495	ENSP00000385527:L495P;ENSP00000342501:L495P	ENSP00000342501:L495P	L	+	2	0	MFSD2B	24100639	0.025000	0.19082	0.950000	0.38849	0.289000	0.27227	0.766000	0.26560	2.024000	0.59613	0.379000	0.24179	CTT	.		0.657	MFSD2B-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000324307.1	NM_001080473	
MICAL1	64780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	109768571	109768571	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr6:109768571G>A	ENST00000358807.3	-	16	2370	c.2059C>T	c.(2059-2061)Caa>Taa	p.Q687*	MICAL1_ENST00000358577.3_Nonsense_Mutation_p.Q601*|MICAL1_ENST00000368952.4_Nonsense_Mutation_p.Q706*	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	687					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		TCCTGGTGTTGGGATGGGGGT	0.627																																					p.Q687X		.											.	MICAL1	154	0			c.C2059T						.						65.0	65.0	65.0					6																	109768571		2203	4300	6503	SO:0001587	stop_gained	64780	exon16			GGTGTTGGGATGG	AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2059C>T	6.37:g.109768571G>A	ENSP00000351664:p.Gln687*	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	13.0	NM_022765	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Nonsense_Mutation	SNP	ENST00000358807.3	37	CCDS5076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.683992|5.683992	0.96774|0.96774	.|.	.|.	ENSG00000135596|ENSG00000135596	ENST00000433205|ENST00000358807;ENST00000368952;ENST00000358577;ENST00000368957	.|.	.|.	.|.	4.93|4.93	1.88|1.88	0.25563|0.25563	.|.	.|1.121610	.|0.06568	.|N	.|0.747923	T|.	0.10551|.	0.0258|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.08106|.	-1.0738|.	3|.	.|0.06494	.|T	.|0.89	.|.	12.4069|12.4069	0.55445|0.55445	0.0:0.5319:0.4681:0.0|0.0:0.5319:0.4681:0.0	.|.	.|.	.|.	.|.	L|X	248|687;706;601;211	.|.	.|ENSP00000351385:Q601X	P|Q	-|-	2|1	0|0	MICAL1|MICAL1	109875264|109875264	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.619000|0.619000	0.37552|0.37552	-0.164000|-0.164000	0.09983|0.09983	0.733000|0.733000	0.32492|0.32492	0.655000|0.655000	0.94253|0.94253	CCA|CAA	.		0.627	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
MLXIPL	51085	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73020297	73020297	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr7:73020297T>C	ENST00000313375.3	-	6	810	c.763A>G	c.(763-765)Act>Gct	p.T255A	MLXIPL_ENST00000434326.1_Intron|MLXIPL_ENST00000414749.2_Missense_Mutation_p.T255A|MLXIPL_ENST00000395189.1_Intron|MLXIPL_ENST00000354613.1_Missense_Mutation_p.T255A|MLXIPL_ENST00000429400.2_Missense_Mutation_p.T255A	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	255					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				GTGAAGAGAGTGTCTGAGATG	0.632																																					p.T255A		.											.	MLXIPL	91	0			c.A763G						.						38.0	35.0	36.0					7																	73020297		2201	4300	6501	SO:0001583	missense	51085	exon6			AGAGAGTGTCTGA	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.763A>G	7.37:g.73020297T>C	ENSP00000320886:p.Thr255Ala	Somatic	52.0	1.0		WXS	Illumina HiSeq	Phase_I	65.0	18.0	NM_032954	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	ENST00000313375.3	37	CCDS5553.1	.	.	.	.	.	.	.	.	.	.	T	12.39	1.922238	0.33908	.	.	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000456640	T;T;T;T;T	0.54279	1.64;1.68;1.64;1.68;0.58	3.62	2.46	0.29980	.	0.000000	0.64402	D	0.000001	T	0.66336	0.2779	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.61697	0.984;0.99;0.99;0.99	D;D;D;D	0.70935	0.935;0.971;0.971;0.971	T	0.64799	-0.6322	10	0.87932	D	0	-11.1533	5.4465	0.16537	0.0:0.1325:0.0:0.8675	.	255;255;255;255	Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	MLXPL_HUMAN;.;.;.	A	255;255;255;255;217	ENSP00000412330:T255A;ENSP00000406296:T255A;ENSP00000320886:T255A;ENSP00000346629:T255A;ENSP00000402615:T217A	ENSP00000320886:T255A	T	-	1	0	MLXIPL	72658233	1.000000	0.71417	0.714000	0.30535	0.641000	0.38312	6.406000	0.73276	0.468000	0.27243	0.260000	0.18958	ACT	.		0.632	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
MME	4311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	154886382	154886382	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr3:154886382A>C	ENST00000460393.1	+	19	2002	c.1882A>C	c.(1882-1884)Aac>Cac	p.N628H	MME_ENST00000493237.1_Missense_Mutation_p.N628H|MME_ENST00000360490.2_Missense_Mutation_p.N628H|MME_ENST00000492661.1_Missense_Mutation_p.N628H|MME-AS1_ENST00000484721.1_RNA|MME_ENST00000462745.1_Missense_Mutation_p.N628H	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	628					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	TCAGTATGGAAACTTTTCCTG	0.418																																					p.N628H		.											.	MME	516	0			c.A1882C						.						139.0	131.0	134.0					3																	154886382		2203	4300	6503	SO:0001583	missense	4311	exon19			TATGGAAACTTTT		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1882A>C	3.37:g.154886382A>C	ENSP00000418525:p.Asn628His	Somatic	235.0	0.0		WXS	Illumina HiSeq	Phase_I	393.0	100.0	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527222	0.85706	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	5.25	5.25	0.73442	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91546	0.7330	M	0.85197	2.74	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	D	0.92612	0.6100	10	0.59425	D	0.04	-23.7422	15.1817	0.72965	1.0:0.0:0.0:0.0	.	628	P08473	NEP_HUMAN	H	628	ENSP00000420389:N628H;ENSP00000418525:N628H;ENSP00000419653:N628H;ENSP00000417079:N628H;ENSP00000353679:N628H	ENSP00000353679:N628H	N	+	1	0	MME	156369076	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.196000	0.94978	1.988000	0.58038	0.528000	0.53228	AAC	.		0.418	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
MROH2B	133558	broad.mit.edu;bcgsc.ca	37	5	41065590	41065590	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:41065590C>A	ENST00000399564.4	-	4	654	c.204G>T	c.(202-204)atG>atT	p.M68I		NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	68																	TTTCTCTGAGCATCTGAGGAG	0.378																																					p.M68I		.											.	.	.	0			c.G204T						.						73.0	66.0	68.0					5																	41065590		1875	4098	5973	SO:0001583	missense	133558	exon4			TCTGAGCATCTGA		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.204G>T	5.37:g.41065590C>A	ENSP00000382476:p.Met68Ile	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	7.0	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.272982	0.23221	.	.	ENSG00000171495	ENST00000399564	T	0.06218	3.33	5.62	-5.64	0.02466	Armadillo-type fold (1);	0.865656	0.10130	N	0.712210	T	0.01489	0.0048	N	0.00436	-1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50541	-0.8816	10	0.26408	T	0.33	.	9.5569	0.39343	0.1331:0.478:0.3889:0.0	.	68	Q7Z745	HTRB2_HUMAN	I	68	ENSP00000382476:M68I	ENSP00000382476:M68I	M	-	3	0	HEATR7B2	41101347	0.000000	0.05858	0.470000	0.27216	0.639000	0.38242	-1.096000	0.03353	-0.557000	0.06126	-0.275000	0.10095	ATG	.		0.378	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
MROH2B	133558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	41065451	41065451	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:41065451C>T	ENST00000399564.4	-	4	793	c.343G>A	c.(343-345)Gaa>Aaa	p.E115K		NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	115																	GTTGCCAATTCAGCCAGGGCA	0.418																																					p.E115K		.											.	.	.	0			c.G343A						.						64.0	60.0	61.0					5																	41065451		1899	4119	6018	SO:0001583	missense	133558	exon4			CCAATTCAGCCAG		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.343G>A	5.37:g.41065451C>T	ENSP00000382476:p.Glu115Lys	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	10.0	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.466823	0.43839	.	.	ENSG00000171495	ENST00000399564	T	0.04194	3.68	6.16	6.16	0.99307	Armadillo-type fold (1);	0.000000	0.56097	D	0.000024	T	0.09992	0.0245	N	0.25286	0.73	0.37279	D	0.90774	D	0.69078	0.997	D	0.64042	0.921	T	0.47262	-0.9131	10	0.15952	T	0.53	.	16.3599	0.83257	0.0:1.0:0.0:0.0	.	115	Q7Z745	HTRB2_HUMAN	K	115	ENSP00000382476:E115K	ENSP00000382476:E115K	E	-	1	0	HEATR7B2	41101208	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.337000	0.43947	2.937000	0.99478	0.650000	0.86243	GAA	.		0.418	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
MROH2B	133558	broad.mit.edu;bcgsc.ca	37	5	41065593	41065593	+	Splice_Site	SNP	C	C	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:41065593C>G	ENST00000399564.4	-	4	652		c.e4-1			NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B																		CTCTGAGCATCTGAGGAGGAA	0.373																																					.		.											.	.	.	0			c.202-1G>C						.						70.0	63.0	65.0					5																	41065593		1867	4095	5962	SO:0001630	splice_region_variant	133558	exon5			GAGCATCTGAGGA		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.202-1G>C	5.37:g.41065593C>G		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	7.0	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Splice_Site	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114838	0.77210	.	.	ENSG00000171495	ENST00000399564	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5067	0.75745	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HEATR7B2	41101350	0.984000	0.35163	0.967000	0.41034	0.582000	0.36321	3.606000	0.54095	2.800000	0.96347	0.650000	0.86243	.	.		0.373	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	Intron
MRPS16	51021	broad.mit.edu;bcgsc.ca	37	10	75010748	75010748	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr10:75010748A>G	ENST00000372945.3	-	3	486	c.276T>C	c.(274-276)ggT>ggC	p.G92G	DNAJC9-AS1_ENST00000440197.2_RNA|DNAJC9_ENST00000372950.4_5'Flank|RP11-152N13.5_ENST00000457147.1_RNA|DNAJC9-AS1_ENST00000513954.1_RNA|RP11-152N13.5_ENST00000457758.1_RNA|RP11-152N13.5_ENST00000394864.2_RNA|MRPS16_ENST00000479005.1_5'UTR|MRPS16_ENST00000372940.3_Intron|TTC18_ENST00000493787.1_5'Flank|MRPS16_ENST00000416782.2_Intron	NM_016065.3	NP_057149.1	Q9Y3D3	RT16_HUMAN	mitochondrial ribosomal protein S16	92					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(2)	4	Prostate(51;0.0119)					AGCCAGCAAGACCTAAAAGTA	0.438																																					p.G92G		.											.	MRPS16	90	0			c.T276C						.						93.0	88.0	90.0					10																	75010748		2203	4300	6503	SO:0001630	splice_region_variant	51021	exon3			AGCAAGACCTAAA	AB051351	CCDS7323.1	10q22.1	2012-09-13			ENSG00000182180	ENSG00000182180		"""Mitochondrial ribosomal proteins / small subunits"""	14048	protein-coding gene	gene with protein product		609204				10810093	Standard	NM_016065		Approved	CGI-132	uc001jts.1	Q9Y3D3	OTTHUMG00000018454	ENST00000372945.3:c.275-1T>C	10.37:g.75010748A>G		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	8.0	NM_016065	B4E032|Q96Q60	Silent	SNP	ENST00000372945.3	37	CCDS7323.1																																																																																			.		0.438	MRPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048616.1		Silent
MYO6	4646	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	76596568	76596568	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr6:76596568G>A	ENST00000369977.3	+	25	2654	c.2515G>A	c.(2515-2517)Ggt>Agt	p.G839S	MYO6_ENST00000369975.1_Missense_Mutation_p.G839S|MYO6_ENST00000369981.3_Missense_Mutation_p.G839S|MYO6_ENST00000369985.4_Missense_Mutation_p.G839S	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	839					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CAGCATTGATGGTCTGGTTAA	0.328																																					p.G839S		.											.	MYO6	92	0			c.G2515A						.						76.0	81.0	79.0					6																	76596568		2203	4300	6503	SO:0001583	missense	4646	exon25			ATTGATGGTCTGG	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2515G>A	6.37:g.76596568G>A	ENSP00000358994:p.Gly839Ser	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	9.0	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	37	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890303	0.91889	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;D	0.88354	-2.33;-2.37;-2.35;-2.36	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.91660	0.7364	M	0.62266	1.93	0.80722	D	1	D;D	0.89917	0.959;1.0	P;D	0.83275	0.615;0.996	D	0.87098	0.2177	10	0.11485	T	0.65	.	20.3465	0.98790	0.0:0.0:1.0:0.0	.	839;839	Q9UM54-2;Q9UM54-1	.;.	S	839	ENSP00000358998:G839S;ENSP00000359002:G839S;ENSP00000358994:G839S;ENSP00000358992:G839S	ENSP00000358992:G839S	G	+	1	0	MYO6	76653288	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.378000	0.97191	2.798000	0.96311	0.655000	0.94253	GGT	.		0.328	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
NOS2	4843	ucsc.edu;bcgsc.ca	37	17	26106023	26106023	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:26106023A>G	ENST00000313735.6	-	10	1297	c.1064T>C	c.(1063-1065)aTg>aCg	p.M355T		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	355					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CTCAAGCAGCATGTTGGCCAC	0.572																																					p.M355T		.											.	NOS2	156	0			c.T1064C						.						66.0	64.0	64.0					17																	26106023		2203	4300	6503	SO:0001583	missense	4843	exon10			AGCAGCATGTTGG	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1064T>C	17.37:g.26106023A>G	ENSP00000327251:p.Met355Thr	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.386377	0.82902	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.27557	1.66	5.68	5.68	0.88126	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.85682	D	0.000000	T	0.69450	0.3112	H	0.96889	3.9	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.80841	-0.1202	10	0.87932	D	0	.	15.1191	0.72429	1.0:0.0:0.0:0.0	.	355;355	F8WEM3;P35228	.;NOS2_HUMAN	T	355;316;355	ENSP00000327251:M355T	ENSP00000305638:M355T	M	-	2	0	NOS2	23130150	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.339000	0.96797	2.167000	0.68274	0.459000	0.35465	ATG	.		0.572	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
NPFF	8620	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	53900573	53900573	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:53900573A>G	ENST00000267017.3	-	3	492	c.329T>C	c.(328-330)tTt>tCt	p.F110S	NPFF_ENST00000609999.1_Missense_Mutation_p.F113S|RP11-793H13.10_ENST00000591834.1_3'UTR	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor	110					acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						CTTCTTCCCAAAGCGTTGAGG	0.527																																					p.F110S		.											.	NPFF	90	0			c.T329C						.						100.0	96.0	98.0					12																	53900573		2203	4300	6503	SO:0001583	missense	8620	exon3			TTCCCAAAGCGTT	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856	ENST00000267017.3:c.329T>C	12.37:g.53900573A>G	ENSP00000267017:p.Phe110Ser	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	17.0	NM_003717	Q3SXL4	Missense_Mutation	SNP	ENST00000267017.3	37	CCDS8862.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.256940	0.80246	.	.	ENSG00000139574	ENST00000267017	T	0.66280	-0.2	4.59	4.59	0.56863	.	0.000000	0.64402	D	0.000001	T	0.75332	0.3835	M	0.72894	2.215	0.44409	D	0.997323	D	0.61080	0.989	D	0.63957	0.92	T	0.78964	-0.1996	10	0.87932	D	0	-1.7463	13.375	0.60732	1.0:0.0:0.0:0.0	.	110	O15130	NPFF_HUMAN	S	110	ENSP00000267017:F110S	ENSP00000267017:F110S	F	-	2	0	NPFF	52186840	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.617000	0.67716	2.057000	0.61298	0.402000	0.26972	TTT	.		0.527	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717	
NRXN1	9378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	50758388	50758388	+	Missense_Mutation	SNP	C	C	T	rs369744946		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr2:50758388C>T	ENST00000406316.2	-	11	3800	c.2324G>A	c.(2323-2325)cGt>cAt	p.R775H	NRXN1_ENST00000401669.2_Missense_Mutation_p.R775H|NRXN1_ENST00000406859.3_Missense_Mutation_p.R775H|NRXN1_ENST00000402717.3_Missense_Mutation_p.R767H|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000404971.1_Missense_Mutation_p.R815H|NRXN1_ENST00000405472.3_Missense_Mutation_p.R767H	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	775	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CAGTTTCACACGTCCTGCGTC	0.473																																					p.R815H		.											.	NRXN1	92	0			c.G2444A						.	C	HIS/ARG,HIS/ARG	1,4079		0,1,2039	68.0	72.0	71.0		2444,2324	5.8	1.0	2		71	0,8422		0,0,4211	no	missense,missense	NRXN1	NM_001135659.1,NM_004801.4	29,29	0,1,6250	TT,TC,CC		0.0,0.0245,0.0080	probably-damaging,probably-damaging	815/1548,775/1478	50758388	1,12501	2040	4211	6251	SO:0001583	missense	9378	exon12			TTCACACGTCCTG	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2324G>A	2.37:g.50758388C>T	ENSP00000384311:p.Arg775His	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	20.0	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	35	5.473955	0.96291	2.45E-4	0.0	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.88662	0.6497	M	0.80982	2.52	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.70935	0.966;0.867;0.971	D	0.86309	0.1685	10	0.35671	T	0.21	.	20.3316	0.98722	0.0:1.0:0.0:0.0	.	815;775;767	Q9ULB1-3;F8WB18;A7E294	.;.;.	H	815;775;767;775;816;767;775	ENSP00000385142:R815H;ENSP00000384311:R775H;ENSP00000434015:R767H;ENSP00000385017:R775H;ENSP00000385434:R767H;ENSP00000385681:R775H	ENSP00000385017:R775H	R	-	2	0	NRXN1	50611892	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	7.772000	0.85439	2.871000	0.98454	0.655000	0.94253	CGT	.		0.473	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
OR5B12	390191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58207461	58207461	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:58207461G>T	ENST00000302572.2	-	1	185	c.164C>A	c.(163-165)aCc>aAc	p.T55N		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTACATGGGGGTGTGGAGACA	0.488																																					p.T55N		.											.	OR5B12	68	0			c.C164A						.						65.0	70.0	69.0					11																	58207461		2201	4295	6496	SO:0001583	missense	390191	exon1			ATGGGGGTGTGGA	AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.164C>A	11.37:g.58207461G>T	ENSP00000306657:p.Thr55Asn	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	47.0	NM_001004733	B2RNL2|Q6IEV5	Missense_Mutation	SNP	ENST00000302572.2	37	CCDS31551.1	.	.	.	.	.	.	.	.	.	.	G	3.547	-0.092466	0.07053	.	.	ENSG00000172362	ENST00000302572	T	0.00478	7.13	4.61	2.71	0.32032	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45126	D	0.000386	T	0.00608	0.0020	M	0.87456	2.885	0.09310	N	0.999996	B	0.21225	0.053	B	0.24394	0.053	T	0.41378	-0.9512	10	0.56958	D	0.05	-5.6865	5.8948	0.18933	0.078:0.1357:0.6461:0.1402	.	55	Q96R08	OR5BC_HUMAN	N	55	ENSP00000306657:T55N	ENSP00000306657:T55N	T	-	2	0	OR5B12	57964037	0.001000	0.12720	0.422000	0.26621	0.035000	0.12851	-0.061000	0.11693	0.660000	0.30964	0.462000	0.41574	ACC	.		0.488	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394987.1	NM_001004733	
OSGIN2	734	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	90937753	90937753	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr8:90937753T>C	ENST00000297438.2	+	6	1866	c.1511T>C	c.(1510-1512)aTa>aCa	p.I504T	OSGIN2_ENST00000451899.2_Missense_Mutation_p.I548T	NM_004337.2	NP_004328.1	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family member 2	504					meiotic nuclear division (GO:0007126)					breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(1)	17			BRCA - Breast invasive adenocarcinoma(11;0.0344)			GGAGATGGGATAGCTTAAAGC	0.383																																					p.I548T		.											.	OSGIN2	68	0			c.T1643C						.						46.0	44.0	44.0					8																	90937753		2203	4300	6503	SO:0001583	missense	734	exon6			ATGGGATAGCTTA	AF061326	CCDS6248.1, CCDS47888.1	8q21	2006-10-05	2006-10-05	2006-10-05	ENSG00000164823	ENSG00000164823			1355	protein-coding gene	gene with protein product		604598	"""chromosome 8 open reading frame 1"""	C8orf1		9933573	Standard	NM_004337		Approved	hT41	uc003yeh.3	Q9Y236	OTTHUMG00000163811	ENST00000297438.2:c.1511T>C	8.37:g.90937753T>C	ENSP00000297438:p.Ile504Thr	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	218.0	126.0	NM_001126111		Missense_Mutation	SNP	ENST00000297438.2	37	CCDS6248.1	.	.	.	.	.	.	.	.	.	.	T	12.92	2.083021	0.36758	.	.	ENSG00000164823	ENST00000297438;ENST00000451899	T;T	0.24908	1.86;1.83	5.79	5.79	0.91817	.	0.566107	0.20520	N	0.090702	T	0.16214	0.0390	N	0.08118	0	0.80722	D	1	B;B	0.26845	0.161;0.041	B;B	0.21151	0.033;0.01	T	0.07616	-1.0763	10	0.72032	D	0.01	-6.7707	16.1325	0.81454	0.0:0.0:0.0:1.0	.	548;504	Q9Y236-2;Q9Y236	.;OSGI2_HUMAN	T	504;548	ENSP00000297438:I504T;ENSP00000396445:I548T	ENSP00000297438:I504T	I	+	2	0	OSGIN2	91006928	0.997000	0.39634	0.986000	0.45419	0.953000	0.61014	6.574000	0.74014	2.219000	0.72066	0.460000	0.39030	ATA	.		0.383	OSGIN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375691.1	NM_004337	
PAX1	5075	broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	21687580	21687580	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr20:21687580G>A	ENST00000398485.2	+	2	845	c.791G>A	c.(790-792)gGc>gAc	p.G264D	PAX1_ENST00000444366.2_Missense_Mutation_p.G240D|PAX1_ENST00000460221.1_3'UTR	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	264					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						TCGCCCACGGGCGCCAAGATG	0.697																																					p.G264D		.											.	PAX1	227	0			c.G791A						.						23.0	28.0	26.0					20																	21687580		2202	4297	6499	SO:0001583	missense	5075	exon2			CCACGGGCGCCAA		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.791G>A	20.37:g.21687580G>A	ENSP00000381499:p.Gly264Asp	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	5.0	NM_006192	B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974304	0.74246	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.98362	-4.4;-4.89	5.32	4.37	0.52481	.	0.264062	0.37483	N	0.002074	D	0.98391	0.9465	M	0.68952	2.095	0.38269	D	0.942109	P;P;D	0.76494	0.936;0.704;0.999	P;B;P	0.61874	0.738;0.213;0.895	D	0.99926	1.1285	10	0.72032	D	0.01	.	14.4776	0.67557	0.0:0.448:0.552:0.0	.	240;170;264	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	D	264;240	ENSP00000381499:G264D;ENSP00000410355:G240D	ENSP00000381499:G264D	G	+	2	0	PAX1	21635580	0.952000	0.32445	0.856000	0.33681	0.876000	0.50452	2.010000	0.40913	1.233000	0.43693	0.561000	0.74099	GGC	.		0.697	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3		
PCDH11Y	83259	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	Y	4968285	4968285	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chrY:4968285C>A	ENST00000333703.4	+	5	3146	c.2633C>A	c.(2632-2634)cCa>cAa	p.P878Q	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.P889Q|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.P889Q	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	889					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TGGGCTACCCCAAACCCAGAA	0.413																																					p.P889Q		.											.	.	.	0			c.C2666A						.						39.0	36.0	36.0					Y																	4968285		616	1950	2566	SO:0001583	missense	83259	exon2			CTACCCCAAACCC	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.2633C>A	Y.37:g.4968285C>A	ENSP00000330552:p.Pro878Gln	Somatic	258.0	0.0		WXS	Illumina HiSeq	Phase_I	484.0	120.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	CCDS14776.1																																																																																			.		0.413	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
PER2	8864	broad.mit.edu;bcgsc.ca	37	2	239155099	239155099	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr2:239155099A>G	ENST00000254657.3	-	23	3964	c.3685T>C	c.(3685-3687)Tct>Cct	p.S1229P	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	1229	CRY binding domain. {ECO:0000250|UniProtKB:Q9Z301}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		AGTCCCAGAGAAGGAATATCT	0.413																																					p.S1229P		.											.	PER2	154	0			c.T3685C						.						98.0	84.0	88.0					2																	239155099		2203	4300	6503	SO:0001583	missense	8864	exon23			CCAGAGAAGGAAT	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.3685T>C	2.37:g.239155099A>G	ENSP00000254657:p.Ser1229Pro	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	6.0	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.565498	0.45694	.	.	ENSG00000132326	ENST00000254657	T	0.15017	2.46	5.03	-9.02	0.00741	Period circadian-like, C-terminal (1);	1.759790	0.03892	N	0.278857	T	0.07683	0.0193	N	0.19112	0.55	0.26117	N	0.980606	B	0.02656	0.0	B	0.04013	0.001	T	0.24584	-1.0156	10	0.33940	T	0.23	-2.1579	1.8826	0.03231	0.2729:0.3045:0.3052:0.1174	.	1229	O15055	PER2_HUMAN	P	1229	ENSP00000254657:S1229P	ENSP00000254657:S1229P	S	-	1	0	PER2	238819838	0.000000	0.05858	0.001000	0.08648	0.664000	0.39144	-0.988000	0.03739	-1.262000	0.02459	0.533000	0.62120	TCT	.		0.413	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
PHF21B	112885	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	45289355	45289355	+	Silent	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr22:45289355G>A	ENST00000313237.5	-	7	1092	c.942C>T	c.(940-942)agC>agT	p.S314S	PHF21B_ENST00000447824.3_Silent_p.S260S|PHF21B_ENST00000404079.2_Silent_p.S260S|PHF21B_ENST00000403565.1_Silent_p.S110S|PHF21B_ENST00000396103.3_Silent_p.S272S	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	314							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		CCAGGAGGCCGCTGTAGGCAG	0.642																																					p.S314S		.											.	PHF21B	93	0			c.C942T						.						106.0	80.0	89.0					22																	45289355		2203	4299	6502	SO:0001819	synonymous_variant	112885	exon7			GAGGCCGCTGTAG	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.942C>T	22.37:g.45289355G>A		Somatic	139.0	2.0		WXS	Illumina HiSeq	Phase_I	195.0	36.0	NM_138415	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Silent	SNP	ENST00000313237.5	37	CCDS14061.1																																																																																			.		0.642	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415	
RASGRP2	10235	ucsc.edu;bcgsc.ca	37	11	64496440	64496440	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:64496440T>C	ENST00000354024.3	-	15	1918	c.1666A>G	c.(1666-1668)Agc>Ggc	p.S556G	RASGRP2_ENST00000394432.3_Missense_Mutation_p.S556G|RASGRP2_ENST00000377497.3_Missense_Mutation_p.S556G|RASGRP2_ENST00000377494.1_Missense_Mutation_p.S556G	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	556					blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCCTCCAGGCTCACACTCTGG	0.652																																					p.S556G		.											.	RASGRP2	227	0			c.A1666G						.						75.0	57.0	63.0					11																	64496440		2201	4297	6498	SO:0001583	missense	10235	exon15			CCAGGCTCACACT	U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.1666A>G	11.37:g.64496440T>C	ENSP00000338864:p.Ser556Gly	Somatic	36.0	1.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_001098671	A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	ENST00000354024.3	37	CCDS31598.1	.	.	.	.	.	.	.	.	.	.	T	13.84	2.356510	0.41700	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024	T;T;T;T	0.73363	-0.73;-0.74;-0.74;-0.74	4.17	4.17	0.49024	.	0.125985	0.48767	D	0.000179	T	0.73814	0.3635	L	0.27053	0.805	0.80722	D	1	P;D	0.63880	0.9;0.993	B;D	0.65443	0.337;0.935	T	0.68985	-0.5265	10	0.18710	T	0.47	-4.2572	11.8309	0.52295	0.0:0.0:0.0:1.0	.	556;556	Q7LDG7;A6NDC7	GRP2_HUMAN;.	G	556	ENSP00000366714:S556G;ENSP00000377953:S556G;ENSP00000366717:S556G;ENSP00000338864:S556G	ENSP00000338864:S556G	S	-	1	0	RASGRP2	64253016	1.000000	0.71417	0.992000	0.48379	0.829000	0.46940	4.370000	0.59517	1.835000	0.53391	0.533000	0.62120	AGC	.		0.652	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142062.1	NM_153819	
RBM46	166863	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155719372	155719372	+	Silent	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr4:155719372A>G	ENST00000281722.3	+	3	796	c.561A>G	c.(559-561)gcA>gcG	p.A187A	RBM46_ENST00000510397.1_Silent_p.A187A|RBM46_ENST00000514866.1_Silent_p.A187A	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	187	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				GTGGTTTTGCATTTGTGGAAT	0.333																																					p.A187A		.											.	RBM46	69	0			c.A561G						.						60.0	58.0	59.0					4																	155719372		2203	4295	6498	SO:0001819	synonymous_variant	166863	exon3			TTTTGCATTTGTG	BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.561A>G	4.37:g.155719372A>G		Somatic	192.0	2.0		WXS	Illumina HiSeq	Phase_I	219.0	43.0	NM_144979	B3KWU8|B4DZ27	Silent	SNP	ENST00000281722.3	37	CCDS3790.1																																																																																			.		0.333	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365259.1	NM_144979	
RBM48	84060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92158153	92158153	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr7:92158153G>T	ENST00000265732.5	+	1	67	c.26G>T	c.(25-27)gGg>gTg	p.G9V	PEX1_ENST00000248633.4_5'Flank|PEX1_ENST00000438045.1_5'Flank|RBM48_ENST00000481551.1_Missense_Mutation_p.G9V|PEX1_ENST00000428214.1_5'Flank	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48	9						nucleus (GO:0005634)	RNA binding (GO:0003723)										GGGGAGCTAGGGAGTTTATTT	0.557																																					p.G9V		.											.	.	.	0			c.G26T						.						69.0	74.0	72.0					7																	92158153		1983	4138	6121	SO:0001583	missense	84060	exon1			AGCTAGGGAGTTT	AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.26G>T	7.37:g.92158153G>T	ENSP00000265732:p.Gly9Val	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	46.0	NM_032120	B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Missense_Mutation	SNP	ENST00000265732.5	37	CCDS43615.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016717	0.54468	.	.	ENSG00000127993	ENST00000509224;ENST00000265732;ENST00000481551;ENST00000450580	.	.	.	4.77	4.77	0.60923	.	0.223472	0.47455	D	0.000224	T	0.53642	0.1809	L	0.48362	1.52	0.38410	D	0.945893	B;D;P	0.62365	0.261;0.991;0.894	B;P;B	0.50192	0.042;0.634;0.314	T	0.57579	-0.7787	9	0.45353	T	0.12	-1.3684	13.3215	0.60436	0.0:0.0:0.8421:0.1579	.	9;9;9	B4DGJ6;B7Z2K5;Q5RL73	.;.;CG064_HUMAN	V	11;9;9;9	.	ENSP00000265732:G9V	G	+	2	0	C7orf64	91996089	1.000000	0.71417	0.121000	0.21740	0.009000	0.06853	5.556000	0.67307	2.631000	0.89168	0.561000	0.74099	GGG	.		0.557	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356076.1	NM_032120	
CLSTN3	9746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7281340	7281340	+	5'Flank	SNP	A	A	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:7281340A>T	ENST00000266546.6	+	0	0				RBP5_ENST00000266560.3_Missense_Mutation_p.F11Y|RBP5_ENST00000542370.1_Missense_Mutation_p.F11Y|RP11-273B20.1_ENST00000538062.1_RNA|RP11-273B20.1_ENST00000544657.1_RNA	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CTGCGAGACAAAGCGGTAGTA	0.562																																					p.F11Y		.											.	RBP5	91	0			c.T32A						.						127.0	99.0	109.0					12																	7281340		2203	4300	6503	SO:0001631	upstream_gene_variant	83758	exon1			GAGACAAAGCGGT	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7281340A>T	Exception_encountered	Somatic	223.0	0.0		WXS	Illumina HiSeq	Phase_I	296.0	73.0	NM_031491	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	37	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	A	13.18	2.161222	0.38119	.	.	ENSG00000139194	ENST00000266560;ENST00000542370	T;T	0.22134	1.97;1.97	2.86	2.86	0.33363	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.329652	0.35067	N	0.003464	T	0.25494	0.0620	M	0.71581	2.175	0.45439	D	0.998415	P	0.46457	0.878	B	0.41946	0.371	T	0.23440	-1.0188	10	0.87932	D	0	.	11.8957	0.52656	1.0:0.0:0.0:0.0	.	11	P82980	RET5_HUMAN	Y	11	ENSP00000266560:F11Y;ENSP00000438083:F11Y	ENSP00000266560:F11Y	F	-	2	0	RBP5	7172607	1.000000	0.71417	0.997000	0.53966	0.871000	0.50021	2.915000	0.48805	1.549000	0.49425	0.402000	0.26972	TTT	.		0.562	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
SARS2	54938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39408640	39408640	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr19:39408640C>A	ENST00000221431.6	-	11	1130	c.971G>T	c.(970-972)tGc>tTc	p.C324F	SARS2_ENST00000430193.3_Missense_Mutation_p.C324F|SARS2_ENST00000598831.1_5'Flank|CTC-360G5.8_ENST00000599996.1_Missense_Mutation_p.L393F|SARS2_ENST00000448145.2_Missense_Mutation_p.C324F|SARS2_ENST00000594171.1_Missense_Mutation_p.C134F|SARS2_ENST00000600042.1_Missense_Mutation_p.C326F	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	324					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGTGCTGGAGCAAACCATCCT	0.572																																					p.C326F		.											.	SARS2	93	0			c.G977T						.						112.0	85.0	94.0					19																	39408640		2203	4300	6503	SO:0001583	missense	54938	exon12			CTGGAGCAAACCA	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.971G>T	19.37:g.39408640C>A	ENSP00000221431:p.Cys324Phe	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	190.0	60.0	NM_001145901	A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	37	CCDS33017.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.088615	0.76756	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000448145	T;T	0.76316	-1.01;-1.01	4.88	4.88	0.63580	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.85712	0.5760	M	0.67953	2.075	.	.	.	D;D;D;D	0.76494	0.999;0.996;0.999;0.979	D;P;D;P	0.65010	0.931;0.875;0.931;0.77	D	0.88857	0.3323	9	0.87932	D	0	.	15.5397	0.76031	0.0:1.0:0.0:0.0	.	324;326;324;324	E7EX87;B4DE10;B4DXB9;Q9NP81	.;.;.;SYSM_HUMAN	F	326;324;324	ENSP00000221431:C324F;ENSP00000399330:C324F	ENSP00000221431:C324F	C	-	2	0	FBXO17	44100480	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.079000	0.76829	2.263000	0.75096	0.424000	0.28305	TGC	.		0.572	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
SBNO1	55206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123825580	123825580	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:123825580T>G	ENST00000602398.1	-	5	733	c.606A>C	c.(604-606)agA>agC	p.R202S	SBNO1_ENST00000267176.4_Missense_Mutation_p.R201S|SBNO1_ENST00000420886.2_Missense_Mutation_p.R202S|SBNO1_ENST00000602750.1_Missense_Mutation_p.R201S			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	202					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TTATCCACATTCTAGCTCCTT	0.353																																					p.R202S		.											.	SBNO1	292	0			c.A606C						.						146.0	138.0	141.0					12																	123825580		2203	4300	6503	SO:0001583	missense	55206	exon4			CCACATTCTAGCT	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.606A>C	12.37:g.123825580T>G	ENSP00000473665:p.Arg202Ser	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	66.0	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	T	19.42	3.823596	0.71143	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.33654	1.4;1.4	5.49	3.13	0.36017	.	0.000000	0.85682	D	0.000000	T	0.46288	0.1385	L	0.51422	1.61	0.47659	D	0.999484	D;D;D	0.61697	0.981;0.99;0.981	D;P;D	0.69824	0.966;0.852;0.943	T	0.26121	-1.0112	10	0.23302	T	0.38	-29.2449	7.7316	0.28789	0.0:0.2345:0.0:0.7655	.	202;201;200	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	S	202;201;201	ENSP00000387361:R202S;ENSP00000267176:R201S	ENSP00000267176:R201S	R	-	3	2	SBNO1	122391533	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	0.538000	0.23160	0.391000	0.25143	0.459000	0.35465	AGA	.		0.353	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
SEMG2	6407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43851219	43851219	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr20:43851219A>T	ENST00000372769.3	+	2	1036	c.946A>T	c.(946-948)Atc>Ttc	p.I316F		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	316	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				CAGCATTTCTATCCAAACTGA	0.373																																					p.I316F		.											.	SEMG2	91	0			c.A946T						.						84.0	78.0	80.0					20																	43851219		2203	4300	6503	SO:0001583	missense	6407	exon2			ATTTCTATCCAAA		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.946A>T	20.37:g.43851219A>T	ENSP00000361855:p.Ile316Phe	Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	257.0	64.0	NM_003008	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	A	11.31	1.600133	0.28534	.	.	ENSG00000124157	ENST00000372769	T	0.06933	3.24	1.2	1.2	0.21068	.	.	.	.	.	T	0.09512	0.0234	L	0.39898	1.24	0.09310	N	1	P;P;P	0.37122	0.553;0.583;0.583	B;B;B	0.43916	0.436;0.36;0.36	T	0.29701	-1.0003	9	0.62326	D	0.03	.	4.5711	0.12210	1.0:0.0:0.0:0.0	.	316;316;316	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	F	316	ENSP00000361855:I316F	ENSP00000361855:I316F	I	+	1	0	SEMG2	43284633	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	0.359000	0.20233	0.799000	0.34018	0.338000	0.21704	ATC	.		0.373	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008	
SERPINH1	871	broad.mit.edu;bcgsc.ca	37	11	75279857	75279857	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:75279857T>C	ENST00000524558.1	+	3	2139	c.704T>C	c.(703-705)aTg>aCg	p.M235T	SERPINH1_ENST00000530284.1_Missense_Mutation_p.M235T|SERPINH1_ENST00000525876.1_Missense_Mutation_p.M18T|SERPINH1_ENST00000358171.3_Missense_Mutation_p.M235T|SERPINH1_ENST00000533603.1_Missense_Mutation_p.M235T			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	235				M -> T (in Ref. 1; CAA43795). {ECO:0000305}.	chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					GTGGGTGTCATGATGATGCAC	0.572																																					p.M235T		.											.	SERPINH1	228	0			c.T704C						.						149.0	111.0	124.0					11																	75279857		2200	4293	6493	SO:0001583	missense	871	exon4			GTGTCATGATGAT	X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.704T>C	11.37:g.75279857T>C	ENSP00000434412:p.Met235Thr	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	7.0	NM_001207014	B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Missense_Mutation	SNP	ENST00000524558.1	37	CCDS8239.1	.	.	.	.	.	.	.	.	.	.	T	11.95	1.791284	0.31685	.	.	ENSG00000149257	ENST00000533603;ENST00000358171;ENST00000526397;ENST00000421448;ENST00000530284;ENST00000532356;ENST00000524558;ENST00000525611;ENST00000525876	D;D;D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	5.71	4.78	0.61160	Serpin domain (3);	0.408600	0.28790	N	0.014139	T	0.73690	0.3619	N	0.08118	0	0.09310	N	0.999998	B;B	0.24651	0.108;0.061	B;B	0.27796	0.083;0.039	T	0.61686	-0.7012	10	0.27082	T	0.32	.	10.064	0.42292	0.0:0.8961:0.0:0.1039	rs2229782	235;235	E9PPV6;P50454	.;SERPH_HUMAN	T	235;235;235;214;235;235;235;235;18	ENSP00000434657:M235T;ENSP00000350894:M235T;ENSP00000434964:M235T;ENSP00000436305:M235T;ENSP00000436040:M235T;ENSP00000434412:M235T;ENSP00000435452:M235T;ENSP00000433532:M18T	ENSP00000350894:M235T	M	+	2	0	SERPINH1	74957505	0.816000	0.29132	0.910000	0.35882	0.997000	0.91878	3.726000	0.54977	1.327000	0.45338	0.533000	0.62120	ATG	.		0.572	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383610.1	NM_004353	
SETD2	29072	broad.mit.edu;bcgsc.ca	37	3	47163442	47163442	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr3:47163442A>G	ENST00000409792.3	-	3	2726	c.2684T>C	c.(2683-2685)cTa>cCa	p.L895P		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	895					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CAAGAGAGTTAGACTGTCCAC	0.388			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.L895P		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	1273	0			c.T2684C						.						95.0	99.0	98.0					3																	47163442		2203	4300	6503	SO:0001583	missense	29072	exon3			AGAGTTAGACTGT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.2684T>C	3.37:g.47163442A>G	ENSP00000386759:p.Leu895Pro	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	7.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	A	5.211	0.224384	0.09863	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.89196	-2.48;1.42	4.39	3.22	0.36961	.	0.446573	0.16365	N	0.217599	T	0.69142	0.3078	N	0.02539	-0.55	0.26064	N	0.981318	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.58312	-0.7658	10	0.56958	D	0.05	.	1.907	0.03279	0.5608:0.0:0.1721:0.2671	.	895;895	F2Z317;Q9BYW2	.;SETD2_HUMAN	P	895;895;895;851	ENSP00000386759:L895P;ENSP00000416401:L851P	ENSP00000386759:L895P	L	-	2	0	SETD2	47138446	0.036000	0.19791	0.989000	0.46669	0.880000	0.50808	1.285000	0.33261	1.831000	0.53308	0.533000	0.62120	CTA	.		0.388	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SHROOM3	57619	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	77677614	77677618	+	Frame_Shift_Del	DEL	TTCTA	TTCTA	-	rs139635179	byFrequency	TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	TTCTA	TTCTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr4:77677614_77677618delTTCTA	ENST00000296043.6	+	8	5675_5679	c.4722_4726delTTCTA	c.(4720-4728)ctttctaaafs	p.SK1575fs	RP11-359D14.3_ENST00000449007.1_RNA|RP11-359D14.2_ENST00000452412.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1575					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TCAACAAACTTTCTAAAGTGACAAT	0.424																																					p.1574_1576del		.											.	SHROOM3	93	0			c.4722_4726del						.																																			SO:0001589	frameshift_variant	57619	exon8			CAAACTTTCTAAA	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.4722_4726delTTCTA	4.37:g.77677614_77677618delTTCTA	ENSP00000296043:p.Ser1575fs	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	19.0	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Frame_Shift_Del	DEL	ENST00000296043.6	37	CCDS3579.2																																																																																			.		0.424	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
SLAMF6	114836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160461021	160461021	+	Silent	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:160461021A>G	ENST00000368057.3	-	3	600	c.540T>C	c.(538-540)acT>acC	p.T180T	SLAMF6_ENST00000368055.1_Silent_p.T69T|SLAMF6_ENST00000368059.3_Silent_p.T180T			Q96DU3	SLAF6_HUMAN	SLAM family member 6	180	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			CCCAGGAGACAGTGAGGTTTG	0.493																																					p.T180T		.											.	SLAMF6	228	0			c.T540C						.						148.0	139.0	142.0					1																	160461021		2203	4300	6503	SO:0001819	synonymous_variant	114836	exon3			GGAGACAGTGAGG	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.540T>C	1.37:g.160461021A>G		Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	238.0	71.0	NM_052931	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Silent	SNP	ENST00000368057.3	37	CCDS53394.1																																																																																			.		0.493	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059010.1	NM_052931	
SLITRK2	84631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	144904543	144904543	+	Silent	SNP	C	C	A	rs377679182		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chrX:144904543C>A	ENST00000370490.1	+	1	4855	c.600C>A	c.(598-600)ggC>ggA	p.G200G	SLITRK2_ENST00000447897.2_Silent_p.G200G|SLITRK2_ENST00000434188.2_Silent_p.G200G|SLITRK2_ENST00000428560.2_Silent_p.G200G|SLITRK2_ENST00000413937.2_Silent_p.G200G			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	200					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTTGCTGGCGTCCTTGAAC	0.488																																					p.G200G		.											.	SLITRK2	136	0			c.C600A						.	C	,,,,,,,	1,3834		0,1,1631,571	141.0	125.0	130.0		600,600,600,600,600,600,600,600	-10.0	0.0	X		130	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SLITRK2	NM_001144003.2,NM_001144004.2,NM_001144005.2,NM_001144006.2,NM_001144008.2,NM_001144009.2,NM_001144010.2,NM_032539.4	,,,,,,,	0,1,4059,2443	AA,AC,CC,C		0.0,0.0261,0.0095	,,,,,,,	200/846,200/846,200/846,200/846,200/846,200/846,200/846,200/846	144904543	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	84631	exon5			TGCTGGCGTCCTT	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.600C>A	X.37:g.144904543C>A		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	37.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Silent	SNP	ENST00000370490.1	37	CCDS14680.1																																																																																			.		0.488	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
SPATA24	202051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	138739744	138739744	+	Silent	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr5:138739744C>A	ENST00000451821.2	-	1	12	c.6G>T	c.(4-6)gcG>gcT	p.A2A	SPATA24_ENST00000507779.2_Silent_p.A2A|SPATA24_ENST00000509959.1_Silent_p.A2A			Q86W54	SPA24_HUMAN	spermatogenesis associated 24	2					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)										CGAGGGGCGTCGCCATCTTCC	0.622																																					p.A2A		.											.	.	.	0			c.G6T						.						37.0	36.0	36.0					5																	138739744		692	1591	2283	SO:0001819	synonymous_variant	202051	exon1			GGGCGTCGCCATC	AK098740	CCDS47274.1	5q31.2	2014-02-12	2009-09-30		ENSG00000170469	ENSG00000170469			27322	protein-coding gene	gene with protein product	"""coiled-coil domain containing 161"""					16146721	Standard	NM_194296		Approved	T6441, CCDC161	uc003lel.4	Q86W54	OTTHUMG00000163388	ENST00000451821.2:c.6G>T	5.37:g.138739744C>A		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	12.0	NM_194296		Silent	SNP	ENST00000451821.2	37																																																																																				.		0.622	SPATA24-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000372986.1	NM_194296	
SSPO	23145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	149485526	149485526	+	RNA	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr7:149485526G>A	ENST00000378016.2	+	0	3932							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGTGTGGAGGGCTGCTTCTGC	0.652																																					p.G1311D		.											.	.	.	0			c.G3932A						.						38.0	47.0	44.0					7																	149485526		2119	4217	6336			23145	exon27			TGGAGGGCTGCTT	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149485526G>A		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	26.0	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																				.		0.652	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
ST3GAL1	6482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	134477129	134477129	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr8:134477129G>C	ENST00000319914.5	-	6	1602	c.575C>G	c.(574-576)cCt>cGt	p.P192R	ST3GAL1_ENST00000521180.1_Missense_Mutation_p.P192R|ST3GAL1_ENST00000399640.2_Missense_Mutation_p.P192R|ST3GAL1_ENST00000522652.1_Missense_Mutation_p.P192R			Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 1	192					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein phosphorylation (GO:0006468)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			endometrium(3)|large_intestine(2)|lung(11)|prostate(1)	17	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			GAAGCTCTCAGGGTACACCAG	0.582																																					p.P192R		.											.	ST3GAL1	90	0			c.C575G						.						175.0	160.0	165.0					8																	134477129		2203	4300	6503	SO:0001583	missense	6482	exon7			CTCTCAGGGTACA	L29555	CCDS6373.1	8q24.22	2013-03-01	2003-01-14	2005-02-07	ENSG00000008513	ENSG00000008513	2.4.99.4	"""Sialyltransferases"""	10862	protein-coding gene	gene with protein product	"""ST3Gal I"""	607187	"""sialyltransferase 4A (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4A		10504389, 7655169	Standard	NM_003033		Approved	ST3O, SIATFL, ST3GalA.1	uc003yuk.2	Q11201	OTTHUMG00000164534	ENST00000319914.5:c.575C>G	8.37:g.134477129G>C	ENSP00000318445:p.Pro192Arg	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	336.0	176.0	NM_173344	O60677|Q9UN51	Missense_Mutation	SNP	ENST00000319914.5	37	CCDS6373.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913610	0.92178	.	.	ENSG00000008513	ENST00000319914;ENST00000399640;ENST00000521180;ENST00000522652;ENST00000523854	T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.67040	0.2851	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75252	-0.3383	10	0.87932	D	0	-24.2124	17.094	0.86630	0.0:0.0:1.0:0.0	.	192	Q11201	SIA4A_HUMAN	R	192;192;192;192;62	ENSP00000318445:P192R;ENSP00000414073:P192R;ENSP00000428540:P192R;ENSP00000430515:P192R;ENSP00000429638:P62R	ENSP00000318445:P192R	P	-	2	0	ST3GAL1	134546311	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.648000	0.98483	2.271000	0.75665	0.561000	0.74099	CCT	.		0.582	ST3GAL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379132.1	NM_003033	
FAM47E-STBD1	100631383	ucsc.edu;bcgsc.ca	37	4	77228038	77228038	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr4:77228038A>G	ENST00000237642.6	+	1	860	c.116A>G	c.(115-117)gAg>gGg	p.E39G	FAM47E-STBD1_ENST00000539752.1_Intron|FAM47E_ENST00000515604.1_Intron	NM_003943.4	NP_003934.1			FAM47E-STBD1 readthrough																		GCGGAGCAGGAGAAAGACGCC	0.677											OREG0016232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E39G		.											.	STBD1	69	0			c.A116G						.						34.0	45.0	41.0					4																	77228038		2203	4300	6503	SO:0001583	missense	8987	exon1			AGCAGGAGAAAGA		CCDS58908.1	4q21.1	2013-04-23			ENSG00000118804	ENSG00000118804			44667	other	readthrough							Standard	NM_001242939		Approved				OTTHUMG00000160966	ENST00000237642.6:c.116A>G	4.37:g.77228038A>G	ENSP00000237642:p.Glu39Gly	Somatic	58.0	2.0	1174	WXS	Illumina HiSeq	.	57.0	5.0	NM_003943		Missense_Mutation	SNP	ENST00000237642.6	37	CCDS3578.1	.	.	.	.	.	.	.	.	.	.	A	12.55	1.970284	0.34754	.	.	ENSG00000118804	ENST00000237642	T	0.26957	1.7	3.84	-3.18	0.05186	.	2.324380	0.02141	N	0.057192	T	0.12902	0.0313	N	0.14661	0.345	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.13072	-1.0523	10	0.33141	T	0.24	6.8166	1.5354	0.02544	0.2355:0.1807:0.406:0.1778	.	39	O95210	STBD1_HUMAN	G	39	ENSP00000237642:E39G	ENSP00000237642:E39G	E	+	2	0	STBD1	77447062	0.001000	0.12720	0.000000	0.03702	0.119000	0.20118	0.338000	0.19858	-0.500000	0.06614	0.383000	0.25322	GAG	.		0.677	FAM47E-STBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252415.2		
STRN4	29888	ucsc.edu;bcgsc.ca	37	19	47225275	47225275	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr19:47225275A>G	ENST00000263280.6	-	16	2109	c.2060T>C	c.(2059-2061)gTg>gCg	p.V687A	STRN4_ENST00000539396.1_Missense_Mutation_p.V568A|STRN4_ENST00000594357.2_5'Flank|STRN4_ENST00000391910.3_Missense_Mutation_p.V694A	NM_001039877.1|NM_013403.2	NP_001034966.1|NP_037535.2	Q9NRL3	STRN4_HUMAN	striatin, calmodulin binding protein 4	687						cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		GTTGGGGTCCACGGCTAGGCA	0.637																																					p.V694A		.											.	STRN4	90	0			c.T2081C						.						110.0	101.0	104.0					19																	47225275		2203	4300	6503	SO:0001583	missense	29888	exon16			GGGTCCACGGCTA	AF212940	CCDS12690.1, CCDS42581.1	19q13.32	2013-01-10			ENSG00000090372	ENSG00000090372		"""WD repeat domain containing"""	15721	protein-coding gene	gene with protein product		614767				10748158	Standard	XM_006723171		Approved	zinedin, ZIN	uc002pfm.3	Q9NRL3		ENST00000263280.6:c.2060T>C	19.37:g.47225275A>G	ENSP00000263280:p.Val687Ala	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_001039877	A0A024R0V2|B4DQH7|F8VYA6|Q8NE53	Missense_Mutation	SNP	ENST00000263280.6	37	CCDS12690.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.958130	0.53400	.	.	ENSG00000090372	ENST00000391910;ENST00000263280;ENST00000539396	T;T;T	0.60797	0.16;0.16;0.16	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.128929	0.53938	D	0.000058	T	0.44350	0.1289	L	0.31664	0.95	0.80722	D	1	B;B	0.14012	0.009;0.002	B;B	0.19666	0.026;0.011	T	0.42327	-0.9458	10	0.56958	D	0.05	-23.2434	8.7909	0.34850	0.9115:0.0:0.0885:0.0	.	694;687	F8VYA6;Q9NRL3	.;STRN4_HUMAN	A	694;687;568	ENSP00000375777:V694A;ENSP00000263280:V687A;ENSP00000440901:V568A	ENSP00000263280:V687A	V	-	2	0	STRN4	51917115	0.991000	0.36638	0.999000	0.59377	0.892000	0.51952	3.736000	0.55052	2.078000	0.62432	0.418000	0.28097	GTG	.		0.637	STRN4-001	KNOWN	NMD_exception|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466607.2		
TBX2	6909	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	59479112	59479112	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:59479112A>T	ENST00000240328.3	+	2	744	c.463A>T	c.(463-465)Atg>Ttg	p.M155L	RP11-332H18.4_ENST00000591313.1_RNA|RP11-332H18.4_ENST00000590421.1_RNA|RP11-332H18.4_ENST00000592009.1_RNA|RP11-332H18.5_ENST00000585765.1_RNA|RP11-332H18.4_ENST00000589814.1_RNA	NM_005994.3	NP_005985.3	Q13207	TBX2_HUMAN	T-box 2	155					aorta morphogenesis (GO:0035909)|atrioventricular canal development (GO:0036302)|cardiac muscle tissue development (GO:0048738)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|developmental growth involved in morphogenesis (GO:0060560)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|endocardial cushion morphogenesis (GO:0003203)|mammary placode formation (GO:0060596)|muscle cell fate determination (GO:0007521)|negative regulation of cardiac chamber formation (GO:1901211)|negative regulation of heart looping (GO:1901208)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|palate development (GO:0060021)|pharynx development (GO:0060465)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(7)|ovary(1)	9						TATCCTGCTGATGGACATTGT	0.587																																					p.M155L	GBM(3;187 253 11467 14965 23079)	.											.	TBX2	226	0			c.A463T						.						67.0	59.0	61.0					17																	59479112		2203	4300	6503	SO:0001583	missense	6909	exon2			CTGCTGATGGACA	AB209378	CCDS11627.2	17q23.2	2012-01-23			ENSG00000121068	ENSG00000121068		"""T-boxes"""	11597	protein-coding gene	gene with protein product		600747				8530034	Standard	NM_005994		Approved		uc010wox.2	Q13207	OTTHUMG00000156986	ENST00000240328.3:c.463A>T	17.37:g.59479112A>T	ENSP00000240328:p.Met155Leu	Somatic	74.0	1.0		WXS	Illumina HiSeq	Phase_I	70.0	9.0	NM_005994	Q16424|Q7Z647	Missense_Mutation	SNP	ENST00000240328.3	37	CCDS11627.2	.	.	.	.	.	.	.	.	.	.	A	15.71	2.914926	0.52546	.	.	ENSG00000121068	ENST00000240328;ENST00000424871	D	0.85258	-1.96	4.71	4.71	0.59529	p53-like transcription factor, DNA-binding (1);	0.083989	0.85682	D	0.000000	T	0.78748	0.4332	N	0.17922	0.545	0.80722	D	1	B;B	0.20988	0.05;0.004	B;B	0.34418	0.182;0.063	T	0.75258	-0.3381	10	0.40728	T	0.16	.	13.5094	0.61502	1.0:0.0:0.0:0.0	.	155;92	Q13207;Q59FT1	TBX2_HUMAN;.	L	155;130	ENSP00000240328:M155L	ENSP00000240328:M155L	M	+	1	0	TBX2	56833894	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.969000	0.70422	1.972000	0.57404	0.459000	0.35465	ATG	.		0.587	TBX2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346977.2	NM_005994	
TMEM106C	79022	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	48359720	48359720	+	Silent	SNP	C	C	T	rs370706223		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr12:48359720C>T	ENST00000429772.2	+	4	464	c.351C>T	c.(349-351)ggC>ggT	p.G117G	TMEM106C_ENST00000449758.2_Silent_p.G117G|TMEM106C_ENST00000256686.6_Silent_p.G117G|TMEM106C_ENST00000552561.1_Silent_p.G117G|TMEM106C_ENST00000552546.1_Silent_p.G46G|TMEM106C_ENST00000550552.1_Silent_p.G117G|TMEM106C_ENST00000549288.1_Intron	NM_001143842.1	NP_001137314.1	Q9BVX2	T106C_HUMAN	transmembrane protein 106C	117						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(13;0.11)		GBM - Glioblastoma multiforme(48;0.241)		ATGATGACGGCATCAAAGTGG	0.468																																					p.G117G		.											.	TMEM106C	90	0			c.C351T						.						316.0	284.0	295.0					12																	48359720		2203	4300	6503	SO:0001819	synonymous_variant	79022	exon4			TGACGGCATCAAA	BC000854	CCDS8758.1, CCDS44867.1	12q13.1	2005-12-19				ENSG00000134291			28775	protein-coding gene	gene with protein product							Standard	NM_024056		Approved	MGC5576	uc001rqr.3	Q9BVX2	OTTHUMG00000169892	ENST00000429772.2:c.351C>T	12.37:g.48359720C>T		Somatic	453.0	0.0		WXS	Illumina HiSeq	Phase_I	740.0	47.0	NM_001143843	B2R998|B7Z5M4|Q3B761	Silent	SNP	ENST00000429772.2	37	CCDS8758.1	.	.	.	.	.	.	.	.	.	.	C	9.155	1.017150	0.19355	.	.	ENSG00000134291	ENST00000547682	.	.	.	4.48	1.63	0.23807	.	.	.	.	.	T	0.53498	0.1800	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42816	-0.9429	4	.	.	.	-5.8902	6.0324	0.19686	0.0:0.5351:0.2999:0.165	.	.	.	.	Y	4	.	.	H	+	1	0	TMEM106C	46645987	0.919000	0.31177	0.976000	0.42696	0.952000	0.60782	-0.035000	0.12205	0.381000	0.24851	-0.175000	0.13238	CAT	.		0.468	TMEM106C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406452.1	NM_024056	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	7578419	7578419	+	Nonsense_Mutation	SNP	C	C	A	rs587781845		TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr17:7578419C>A	ENST00000269305.4	-	5	700	c.511G>T	c.(511-513)Gag>Tag	p.E171*	TP53_ENST00000420246.2_Nonsense_Mutation_p.E171*|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Nonsense_Mutation_p.E171*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E171*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E171*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E171*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	171	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E171K(11)|p.E171*(10)|p.0?(8)|p.E171Q(4)|p.E171fs*2(3)|p.E171fs*3(2)|p.E171fs*10(2)|p.V157_C176del20(1)|p.T170fs*8(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.E171fs*9(1)|p.T170fs*2(1)|p.E171fs*1(1)|p.E78fs*2(1)|p.H168fs*3(1)|p.H168fs*69(1)|p.T170_E171insXX(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.E39fs*2(1)|p.E171_V172delEV(1)|p.E39K(1)|p.E78K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCACAACCTCCGTCATGTGC	0.662		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E171X	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	57	Substitution - Missense(17)|Deletion - Frameshift(15)|Substitution - Nonsense(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(2)|Insertion - In frame(1)	urinary_tract(8)|lung(8)|breast(8)|oesophagus(6)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|large_intestine(3)|stomach(3)|central_nervous_system(3)|skin(3)|upper_aerodigestive_tract(2)|thyroid(1)|kidney(1)|endometrium(1)|liver(1)|ovary(1)	c.G511T						.						52.0	52.0	52.0					17																	7578419		2203	4300	6503	SO:0001587	stop_gained	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAACCTCCGTCAT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.511G>T	17.37:g.7578419C>A	ENSP00000269305:p.Glu171*	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	23.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186918	0.78789	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.47	5.47	0.80525	.	0.106949	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-29.8225	17.1938	0.86887	0.0:1.0:0.0:0.0	.	.	.	.	X	171;171;171;171;171;171;160;78;39;78;39	.	ENSP00000269305:E171X	E	-	1	0	TP53	7519144	1.000000	0.71417	0.689000	0.30133	0.389000	0.30415	7.775000	0.85489	2.735000	0.93741	0.563000	0.77884	GAG	.		0.662	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRHR	7201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110131669	110131669	+	Silent	SNP	C	C	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr8:110131669C>A	ENST00000518632.1	+	3	1533	c.1182C>A	c.(1180-1182)tcC>tcA	p.S394S	TRHR_ENST00000311762.2_Silent_p.S394S			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	394					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CTGAGGTATCCTTTAGCCAAA	0.403																																					p.S394S		.											TRHR,nipple,malignant_melanoma,+1	TRHR	620	0			c.C1182A						.						63.0	63.0	63.0					8																	110131669		2203	4299	6502	SO:0001819	synonymous_variant	7201	exon2			GGTATCCTTTAGC		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.1182C>A	8.37:g.110131669C>A		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	297.0	67.0	NM_003301	Q2M339	Silent	SNP	ENST00000518632.1	37	CCDS6311.1																																																																																			.		0.403	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1		
TRPM7	54822	bcgsc.ca;mdanderson.org	37	15	50897161	50897161	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr15:50897161T>G	ENST00000313478.7	-	21	3171	c.2890A>C	c.(2890-2892)Att>Ctt	p.I964L	TRPM7_ENST00000560955.1_Missense_Mutation_p.I964L	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	964					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AGACAGTAAATTAATCTTCCA	0.328																																					p.I964L		.											.	TRPM7	392	0			c.A2890C						.						68.0	67.0	67.0					15																	50897161		1817	4080	5897	SO:0001583	missense	54822	exon21			AGTAAATTAATCT	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.2890A>C	15.37:g.50897161T>G	ENSP00000320239:p.Ile964Leu	Somatic	151.0	1.0		WXS	Illumina HiSeq	Phase_1	196.0	26.0	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.857248	0.51376	.	.	ENSG00000092439	ENST00000313478	T	0.73575	-0.76	5.52	5.52	0.82312	Ion transport (1);	0.183175	0.49305	D	0.000151	T	0.64757	0.2627	N	0.25647	0.755	0.32027	N	0.600028	B	0.14805	0.011	B	0.15484	0.013	T	0.68209	-0.5469	10	0.54805	T	0.06	-21.3722	15.6211	0.76808	0.0:0.0:0.0:1.0	.	964	Q96QT4	TRPM7_HUMAN	L	964	ENSP00000320239:I964L	ENSP00000320239:I964L	I	-	1	0	TRPM7	48684453	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.368000	0.52357	2.082000	0.62665	0.477000	0.44152	ATT	.		0.328	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
UCP3	7352	ucsc.edu;bcgsc.ca	37	11	73714875	73714875	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:73714875T>C	ENST00000314032.4	-	6	1373	c.821A>G	c.(820-822)aAg>aGg	p.K274R	UCP3_ENST00000426995.2_Missense_Mutation_p.K274R|UCP3_ENST00000348534.4_Missense_Mutation_p.K172R|UCP3_ENST00000545271.1_5'Flank	NM_003356.3	NP_003347.1	P55916	UCP3_HUMAN	uncoupling protein 3 (mitochondrial, proton carrier)	274					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to hormone stimulus (GO:0032870)|fatty acid metabolic process (GO:0006631)|lipid metabolic process (GO:0006629)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|response to activity (GO:0014823)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12	Breast(11;2.08e-05)					GGCTCACCCCTTGTAGAAGGC	0.577																																					p.K274R		.											.	UCP3	91	0			c.A821G						.						102.0	117.0	112.0					11																	73714875		2200	4293	6493	SO:0001583	missense	7352	exon6			CACCCCTTGTAGA	AF001787	CCDS8229.1, CCDS44677.1	11q13.4	2013-05-22				ENSG00000175564		"""Solute carriers"""	12519	protein-coding gene	gene with protein product		602044				9480760, 9196039	Standard	NM_003356		Approved	SLC25A9	uc001our.3	P55916		ENST00000314032.4:c.821A>G	11.37:g.73714875T>C	ENSP00000323740:p.Lys274Arg	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_003356	O60475|Q96HL3	Missense_Mutation	SNP	ENST00000314032.4	37	CCDS8229.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.679614	0.88542	.	.	ENSG00000175564	ENST00000314032;ENST00000348534;ENST00000426995	T;T;T	0.78707	-1.2;-1.2;-1.2	4.93	4.93	0.64822	Mitochondrial carrier domain (2);	0.043405	0.85682	D	0.000000	T	0.79417	0.4442	L	0.43646	1.37	0.44595	D	0.997563	B	0.29085	0.232	B	0.44108	0.441	T	0.80209	-0.1477	10	0.66056	D	0.02	.	14.5287	0.67909	0.0:0.0:0.0:1.0	.	274	P55916	UCP3_HUMAN	R	274;172;274	ENSP00000323740:K274R;ENSP00000343615:K172R;ENSP00000392143:K274R	ENSP00000323740:K274R	K	-	2	0	UCP3	73392523	1.000000	0.71417	0.999000	0.59377	0.836000	0.47400	7.839000	0.86812	1.980000	0.57719	0.533000	0.62120	AAG	.		0.577	UCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398200.1	NM_003356	
ZCCHC2	54877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	60242702	60242702	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr18:60242702A>C	ENST00000269499.5	+	13	3806	c.3388A>C	c.(3388-3390)Aat>Cat	p.N1130H	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.N809H	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	1130						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						GAAGAATGGGAATGTCTCATG	0.483																																					p.N1130H		.											.	ZCCHC2	432	0			c.A3388C						.						121.0	119.0	119.0					18																	60242702		2000	4184	6184	SO:0001583	missense	54877	exon13			AATGGGAATGTCT	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.3388A>C	18.37:g.60242702A>C	ENSP00000269499:p.Asn1130His	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	197.0	55.0	NM_017742	B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	37	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	A	18.18	3.567109	0.65651	.	.	ENSG00000141664	ENST00000269499	T	0.77489	-1.1	5.57	5.57	0.84162	Zinc finger, CCHC retroviral-type (1);	0.335440	0.29459	N	0.012089	T	0.82245	0.4995	M	0.65498	2.005	0.52099	D	0.999944	P	0.47409	0.895	P	0.49708	0.62	D	0.84692	0.0723	10	0.87932	D	0	-3.8166	16.0262	0.80548	1.0:0.0:0.0:0.0	.	1130	Q9C0B9	ZCHC2_HUMAN	H	1130	ENSP00000269499:N1130H	ENSP00000269499:N1130H	N	+	1	0	ZCCHC2	58393682	1.000000	0.71417	0.125000	0.21846	0.982000	0.71751	8.372000	0.90127	2.243000	0.73865	0.533000	0.62120	AAT	.		0.483	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
ZNF365	22891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	64148204	64148204	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr10:64148204G>T	ENST00000395254.3	+	3	1073	c.793G>T	c.(793-795)Gtt>Ttt	p.V265F	ZNF365_ENST00000395255.3_Missense_Mutation_p.V265F|ZNF365_ENST00000410046.3_Missense_Mutation_p.V265F|ZNF365_ENST00000466727.1_3'UTR	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					TGAGAAGGAGGTTCAAGGGAA	0.483																																					p.V265F		.											.	ZNF365	92	0			c.G793T						.						67.0	67.0	67.0					10																	64148204		2203	4300	6503	SO:0001583	missense	22891	exon3			AAGGAGGTTCAAG	AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.793G>T	10.37:g.64148204G>T	ENSP00000378674:p.Val265Phe	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	23.0	NM_014951		Missense_Mutation	SNP	ENST00000395254.3	37	CCDS31209.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040020	0.35989	.	.	ENSG00000138311	ENST00000395254;ENST00000395255;ENST00000410046	T;T;T	0.37235	1.21;1.21;1.21	5.67	4.71	0.59529	.	0.404030	0.23418	N	0.048388	T	0.29817	0.0745	L	0.48362	1.52	0.80722	D	1	B;B;B;B	0.24721	0.11;0.01;0.001;0.003	B;B;B;B	0.17433	0.018;0.004;0.003;0.004	T	0.05273	-1.0895	10	0.38643	T	0.18	-11.2452	10.3383	0.43862	0.0:0.1254:0.6271:0.2475	.	265;265;265;280	Q70YC5-3;Q70YC5-2;Q70YC5;Q70YC5-4	.;.;ZN365_HUMAN;.	F	265	ENSP00000378674:V265F;ENSP00000378675:V265F;ENSP00000387091:V265F	ENSP00000378674:V265F	V	+	1	0	ZNF365	63818210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.997000	0.40786	2.836000	0.97738	0.655000	0.94253	GTT	.		0.483	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048238.2	NM_014951	
ZNF462	58499	broad.mit.edu;mdanderson.org	37	9	109688981	109688981	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr9:109688981T>C	ENST00000277225.5	+	3	3077	c.2788T>C	c.(2788-2790)Tgt>Cgt	p.C930R	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.C930R			Q96JM2	ZN462_HUMAN	zinc finger protein 462	930					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GTGTCGGTTTTGTTCATACAC	0.468																																					p.C930R		.											.	ZNF462	95	0			c.T2788C						.						125.0	120.0	121.0					9																	109688981		2203	4300	6503	SO:0001583	missense	58499	exon3			CGGTTTTGTTCAT	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.2788T>C	9.37:g.109688981T>C	ENSP00000277225:p.Cys930Arg	Somatic	47.0	1.0		WXS	Illumina HiSeq	Phase_I	66.0	17.0	NM_021224	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	T	16.90	3.249170	0.59103	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.20463	2.07;2.49	5.79	5.79	0.91817	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.26810	0.0656	N	0.08118	0	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	T	0.28902	-1.0029	9	.	.	.	.	16.1388	0.81509	0.0:0.0:0.0:1.0	.	930;930	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	R	930	ENSP00000277225:C930R;ENSP00000414570:C930R	.	C	+	1	0	ZNF462	108728802	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.961000	0.87903	2.205000	0.71048	0.528000	0.53228	TGT	.		0.468	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
ZNF596	169270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	195803	195803	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr8:195803G>A	ENST00000398612.1	+	6	1339	c.956G>A	c.(955-957)tGt>tAt	p.C319Y	ZNF596_ENST00000320552.2_Missense_Mutation_p.C249Y|ZNF596_ENST00000308811.4_Missense_Mutation_p.C319Y	NM_001042415.1|NM_001042416.1	NP_001035880.1|NP_001035881.1	Q8TC21	ZN596_HUMAN	zinc finger protein 596	319					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(5)	14		all_cancers(2;4.81e-29)|all_epithelial(2;5.03e-19)|Lung NSC(2;8.68e-08)|all_lung(2;1.52e-07)|Ovarian(12;0.00965)|Colorectal(14;0.0367)|all_neural(12;0.0837)|Myeloproliferative disorder(644;0.116)|all_hematologic(2;0.138)|Acute lymphoblastic leukemia(644;0.242)		Epithelial(5;3.77e-18)|all cancers(2;5.2e-17)|OV - Ovarian serous cystadenocarcinoma(5;5.37e-09)|BRCA - Breast invasive adenocarcinoma(11;1.7e-06)|Colorectal(2;6.51e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0702)		TTCAGTAAATGTTCTTACCTT	0.388																																					p.C319Y		.											.	ZNF596	90	0			c.G956A						.						51.0	51.0	51.0					8																	195803		2203	4300	6503	SO:0001583	missense	169270	exon6			GTAAATGTTCTTA	BC026190	CCDS5951.2	8p23.3	2013-01-08			ENSG00000172748	ENSG00000172748		"""Zinc fingers, C2H2-type"", ""-"""	27268	protein-coding gene	gene with protein product						12477932	Standard	NM_001287256		Approved		uc003wot.3	Q8TC21	OTTHUMG00000086931	ENST00000398612.1:c.956G>A	8.37:g.195803G>A	ENSP00000381613:p.Cys319Tyr	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	54.0	NM_173539	B2R8P4|O95015|Q8N9X0	Missense_Mutation	SNP	ENST00000398612.1	37	CCDS5951.2	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.165931	0.00318	.	.	ENSG00000172748	ENST00000308811;ENST00000320552;ENST00000398612	T;T;T	0.14516	2.5;3.21;2.5	2.62	-1.9	0.07665	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04907	0.0132	N	0.20685	0.6	0.09310	N	1	P	0.47302	0.893	B	0.39738	0.308	T	0.16867	-1.0388	9	0.02654	T	1	.	1.4284	0.02328	0.2628:0.3827:0.2178:0.1367	.	319	Q8TC21	ZN596_HUMAN	Y	319;249;319	ENSP00000310033:C319Y;ENSP00000318719:C249Y;ENSP00000381613:C319Y	ENSP00000310033:C319Y	C	+	2	0	ZNF596	185803	0.000000	0.05858	0.000000	0.03702	0.973000	0.67179	-2.420000	0.01032	-0.474000	0.06862	0.585000	0.79938	TGT	.		0.388	ZNF596-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195858.4	NM_173539	
PI4KB	5298	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	151262327	151262328	+	IGR	INS	-	-	C			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr1:151262327_151262328insC	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_Frame_Shift_Ins_p.P937fs			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCTCCCCTGAGCCCCCCCGTCC	0.649																																					p.E936fs	Colon(154;765 1838 9854 28443 37492)	.											.	ZNF687	92	0			c.2808_2809insC						.																																			SO:0001628	intergenic_variant	57592	exon6			CCCTGAGCCCCCC	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		1.37:g.151262334_151262334dupC		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	17.0	NM_020832	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Frame_Shift_Ins	INS	ENST00000368873.1	37																																																																																				.		0.649	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651	
ZP1	22917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	60641219	60641219	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EI-01A-11D-A12Z-10	TCGA-DD-A1EI-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c016d025-3c92-41c5-b846-493b1fcce79e	f48e484a-7373-4ffb-bbd7-41c3d2f91d5f	g.chr11:60641219T>G	ENST00000278853.5	+	9	1543	c.1543T>G	c.(1543-1545)Tca>Gca	p.S515A		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	515	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CCTCCTGGACTCAGGCTCCCA	0.602																																					p.S515A		.											.	ZP1	90	0			c.T1543G						.						88.0	91.0	90.0					11																	60641219		2203	4299	6502	SO:0001583	missense	22917	exon9			CTGGACTCAGGCT	BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.1543T>G	11.37:g.60641219T>G	ENSP00000278853:p.Ser515Ala	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	12.0	NM_207341		Missense_Mutation	SNP	ENST00000278853.5	37	CCDS31572.1	.	.	.	.	.	.	.	.	.	.	T	11.82	1.751274	0.31046	.	.	ENSG00000149506	ENST00000278853;ENST00000544498	T	0.23950	1.88	5.29	-4.13	0.03904	Zona pellucida sperm-binding protein (3);	1.307360	0.04747	N	0.423896	T	0.28234	0.0697	M	0.79693	2.465	0.09310	N	1	B	0.25105	0.118	B	0.32149	0.141	T	0.37220	-0.9715	10	0.41790	T	0.15	-1.953	0.6784	0.00870	0.2335:0.3002:0.2071:0.2592	.	515	P60852	ZP1_HUMAN	A	515;222	ENSP00000278853:S515A	ENSP00000278853:S515A	S	+	1	0	ZP1	60397795	0.004000	0.15560	0.007000	0.13788	0.572000	0.35998	-0.289000	0.08365	-1.064000	0.03172	0.260000	0.18958	TCA	.		0.602	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396329.1	NM_207341	
