#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu	37	7	48318518	48318518	+	Nonsense_Mutation	SNP	T	T	A	rs544493291	byFrequency	TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr7:48318518T>A	ENST00000435803.1	+	18	7751	c.7727T>A	c.(7726-7728)tTa>tAa	p.L2576*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2576					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATAGCTACTTTAAAAAAAATA	0.318													T|||	3	0.000599042	0.0	0.0014	5008	,	,		18836	0.0		0.0	False		,,,				2504	0.002				p.L2576X		.											.	ABCA13	521	0			c.T7727A						.						55.0	59.0	58.0					7																	48318518		1794	4040	5834	SO:0001587	stop_gained	154664	exon18			CTACTTTAAAAAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7727T>A	7.37:g.48318518T>A	ENSP00000411096:p.Leu2576*	Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	17.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	T	47	13.299669	0.99733	.	.	ENSG00000179869	ENST00000435803	.	.	.	4.93	-0.0604	0.13789	.	1.145970	0.06770	N	0.783306	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.0212	0.09667	0.0:0.3009:0.2063:0.4928	.	.	.	.	X	2576	.	ENSP00000411096:L2576X	L	+	2	0	ABCA13	48289064	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-1.274000	0.02820	-0.020000	0.14032	-0.331000	0.08364	TTA	.		0.318	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
APOH	350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	64222231	64222231	+	Missense_Mutation	SNP	G	G	A	rs55645281		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr17:64222231G>A	ENST00000205948.6	-	3	290	c.253C>T	c.(253-255)Cct>Tct	p.P85S		NM_000042.2	NP_000033.2	P02749	APOH_HUMAN	apolipoprotein H (beta-2-glycoprotein I)	85	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation, intrinsic pathway (GO:0007597)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|plasminogen activation (GO:0031639)|positive regulation of blood coagulation (GO:0030194)|positive regulation of lipoprotein lipase activity (GO:0051006)|regulation of fibrinolysis (GO:0051917)|triglyceride metabolic process (GO:0006641)|triglyceride transport (GO:0034197)	cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipid binding (GO:0005543)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			CCAGCAAAAGGACATACTCTG	0.318																																					p.P85S	Melanoma(155;624 1882 16869 48804 51309)	.											.	APOH	90	0			c.C253T						.						91.0	84.0	86.0					17																	64222231		2203	4300	6503	SO:0001583	missense	350	exon3			CAAAAGGACATAC		CCDS11663.1	17q24.2	2013-01-24				ENSG00000091583		"""Apolipoproteins"""	616	protein-coding gene	gene with protein product	"""beta-2-glycoprotein I"""	138700		B2G1		1582254	Standard	NM_000042		Approved	BG	uc002jfn.4	P02749		ENST00000205948.6:c.253C>T	17.37:g.64222231G>A	ENSP00000205948:p.Pro85Ser	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	76.0	NM_000042	B2R9M3|Q9UCN7	Missense_Mutation	SNP	ENST00000205948.6	37	CCDS11663.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.039753	0.35989	.	.	ENSG00000091583	ENST00000205948	T	0.66099	-0.19	5.55	5.55	0.83447	Complement control module (2);Sushi/SCR/CCP (3);	0.050624	0.85682	D	0.000000	T	0.67011	0.2848	L	0.56396	1.775	0.46260	D	0.998959	D	0.57899	0.981	P	0.53266	0.722	T	0.61806	-0.6987	10	0.15952	T	0.53	.	15.0313	0.71708	0.0:0.0:1.0:0.0	rs55645281	85	P02749	APOH_HUMAN	S	85	ENSP00000205948:P85S	ENSP00000205948:P85S	P	-	1	0	APOH	61652693	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.458000	0.53014	2.611000	0.88343	0.563000	0.77884	CCT	.		0.318	APOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446926.1	NM_000042	
ARSA	410	bcgsc.ca;mdanderson.org	37	22	51065802	51065802	+	Missense_Mutation	SNP	C	C	A	rs74315458		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr22:51065802C>A	ENST00000547307.1	-	2	656	c.251G>T	c.(250-252)cGg>cTg	p.R84L	ARSA_ENST00000547805.1_Missense_Mutation_p.R84L|ARSA_ENST00000216124.5_Missense_Mutation_p.R86L|ARSA_ENST00000395621.3_Missense_Mutation_p.R86L|ARSA_ENST00000356098.5_Missense_Mutation_p.R86L|ARSA_ENST00000453344.2_5'UTR|ARSA_ENST00000395619.3_Missense_Mutation_p.R86L			P15289	ARSA_HUMAN	arylsulfatase A	84			R -> Q (in MLD; mild; dbSNP:rs74315458). {ECO:0000269|PubMed:1353340, ECO:0000269|PubMed:18693274}.|R -> W (in MLD; juvenile form; dbSNP:rs199476352). {ECO:0000269|PubMed:10477432}.		autophagy (GO:0006914)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum lumen (GO:0005788)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|cerebroside-sulfatase activity (GO:0004098)|sulfuric ester hydrolase activity (GO:0008484)			endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|skin(1)	9		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Micafungin(DB01141)|Suramin(DB04786)	CATGCCCATCCGAACCGGGAG	0.677																																					p.R86L		.											.	ARSA	92	0			c.G257T	GRCh37	CM940096	ARSA	M	rs74315458	.						8.0	9.0	9.0					22																	51065802		2169	4263	6432	SO:0001583	missense	410	exon3			CCCATCCGAACCG	X52150	CCDS14100.1, CCDS46736.1, CCDS14100.2	22q13.33	2013-09-19			ENSG00000100299	ENSG00000100299	3.1.6.8	"""Arylsulfatase family"""	713	protein-coding gene	gene with protein product	"""metachromatic leucodystrophy"""	607574				15772092	Standard	NM_000487		Approved		uc003bmz.5	P15289	OTTHUMG00000150180	ENST00000547307.1:c.251G>T	22.37:g.51065802C>A	ENSP00000448440:p.Arg84Leu	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_1	9.0	3.0	NM_001085426	B2RCA6|B7XD04|F8WCC8|Q6ICI5|Q96CJ0	Missense_Mutation	SNP	ENST00000547307.1	37		.	.	.	.	.	.	.	.	.	.	C	33	5.239386	0.95240	.	.	ENSG00000100299	ENST00000356098;ENST00000216124;ENST00000547307;ENST00000547805;ENST00000395621;ENST00000395619	D;D;D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14;-5.14;-5.14	4.99	4.99	0.66335	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.051416	0.85682	D	0.000000	D	0.99339	0.9768	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98758	1.0723	10	0.87932	D	0	.	16.1209	0.81357	0.0:1.0:0.0:0.0	.	84;84	B4DVI5;P15289	.;ARSA_HUMAN	L	86;86;84;84;86;86	ENSP00000348406:R86L;ENSP00000216124:R86L;ENSP00000448440:R84L;ENSP00000448932:R84L;ENSP00000378983:R86L;ENSP00000378981:R86L	ENSP00000216124:R86L	R	-	2	0	ARSA	49412668	1.000000	0.71417	0.124000	0.21820	0.957000	0.61999	5.759000	0.68785	2.476000	0.83614	0.609000	0.83330	CGG	.		0.677	ARSA-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000487	
ATP13A5	344905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	193061790	193061790	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:193061790G>A	ENST00000342358.4	-	9	986	c.869C>T	c.(868-870)cCa>cTa	p.P290L		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	290						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AAATTTTCCTGGAAGAATAAG	0.453																																					p.P290L		.											.	ATP13A5	144	0			c.C869T						.						75.0	70.0	72.0					3																	193061790		2203	4300	6503	SO:0001583	missense	344905	exon9			TTTCCTGGAAGAA	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.869C>T	3.37:g.193061790G>A	ENSP00000341942:p.Pro290Leu	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	96.0	NM_198505	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580969	0.46006	.	.	ENSG00000187527	ENST00000342358	D	0.90504	-2.68	5.57	4.64	0.57946	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.354064	0.28312	N	0.015802	D	0.87557	0.6207	L	0.54965	1.715	0.53005	D	0.999965	B	0.10296	0.003	B	0.18561	0.022	D	0.84365	0.0540	10	0.66056	D	0.02	-6.5577	10.9351	0.47241	0.0:0.1383:0.7192:0.1424	.	290	Q4VNC0	AT135_HUMAN	L	290	ENSP00000341942:P290L	ENSP00000341942:P290L	P	-	2	0	ATP13A5	194544484	0.933000	0.31639	1.000000	0.80357	0.848000	0.48234	3.592000	0.53993	2.802000	0.96397	0.650000	0.86243	CCA	.		0.453	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
C21orf59	56683	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	33974647	33974647	+	Missense_Mutation	SNP	T	T	C	rs370327238		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr21:33974647T>C	ENST00000290155.3	-	6	1319	c.697A>G	c.(697-699)Att>Gtt	p.I233V	AP000275.65_ENST00000553001.1_Intron|C21orf59_ENST00000382549.4_3'UTR	NM_021254.2	NP_067077.1	P57076	CU059_HUMAN	chromosome 21 open reading frame 59	233						cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|prostate(1)|skin(1)	5						CTGCTAATAATAGGCTCTCGG	0.502																																					p.I233V		.											.	C21orf59	90	0			c.A697G						.	T	VAL/ILE	1,4405	2.1+/-5.4	0,1,2202	143.0	130.0	134.0		697	-6.2	0.0	21		134	0,8600		0,0,4300	no	missense	C21orf59	NM_021254.2	29	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign	233/291	33974647	1,13005	2203	4300	6503	SO:0001583	missense	56683	exon6			TAATAATAGGCTC	AF282851	CCDS13617.1	21q22.11	2014-02-03	2003-07-22		ENSG00000159079	ENSG00000159079			1301	protein-coding gene	gene with protein product		615494	"""chromosome 21 open reading frame 48"""	C21orf48		24094744	Standard	NM_021254		Approved	FLJ20467, FBB18, CILD26	uc002yqc.3	P57076	OTTHUMG00000179510	ENST00000290155.3:c.697A>G	21.37:g.33974647T>C	ENSP00000290155:p.Ile233Val	Somatic	85.0	1.0		WXS	Illumina HiSeq	Phase_I	67.0	21.0	NM_021254	Q53FH0	Missense_Mutation	SNP	ENST00000290155.3	37	CCDS13617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.490|2.490	-0.317730|-0.317730	0.05386|0.05386	2.27E-4|2.27E-4	0.0|0.0	ENSG00000159079|ENSG00000159079	ENST00000290155|ENST00000425336	.|.	.|.	.|.	4.98|4.98	-6.25|-6.25	0.02039|0.02039	.|.	0.964867|.	0.08618|.	N|.	0.918936|.	T|T	0.12475|0.12475	0.0303|0.0303	N|N	0.00525|0.00525	-1.395|-1.395	0.45995|0.45995	D|D	0.9988|0.9988	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.06405|.	0.001;0.002|.	T|T	0.30563|0.30563	-0.9974|-0.9974	9|5	0.02654|.	T|.	1|.	-27.1014|-27.1014	11.6988|11.6988	0.51558|0.51558	0.0:0.5392:0.3253:0.1355|0.0:0.5392:0.3253:0.1355	.|.	233;233|.	Q53FH0;P57076|.	.;CU059_HUMAN|.	V|C	233|80	.|.	ENSP00000290155:I233V|.	I|Y	-|-	1|2	0|0	C21orf59|C21orf59	32896518|32896518	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.276000|0.276000	0.26787|0.26787	-0.764000|-0.764000	0.04735|0.04735	-1.085000|-1.085000	0.03088|0.03088	-0.256000|-0.256000	0.11100|0.11100	ATT|TAT	.		0.502	C21orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139431.1	NM_021254	
CACNA1D	776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	53707151	53707151	+	Silent	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:53707151C>T	ENST00000350061.5	+	8	1729	c.1218C>T	c.(1216-1218)agC>agT	p.S406S	CACNA1D_ENST00000422281.2_Silent_p.S406S|CACNA1D_ENST00000288139.4_Intron|CACNA1D_ENST00000498251.1_3'UTR	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	406					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTGTATTGAGCGGGTAAGCTA	0.468																																					p.S406S		.											.	CACNA1D	100	0			c.C1218T						.						260.0	209.0	224.0					3																	53707151		692	1591	2283	SO:0001819	synonymous_variant	776	exon8			ATTGAGCGGGTAA	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.1218C>T	3.37:g.53707151C>T		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	978.0	485.0	NM_001128840	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	ENST00000350061.5	37	CCDS46848.1																																																																																			.		0.468	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
CADM2	253559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	86114753	86114753	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:86114753A>G	ENST00000407528.2	+	9	1125		c.e9-1		CADM2_ENST00000383699.3_Splice_Site|CADM2_ENST00000405615.2_Splice_Site	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2						adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TGTCTTTTCCAGATCCTAATG	0.368																																					.		.											.	CADM2	228	0			c.1064-2A>G						.						134.0	122.0	126.0					3																	86114753		2203	4300	6503	SO:0001630	splice_region_variant	253559	exon9			TTTTCCAGATCCT	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.1064-1A>G	3.37:g.86114753A>G		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	249.0	110.0	NM_001167674	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Splice_Site	SNP	ENST00000407528.2	37	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.622329	0.87460	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0708	0.80928	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CADM2	86197443	1.000000	0.71417	0.960000	0.40013	0.941000	0.58515	9.339000	0.96797	2.197000	0.70478	0.528000	0.53228	.	.		0.368	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	Intron
CGREF1	10669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27325451	27325451	+	Missense_Mutation	SNP	G	G	T	rs376042252	byFrequency	TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr2:27325451G>T	ENST00000260595.5	-	3	381	c.89C>A	c.(88-90)tCt>tAt	p.S30Y	CGREF1_ENST00000452318.2_De_novo_Start_OutOfFrame|CGREF1_ENST00000404694.3_Missense_Mutation_p.S152Y|CGREF1_ENST00000405600.1_Missense_Mutation_p.S30Y|CGREF1_ENST00000312734.4_Missense_Mutation_p.S30Y|CGREF1_ENST00000402550.1_Missense_Mutation_p.S30Y|CGREF1_ENST00000402394.1_Missense_Mutation_p.S30Y			Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1	30					cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			kidney(1)|lung(4)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCACTTCAGAGTCTGGCCT	0.637																																					p.S30Y		.											.	CGREF1	91	0			c.C89A						.						50.0	53.0	52.0					2																	27325451		2203	4300	6503	SO:0001583	missense	10669	exon3			ACTTCAGAGTCTG	BC034764	CCDS33162.1, CCDS33162.2, CCDS54339.1	2p23.3	2013-01-10			ENSG00000138028	ENSG00000138028		"""EF-hand domain containing"""	16962	protein-coding gene	gene with protein product		606137				8968090	Standard	NM_006569		Approved	CGR11	uc002riq.3	Q99674	OTTHUMG00000152009	ENST00000260595.5:c.89C>A	2.37:g.27325451G>T	ENSP00000260595:p.Ser30Tyr	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	10.0	NM_001166239	A6NHV7|B4DXY8|B5MCB7|B5MCC9|B5MCP5|E7EU99|Q8N4B7	Missense_Mutation	SNP	ENST00000260595.5	37		.	.	.	.	.	.	.	.	.	.	G	12.57	1.978392	0.34942	.	.	ENSG00000138028	ENST00000402550;ENST00000402394;ENST00000405600;ENST00000389521;ENST00000312734;ENST00000404694;ENST00000260595	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	4.74	3.86	0.44501	.	0.815240	0.11022	N	0.608288	T	0.15825	0.0381	N	0.14661	0.345	0.09310	N	1	P;P;P	0.52316	0.952;0.875;0.875	B;B;B	0.38327	0.271;0.271;0.271	T	0.03364	-1.1044	10	0.23302	T	0.38	-2.1333	8.5357	0.33362	0.1038:0.0:0.8962:0.0	.	152;30;30	B5MCC9;B5MCP5;Q99674	.;.;CGRE1_HUMAN	Y	30;30;30;30;30;152;30	ENSP00000385452:S30Y;ENSP00000386113:S30Y;ENSP00000324025:S30Y;ENSP00000385574:S152Y;ENSP00000260595:S30Y	ENSP00000260595:S30Y	S	-	2	0	CGREF1	27178955	0.034000	0.19679	0.002000	0.10522	0.079000	0.17450	0.393000	0.20817	1.223000	0.43536	0.551000	0.68910	TCT	.		0.637	CGREF1-201	KNOWN	basic	protein_coding	protein_coding		NM_006569	
CLCN1	1180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143039472	143039472	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr7:143039472A>G	ENST00000343257.2	+	16	1891	c.1804A>G	c.(1804-1806)Acc>Gcc	p.T602A		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	602					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TAGCAAATATACCATCTTTGT	0.463																																					p.T602A		.											.	CLCN1	156	0			c.A1804G						.						147.0	114.0	125.0					7																	143039472		2203	4300	6503	SO:0001583	missense	1180	exon16			AAATATACCATCT	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1804A>G	7.37:g.143039472A>G	ENSP00000339867:p.Thr602Ala	Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	57.0	NM_000083	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	A	18.86	3.714293	0.68730	.	.	ENSG00000188037	ENST00000343257	D	0.87966	-2.32	5.82	5.82	0.92795	.	0.147273	0.64402	D	0.000020	T	0.81688	0.4875	N	0.24115	0.695	0.50171	D	0.999857	P	0.42296	0.775	B	0.42851	0.4	T	0.80632	-0.1296	10	0.27082	T	0.32	.	16.1771	0.81858	1.0:0.0:0.0:0.0	.	602	P35523	CLCN1_HUMAN	A	602	ENSP00000339867:T602A	ENSP00000339867:T602A	T	+	1	0	CLCN1	142749594	1.000000	0.71417	0.994000	0.49952	0.883000	0.51084	9.331000	0.96430	2.225000	0.72522	0.523000	0.50628	ACC	.		0.463	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
CPB1	1360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	148559613	148559613	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:148559613G>A	ENST00000491148.1	+	7	812	c.478G>A	c.(478-480)Ggc>Agc	p.G160S	CPB1_ENST00000282957.4_Missense_Mutation_p.G160S			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	160						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			GCAATAGGTTGGCAAAGCTGG	0.453																																					p.G160S		.											.	CPB1	92	0			c.G478A						.						150.0	138.0	142.0					3																	148559613		2203	4300	6503	SO:0001583	missense	1360	exon6			TAGGTTGGCAAAG	AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.478G>A	3.37:g.148559613G>A	ENSP00000417222:p.Gly160Ser	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	93.0	NM_001871	O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	ENST00000491148.1	37	CCDS33874.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958321	0.92726	.	.	ENSG00000153002	ENST00000491148;ENST00000282957;ENST00000468341	T;T;T	0.30714	1.52;1.52;2.89	5.28	5.28	0.74379	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.43523	0.1251	L	0.33668	1.02	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.08848	-1.0702	10	0.09338	T	0.73	.	19.2751	0.94029	0.0:0.0:1.0:0.0	.	160	P15086	CBPB1_HUMAN	S	160;160;126	ENSP00000417222:G160S;ENSP00000282957:G160S;ENSP00000419427:G126S	ENSP00000282957:G160S	G	+	1	0	CPB1	150042303	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.583000	0.74053	2.644000	0.89710	0.655000	0.94253	GGC	.		0.453	CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355928.1	NM_001871	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	113347573	113347574	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr8:113347573_113347574insA	ENST00000297405.5	-	45	7393_7394	c.7149_7150insT	c.(7147-7152)tttgtgfs	p.V2384fs	CSMD3_ENST00000352409.3_Frame_Shift_Ins_p.V2314fs|CSMD3_ENST00000455883.2_Frame_Shift_Ins_p.V2280fs|CSMD3_ENST00000343508.3_Frame_Shift_Ins_p.V2344fs	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2384	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TAACTGAGCACAAAAAAGCCAC	0.351										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.V2384fs		.											.	CSMD3	1132	0			c.7150_7151insT						.																																			SO:0001589	frameshift_variant	114788	exon45			TGAGCACAAAAAA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7150dupT	8.37:g.113347579_113347579dupA	ENSP00000297405:p.Val2384fs	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	44.0	NM_198123	Q96PZ3	Frame_Shift_Ins	INS	ENST00000297405.5	37	CCDS6315.1																																																																																			.		0.351	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	41268766	41268766	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:41268766A>T	ENST00000349496.5	+	7	1284	c.1004A>T	c.(1003-1005)aAa>aTa	p.K335I	CTNNB1_ENST00000405570.1_Missense_Mutation_p.K335I|CTNNB1_ENST00000453024.1_Missense_Mutation_p.K328I|CTNNB1_ENST00000396185.3_Missense_Mutation_p.K335I|CTNNB1_ENST00000396183.3_Missense_Mutation_p.K335I	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	335					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.K335I(8)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACTTACGAAAAACTACTGTGG	0.383		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.K335I	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,Wilms_tumour,0	CTNNB1	24361	8	Substitution - Missense(8)	liver(7)|kidney(1)	c.A1004T						.						110.0	108.0	109.0					3																	41268766		2203	4300	6503	SO:0001583	missense	1499	exon7	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACGAAAAACTACT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1004A>T	3.37:g.41268766A>T	ENSP00000344456:p.Lys335Ile	Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	89.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	29.8	5.040885	0.93685	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82148	0.4974	M	0.89287	3.02	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.75484	0.97;0.986	D	0.85830	0.1391	10	0.72032	D	0.01	-3.7939	15.5934	0.76558	1.0:0.0:0.0:0.0	.	263;335	B4DSW9;P35222	.;CTNB1_HUMAN	I	335;335;335;328;335	ENSP00000385604:K335I;ENSP00000379486:K335I;ENSP00000344456:K335I;ENSP00000411226:K328I;ENSP00000379488:K335I	ENSP00000344456:K335I	K	+	2	0	CTNNB1	41243770	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.339000	0.96797	2.094000	0.63399	0.482000	0.46254	AAA	.		0.383	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CYB5R3	1727	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	43024254	43024254	+	Missense_Mutation	SNP	C	C	T	rs367914897		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr22:43024254C>T	ENST00000352397.5	-	5	619	c.367G>A	c.(367-369)Gct>Act	p.A123T	CYB5R3_ENST00000396303.3_Missense_Mutation_p.A100T|CYB5R3_ENST00000361740.4_Missense_Mutation_p.A156T|CYB5R3_ENST00000407332.1_Missense_Mutation_p.A100T|CYB5R3_ENST00000402438.1_Missense_Mutation_p.A100T|CYB5R3_ENST00000407623.3_Missense_Mutation_p.A100T	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3	123	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	TTCCCTCCAGCGGGAAACTTG	0.597																																					p.A156T		.											.	CYB5R3	91	0			c.G466A						.	C	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	147.0	146.0	146.0		367,298,466,298,298	2.9	0.1	22		146	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense,missense,missense	CYB5R3	NM_000398.6,NM_001129819.2,NM_001171660.1,NM_001171661.1,NM_007326.4	58,58,58,58,58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign,benign,benign	123/302,100/279,156/335,100/279,100/279	43024254	2,13004	2203	4300	6503	SO:0001583	missense	1727	exon5			CTCCAGCGGGAAA	M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.367G>A	22.37:g.43024254C>T	ENSP00000338461:p.Ala123Thr	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	8.0	NM_001171660	B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Missense_Mutation	SNP	ENST00000352397.5	37	CCDS33658.1	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067960	0.55539	0.0	2.33E-4	ENSG00000100243	ENST00000361740;ENST00000396303;ENST00000352397;ENST00000407623;ENST00000407332;ENST00000402438;ENST00000438270	D;D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	3.92	2.9	0.33743	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);Oxidoreductase, FAD-binding domain (1);	0.285135	0.38164	N	0.001782	T	0.76428	0.3986	L	0.60957	1.885	0.28537	N	0.912314	P;B	0.49447	0.924;0.023	B;B	0.29353	0.101;0.008	T	0.74315	-0.3705	10	0.59425	D	0.04	-4.9064	11.1764	0.48601	0.0:0.9071:0.0:0.0929	.	156;123	B7Z7L3;P00387	.;NB5R3_HUMAN	T	156;100;123;100;100;100;100	ENSP00000354468:A156T;ENSP00000379597:A100T;ENSP00000338461:A123T;ENSP00000384834:A100T;ENSP00000384457:A100T;ENSP00000385679:A100T;ENSP00000403439:A100T	ENSP00000338461:A123T	A	-	1	0	CYB5R3	41354198	0.992000	0.36948	0.072000	0.20136	0.827000	0.46813	3.627000	0.54252	1.234000	0.43709	0.555000	0.69702	GCT	.		0.597	CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320439.1		
DAPK1	1612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	90318036	90318036	+	Silent	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr9:90318036G>A	ENST00000408954.3	+	25	3299	c.2964G>A	c.(2962-2964)ctG>ctA	p.L988L	DAPK1_ENST00000469640.2_Silent_p.L1013L|DAPK1_ENST00000358077.5_Silent_p.L988L|DAPK1_ENST00000472284.1_Silent_p.L988L|DAPK1_ENST00000491893.1_Silent_p.L922L	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	988					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TGATGTCGCTGCAGCAGTTTG	0.592									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.L988L		.											.	DAPK1	359	0			c.G2964A						.						63.0	64.0	64.0					9																	90318036		2131	4240	6371	SO:0001819	synonymous_variant	1612	exon25	Familial Cancer Database	Familial CLL	GTCGCTGCAGCAG	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2964G>A	9.37:g.90318036G>A		Somatic	302.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	17.0	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	ENST00000408954.3	37	CCDS43842.1																																																																																			.		0.592	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
DENND6A	201627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57646514	57646514	+	Silent	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:57646514G>A	ENST00000311128.5	-	7	742	c.672C>T	c.(670-672)caC>caT	p.H224H		NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	224					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										TGATTGGCAGGTGTAATGTTT	0.333																																					p.H224H		.											.	.	.	0			c.C672T						.						41.0	43.0	42.0					3																	57646514		2203	4300	6503	SO:0001819	synonymous_variant	201627	exon7			TGGCAGGTGTAAT	AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.672C>T	3.37:g.57646514G>A		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	400.0	170.0	NM_152678	Q7Z5T4|Q8N235|Q8TEG8	Silent	SNP	ENST00000311128.5	37	CCDS33773.1	.	.	.	.	.	.	.	.	.	.	G	6.885	0.532775	0.13127	.	.	ENSG00000174839	ENST00000477344	.	.	.	5.02	0.0298	0.14164	.	.	.	.	.	T	0.45256	0.1333	.	.	.	0.33649	D	0.608268	.	.	.	.	.	.	T	0.50600	-0.8809	4	.	.	.	-13.231	6.5539	0.22450	0.5001:0.1257:0.3742:0.0	.	.	.	.	S	14	.	.	P	-	1	0	FAM116A	57621554	0.063000	0.20901	0.521000	0.27850	0.979000	0.70002	-0.471000	0.06631	-0.332000	0.08489	0.460000	0.39030	CCT	.		0.333	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351594.1	NM_152678	
DISC1	27185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	231830097	231830097	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr1:231830097C>A	ENST00000602281.1	+	2	646	c.593C>A	c.(592-594)aCc>aAc	p.T198N	DISC1_ENST00000366636.4_Missense_Mutation_p.T198N|DISC1_ENST00000439617.2_Missense_Mutation_p.T198N|TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000535983.1_Missense_Mutation_p.T198N|DISC1_ENST00000317586.4_Missense_Mutation_p.T198N|DISC1_ENST00000602873.1_Intron|DISC1_ENST00000537876.1_Missense_Mutation_p.T198N|DISC1_ENST00000539444.1_Missense_Mutation_p.T198N|DISC1_ENST00000366633.3_Missense_Mutation_p.T198N	NM_001164542.1|NM_001164544.1	NP_001158014.1|NP_001158016.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	198	Interaction with MAP1A.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				GTCCCCCCAACCCCTCCTGGC	0.612																																					p.T198N		.											.	DISC1	91	0			c.C593A						.						62.0	60.0	60.0					1																	231830097		2203	4300	6503	SO:0001583	missense	27185	exon2			CCCCAACCCCTCC	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000602281.1:c.593C>A	1.37:g.231830097C>A	ENSP00000473425:p.Thr198Asn	Somatic	450.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	21.0	NM_001164541	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	ENST00000602281.1	37	CCDS59205.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495903	0.26774	.	.	ENSG00000162946	ENST00000439617;ENST00000366637;ENST00000317586;ENST00000366636;ENST00000366638;ENST00000532576;ENST00000535983;ENST00000537876;ENST00000366633;ENST00000539444;ENST00000295051;ENST00000535944;ENST00000366632	T;T;T;T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83	4.61	3.7	0.42460	.	1.182920	0.05667	N	0.587932	T	0.17577	0.0422	N	0.24115	0.695	0.09310	N	1	B;P;P;P;P;P;P;P;P;P;B;P;P;P;P;P;P;P;P;P;B	0.47302	0.062;0.804;0.804;0.804;0.589;0.893;0.804;0.804;0.589;0.804;0.062;0.744;0.61;0.804;0.589;0.589;0.744;0.589;0.589;0.589;0.118	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.40134	0.069;0.32;0.225;0.32;0.211;0.32;0.32;0.32;0.211;0.32;0.094;0.271;0.154;0.32;0.211;0.211;0.211;0.211;0.211;0.211;0.094	T	0.11446	-1.0587	10	0.28530	T	0.3	0.0954	5.7571	0.18178	0.1909:0.7102:0.0:0.0988	.	198;198;198;198;198;198;198;198;198;198;198;198;198;198;198;198;198;198;198;198;198	C4P094;C4P0A3;C4P098;C4P0A1;C4P0A4;A6NLH2;C4P0A5;C4P095;C4P0B6;C4P0C4;C4P091;C4P0D2;C4P0D3;C4P0B1;A7E2W8;Q5T409;C4P0D0;Q9NRI5-2;Q9NRI5;Q9NRI5-3;Q9NRI5-4	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;DISC1_HUMAN;.;.	N	198;198;198;198;198;198;198;198;198;198;198;198;49	ENSP00000403888:T198N;ENSP00000320784:T198N;ENSP00000355596:T198N;ENSP00000443996:T198N;ENSP00000440909:T198N;ENSP00000355593:T198N;ENSP00000440953:T198N;ENSP00000295051:T198N;ENSP00000441193:T198N	ENSP00000295051:T198N	T	+	2	0	DISC1	229896720	0.002000	0.14202	0.003000	0.11579	0.026000	0.11368	1.675000	0.37555	1.145000	0.42336	0.561000	0.74099	ACC	.		0.612	DISC1-019	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467451.1	NM_018662	
DNAJA2	10294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	46991020	46991020	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr16:46991020C>A	ENST00000317089.5	-	9	1375	c.1160G>T	c.(1159-1161)aGg>aTg	p.R387M		NM_005880.3	NP_005871.1	O60884	DNJA2_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 2	387					positive regulation of cell proliferation (GO:0008284)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	14		all_cancers(37;0.00125)|all_lung(18;0.00338)|all_epithelial(9;0.00358)|Lung NSC(13;0.0309)|Breast(268;0.116)				GGCTTCACGCCTCTGACCACC	0.478																																					p.R387M		.											.	DNAJA2	226	0			c.G1160T						.						268.0	262.0	264.0					16																	46991020		2203	4300	6503	SO:0001583	missense	10294	exon9			TCACGCCTCTGAC	AF116720	CCDS10726.1	16q12.1	2011-09-02			ENSG00000069345	ENSG00000069345		"""Heat shock proteins / DNAJ (HSP40)"""	14884	protein-coding gene	gene with protein product		611322				9710638, 11147971	Standard	NM_005880		Approved	HIRIP4, DNAJ, CPR3, DNJ3	uc002eeo.2	O60884	OTTHUMG00000133104	ENST00000317089.5:c.1160G>T	16.37:g.46991020C>A	ENSP00000314030:p.Arg387Met	Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	66.0	NM_005880	B2R7L7|O14711	Missense_Mutation	SNP	ENST00000317089.5	37	CCDS10726.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739595	0.89573	.	.	ENSG00000069345	ENST00000317089	T	0.38722	1.12	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.60353	0.2262	M	0.78456	2.415	0.80722	D	1	D	0.57571	0.98	P	0.52672	0.706	T	0.64769	-0.6329	10	0.62326	D	0.03	-18.9488	19.5403	0.95271	0.0:1.0:0.0:0.0	.	387	O60884	DNJA2_HUMAN	M	387	ENSP00000314030:R387M	ENSP00000314030:R387M	R	-	2	0	DNAJA2	45548521	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.610000	0.82949	2.623000	0.88846	0.561000	0.74099	AGG	.		0.478	DNAJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256769.2		
EBNA1BP2	10969	ucsc.edu;bcgsc.ca	37	1	43637633	43637633	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr1:43637633T>C	ENST00000236051.2	-	2	215	c.74A>G	c.(73-75)gAt>gGt	p.D25G	WDR65_ENST00000372492.4_5'Flank|WDR65_ENST00000528956.1_5'Flank|EBNA1BP2_ENST00000472982.1_5'UTR|EBNA1BP2_ENST00000431635.2_Missense_Mutation_p.D80G	NM_006824.2	NP_006815.2	Q99848	EBP2_HUMAN	EBNA1 binding protein 2	25					ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)	16	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGAAAACGCATCCTGCAACTG	0.637																																					p.D80G		.											.	EBNA1BP2	90	0			c.A239G						.						88.0	75.0	79.0					1																	43637633		2203	4300	6503	SO:0001583	missense	10969	exon3			AACGCATCCTGCA	U86602	CCDS478.1, CCDS53308.1	1p35-p33	2011-02-10	2001-11-28		ENSG00000117395	ENSG00000117395			15531	protein-coding gene	gene with protein product		614443	"""EBNA1-binding protein 2"""			10074103, 11438656	Standard	NM_001159936		Approved	NOBP, EBP2, P40	uc010ojx.2	Q99848	OTTHUMG00000007284	ENST00000236051.2:c.74A>G	1.37:g.43637633T>C	ENSP00000236051:p.Asp25Gly	Somatic	201.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001159936	Q96A66	Missense_Mutation	SNP	ENST00000236051.2	37	CCDS478.1	.	.	.	.	.	.	.	.	.	.	t	25.3	4.628908	0.87560	.	.	ENSG00000117395	ENST00000431635;ENST00000236051	T;T	0.47869	0.83;0.83	5.96	5.96	0.96718	.	0.282943	0.44285	D	0.000470	T	0.52256	0.1723	L	0.34521	1.04	0.50813	D	0.999895	P;B;B	0.40578	0.722;0.196;0.196	P;B;B	0.50270	0.636;0.165;0.165	T	0.54529	-0.8280	10	0.72032	D	0.01	-4.9985	16.435	0.83872	0.0:0.0:0.0:1.0	.	25;25;25	B4DHA6;Q6IB29;Q99848	.;.;EBP2_HUMAN	G	80;25	ENSP00000407323:D80G;ENSP00000236051:D25G	ENSP00000236051:D25G	D	-	2	0	EBNA1BP2	43410220	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.992000	0.63889	2.278000	0.76064	0.529000	0.55759	GAT	.		0.637	EBNA1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019015.1		
ELMSAN1	91748	broad.mit.edu;bcgsc.ca	37	14	74205467	74205467	+	Silent	SNP	T	T	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr14:74205467T>C	ENST00000286523.5	-	2	2027	c.1245A>G	c.(1243-1245)agA>agG	p.R415R	ELMSAN1_ENST00000394071.2_Silent_p.R415R|ELMSAN1_ENST00000486739.1_5'Flank	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Q408fs*65(1)									TGGGTGCTAGTCTCTCCCCAT	0.677																																					p.R415R		.											.	.	.	1	Deletion - Frameshift(1)	kidney(1)	c.A1245G						.						26.0	26.0	26.0					14																	74205467		2203	4299	6502	SO:0001819	synonymous_variant	91748	exon2			TGCTAGTCTCTCC	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1245A>G	14.37:g.74205467T>C		Somatic	451.0	1.0		WXS	Illumina HiSeq	Phase_I	95.0	5.0	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Silent	SNP	ENST00000286523.5	37	CCDS9819.1																																																																																			.		0.677	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
EPG5	57724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	43435550	43435550	+	Silent	SNP	G	G	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr18:43435550G>C	ENST00000282041.5	-	43	7579	c.7545C>G	c.(7543-7545)ccC>ccG	p.P2515P	EPG5_ENST00000585906.1_5'Flank	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2515					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GCTGAGCTTTGGGGGTCAGAT	0.527																																					p.P2515P		.											.	EPG5	580	0			c.C7545G						.						55.0	57.0	57.0					18																	43435550		1933	4149	6082	SO:0001819	synonymous_variant	57724	exon43			AGCTTTGGGGGTC	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.7545C>G	18.37:g.43435550G>C		Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	11.0	NM_020964	A2BDF3|Q9H8C8	Silent	SNP	ENST00000282041.5	37	CCDS11926.2																																																																																			.		0.527	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
EPHA3	2042	broad.mit.edu;bcgsc.ca	37	3	89156983	89156983	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:89156983G>A	ENST00000336596.2	+	1	310	c.85G>A	c.(85-87)Gaa>Aaa	p.E29K	EPHA3_ENST00000494014.1_Missense_Mutation_p.E29K|EPHA3_ENST00000452448.2_Missense_Mutation_p.E29K	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	29	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GCCTTCCAATGAAGGTAAGCC	0.597										TSP Lung(6;0.00050)																											p.E29K		.											.	EPHA3	1500	0			c.G85A						.						108.0	87.0	94.0					3																	89156983		2203	4300	6503	SO:0001583	missense	2042	exon1			TCCAATGAAGGTA	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.85G>A	3.37:g.89156983G>A	ENSP00000337451:p.Glu29Lys	Somatic	216.0	1.0		WXS	Illumina HiSeq	Phase_I	87.0	5.0	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095011	0.56075	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.11063	2.81;2.81;2.81	5.46	4.57	0.56435	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.063428	0.64402	D	0.000015	T	0.23846	0.0577	M	0.82323	2.585	0.44825	D	0.997835	B;P	0.36874	0.076;0.572	B;B	0.43103	0.085;0.408	T	0.02567	-1.1140	9	.	.	.	.	15.7661	0.78128	0.0:0.137:0.863:0.0	.	29;29	P29320;P29320-2	EPHA3_HUMAN;.	K	29	ENSP00000337451:E29K;ENSP00000399926:E29K;ENSP00000419190:E29K	.	E	+	1	0	EPHA3	89239673	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	5.233000	0.65337	1.261000	0.44149	0.462000	0.41574	GAA	.		0.597	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
FBXL7	23194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	15937055	15937055	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr5:15937055delC	ENST00000504595.1	+	4	1717	c.1236delC	c.(1234-1236)tgcfs	p.C412fs	FBXL7_ENST00000510662.1_Frame_Shift_Del_p.C365fs|FBXL7_ENST00000329673.7_Frame_Shift_Del_p.C400fs|MIR887_ENST00000401258.1_RNA	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	412					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						TCGGCAAATGCCCTTTGGTAT	0.607																																					p.C412fs		.											.	FBXL7	228	0			c.1236delC						.						91.0	96.0	94.0					5																	15937055		2093	4214	6307	SO:0001589	frameshift_variant	23194	exon4			CAAATGCCCTTTG	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.1236delC	5.37:g.15937055delC	ENSP00000423630:p.Cys412fs	Somatic	329.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	17.0	NM_012304	B9EGF1|D6RDY7|O94926	Frame_Shift_Del	DEL	ENST00000504595.1	37	CCDS54833.1																																																																																			.		0.607	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
FDXACB1	91893	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	111746748	111746748	+	Missense_Mutation	SNP	G	G	A	rs189903941	byFrequency	TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr11:111746748G>A	ENST00000260257.4	-	5	820	c.773C>T	c.(772-774)cCg>cTg	p.P258L	FDXACB1_ENST00000542429.1_Missense_Mutation_p.P109L|C11orf1_ENST00000528125.1_5'Flank|ALG9_ENST00000524880.1_Intron|ALG9_ENST00000527377.1_5'UTR	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	258					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)	p.P258Q(2)		endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						CCTTTTTAGCGGGAAAACTTT	0.418													G|||	3	0.000599042	0.0	0.0	5008	,	,		19244	0.0		0.002	False		,,,				2504	0.001				p.P258L		.											.	FDXACB1	22	2	Substitution - Missense(2)	lung(2)	c.C773T						.	G	LEU/PRO	0,3714		0,0,1857	114.0	110.0	112.0		773	6.2	0.9	11		112	8,8168		0,8,4080	yes	missense	FDXACB1	NM_138378.2	98	0,8,5937	AA,AG,GG		0.0978,0.0,0.0673	probably-damaging	258/625	111746748	8,11882	1857	4088	5945	SO:0001583	missense	91893	exon5			TTTAGCGGGAAAA		CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.773C>T	11.37:g.111746748G>A	ENSP00000260257:p.Pro258Leu	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	35.0	NM_138378	A0PJW7|B4DUU2	Missense_Mutation	SNP	ENST00000260257.4	37	CCDS44729.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	13.43	2.233451	0.39498	0.0	9.78E-4	ENSG00000255561	ENST00000260257;ENST00000542429;ENST00000528274	T;T;T	0.74106	0.21;-0.81;0.65	6.17	6.17	0.99709	.	0.327093	0.37955	N	0.001864	T	0.75664	0.3880	M	0.62723	1.935	0.80722	D	1	D	0.59767	0.986	B	0.42087	0.375	T	0.78628	-0.2130	10	0.66056	D	0.02	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	258	Q9BRP7	FDXA1_HUMAN	L	258;109;169	ENSP00000260257:P258L;ENSP00000441304:P109L;ENSP00000435572:P169L	ENSP00000260257:P258L	P	-	2	0	FDXACB1	111251958	1.000000	0.71417	0.946000	0.38457	0.629000	0.37895	3.730000	0.55006	2.941000	0.99782	0.655000	0.94253	CCG	G|0.999;A|0.001		0.418	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391497.1	NM_138378	
FHDC1	85462	ucsc.edu;bcgsc.ca	37	4	153897270	153897270	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr4:153897270A>G	ENST00000511601.1	+	12	3015	c.2827A>G	c.(2827-2829)Aac>Gac	p.N943D	FHDC1_ENST00000260008.3_Missense_Mutation_p.N943D			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	943									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					GTCACGCCAGAACTCCGTGCG	0.701																																					p.N943D		.											.	FHDC1	136	0			c.A2827G						.						20.0	22.0	22.0					4																	153897270		2203	4297	6500	SO:0001583	missense	85462	exon11			CGCCAGAACTCCG	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2827A>G	4.37:g.153897270A>G	ENSP00000427567:p.Asn943Asp	Somatic	244.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_033393		Missense_Mutation	SNP	ENST00000511601.1	37	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	A	1.637	-0.517593	0.04171	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.29917	1.55;1.55	5.6	1.78	0.24846	.	3.490540	0.00721	N	0.000899	T	0.17109	0.0411	N	0.08118	0	0.18873	N	0.999981	B	0.12013	0.005	B	0.11329	0.006	T	0.16808	-1.0390	10	0.21014	T	0.42	.	5.2327	0.15430	0.6329:0.1384:0.2287:0.0	.	943	Q9C0D6	FHDC1_HUMAN	D	943	ENSP00000427567:N943D;ENSP00000260008:N943D	ENSP00000260008:N943D	N	+	1	0	FHDC1	154116720	0.291000	0.24352	0.035000	0.18076	0.018000	0.09664	2.409000	0.44583	0.075000	0.16796	0.533000	0.62120	AAC	.		0.701	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
FRG1	2483	bcgsc.ca;mdanderson.org	37	4	190876283	190876283	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr4:190876283C>A	ENST00000226798.4	+	5	631	c.409C>A	c.(409-411)Caa>Aaa	p.Q137K	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	137					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ACCAAGAGAACAATGGGAACC	0.353																																					p.Q137K		.											.	FRG1	90	0			c.C409A						.						88.0	87.0	87.0					4																	190876283		2203	4300	6503	SO:0001583	missense	2483	exon5			AGAGAACAATGGG	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.409C>A	4.37:g.190876283C>A	ENSP00000226798:p.Gln137Lys	Somatic	123.0	2.0		WXS	Illumina HiSeq	Phase_1	468.0	35.0	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	16.72	3.202137	0.58234	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.49139	2.03;0.79	4.04	4.04	0.47022	Actin cross-linking (1);	0.103449	0.64402	D	0.000002	T	0.54902	0.1887	M	0.88377	2.95	0.80722	D	1	B	0.11235	0.004	B	0.15484	0.013	T	0.60078	-0.7333	10	0.42905	T	0.14	-3.5101	14.1451	0.65347	0.0:1.0:0.0:0.0	.	137	Q14331	FRG1_HUMAN	K	137;74	ENSP00000226798:Q137K;ENSP00000435943:Q74K	ENSP00000226798:Q137K	Q	+	1	0	FRG1	191113277	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.292000	0.78731	1.964000	0.57103	0.567000	0.79289	CAA	.		0.353	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
GAREM	64762	broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	29867589	29867589	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr18:29867589T>C	ENST00000269209.6	-	4	974	c.971A>G	c.(970-972)cAt>cGt	p.H324R	GAREM_ENST00000399218.4_Missense_Mutation_p.H324R|GAREM_ENST00000578619.1_5'Flank|RP11-344B2.2_ENST00000579580.1_RNA			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	324					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										TAGCCAGTGATGGACCAGGGT	0.532																																					p.H324R		.											.	.	.	0			c.A971G						.						87.0	82.0	84.0					18																	29867589		2203	4300	6503	SO:0001583	missense	64762	exon4			CAGTGATGGACCA	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.971A>G	18.37:g.29867589T>C	ENSP00000269209:p.His324Arg	Somatic	285.0	1.0		WXS	Illumina HiSeq	Phase_I	110.0	25.0	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	T	14.26	2.481341	0.44147	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.12774	2.65;2.65	5.49	5.49	0.81192	.	0.142257	0.64402	D	0.000004	T	0.04679	0.0127	N	0.01267	-0.92	0.45046	D	0.998067	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.27157	-1.0082	10	0.02654	T	1	-17.4637	15.8736	0.79145	0.0:0.0:0.0:1.0	.	324;324	Q9H706;Q9H706-3	FA59A_HUMAN;.	R	324	ENSP00000382165:H324R;ENSP00000269209:H324R	ENSP00000269209:H324R	H	-	2	0	FAM59A	28121587	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.846000	0.69444	2.215000	0.71742	0.459000	0.35465	CAT	.		0.532	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
GDPD4	220032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	76969478	76969478	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr11:76969478C>T	ENST00000376217.2	-	10	1067	c.817G>A	c.(817-819)Gat>Aat	p.D273N	GDPD4_ENST00000315938.4_Missense_Mutation_p.D273N			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	273	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						GATAGGAAATCCCAGTTGAAG	0.438																																					p.D273N		.											.	GDPD4	69	0			c.G817A						.						149.0	144.0	146.0					11																	76969478		2200	4292	6492	SO:0001583	missense	220032	exon10			GGAAATCCCAGTT	AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.817G>A	11.37:g.76969478C>T	ENSP00000365390:p.Asp273Asn	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	93.0	NM_182833	Q7Z5B0	Missense_Mutation	SNP	ENST00000376217.2	37		.	.	.	.	.	.	.	.	.	.	C	9.854	1.194494	0.22037	.	.	ENSG00000178795	ENST00000376217;ENST00000315938	T;T	0.30448	1.53;1.53	4.84	-9.68	0.00528	.	1.705610	0.02590	N	0.099851	T	0.20292	0.0488	L	0.45228	1.405	0.09310	N	0.999999	B	0.32467	0.372	B	0.30316	0.114	T	0.05037	-1.0910	10	0.21014	T	0.42	0.3622	8.3392	0.32232	0.0:0.1276:0.1973:0.6751	.	273	Q6W3E5-2	.	N	273	ENSP00000365390:D273N;ENSP00000320815:D273N	ENSP00000320815:D273N	D	-	1	0	GDPD4	76647126	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-1.641000	0.02007	-1.708000	0.01401	-0.367000	0.07326	GAT	.		0.438	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382075.1	NM_182833	
GJB1	2705	hgsc.bcm.edu;broad.mit.edu	37	X	70443636	70443637	+	In_Frame_Ins	INS	-	-	TCATCT			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chrX:70443636_70443637insTCATCT	ENST00000374022.3	+	2	174_175	c.79_80insTCATCT	c.(79-81)gtc>gTCATCTtc	p.31_32insIF	GJB1_ENST00000374029.1_In_Frame_Ins_p.31_32insIF|GJB1_ENST00000361726.6_In_Frame_Ins_p.31_32insIF	NM_001097642.2	NP_001091111.1	P08034	CXB1_HUMAN	gap junction protein, beta 1, 32kDa	31					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)|purine ribonucleotide transport (GO:0015868)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(1)	10	Renal(35;0.156)					ATGGCTCTCGGTCATCTTCATC	0.53																																					p.V27delinsVIF		.											.	GJB1	193	0			c.79_80insTCATCT						.																																			SO:0001652	inframe_insertion	2705	exon2			CTCTCGGTCATCT	X04325	CCDS14408.1	Xq13.1	2014-09-17	2007-01-16		ENSG00000169562	ENSG00000169562		"""Ion channels / Gap junction proteins (connexins)"""	4283	protein-coding gene	gene with protein product	"""Charcot-Marie-Tooth neuropathy, X-linked"", ""connexin 32"""	304040	"""gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32)"""	CMTX1, CMTX		1319395	Standard	NM_000166		Approved	CX32	uc004dzf.3	P08034	OTTHUMG00000021797	ENST00000374022.3:c.86_91dupTCATCT	X.37:g.70443637_70443642dupTCATCT	ENSP00000363134:p.Ile30_Phe31dup	Somatic	322.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	40.0	NM_001097642	B2R8R2|D3DVV2|Q5U0S4	In_Frame_Ins	INS	ENST00000374022.3	37	CCDS14408.1																																																																																			.		0.530	GJB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057133.1	NM_000166	
GMIP	51291	ucsc.edu;bcgsc.ca	37	19	19744903	19744903	+	Silent	SNP	T	T	C	rs376288223		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr19:19744903T>C	ENST00000203556.4	-	19	2318	c.2181A>G	c.(2179-2181)gcA>gcG	p.A727A	GMIP_ENST00000587238.1_Silent_p.A701A|GMIP_ENST00000445806.2_Silent_p.A698A|GMIP_ENST00000586269.1_5'Flank	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	727	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						TGGCGCTGGCTGCCCGCGGGC	0.612																																					p.A727A		.											.	GMIP	91	0			c.A2181G						.						36.0	40.0	39.0					19																	19744903		2202	4297	6499	SO:0001819	synonymous_variant	51291	exon19			GCTGGCTGCCCGC	AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.2181A>G	19.37:g.19744903T>C		Somatic	160.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_016573	A0AVN9|B7ZLZ0	Silent	SNP	ENST00000203556.4	37	CCDS12408.1																																																																																			.		0.612	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460551.1	NM_016573	
GNB5	10681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	52476791	52476791	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr15:52476791T>A	ENST00000261837.7	-	2	148	c.83A>T	c.(82-84)aAg>aTg	p.K28M	RP11-430B1.2_ENST00000560518.1_lincRNA	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	28					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		TTGAGACTTCTTGAAAACTGG	0.378																																					p.K28M		.											.	GNB5	227	0			c.A83T						.						129.0	123.0	125.0					15																	52476791		2195	4293	6488	SO:0001583	missense	10681	exon2			GACTTCTTGAAAA	AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.83A>T	15.37:g.52476791T>A	ENSP00000261837:p.Lys28Met	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	37.0	NM_016194	B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	ENST00000261837.7	37	CCDS10149.1	.	.	.	.	.	.	.	.	.	.	T	14.42	2.528624	0.44969	.	.	ENSG00000069966	ENST00000261837	T	0.61627	0.09	5.78	4.63	0.57726	.	0.222920	0.29480	N	0.012030	T	0.46308	0.1386	L	0.36672	1.1	0.80722	D	1	B	0.19445	0.036	B	0.17979	0.02	T	0.47235	-0.9133	10	0.59425	D	0.04	-28.8729	10.0548	0.42239	0.2612:0.0:0.0:0.7388	.	28	O14775	GBB5_HUMAN	M	28	ENSP00000261837:K28M	ENSP00000261837:K28M	K	-	2	0	GNB5	50264083	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.474000	0.60203	2.195000	0.70347	0.528000	0.53228	AAG	.		0.378	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254842.1		
GRAMD4	23151	ucsc.edu;bcgsc.ca	37	22	47058978	47058978	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr22:47058978T>C	ENST00000406902.1	+	6	721	c.508T>C	c.(508-510)Ttc>Ctc	p.F170L	GRAMD4_ENST00000361034.3_Missense_Mutation_p.F170L			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	170					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		GCAGAAGTGGTTCTACGAGCG	0.672																																					p.F170L		.											.	GRAMD4	23	0			c.T508C						.						55.0	58.0	57.0					22																	47058978		2203	4300	6503	SO:0001583	missense	23151	exon5			AAGTGGTTCTACG		CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.508T>C	22.37:g.47058978T>C	ENSP00000385689:p.Phe170Leu	Somatic	100.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_015124	A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	ENST00000406902.1	37	CCDS33672.1	.	.	.	.	.	.	.	.	.	.	T	3.551	-0.091583	0.07053	.	.	ENSG00000075240	ENST00000406902;ENST00000361034	T;T	0.39592	1.07;1.07	4.77	2.61	0.31194	.	0.123610	0.53938	N	0.000046	T	0.15349	0.0370	N	0.03608	-0.345	0.38648	D	0.951766	B	0.06786	0.001	B	0.06405	0.002	T	0.15983	-1.0418	10	0.06494	T	0.89	-28.1438	7.7897	0.29112	0.0:0.1818:0.0:0.8181	.	170	Q6IC98	GRAM4_HUMAN	L	170	ENSP00000385689:F170L;ENSP00000354313:F170L	ENSP00000354313:F170L	F	+	1	0	GRAMD4	45437642	1.000000	0.71417	0.990000	0.47175	0.675000	0.39556	1.374000	0.34283	0.398000	0.25338	0.456000	0.33151	TTC	.		0.672	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317969.1	NM_015124	
GRIN3B	116444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	1004576	1004576	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr19:1004576G>A	ENST00000234389.3	+	3	1095	c.1076G>A	c.(1075-1077)aGc>aAc	p.S359N	AC004528.4_ENST00000588380.1_RNA|GRIN3B_ENST00000588335.1_3'UTR	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	359					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTGACAGGCAGCTCCCAGGTA	0.706																																					p.S359N		.											.	GRIN3B	90	0			c.G1076A						.						17.0	17.0	17.0					19																	1004576		2184	4272	6456	SO:0001583	missense	116444	exon3			CAGGCAGCTCCCA		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1076G>A	19.37:g.1004576G>A	ENSP00000234389:p.Ser359Asn	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	12.0	NM_138690	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	.	.	.	.	.	.	.	.	.	.	G	1.505	-0.551022	0.03996	.	.	ENSG00000116032	ENST00000234389	D	0.83591	-1.74	4.6	2.25	0.28309	.	2.023840	0.02223	N	0.064182	T	0.73776	0.3630	L	0.36672	1.1	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.57528	-0.7796	10	0.02654	T	1	.	7.6082	0.28113	0.3028:0.5331:0.1641:0.0	.	359	O60391	NMD3B_HUMAN	N	359	ENSP00000234389:S359N	ENSP00000234389:S359N	S	+	2	0	GRIN3B	955576	0.000000	0.05858	0.312000	0.25196	0.116000	0.19942	0.244000	0.18124	0.915000	0.36847	-0.507000	0.04495	AGC	.		0.706	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65214794	65214794	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr17:65214794C>A	ENST00000358691.5	-	4	293	c.127G>T	c.(127-129)Gac>Tac	p.D43Y	HELZ_ENST00000580168.1_Missense_Mutation_p.D43Y|HELZ_ENST00000580662.1_5'UTR	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	43						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CCTGTGAAGTCTGCCATGGAG	0.458																																					p.D43Y		.											.	HELZ	92	0			c.G127T						.						139.0	133.0	135.0					17																	65214794		1910	4120	6030	SO:0001583	missense	9931	exon4			TGAAGTCTGCCAT	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.127G>T	17.37:g.65214794C>A	ENSP00000351524:p.Asp43Tyr	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	33.0	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	c	10.18	1.278784	0.23307	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	T;T	0.73363	-0.74;-0.74	5.14	4.08	0.47627	.	0.294619	0.37577	N	0.002035	T	0.48750	0.1517	N	0.08118	0	0.28778	N	0.9	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.08055	0.0;0.003;0.0	T	0.29792	-1.0000	10	0.45353	T	0.12	-16.3031	3.4952	0.07653	0.158:0.5465:0.1778:0.1177	.	43;43;43	B7ZLW2;F8WBX6;P42694	.;.;HELZ_HUMAN	Y	43	ENSP00000351524:D43Y;ENSP00000411144:D43Y	ENSP00000351524:D43Y	D	-	1	0	HELZ	62645256	0.526000	0.26298	0.857000	0.33713	0.825000	0.46686	0.971000	0.29396	2.382000	0.81193	0.460000	0.39030	GAC	.		0.458	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
HTR7	3363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	92508894	92508894	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr10:92508894C>T	ENST00000336152.3	-	2	1023	c.997G>A	c.(997-999)Gtc>Atc	p.V333I	HTR7_ENST00000371719.2_Missense_Mutation_p.V333I|HTR7_ENST00000277874.6_Missense_Mutation_p.V333I|HTR7_ENST00000371721.3_Missense_Mutation_p.V333I	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	333					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	AAGGCCCCGACGATGATCCCC	0.537																																					p.V333I		.											.	HTR7	91	0			c.G997A						.						81.0	73.0	76.0					10																	92508894		2203	4300	6503	SO:0001583	missense	3363	exon2			CCCCGACGATGAT	BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.997G>A	10.37:g.92508894C>T	ENSP00000337949:p.Val333Ile	Somatic	252.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	43.0	NM_019860	B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	ENST00000336152.3	37	CCDS7408.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301775	0.81136	.	.	ENSG00000148680	ENST00000336152;ENST00000277874;ENST00000371719;ENST00000371721	T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.82033	0.4949	L	0.50993	1.605	0.50467	D	0.999875	D;D	0.76494	0.999;0.996	P;P	0.60886	0.88;0.803	T	0.83054	-0.0151	10	0.59425	D	0.04	.	19.0553	0.93062	0.0:1.0:0.0:0.0	.	333;333	P34969;P34969-2	5HT7R_HUMAN;.	I	333	ENSP00000337949:V333I;ENSP00000277874:V333I;ENSP00000360784:V333I;ENSP00000360786:V333I	ENSP00000277874:V333I	V	-	1	0	HTR7	92498874	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.086000	0.71352	2.499000	0.84300	0.650000	0.86243	GTC	.		0.537	HTR7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049343.1	NM_000872	
IGFALS	3483	ucsc.edu;bcgsc.ca	37	16	1841215	1841215	+	Missense_Mutation	SNP	G	G	T	rs370923559		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr16:1841215G>T	ENST00000215539.3	-	2	1314	c.1204C>A	c.(1204-1206)Cgc>Agc	p.R402S	IGFALS_ENST00000415638.3_Missense_Mutation_p.R440S			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	402					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						GTGTGCGGGCGGATGCGTCCC	0.682																																					p.R440S		.											.	IGFALS	90	0			c.C1318A						.						24.0	30.0	28.0					16																	1841215		2196	4297	6493	SO:0001583	missense	3483	exon2			GCGGGCGGATGCG	M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.1204C>A	16.37:g.1841215G>T	ENSP00000215539:p.Arg402Ser	Somatic	178.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_001146006	B4DZY8|E9PGU3	Missense_Mutation	SNP	ENST00000215539.3	37	CCDS10446.1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.482500	0.01027	.	.	ENSG00000099769	ENST00000215539;ENST00000415638	T;T	0.22134	1.97;1.97	5.07	4.11	0.48088	.	0.816117	0.10968	N	0.614129	T	0.08313	0.0207	N	0.04260	-0.245	0.09310	N	0.999998	B;B	0.26512	0.069;0.151	B;B	0.22601	0.04;0.04	T	0.30563	-0.9974	10	0.06365	T	0.9	.	7.9269	0.29880	0.0:0.162:0.565:0.273	.	440;402	E9PGU3;P35858	.;ALS_HUMAN	S	402;440	ENSP00000215539:R402S;ENSP00000416683:R440S	ENSP00000215539:R402S	R	-	1	0	IGFALS	1781216	0.566000	0.26618	0.010000	0.14722	0.193000	0.23685	0.867000	0.27968	1.125000	0.41998	0.556000	0.70494	CGC	.		0.682	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250509.2		
INTS4	92105	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	77672039	77672039	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr11:77672039T>A	ENST00000534064.1	-	5	651	c.617A>T	c.(616-618)gAc>gTc	p.D206V	INTS4_ENST00000529807.1_Missense_Mutation_p.D206V	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	206					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			TGGGTCTTGGTCACTGAAGTA	0.403																																					p.D206V		.											.	INTS4	92	0			c.A617T						.						225.0	214.0	218.0					11																	77672039		2200	4292	6492	SO:0001583	missense	92105	exon5			TCTTGGTCACTGA	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.617A>T	11.37:g.77672039T>A	ENSP00000434466:p.Asp206Val	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	23.0	NM_033547	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.366516	0.82463	.	.	ENSG00000149262	ENST00000534064;ENST00000354849;ENST00000529807	T;T	0.29917	1.55;1.55	4.48	4.48	0.54585	Armadillo-like helical (1);Armadillo-type fold (1);	0.102503	0.64402	D	0.000005	T	0.52677	0.1749	M	0.70275	2.135	0.80722	D	1	D	0.67145	0.996	D	0.67382	0.951	T	0.58578	-0.7612	10	0.87932	D	0	-15.2985	14.2195	0.65818	0.0:0.0:0.0:1.0	.	206	Q96HW7	INT4_HUMAN	V	206;57;206	ENSP00000434466:D206V;ENSP00000433644:D206V	ENSP00000346913:D57V	D	-	2	0	INTS4	77349687	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.146000	0.77373	1.999000	0.58509	0.528000	0.53228	GAC	.		0.403	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
KALRN	8997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	124165646	124165646	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:124165646C>G	ENST00000240874.3	+	21	3617	c.3460C>G	c.(3460-3462)Ctc>Gtc	p.L1154V	KALRN_ENST00000460856.1_Missense_Mutation_p.L1145V|KALRN_ENST00000360013.3_Missense_Mutation_p.L1154V	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1154					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TGAATTTTACCTCTCAACACA	0.488																																					p.L1154V		.											.	KALRN	738	0			c.C3460G						.						125.0	127.0	127.0					3																	124165646		2203	4300	6503	SO:0001583	missense	8997	exon21			TTTTACCTCTCAA	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3460C>G	3.37:g.124165646C>G	ENSP00000240874:p.Leu1154Val	Somatic	13.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	29.0	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.972333	0.92919	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.54071	0.59;0.59;0.59	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000001	T	0.72590	0.3479	M	0.73217	2.22	0.80722	D	1	P;P;D;P	0.69078	0.933;0.921;0.997;0.918	P;P;D;P	0.79108	0.718;0.901;0.992;0.596	T	0.70945	-0.4734	10	0.44086	T	0.13	.	19.3628	0.94448	0.0:1.0:0.0:0.0	.	1145;500;1154;1154	C9IZQ6;F2Z3Q6;O60229;O60229-2	.;.;KALRN_HUMAN;.	V	1145;1154;1154	ENSP00000418611:L1145V;ENSP00000240874:L1154V;ENSP00000353109:L1154V	ENSP00000240874:L1154V	L	+	1	0	KALRN	125648336	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.782000	0.62396	2.802000	0.96397	0.561000	0.74099	CTC	.		0.488	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
KCNH1	3756	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	211093326	211093326	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr1:211093326T>C	ENST00000271751.4	-	7	1145	c.1118A>G	c.(1117-1119)gAa>gGa	p.E373G	KCNH1_ENST00000367007.4_Missense_Mutation_p.E346G			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	373					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		AGCTCCATATTCAATGTAGTG	0.552																																					p.E373G		.											.	KCNH1	94	0			c.A1118G						.						120.0	120.0	120.0					1																	211093326		2203	4300	6503	SO:0001583	missense	3756	exon7			CCATATTCAATGT	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1118A>G	1.37:g.211093326T>C	ENSP00000271751:p.Glu373Gly	Somatic	481.0	1.0		WXS	Illumina HiSeq	Phase_I	156.0	33.0	NM_172362	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.672251	0.88348	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98150	-4.75;-4.75	5.69	5.69	0.88448	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98661	0.9551	M	0.84846	2.72	0.80722	D	1	P;P	0.50369	0.934;0.934	D;D	0.64687	0.928;0.928	D	0.99675	1.0997	10	0.87932	D	0	.	15.1339	0.72549	0.0:0.0:0.0:1.0	.	346;373	Q14CL3;O95259	.;KCNH1_HUMAN	G	373;346	ENSP00000271751:E373G;ENSP00000355974:E346G	ENSP00000271751:E373G	E	-	2	0	KCNH1	209159949	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.751000	0.85126	2.173000	0.68751	0.533000	0.62120	GAA	.		0.552	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
KCTD20	222658	hgsc.bcm.edu;mdanderson.org	37	6	36447368	36447368	+	Splice_Site	SNP	G	G	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr6:36447368G>T	ENST00000373731.2	+	5	929	c.538G>T	c.(538-540)Gat>Tat	p.D180Y	KCTD20_ENST00000544295.1_Intron|KCTD20_ENST00000474988.1_Intron|KCTD20_ENST00000449081.2_Intron|KCTD20_ENST00000536244.1_Splice_Site_p.D35Y	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	180	BTB.				protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						CTATTTACAGGATTATTACAA	0.353																																					p.D180Y		.											.	KCTD20	92	0			c.G538T						.						109.0	106.0	107.0					6																	36447368		2203	4300	6503	SO:0001630	splice_region_variant	222658	exon5			TTACAGGATTATT	BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.538-1G>T	6.37:g.36447368G>T		Somatic	11.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	11.0	NM_173562	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Missense_Mutation	SNP	ENST00000373731.2	37	CCDS4821.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170316	0.78452	.	.	ENSG00000112078	ENST00000373731;ENST00000536244	D;D	0.82433	-1.61;-1.61	5.01	5.01	0.66863	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.90338	0.6977	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89978	0.4098	9	.	.	.	-26.3868	18.5249	0.90968	0.0:0.0:1.0:0.0	.	180	Q7Z5Y7	KCD20_HUMAN	Y	180;35	ENSP00000362836:D180Y;ENSP00000439118:D35Y	.	D	+	1	0	KCTD20	36555346	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	9.657000	0.98554	2.602000	0.87976	0.591000	0.81541	GAT	.		0.353	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562	Missense_Mutation
KLF9	687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	73027906	73027906	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr9:73027906G>C	ENST00000377126.2	-	1	1634	c.374C>G	c.(373-375)tCc>tGc	p.S125C		NM_001206.2	NP_001197.1	Q13886	KLF9_HUMAN	Kruppel-like factor 9	125					cellular response to thyroid hormone stimulus (GO:0097067)|embryo implantation (GO:0007566)|progesterone receptor signaling pathway (GO:0050847)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|lung(1)|prostate(2)|urinary_tract(1)	9						ATGGAGGAGGGAGAGCGGGCT	0.612																																					p.S125C		.											.	KLF9	90	0			c.C374G						.						92.0	95.0	94.0					9																	73027906		2203	4300	6503	SO:0001583	missense	687	exon1			AGGAGGGAGAGCG	BC069431	CCDS6633.1	9q21.11	2013-01-08	2004-11-29	2004-12-01	ENSG00000119138	ENSG00000119138		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	1123	protein-coding gene	gene with protein product		602902	"""basic transcription element binding protein 1"""	BTEB1		1356762	Standard	NM_001206		Approved		uc004aht.3	Q13886	OTTHUMG00000019991	ENST00000377126.2:c.374C>G	9.37:g.73027906G>C	ENSP00000366330:p.Ser125Cys	Somatic	558.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	42.0	NM_001206	B2R943|Q16196	Missense_Mutation	SNP	ENST00000377126.2	37	CCDS6633.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405712	0.42715	.	.	ENSG00000119138	ENST00000377126	T	0.05996	3.36	4.55	4.55	0.56014	.	0.219783	0.31636	N	0.007316	T	0.04861	0.0131	N	0.22421	0.69	0.35635	D	0.810482	P	0.43352	0.804	B	0.34652	0.187	T	0.49943	-0.8885	10	0.34782	T	0.22	.	15.1803	0.72952	0.0:0.0:1.0:0.0	.	125	Q13886	KLF9_HUMAN	C	125	ENSP00000366330:S125C	ENSP00000366330:S125C	S	-	2	0	KLF9	72217726	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.905000	0.39878	2.250000	0.74265	0.557000	0.71058	TCC	.		0.612	KLF9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052602.1	NM_001206	
LAMA2	3908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	129637033	129637033	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr6:129637033G>A	ENST00000421865.2	+	26	3911	c.3862G>A	c.(3862-3864)Gtc>Atc	p.V1288I		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1288	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TAGAATTATCGTCAGGCATAT	0.418																																					p.V1288I		.											.	LAMA2	162	0			c.G3862A						.						110.0	111.0	111.0					6																	129637033		2203	4300	6503	SO:0001583	missense	3908	exon26			ATTATCGTCAGGC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.3862G>A	6.37:g.129637033G>A	ENSP00000400365:p.Val1288Ile	Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	11.0	NM_000426	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	6.966	0.548237	0.13312	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.34667	1.35	5.55	-8.19	0.01049	Laminin B type IV (2);Laminin B, subgroup (1);	1.139610	0.06183	N	0.679911	T	0.11707	0.0285	N	0.25647	0.755	0.09310	N	0.999995	B;B	0.14805	0.011;0.011	B;B	0.09377	0.004;0.004	T	0.09509	-1.0671	10	0.48119	T	0.1	.	19.8259	0.96617	0.2743:0.0:0.7257:0.0	.	1288;1288	A6NF00;P24043	.;LAMA2_HUMAN	I	1288	ENSP00000400365:V1288I	ENSP00000346769:V1288I	V	+	1	0	LAMA2	129678726	0.002000	0.14202	0.311000	0.25182	0.940000	0.58332	-0.187000	0.09656	-1.575000	0.01655	-1.083000	0.02208	GTC	.		0.418	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
LARGE	9215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	22	33960897	33960897	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr22:33960897C>T	ENST00000354992.2	-	7	1295	c.724G>A	c.(724-726)Gac>Aac	p.D242N	LARGE_ENST00000337431.2_Missense_Mutation_p.D242N|LARGE_ENST00000397394.2_Missense_Mutation_p.D242N|LARGE_ENST00000402320.1_Missense_Mutation_p.D242N|LARGE_ENST00000452586.2_Missense_Mutation_p.D41N|LARGE_ENST00000437602.2_Missense_Mutation_p.D242N	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	242					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				ATATCCGTGTCAAGGACGATG	0.473																																					p.D242N	Colon(70;397 1175 4573 19089 45288)	.											.	LARGE	92	0			c.G724A						.						141.0	122.0	129.0					22																	33960897		2203	4300	6503	SO:0001583	missense	9215	exon7			CCGTGTCAAGGAC	AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.724G>A	22.37:g.33960897C>T	ENSP00000347088:p.Asp242Asn	Somatic	13.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	46.0	NM_004737	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	ENST00000354992.2	37	CCDS13912.1	.	.	.	.	.	.	.	.	.	.	C	36	5.793450	0.96952	.	.	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602;ENST00000421768	D;D;D;D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06;-3.06;-3.06;-3.06	6.16	6.16	0.99307	.	0.082524	0.85682	D	0.000000	D	0.97532	0.9192	H	0.94886	3.595	0.80722	D	1	D;D;D;D	0.89917	1.0;0.982;1.0;1.0	D;D;D;D	0.85130	0.997;0.968;0.995;0.995	D	0.97567	1.0102	10	0.87932	D	0	-5.881	20.8598	0.99761	0.0:1.0:0.0:0.0	.	242;41;242;242	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	N	242;242;242;242;41;242;41	ENSP00000347088:D242N;ENSP00000336636:D242N;ENSP00000380549:D242N;ENSP00000385223:D242N;ENSP00000407917:D41N;ENSP00000388544:D242N;ENSP00000403841:D41N	ENSP00000336636:D242N	D	-	1	0	LARGE	32290897	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	7.414000	0.80117	2.937000	0.99478	0.650000	0.86243	GAC	.		0.473	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642	
LILRB5	10990	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54760149	54760149	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr19:54760149C>T	ENST00000316219.5	-	4	519	c.412G>A	c.(412-414)Gga>Aga	p.G138R	LILRB5_ENST00000450632.1_Missense_Mutation_p.G129R|LILRB5_ENST00000449561.2_Missense_Mutation_p.G138R|LILRB5_ENST00000345866.6_Intron	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	138	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTCACATTTCCTCCTGAGGCC	0.542																																					p.G138R		.											.	LILRB5	92	0			c.G412A						.						75.0	82.0	80.0					19																	54760149		2203	4300	6503	SO:0001583	missense	10990	exon4			CATTTCCTCCTGA	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.412G>A	19.37:g.54760149C>T	ENSP00000320390:p.Gly138Arg	Somatic	96.0	1.0		WXS	Illumina HiSeq	Phase_I	35.0	10.0	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586358	0.46110	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561	T;T;T	0.00776	5.71;5.71;5.71	3.16	1.99	0.26369	Immunoglobulin-like fold (1);	0.530310	0.17133	N	0.185765	T	0.02610	0.0079	M	0.64676	1.99	0.23186	N	0.998157	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.80764	0.994;0.982;0.969	T	0.34725	-0.9817	10	0.66056	D	0.02	.	7.5547	0.27817	0.0:0.7323:0.2677:0.0	.	129;138;138	C9JMK7;O75023-3;O75023	.;.;LIRB5_HUMAN	R	138;129;138	ENSP00000320390:G138R;ENSP00000414225:G129R;ENSP00000406478:G138R	ENSP00000320390:G138R	G	-	1	0	LILRB5	59451961	0.071000	0.21146	0.752000	0.31206	0.033000	0.12548	0.908000	0.28545	1.764000	0.52075	0.573000	0.79308	GGA	.		0.542	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
LMAN1	3998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	56998712	56998712	+	Silent	SNP	C	C	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr18:56998712C>A	ENST00000251047.5	-	12	2151	c.1434G>T	c.(1432-1434)acG>acT	p.T478T		NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	478					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TGAAGTGGACCGTAGACAAAC	0.348																																					p.T478T		.											.	LMAN1	91	0			c.G1434T						.						131.0	125.0	127.0					18																	56998712		2203	4300	6503	SO:0001819	synonymous_variant	3998	exon12			GTGGACCGTAGAC	X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.1434G>T	18.37:g.56998712C>A		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	21.0	NM_005570	Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Silent	SNP	ENST00000251047.5	37	CCDS11974.1																																																																																			.		0.348	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256129.2	NM_005570	
MLXIPL	51085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	73020290	73020290	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr7:73020290A>G	ENST00000313375.3	-	6	817	c.770T>C	c.(769-771)tTc>tCc	p.F257S	MLXIPL_ENST00000414749.2_Missense_Mutation_p.F257S|MLXIPL_ENST00000434326.1_Intron|MLXIPL_ENST00000429400.2_Missense_Mutation_p.F257S|MLXIPL_ENST00000395189.1_Intron|MLXIPL_ENST00000354613.1_Missense_Mutation_p.F257S	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	257					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				AGTCATGGTGAAGAGAGTGTC	0.627																																					p.F257S		.											.	MLXIPL	91	0			c.T770C						.						36.0	33.0	34.0					7																	73020290		2201	4300	6501	SO:0001583	missense	51085	exon6			ATGGTGAAGAGAG	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.770T>C	7.37:g.73020290A>G	ENSP00000320886:p.Phe257Ser	Somatic	220.0	1.0		WXS	Illumina HiSeq	Phase_I	54.0	28.0	NM_032954	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	ENST00000313375.3	37	CCDS5553.1	.	.	.	.	.	.	.	.	.	.	A	14.15	2.450017	0.43531	.	.	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000456640	T;T;T;T;T	0.58940	1.13;1.18;1.13;1.17;0.3	3.62	3.62	0.41486	.	0.000000	0.85682	D	0.000000	T	0.72301	0.3443	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.69078	0.995;0.997;0.997;0.997	D;D;D;D	0.75484	0.969;0.986;0.986;0.986	T	0.74677	-0.3585	10	0.87932	D	0	-19.6467	8.5243	0.33296	1.0:0.0:0.0:0.0	.	257;257;257;257	Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	MLXPL_HUMAN;.;.;.	S	257;257;257;257;219	ENSP00000412330:F257S;ENSP00000406296:F257S;ENSP00000320886:F257S;ENSP00000346629:F257S;ENSP00000402615:F219S	ENSP00000320886:F257S	F	-	2	0	MLXIPL	72658226	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	7.470000	0.80973	1.508000	0.48769	0.260000	0.18958	TTC	.		0.627	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1077628	1077628	+	Silent	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr11:1077628G>A	ENST00000441003.2	+	3	405	c.378G>A	c.(376-378)ctG>ctA	p.L126L	MUC2_ENST00000359061.5_Silent_p.L126L	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	126	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCCCCGGGCTGCTCATTGAGA	0.672																																					p.L126L		.											.	MUC2	90	0			c.G378A						.						32.0	38.0	36.0					11																	1077628		1960	4126	6086	SO:0001819	synonymous_variant	4583	exon3			CGGGCTGCTCATT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.378G>A	11.37:g.1077628G>A		Somatic	382.0	1.0		WXS	Illumina HiSeq	Phase_I	82.0	22.0	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.672	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
NAV2	89797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	19955620	19955620	+	Silent	SNP	C	C	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr11:19955620C>G	ENST00000396087.3	+	8	1998	c.1899C>G	c.(1897-1899)tcC>tcG	p.S633S	NAV2_ENST00000360655.4_Silent_p.S546S|NAV2_ENST00000540292.1_Silent_p.S564S|NAV2_ENST00000396085.1_Silent_p.S610S|NAV2_ENST00000527559.2_Silent_p.S562S|NAV2_ENST00000349880.4_Silent_p.S610S	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	633	Poly-Ser.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						GCAGACACTCCAGTTCCTCTT	0.637																																					p.S633S		.											.	NAV2	96	0			c.C1899G						.						49.0	52.0	51.0					11																	19955620		2199	4293	6492	SO:0001819	synonymous_variant	89797	exon8			ACACTCCAGTTCC	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.1899C>G	11.37:g.19955620C>G		Somatic	316.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	30.0	NM_001244963	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	CCDS58126.1																																																																																			.		0.637	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
NEUROD4	58158	ucsc.edu;mdanderson.org	37	12	55420793	55420793	+	Silent	SNP	T	T	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr12:55420793T>C	ENST00000242994.3	+	2	948	c.570T>C	c.(568-570)tcT>tcC	p.S190S		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	190					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						AGGATAAATCTCCTATTTGTG	0.517																																					p.S190S		.											.	NEUROD4	94	0			c.T570C						.						82.0	86.0	84.0					12																	55420793		2203	4300	6503	SO:0001819	synonymous_variant	58158	exon2			TAAATCTCCTATT	AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.570T>C	12.37:g.55420793T>C		Somatic	17.0	0.0		WXS	Illumina HiSeq	.	43.0	8.0	NM_021191	B2RAC9	Silent	SNP	ENST00000242994.3	37	CCDS8886.1																																																																																			.		0.517	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406104.1		
NFRKB	4798	broad.mit.edu;bcgsc.ca	37	11	129762615	129762615	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr11:129762615C>T	ENST00000446488.3	-	2	233	c.130G>A	c.(130-132)Gag>Aag	p.E44K	NFRKB_ENST00000524746.1_Missense_Mutation_p.E44K|NFRKB_ENST00000524794.1_Missense_Mutation_p.E57K|NFRKB_ENST00000526940.1_Missense_Mutation_p.E44K|NFRKB_ENST00000304521.5_Missense_Mutation_p.E44K	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	44					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)	p.E57*(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		CTCACATCCTCCAGAAGGTCC	0.522																																					p.E57K		.											.	NFRKB	93	1	Substitution - Nonsense(1)	lung(1)	c.G169A						.						152.0	128.0	136.0					11																	129762615		2201	4297	6498	SO:0001583	missense	4798	exon1			CATCCTCCAGAAG		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.130G>A	11.37:g.129762615C>T	ENSP00000400476:p.Glu44Lys	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	5.0	NM_006165	Q12869|Q15312|Q9H048	Missense_Mutation	SNP	ENST00000446488.3	37	CCDS44770.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544384	0.86022	.	.	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746;ENST00000531755;ENST00000532225;ENST00000529319;ENST00000526940;ENST00000526884;ENST00000531318	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.82742	0.5103	M	0.78049	2.395	0.80722	D	1	D;D;D;D	0.67145	0.993;0.993;0.996;0.996	D;D;D;D	0.77557	0.978;0.971;0.99;0.99	D	0.85027	0.0915	9	0.87932	D	0	-22.1742	18.8739	0.92327	0.0:1.0:0.0:0.0	.	44;44;44;57	B4DSL1;Q6P4R8;Q6P4R8-3;Q6P4R8-2	.;NFRKB_HUMAN;.;.	K	44;44;57;44;44;44;44;44;44;44	.	ENSP00000303800:E44K	E	-	1	0	NFRKB	129267825	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.264000	0.78432	2.458000	0.83093	0.585000	0.79938	GAG	.		0.522	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165	
NLGN4X	57502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	5811266	5811266	+	Silent	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chrX:5811266G>A	ENST00000381095.3	-	6	2670	c.2043C>T	c.(2041-2043)gtC>gtT	p.V681V	NLGN4X_ENST00000381093.2_Silent_p.V701V|NLGN4X_ENST00000275857.6_Silent_p.V681V|NLGN4X_ENST00000538097.1_Silent_p.V681V|NLGN4X_ENST00000381092.1_Silent_p.V681V	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	681					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						GCGACGCCCCGACGGCAATGG	0.522																																					p.V681V		.											.	NLGN4X	195	0			c.C2043T						.						102.0	95.0	97.0					X																	5811266		2203	4300	6503	SO:0001819	synonymous_variant	57502	exon6			CGCCCCGACGGCA	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.2043C>T	X.37:g.5811266G>A		Somatic	597.0	1.0		WXS	Illumina HiSeq	Phase_I	252.0	95.0	NM_181332	Q6UX10|Q9ULG0	Silent	SNP	ENST00000381095.3	37	CCDS14126.1																																																																																			.		0.522	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
OR51I2	390064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5474986	5474986	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr11:5474986C>T	ENST00000341449.2	+	1	349	c.268C>T	c.(268-270)Cgc>Tgc	p.R90C	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	90					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTCAATGCCCGCAACATCAC	0.473																																					p.R90C		.											OR51I2,NS,carcinoma,-1	OR51I2	72	0			c.C268T						.						133.0	128.0	130.0					11																	5474986		2201	4297	6498	SO:0001583	missense	390064	exon1			AATGCCCGCAACA	BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.268C>T	11.37:g.5474986C>T	ENSP00000341987:p.Arg90Cys	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	28.0	NM_001004754	Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	37	CCDS31383.1	.	.	.	.	.	.	.	.	.	.	C	10.72	1.430705	0.25726	.	.	ENSG00000187918	ENST00000341449	T	0.38401	1.14	5.57	4.66	0.58398	GPCR, rhodopsin-like superfamily (1);	0.186707	0.35320	N	0.003289	T	0.41166	0.1147	M	0.83223	2.63	0.09310	N	1	D	0.61697	0.99	B	0.43623	0.425	T	0.53201	-0.8472	10	0.87932	D	0	.	7.1608	0.25662	0.2483:0.671:0.0:0.0806	.	90	Q9H344	O51I2_HUMAN	C	90	ENSP00000341987:R90C	ENSP00000341987:R90C	R	+	1	0	OR51I2	5431562	0.000000	0.05858	0.119000	0.21687	0.207000	0.24258	-0.274000	0.08537	1.593000	0.50029	0.650000	0.86243	CGC	.		0.473	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754	
OSBPL11	114885	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	125313601	125313605	+	Frame_Shift_Del	DEL	CTCTC	CTCTC	-			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	CTCTC	CTCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:125313601_125313605delCTCTC	ENST00000296220.5	-	1	329_333	c.40_44delGAGAG	c.(40-45)gagagcfs	p.ES14fs		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	14					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						CTTTCCTTCGCTCTCCGAGACTTTC	0.566																																					p.14_15del		.											.	OSBPL11	135	0			c.40_44del						.																																			SO:0001589	frameshift_variant	114885	exon1			CCTTCGCTCTCCG	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.40_44delGAGAG	3.37:g.125313601_125313605delCTCTC	ENSP00000296220:p.Glu14fs	Somatic	392.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	36.0	NM_022776	A8K9I7	Frame_Shift_Del	DEL	ENST00000296220.5	37	CCDS3033.1																																																																																			.		0.566	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
PDE4B	5142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	66723358	66723358	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr1:66723358T>G	ENST00000329654.4	+	5	692	c.505T>G	c.(505-507)Ttt>Gtt	p.F169V	PDE4B_ENST00000371049.3_Missense_Mutation_p.F169V|PDE4B_ENST00000371048.3_3'UTR|PDE4B_ENST00000423207.2_Missense_Mutation_p.F154V	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	169					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	TGTAACTCCTTTTGCCCAGGT	0.383																																					p.F169V		.											.	PDE4B	92	0			c.T505G						.						262.0	254.0	257.0					1																	66723358		2203	4300	6503	SO:0001583	missense	5142	exon5			ACTCCTTTTGCCC	L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.505T>G	1.37:g.66723358T>G	ENSP00000332116:p.Phe169Val	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	252.0	164.0	NM_001037341	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	ENST00000329654.4	37	CCDS632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.7|23.7	4.447079|4.447079	0.84101|0.84101	.|.	.|.	ENSG00000184588|ENSG00000184588	ENST00000491340|ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000412480	.|T;T;T;T;D	.|0.87491	.|-1.42;-1.42;-1.42;-1.43;-2.26	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.89876|0.89876	0.6842|0.6842	M|M	0.79123|0.79123	2.44|2.44	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.48230	.|0.907;0.85;0.85	.|P;P;P	.|0.55055	.|0.767;0.589;0.589	D|D	0.91466|0.91466	0.5193|0.5193	6|10	.|0.87932	.|D	.|0	.|.	14.4679|14.4679	0.67497|0.67497	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|154;159;169	.|Q07343-3;Q59GM8;Q07343	.|.;.;PDE4B_HUMAN	C|V	10|169;169;169;154;77	.|ENSP00000332116:F169V;ENSP00000342637:F169V;ENSP00000360088:F169V;ENSP00000392947:F154V;ENSP00000397548:F77V	.|ENSP00000332116:F169V	F|F	+|+	2|1	0|0	PDE4B|PDE4B	66495946|66495946	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.881000|0.881000	0.50899|0.50899	7.093000|7.093000	0.76937|0.76937	2.251000|2.251000	0.74343|0.74343	0.528000|0.528000	0.53228|0.53228	TTT|TTT	.		0.383	PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3	NM_002600	
PPP2R2C	5522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	6335429	6335429	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr4:6335429G>A	ENST00000382599.4	-	7	1036	c.820C>T	c.(820-822)Cgc>Tgc	p.R274C	PPP2R2C_ENST00000335585.5_Missense_Mutation_p.R274C|PPP2R2C_ENST00000506140.1_Missense_Mutation_p.R267C|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.R257C|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.R267C			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	274					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						AAGAATGAGCGGTTACTGGGG	0.582											OREG0016071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R274C		.											.	PPP2R2C	1084	0			c.C820T						.						105.0	109.0	108.0					4																	6335429		2203	4300	6503	SO:0001583	missense	5522	exon7			ATGAGCGGTTACT	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.820C>T	4.37:g.6335429G>A	ENSP00000372042:p.Arg274Cys	Somatic	434.0	1.0	633	WXS	Illumina HiSeq	Phase_I	103.0	26.0	NM_181876	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	37		.	.	.	.	.	.	.	.	.	.	G	15.86	2.956552	0.53293	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56	4.2	3.26	0.37387	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.054165	0.64402	D	0.000001	T	0.38188	0.1031	M	0.81802	2.56	0.80722	D	1	B;P;D;B;D	0.63046	0.03;0.76;0.979;0.03;0.992	B;B;P;B;P	0.46275	0.015;0.102;0.51;0.015;0.51	T	0.44190	-0.9344	10	0.66056	D	0.02	.	9.1642	0.37041	0.0:0.0:0.602:0.398	.	267;370;274;257;274	B7Z3Y1;Q59GC6;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;.;2ABG_HUMAN;.;.	C	274;267;257;274;267	ENSP00000335083:R274C;ENSP00000423649:R267C;ENSP00000422374:R257C;ENSP00000372042:R274C;ENSP00000425247:R267C	ENSP00000335083:R274C	R	-	1	0	PPP2R2C	6386330	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.393000	0.52544	2.187000	0.69744	0.491000	0.48974	CGC	.		0.582	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
PRELID1	27166	bcgsc.ca;mdanderson.org	37	5	176731012	176731012	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr5:176731012G>T	ENST00000303204.4	+	1	238	c.26G>T	c.(25-27)aGc>aTc	p.S9I	RAB24_ENST00000303270.6_5'Flank|PRELID1_ENST00000503216.1_Missense_Mutation_p.S9I|PRELID1_ENST00000502670.1_3'UTR|RAB24_ENST00000393611.2_5'Flank|RAB24_ENST00000303251.6_5'Flank			Q9Y255	PRLD1_HUMAN	PRELI domain containing 1	9					apoptotic process (GO:0006915)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial membrane potential (GO:0010917)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of cellular respiration (GO:1901857)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of T cell apoptotic process (GO:0070234)|regulation of membrane lipid distribution (GO:0097035)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of T cell differentiation (GO:0045580)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	7	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGGGCCAGAGCGTGCTCCGG	0.647																																					p.S9I		.											.	PRELID1	90	0			c.G26T						.						38.0	33.0	34.0					5																	176731012		2203	4300	6503	SO:0001583	missense	27166	exon1			GCCAGAGCGTGCT	BC013748	CCDS4415.1, CCDS64328.1	5q35.3	2010-01-18			ENSG00000169230	ENSG00000169230			30255	protein-coding gene	gene with protein product	"""protein of relevant evolutionary and lymphoid interest"", ""px19-like protein"""	605733				10784606, 14640972	Standard	NM_013237		Approved	CGI-106, PX19, PRELI	uc003mfx.4	Q9Y255	OTTHUMG00000130847	ENST00000303204.4:c.26G>T	5.37:g.176731012G>T	ENSP00000302114:p.Ser9Ile	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_1	9.0	3.0	NM_013237	B2R5F7|D6RD25|Q549N2|Q9UI13|Q9UJS9	Missense_Mutation	SNP	ENST00000303204.4	37	CCDS4415.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.896417	0.91962	.	.	ENSG00000169230	ENST00000303204;ENST00000503216	T;T	0.17691	2.26;2.28	4.72	4.72	0.59763	PRELI/MSF1 (1);	0.108411	0.64402	D	0.000006	T	0.12390	0.0301	L	0.28458	0.855	0.37413	D	0.913324	B;B	0.16396	0.017;0.003	B;B	0.17979	0.02;0.014	T	0.12889	-1.0530	10	0.27785	T	0.31	-1.2793	10.1912	0.43028	0.0937:0.0:0.9063:0.0	.	9;9	D6RD25;Q9Y255	.;PRLD1_HUMAN	I	9	ENSP00000302114:S9I;ENSP00000427097:S9I	ENSP00000302114:S9I	S	+	2	0	PRELID1	176663618	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.999000	0.76283	2.171000	0.68590	0.462000	0.41574	AGC	.		0.647	PRELID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253414.1	NM_013237	
PTPRF	5792	ucsc.edu;bcgsc.ca	37	1	44069357	44069357	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr1:44069357A>G	ENST00000359947.4	+	16	2874	c.2534A>G	c.(2533-2535)gAa>gGa	p.E845G	PTPRF_ENST00000372414.3_Missense_Mutation_p.E845G|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372413.3_Missense_Mutation_p.E836G|PTPRF_ENST00000438120.1_Missense_Mutation_p.E836G|PTPRF_ENST00000422171.2_Missense_Mutation_p.E193G	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	845	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCACCCAAGGAACTGCCTGGC	0.647																																					p.E845G		.											.	PTPRF	232	0			c.A2534G						.						40.0	41.0	40.0					1																	44069357		2203	4299	6502	SO:0001583	missense	5792	exon16			CCAAGGAACTGCC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2534A>G	1.37:g.44069357A>G	ENSP00000353030:p.Glu845Gly	Somatic	178.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_002840	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.33|17.33	3.361995|3.361995	0.61403|0.61403	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171|ENST00000429895	T;T;T;T;T|.	0.58358|.	0.34;0.34;0.34;0.34;0.34|.	5.03|5.03	5.03|5.03	0.67393|0.67393	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.231155|.	0.22156|.	N|.	0.063854|.	T|T	0.62171|0.62171	0.2406|0.2406	L|L	0.47016|0.47016	1.485|1.485	0.58432|0.58432	D|D	0.999996|0.999996	B;B;P;P|.	0.50819|.	0.361;0.428;0.939;0.929|.	B;B;P;P|.	0.59546|.	0.309;0.243;0.503;0.859|.	T|T	0.59925|0.59925	-0.7362|-0.7362	10|5	0.30854|.	T|.	0.27|.	.|.	15.074|15.074	0.72063|0.72063	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	490;193;836;845|.	Q59FI2;F2Z3B8;P10586-2;P10586|.	.;.;.;PTPRF_HUMAN|.	G|D	845;836;845;836;193|491	ENSP00000353030:E845G;ENSP00000398822:E836G;ENSP00000361491:E845G;ENSP00000361490:E836G;ENSP00000387885:E193G|.	ENSP00000353030:E845G|.	E|N	+|+	2|1	0|0	PTPRF|PTPRF	43841944|43841944	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	7.268000|7.268000	0.78473|0.78473	2.026000|2.026000	0.59711|0.59711	0.533000|0.533000	0.62120|0.62120	GAA|AAC	.		0.647	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
PTPRZ1	5803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	121684588	121684588	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr7:121684588C>T	ENST00000393386.2	+	23	6461	c.6050C>T	c.(6049-6051)cCa>cTa	p.P2017L	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.P1150L	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2017					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ATTCCTGGACCAGCAGGCAAA	0.438																																					p.P2017L		.											.	PTPRZ1	699	0			c.C6050T						.						114.0	104.0	108.0					7																	121684588		2203	4300	6503	SO:0001583	missense	5803	exon23			CTGGACCAGCAGG	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6050C>T	7.37:g.121684588C>T	ENSP00000377047:p.Pro2017Leu	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	24.0	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152865	0.57259	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.10382	2.88;2.88	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000004	T	0.19725	0.0474	M	0.67953	2.075	0.42409	D	0.99259	P;B;P	0.41313	0.589;0.069;0.745	B;B;B	0.41988	0.173;0.053;0.372	T	0.00888	-1.1526	10	0.59425	D	0.04	.	19.3942	0.94598	0.0:1.0:0.0:0.0	.	1156;1150;2017	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	L	2017;1150	ENSP00000377047:P2017L;ENSP00000410000:P1150L	ENSP00000377047:P2017L	P	+	2	0	PTPRZ1	121471824	0.176000	0.23096	0.986000	0.45419	0.706000	0.40770	2.601000	0.46249	2.587000	0.87381	0.655000	0.94253	CCA	.		0.438	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
RAB7A	7879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	128516808	128516808	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:128516808A>G	ENST00000265062.3	+	3	322	c.76A>G	c.(76-78)Aac>Gac	p.N26D	RAB7A_ENST00000485280.1_Missense_Mutation_p.N26D|RAB7A_ENST00000482525.1_Missense_Mutation_p.N26D	NM_004637.5	NP_004628.4	P51149	RAB7A_HUMAN	RAB7A, member RAS oncogene family	26					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|bone resorption (GO:0045453)|cell death (GO:0008219)|early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|epidermal growth factor catabolic process (GO:0007174)|GTP catabolic process (GO:0006184)|phagosome acidification (GO:0090383)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein targeting to lysosome (GO:0006622)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	alveolar lamellar body (GO:0097208)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8				GBM - Glioblastoma multiforme(114;0.231)		ATCACTCATGAACCAGTATGT	0.403																																					p.N26D		.											.	RAB7A	227	0			c.A76G						.						133.0	118.0	123.0					3																	128516808		2203	4300	6503	SO:0001583	missense	7879	exon3			CTCATGAACCAGT	X93499	CCDS3052.1	3q21	2014-09-17	2007-01-15	2007-01-15	ENSG00000075785	ENSG00000075785		"""RAB, member RAS oncogene"""	9788	protein-coding gene	gene with protein product		602298	"""RAB7, member RAS oncogene family"""	RAB7		9126495, 9428630	Standard	NM_004637		Approved		uc003eks.1	P51149	OTTHUMG00000159812	ENST00000265062.3:c.76A>G	3.37:g.128516808A>G	ENSP00000265062:p.Asn26Asp	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	205.0	33.0	NM_004637	A8K3V6|Q9NWJ0|Q9UPB0	Missense_Mutation	SNP	ENST00000265062.3	37	CCDS3052.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.894562	0.91962	.	.	ENSG00000075785	ENST00000265062;ENST00000482525;ENST00000464496;ENST00000490093;ENST00000493186;ENST00000483906;ENST00000485280	D;D;D;D;T;D;T	0.81821	-1.54;-1.54;-1.54;-1.54;-0.93;-1.54;-1.07	5.69	4.52	0.55395	Small GTP-binding protein domain (1);	.	.	.	.	T	0.79868	0.4520	M	0.65320	2	0.80722	D	1	B;B	0.20368	0.027;0.044	B;B	0.30316	0.114;0.089	T	0.76610	-0.2896	9	0.66056	D	0.02	-1.6018	12.9669	0.58490	0.8647:0.1353:0.0:0.0	.	26;26	C9J8S3;P51149	.;RAB7A_HUMAN	D	26	ENSP00000265062:N26D;ENSP00000417668:N26D;ENSP00000417978:N26D;ENSP00000418955:N26D;ENSP00000417189:N26D;ENSP00000417155:N26D;ENSP00000418283:N26D	ENSP00000265062:N26D	N	+	1	0	RAB7A	129999498	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.523000	0.90576	0.978000	0.38470	0.533000	0.62120	AAC	.		0.403	RAB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357479.1		
RXRA	6256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	137328351	137328351	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr9:137328351C>T	ENST00000481739.1	+	10	1332	c.1280C>T	c.(1279-1281)tCc>tTc	p.S427F	RXRA_ENST00000356384.4_3'UTR|RXRA_ENST00000540193.1_Missense_Mutation_p.S330F	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	427	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GCTCTGCGCTCCATCGGGCTC	0.607																																					p.S427F		.											.	RXRA	188	0			c.C1280T						.						132.0	117.0	122.0					9																	137328351		2203	4300	6503	SO:0001583	missense	6256	exon10			TGCGCTCCATCGG	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.1280C>T	9.37:g.137328351C>T	ENSP00000419692:p.Ser427Phe	Somatic	284.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	23.0	NM_002957	B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	ENST00000481739.1	37	CCDS35172.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825420	0.90955	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.96940	-4.18;-4.18	4.76	4.76	0.60689	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98369	0.9458	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99744	1.1016	10	0.87932	D	0	.	17.7817	0.88526	0.0:1.0:0.0:0.0	.	427	P19793	RXRA_HUMAN	F	427;330	ENSP00000419692:S427F;ENSP00000442123:S330F	ENSP00000419692:S427F	S	+	2	0	RXRA	136468172	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.532000	0.81985	2.193000	0.70182	0.591000	0.81541	TCC	.		0.607	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	NM_002957	
RXRB	6257	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	33166198	33166198	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr6:33166198delG	ENST00000374680.3	-	3	738	c.527delC	c.(526-528)cctfs	p.P176fs	RXRB_ENST00000374685.4_Frame_Shift_Del_p.P176fs|SLC39A7_ENST00000374675.3_5'Flank|SLC39A7_ENST00000374677.3_5'Flank|RNY4P10_ENST00000365571.1_RNA|RXRB_ENST00000544186.1_Intron|RXRB_ENST00000413614.2_Frame_Shift_Del_p.P80fs	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	176	Modulating. {ECO:0000250}.|Pro-rich.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	CACATCTTCAGGGGGGCCAGA	0.592																																					p.P176fs		.											.	RXRB	189	0			c.527delC						.						94.0	114.0	107.0					6																	33166198		1508	2707	4215	SO:0001589	frameshift_variant	6257	exon3			TCTTCAGGGGGGC	M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.527delC	6.37:g.33166198delG	ENSP00000363812:p.Pro176fs	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	32.0	NM_021976	P28703|Q59G65|Q5JP92|Q5STQ1	Frame_Shift_Del	DEL	ENST00000374680.3	37	CCDS4768.1																																																																																			.		0.592	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976	
SCUBE3	222663	ucsc.edu;bcgsc.ca	37	6	35209660	35209660	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr6:35209660A>G	ENST00000274938.7	+	12	1390	c.1390A>G	c.(1390-1392)Aac>Gac	p.N464D	SCUBE3_ENST00000394681.1_Missense_Mutation_p.N480D	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						CCACAATGGGAACAGCACCAA	0.547											OREG0017372	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N464D		.											.	SCUBE3	91	0			c.A1390G						.						69.0	59.0	62.0					6																	35209660		2203	4300	6503	SO:0001583	missense	222663	exon12			AATGGGAACAGCA	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.1390A>G	6.37:g.35209660A>G	ENSP00000274938:p.Asn464Asp	Somatic	106.0	0.0	853	WXS	Illumina HiSeq	.	42.0	4.0	NM_152753		Missense_Mutation	SNP	ENST00000274938.7	37	CCDS4800.1	.	.	.	.	.	.	.	.	.	.	A	13.19	2.162993	0.38217	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	T;D	0.82255	-1.17;-1.59	5.34	4.15	0.48705	.	0.251881	0.44483	D	0.000454	T	0.53238	0.1784	L	0.36672	1.1	0.34671	D	0.723654	B;B	0.29301	0.241;0.156	B;B	0.25140	0.058;0.026	T	0.44651	-0.9314	10	0.26408	T	0.33	.	3.9447	0.09343	0.5827:0.0:0.0904:0.3269	.	480;464	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	D	480;464	ENSP00000378174:N480D;ENSP00000274938:N464D	ENSP00000274938:N464D	N	+	1	0	SCUBE3	35317638	0.007000	0.16637	1.000000	0.80357	0.741000	0.42261	1.039000	0.30266	0.829000	0.34733	0.528000	0.53228	AAC	.		0.547	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
SEMA3E	9723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	83021890	83021890	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr7:83021890T>C	ENST00000307792.3	-	14	2115	c.1648A>G	c.(1648-1650)Aca>Gca	p.T550A	SEMA3E_ENST00000427262.1_Missense_Mutation_p.T490A	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	550					axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				TGTGTGCCTGTTGGGTAATAC	0.448																																					p.T550A		.											.	SEMA3E	93	0			c.A1648G						.						105.0	92.0	97.0					7																	83021890		2203	4300	6503	SO:0001583	missense	9723	exon14			TGCCTGTTGGGTA	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1648A>G	7.37:g.83021890T>C	ENSP00000303212:p.Thr550Ala	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	76.0	NM_012431	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	37	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	T	8.152	0.787505	0.16258	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.21361	2.01;2.01	5.32	5.32	0.75619	.	0.097215	0.41294	U	0.000901	T	0.13072	0.0317	N	0.16478	0.41	0.36679	D	0.878952	B	0.11235	0.004	B	0.09377	0.004	T	0.16482	-1.0401	10	0.25751	T	0.34	.	11.557	0.50755	0.0:0.0:0.1493:0.8507	.	550	O15041	SEM3E_HUMAN	A	550;490;550	ENSP00000303212:T550A;ENSP00000405052:T490A	ENSP00000303212:T550A	T	-	1	0	SEMA3E	82859826	0.900000	0.30661	0.883000	0.34634	0.411000	0.31082	0.922000	0.28734	2.142000	0.66516	0.477000	0.44152	ACA	.		0.448	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
SEMA6D	80031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48063289	48063289	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr15:48063289C>A	ENST00000316364.5	+	19	2968	c.2529C>A	c.(2527-2529)aaC>aaA	p.N843K	SEMA6D_ENST00000389433.2_Missense_Mutation_p.N824K|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000536845.2_Missense_Mutation_p.N843K|SEMA6D_ENST00000358066.4_Missense_Mutation_p.N781K|SEMA6D_ENST00000558014.1_Missense_Mutation_p.N781K|SEMA6D_ENST00000389432.2_Missense_Mutation_p.N800K|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000537942.1_Missense_Mutation_p.N781K|SEMA6D_ENST00000354744.4_Missense_Mutation_p.N787K|SEMA6D_ENST00000389428.3_Missense_Mutation_p.N768K	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	843					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CTTTCTCAAACTCCAATGCTC	0.458																																					p.N843K		.											.	SEMA6D	138	0			c.C2529A						.						105.0	96.0	99.0					15																	48063289		2198	4297	6495	SO:0001583	missense	80031	exon19			CTCAAACTCCAAT	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2529C>A	15.37:g.48063289C>A	ENSP00000324857:p.Asn843Lys	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	36.0	NM_153618	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	C	11.11	1.543237	0.27563	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.16897	2.31;2.34;2.34;2.31;2.31;2.31;2.31;2.32	5.58	2.23	0.28157	.	0.601453	0.16987	N	0.191479	T	0.11281	0.0275	N	0.22421	0.69	0.80722	D	1	B;P;B;P	0.47762	0.43;0.9;0.227;0.622	B;B;B;B	0.42522	0.1;0.39;0.138;0.146	T	0.15723	-1.0427	10	0.29301	T	0.29	.	8.8988	0.35481	0.0:0.6408:0.0:0.3592	.	768;787;843;781	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	K	781;843;843;824;800;787;781;768	ENSP00000442040:N781K;ENSP00000446152:N843K;ENSP00000324857:N843K;ENSP00000374084:N824K;ENSP00000374083:N800K;ENSP00000346786:N787K;ENSP00000350770:N781K;ENSP00000374079:N768K	ENSP00000324857:N843K	N	+	3	2	SEMA6D	45850581	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	0.593000	0.23999	0.712000	0.32039	0.563000	0.77884	AAC	.		0.458	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
SGCE	8910	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	94232701	94232701	+	Silent	SNP	T	T	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr7:94232701T>A	ENST00000265735.7	-	6	836	c.726A>T	c.(724-726)ccA>ccT	p.P242P	SGCE_ENST00000447873.1_Silent_p.P242P|SGCE_ENST00000428696.2_Silent_p.P242P|SGCE_ENST00000437425.2_Silent_p.P201P|SGCE_ENST00000445866.2_Silent_p.P242P|SGCE_ENST00000415788.2_Silent_p.P278P	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	242	Cys-rich.				cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ATTGATTCTGTGGATTTTCAA	0.348																																					p.P242P		.											.	SGCE	91	0			c.A726T						.						89.0	84.0	86.0					7																	94232701		2203	4300	6503	SO:0001819	synonymous_variant	8910	exon6			ATTCTGTGGATTT	AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.726A>T	7.37:g.94232701T>A		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	292.0	107.0	NM_001099401	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Silent	SNP	ENST00000265735.7	37	CCDS5637.1																																																																																			.		0.348	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2		
SGTA	6449	ucsc.edu;bcgsc.ca	37	19	2761469	2761469	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr19:2761469A>G	ENST00000221566.2	-	8	849	c.688T>C	c.(688-690)Ttc>Ctc	p.F230L		NM_003021.3	NP_003012.1	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha	230					viral process (GO:0016032)	cytoplasm (GO:0005737)				endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGCTCATGAAGCCAGGGTTG	0.662																																					p.F230L		.											.	SGTA	91	0			c.T688C						.						69.0	56.0	60.0					19																	2761469		2078	4032	6110	SO:0001583	missense	6449	exon8			TCATGAAGCCAGG	AJ223828	CCDS12094.1	19p13	2013-01-10	2003-11-24	2003-11-26		ENSG00000104969		"""Tetratricopeptide (TTC) repeat domain containing"""	10819	protein-coding gene	gene with protein product		603419	"""small glutamine-rich tetratricopeptide repeat (TPR)-containing"""	SGT		9740675, 12735788	Standard	NM_003021		Approved		uc002lwi.1	O43765		ENST00000221566.2:c.688T>C	19.37:g.2761469A>G	ENSP00000221566:p.Phe230Leu	Somatic	206.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_003021	D6W610|Q6FIA9|Q9BTZ9	Missense_Mutation	SNP	ENST00000221566.2	37	CCDS12094.1	.	.	.	.	.	.	.	.	.	.	A	8.557	0.876845	0.17395	.	.	ENSG00000104969	ENST00000221566	T	0.32023	1.47	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.23572	0.0570	L	0.39245	1.2	0.58432	D	0.999997	B	0.11235	0.004	B	0.08055	0.003	T	0.05419	-1.0886	10	0.12103	T	0.63	-17.3314	12.7766	0.57453	1.0:0.0:0.0:0.0	.	230	O43765	SGTA_HUMAN	L	230	ENSP00000221566:F230L	ENSP00000221566:F230L	F	-	1	0	SGTA	2712469	1.000000	0.71417	0.883000	0.34634	0.046000	0.14306	8.844000	0.92147	1.696000	0.51158	0.533000	0.62120	TTC	.		0.662	SGTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451448.2	NM_003021	
SIX2	10736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	45233509	45233509	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr2:45233509A>T	ENST00000303077.6	-	2	995	c.676T>A	c.(676-678)Tca>Aca	p.S226T		NM_016932.4	NP_058628.3	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	226					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|kidney development (GO:0001822)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesenchymal stem cell proliferation (GO:0097168)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|middle ear morphogenesis (GO:0042474)|nephron development (GO:0072006)|nephron morphogenesis (GO:0072028)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus (GO:0006606)|regulation of branching involved in ureteric bud morphogenesis (GO:0090189)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|large_intestine(3)|lung(8)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	22		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GGGCTGGATGATGAGTGGTCT	0.672																																					p.S226T		.											.	SIX2	91	0			c.T676A						.						91.0	94.0	93.0					2																	45233509		2203	4300	6503	SO:0001583	missense	10736	exon2			TGGATGATGAGTG	AF136939	CCDS1822.1	2p21	2011-06-20	2007-07-13		ENSG00000170577	ENSG00000170577		"""Homeoboxes / SINE class"""	10888	protein-coding gene	gene with protein product		604994	"""sine oculis homeobox (Drosophila) homolog 2"", ""sine oculis homeobox homolog 2 (Drosophila)"""				Standard	NM_016932		Approved		uc002ruo.3	Q9NPC8	OTTHUMG00000152421	ENST00000303077.6:c.676T>A	2.37:g.45233509A>T	ENSP00000304502:p.Ser226Thr	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	12.0	NM_016932	Q9BXH7	Missense_Mutation	SNP	ENST00000303077.6	37	CCDS1822.1	.	.	.	.	.	.	.	.	.	.	A	17.70	3.453485	0.63290	.	.	ENSG00000170577	ENST00000303077	D	0.89123	-2.47	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.88235	0.6382	L	0.29908	0.895	0.58432	D	0.999996	P;P	0.49447	0.924;0.924	P;P	0.57776	0.827;0.827	D	0.84878	0.0829	10	0.13853	T	0.58	-11.6023	14.4287	0.67233	1.0:0.0:0.0:0.0	.	226;226	Q8TBA2;Q9NPC8	.;SIX2_HUMAN	T	226	ENSP00000304502:S226T	ENSP00000304502:S226T	S	-	1	0	SIX2	45087013	1.000000	0.71417	0.993000	0.49108	0.853000	0.48598	6.657000	0.74402	1.804000	0.52760	0.379000	0.24179	TCA	.		0.672	SIX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326188.2		
SLITRK1	114798	ucsc.edu;bcgsc.ca;mdanderson.org	37	13	84454187	84454187	+	Silent	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr13:84454187G>A	ENST00000377084.2	-	1	2341	c.1456C>T	c.(1456-1458)Ctg>Ttg	p.L486L		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	486					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TCCACAGGCAGGGACCTCAGC	0.547																																					p.L486L		.											.	SLITRK1	94	0			c.C1456T						.						60.0	60.0	60.0					13																	84454187		2203	4300	6503	SO:0001819	synonymous_variant	114798	exon1			CAGGCAGGGACCT	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1456C>T	13.37:g.84454187G>A		Somatic	211.0	2.0		WXS	Illumina HiSeq	.	122.0	26.0	NM_052910	Q5U5I6|Q96SF9	Silent	SNP	ENST00000377084.2	37	CCDS9464.1																																																																																			.		0.547	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
SMCO3	440087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	14959587	14959587	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr12:14959587C>G	ENST00000316048.2	-	2	100	c.28G>C	c.(28-30)Gag>Cag	p.E10Q	C12orf60_ENST00000330828.2_Intron|C12orf60_ENST00000527783.1_Intron	NM_001013698.2	NP_001013720.2	A2RU48	SMCO3_HUMAN	single-pass membrane protein with coiled-coil domains 3	10						integral component of membrane (GO:0016021)											TTTGGGTTCTCTGGGTAAAGG	0.388																																					p.E10Q		.											.	.	.	0			c.G28C						.						81.0	81.0	81.0					12																	14959587		1829	4091	5920	SO:0001583	missense	0	exon2			GGTTCTCTGGGTA		CCDS41759.1	12p12.3	2013-03-11	2013-03-11	2013-03-11	ENSG00000179256	ENSG00000179256			34401	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 69"""	C12orf69			Standard	NM_001013698		Approved	LOC440087	uc001rck.1	A2RU48	OTTHUMG00000167474	ENST00000316048.2:c.28G>C	12.37:g.14959587C>G	ENSP00000381895:p.Glu10Gln	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	72.0	NM_001013698	Q8NAI5	Missense_Mutation	SNP	ENST00000316048.2	37	CCDS41759.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.828948	0.32329	.	.	ENSG00000179256	ENST00000316048	T	0.33865	1.39	5.25	4.34	0.51931	.	0.641612	0.12334	N	0.478087	T	0.20901	0.0503	N	0.12182	0.205	0.21256	N	0.999747	B	0.09022	0.002	B	0.08055	0.003	T	0.17018	-1.0383	10	0.15952	T	0.53	-19.9399	11.3905	0.49811	0.0:0.8093:0.1907:0.0	.	10	A2RU48	CL069_HUMAN	Q	10	ENSP00000381895:E10Q	ENSP00000381895:E10Q	E	-	1	0	C12orf69	14850854	1.000000	0.71417	0.990000	0.47175	0.853000	0.48598	2.512000	0.45485	1.398000	0.46701	0.555000	0.69702	GAG	.		0.388	SMCO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394738.1	NM_001013698	
SOCS6	9306	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	67992584	67992585	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr18:67992584_67992585insC	ENST00000397942.3	+	2	996_997	c.680_681insC	c.(679-684)ttagatfs	p.LD227fs	SOCS6_ENST00000582322.1_Frame_Shift_Ins_p.LD227fs	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	227					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				ACTGTGCCTTTAGATGAGGGGA	0.505																																					p.L227fs	Melanoma(84;1024 1361 24382 36583 42651)	.											.	SOCS6	721	0			c.680_681insC						.																																			SO:0001589	frameshift_variant	9306	exon2			TGCCTTTAGATGA	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	Exception_encountered	18.37:g.67992584_67992585insC	ENSP00000381034:p.Leu227fs	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	33.0	NM_004232	Q8WUM3	Frame_Shift_Ins	INS	ENST00000397942.3	37	CCDS11998.1																																																																																			.		0.505	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
SOCS6	9306	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	67992586	67992606	+	In_Frame_Del	DEL	GATGAGGGGATGTATCCTTTG	GATGAGGGGATGTATCCTTTG	-	rs368115526|rs201797599		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	GATGAGGGGATGTATCCTTTG	GATGAGGGGATGTATCCTTTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr18:67992586_67992606delGATGAGGGGATGTATCCTTTG	ENST00000397942.3	+	2	998_1018	c.682_702delGATGAGGGGATGTATCCTTTG	c.(682-702)gatgaggggatgtatcctttgdel	p.DEGMYPL228del	SOCS6_ENST00000582322.1_In_Frame_Del_p.DEGMYPL228del	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	228					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				TGTGCCTTTAGATGAGGGGATGTATCCTTTGGAAGGATCAC	0.511																																					p.228_234del	Melanoma(84;1024 1361 24382 36583 42651)	.											.	SOCS6	721	0			c.682_702del						.																																			SO:0001651	inframe_deletion	9306	exon2			CCTTTAGATGAGG	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.682_702delGATGAGGGGATGTATCCTTTG	18.37:g.67992586_67992606delGATGAGGGGATGTATCCTTTG	ENSP00000381034:p.Asp228_Leu234del	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	28.0	NM_004232	Q8WUM3	In_Frame_Del	DEL	ENST00000397942.3	37	CCDS11998.1																																																																																			.		0.511	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
STON1	11037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	48809395	48809395	+	Silent	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr2:48809395G>A	ENST00000406226.1	+	3	1818	c.1623G>A	c.(1621-1623)gtG>gtA	p.V541V	STON1_ENST00000309835.3_Silent_p.V541V|STON1-GTF2A1L_ENST00000394751.3_Silent_p.V541V|STON1-GTF2A1L_ENST00000394754.1_Silent_p.V541V|STON1-GTF2A1L_ENST00000405008.1_Silent_p.V541V|STON1-GTF2A1L_ENST00000402114.2_Silent_p.V541V|STON1-GTF2A1L_ENST00000309827.2_Silent_p.V541V|STON1_ENST00000404752.1_Silent_p.V541V	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	541	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAGCATACGTGGAACTTCAGG	0.468																																					p.V541V		.											.	STON1	91	0			c.G1623A						.						162.0	156.0	158.0					2																	48809395		2203	4300	6503	SO:0001819	synonymous_variant	11037	exon3			ATACGTGGAACTT	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1623G>A	2.37:g.48809395G>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	285.0	43.0	NM_001198595	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Silent	SNP	ENST00000406226.1	37	CCDS1841.1																																																																																			.		0.468	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
SYNE3	161176	ucsc.edu;bcgsc.ca	37	14	95923645	95923645	+	Silent	SNP	G	G	T	rs187376318	byFrequency	TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr14:95923645G>T	ENST00000334258.5	-	4	672	c.658C>A	c.(658-660)Cgg>Agg	p.R220R	SYNE3_ENST00000554873.1_5'Flank|SYNE3_ENST00000557275.1_Silent_p.R220R|SYNE3_ENST00000553340.1_Silent_p.R220R	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	220					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						TCATGCTCCCGGGCCACCTGC	0.617																																					p.R220R		.											.	.	.	0			c.C658A						.						167.0	143.0	151.0					14																	95923645		2203	4300	6503	SO:0001819	synonymous_variant	161176	exon4			GCTCCCGGGCCAC	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.658C>A	14.37:g.95923645G>T		Somatic	283.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Silent	SNP	ENST00000334258.5	37	CCDS9935.1																																																																																			G|0.999;A|0.000		0.617	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
TACR2	6865	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71175920	71175920	+	Missense_Mutation	SNP	C	C	T	rs151093941		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr10:71175920C>T	ENST00000373306.4	-	1	703	c.160G>A	c.(160-162)Gtc>Atc	p.V54I		NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	54					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						ATCCAGATGACGATGGCATTA	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22178	0.0		0.0	False		,,,				2504	0.0				p.V54I		.											.	TACR2	522	0			c.G160A						.	C	ILE/VAL	0,4406		0,0,2203	125.0	94.0	105.0		160	3.5	0.4	10	dbSNP_134	105	5,8595	4.3+/-15.6	0,5,4295	yes	missense	TACR2	NM_001057.2	29	0,5,6498	TT,TC,CC		0.0581,0.0,0.0384	benign	54/399	71175920	5,13001	2203	4300	6503	SO:0001583	missense	6865	exon1			AGATGACGATGGC		CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.160G>A	10.37:g.71175920C>T	ENSP00000362403:p.Val54Ile	Somatic	431.0	1.0		WXS	Illumina HiSeq	Phase_I	99.0	16.0	NM_001057	A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Missense_Mutation	SNP	ENST00000373306.4	37	CCDS7293.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	10.44	1.351500	0.24512	0.0	5.81E-4	ENSG00000075073	ENST00000373306	D	0.83335	-1.71	5.31	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.069870	0.56097	N	0.000023	D	0.85860	0.5795	M	0.82433	2.59	0.41567	D	0.988661	B	0.22683	0.073	B	0.33454	0.164	T	0.82694	-0.0330	10	0.66056	D	0.02	.	14.7587	0.69590	0.0:0.835:0.0:0.165	.	54	P21452	NK2R_HUMAN	I	54	ENSP00000362403:V54I	ENSP00000362403:V54I	V	-	1	0	TACR2	70845926	0.940000	0.31905	0.420000	0.26596	0.192000	0.23643	2.105000	0.41825	0.351000	0.24027	-1.736000	0.00690	GTC	C|1.000;T|0.000		0.607	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048411.1		
TBX3	6926	ucsc.edu;bcgsc.ca	37	12	115112603	115112603	+	Silent	SNP	G	G	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr12:115112603G>A	ENST00000257566.3	-	7	1526	c.1137C>T	c.(1135-1137)gcC>gcT	p.A379A	TBX3_ENST00000349155.2_Silent_p.A359A	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	379					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CTTTGCTCTCGGCCTCGGCGT	0.622																																					p.A379A		.											.	TBX3	93	0			c.C1137T						.						10.0	11.0	11.0					12																	115112603		2187	4259	6446	SO:0001819	synonymous_variant	6926	exon7			GCTCTCGGCCTCG	BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.1137C>T	12.37:g.115112603G>A		Somatic	194.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_016569	Q8TB20|Q9UKF8	Silent	SNP	ENST00000257566.3	37	CCDS9176.1																																																																																			.		0.622	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404947.2	NM_016569, NM_005996	
TMEM132E	124842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	32956067	32956067	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr17:32956067C>A	ENST00000321639.5	+	5	1240	c.912C>A	c.(910-912)gaC>gaA	p.D304E		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	304						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		TGCAGCTGGACTTTGAAATGG	0.627																																					p.D304E		.											.	TMEM132E	68	0			c.C912A						.						84.0	84.0	84.0					17																	32956067		2203	4300	6503	SO:0001583	missense	124842	exon5			GCTGGACTTTGAA	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.912C>A	17.37:g.32956067C>A	ENSP00000316532:p.Asp304Glu	Somatic	466.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	27.0	NM_207313	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	c	10.69	1.420108	0.25552	.	.	ENSG00000181291	ENST00000321639	T	0.21361	2.01	4.51	4.51	0.55191	.	0.097095	0.64402	D	0.000002	T	0.19167	0.0460	L	0.52364	1.645	0.44492	D	0.997435	P	0.41393	0.748	B	0.40101	0.319	T	0.01545	-1.1328	10	0.23302	T	0.38	-35.2459	10.179	0.42957	0.0:0.8974:0.0:0.1026	.	304	Q6IEE7	T132E_HUMAN	E	304	ENSP00000316532:D304E	ENSP00000316532:D304E	D	+	3	2	TMEM132E	29980180	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	2.339000	0.43965	2.502000	0.84385	0.447000	0.29281	GAC	.		0.627	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
TP63	8626	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	3	189349323	189349323	+	Missense_Mutation	SNP	C	C	T	rs376627647		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr3:189349323C>T	ENST00000264731.3	+	1	108	c.19C>T	c.(19-21)Cgg>Tgg	p.R7W	TP63_ENST00000440651.2_Missense_Mutation_p.R7W|TP63_ENST00000418709.2_Missense_Mutation_p.R7W|TP63_ENST00000392460.3_Missense_Mutation_p.R7W|TP63_ENST00000382063.4_Missense_Mutation_p.R7W|TP63_ENST00000320472.5_Missense_Mutation_p.R7W	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	7	Transcription activation.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TGAAACTTCACGGTGTGCCAC	0.358										HNSCC(45;0.13)																											p.R7W		.											.	TP63	421	0			c.C19T						.	C	TRP/ARG,TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	165.0	155.0	159.0		19,19,19	2.8	1.0	3		159	0,8600		0,0,4300	no	missense,missense,missense	TP63	NM_001114978.1,NM_001114979.1,NM_003722.4	101,101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	7/556,7/488,7/681	189349323	1,13005	2203	4300	6503	SO:0001583	missense	8626	exon1			ACTTCACGGTGTG	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.19C>T	3.37:g.189349323C>T	ENSP00000264731:p.Arg7Trp	Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	9.0	NM_001114979	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.830276	0.32329	2.27E-4	0.0	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063	D;D;D;D;D;D	0.99730	-6.11;-6.43;-6.37;-6.36;-6.11;-6.56	5.72	2.84	0.33178	.	0.178925	0.33712	N	0.004636	D	0.97739	0.9258	N	0.08118	0	0.80722	D	1	P;P;P;P	0.47350	0.894;0.74;0.83;0.74	B;B;B;B	0.42771	0.397;0.397;0.129;0.397	D	0.95859	0.8881	9	.	.	.	-15.8525	14.0794	0.64912	0.3941:0.6059:0.0:0.0	.	7;7;7;7	Q9H3D4-7;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;P63_HUMAN;.	W	7	ENSP00000264731:R7W;ENSP00000407144:R7W;ENSP00000317510:R7W;ENSP00000376253:R7W;ENSP00000394337:R7W;ENSP00000371495:R7W	.	R	+	1	2	TP63	190832017	1.000000	0.71417	0.983000	0.44433	0.996000	0.88848	2.153000	0.42282	0.282000	0.22254	0.655000	0.94253	CGG	.		0.358	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
TRIM55	84675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	67067941	67067941	+	Intron	SNP	A	A	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr8:67067941A>C	ENST00000315962.4	+	9	1897				TRIM55_ENST00000276573.7_Missense_Mutation_p.L536F|TRIM55_ENST00000350034.4_Intron|TRIM55_ENST00000353317.5_Intron	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55						signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TTTTTACTTTAATGGGTAGGA	0.363																																					p.L536F		.											.	TRIM55	230	0			c.A1608C						.						146.0	130.0	135.0					8																	67067941		2203	4299	6502	SO:0001627	intron_variant	84675	exon10			TACTTTAATGGGT	AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.1524+1372A>C	8.37:g.67067941A>C		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	253.0	120.0	NM_033058	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	ENST00000315962.4	37	CCDS6184.1	.	.	.	.	.	.	.	.	.	.	A	17.21	3.330611	0.60743	.	.	ENSG00000147573	ENST00000276573	T	0.35048	1.33	5.8	3.04	0.35103	.	.	.	.	.	T	0.17959	0.0431	N	0.08118	0	0.80722	D	1	B	0.20671	0.047	B	0.19946	0.027	T	0.04991	-1.0913	9	0.31617	T	0.26	.	8.5873	0.33666	0.5693:0.3543:0.0763:0.0	.	536	Q9BYV6-3	.	F	536	ENSP00000276573:L536F	ENSP00000276573:L536F	L	+	3	2	TRIM55	67230495	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.539000	0.23175	1.000000	0.39049	0.529000	0.55759	TTA	.		0.363	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179559565	179559565	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr2:179559565C>G	ENST00000591111.1	-	114	30612	c.30388G>C	c.(30388-30390)Gtc>Ctc	p.V10130L	TTN_ENST00000342992.6_Missense_Mutation_p.V9203L|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V10447L|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTTGGTGACTTGAACTTTT	0.294																																					p.V10447L		.											.	TTN	636	0			c.G31339C						.						114.0	105.0	108.0					2																	179559565		1785	4043	5828	SO:0001583	missense	7273	exon116			TGGTGACTTGAAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.30388G>C	2.37:g.179559565C>G	ENSP00000465570:p.Val10130Leu	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	339.0	126.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	17.04	3.288235	0.59976	.	.	ENSG00000155657	ENST00000342992;ENST00000414766	T	0.65178	-0.14	5.66	5.66	0.87406	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.61060	0.2317	N	0.24115	0.695	0.80722	D	1	B;D	0.55385	0.231;0.971	B;P	0.54815	0.081;0.761	T	0.64525	-0.6387	9	0.87932	D	0	.	13.2577	0.60089	0.0:0.8409:0.1591:0.0	.	10130;10130	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	L	9203;325	ENSP00000343764:V9203L	ENSP00000343764:V9203L	V	-	1	0	TTN	179267810	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.160000	0.42348	2.826000	0.97356	0.655000	0.94253	GTC	.		0.294	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TVP23B	51030	broad.mit.edu;mdanderson.org	37	17	18694221	18694221	+	Silent	SNP	A	A	G	rs573504806		TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr17:18694221A>G	ENST00000307767.8	+	3	407	c.108A>G	c.(106-108)gcA>gcG	p.A36A	TVP23B_ENST00000476139.1_5'UTR|TVP23B_ENST00000581733.1_5'UTR|TVP23B_ENST00000574226.1_Silent_p.A36A	NM_016078.4	NP_057162.4	Q9NYZ1	TV23B_HUMAN	trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)	36						integral component of membrane (GO:0016021)											ATCCAGTAGCATCGTTTTTCC	0.373													a|||	1	0.000199681	0.0	0.0	5008	,	,		11834	0.0		0.0	False		,,,				2504	0.001				p.A36A		.											.	.	.	0			c.A108G						.						119.0	120.0	120.0					17																	18694221		2203	4298	6501	SO:0001819	synonymous_variant	51030	exon3			AGTAGCATCGTTT	AF151906	CCDS42274.1	17p11.2	2012-11-29	2012-11-29	2012-11-29	ENSG00000171928	ENSG00000171928			20399	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B"", ""family with sequence similarity 18, member B1"""	FAM18B, FAM18B1		10810093	Standard	NM_016078		Approved	CGI-148, YDR084C	uc002gum.2	Q9NYZ1	OTTHUMG00000059052	ENST00000307767.8:c.108A>G	17.37:g.18694221A>G		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	240.0	28.0	NM_016078	A8K448|Q96HK5|Q9Y3E6	Silent	SNP	ENST00000307767.8	37	CCDS42274.1																																																																																			.		0.373	TVP23B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130667.2	NM_016078	
UGGT2	55757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	96599294	96599294	+	Silent	SNP	T	T	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr13:96599294T>C	ENST00000376747.3	-	15	1744	c.1674A>G	c.(1672-1674)gtA>gtG	p.V558V		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	558					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						AACTCACGTGTACTATAGAAA	0.303																																					p.V558V		.											.	UGGT2	92	0			c.A1674G						.						48.0	52.0	51.0					13																	96599294		2202	4299	6501	SO:0001819	synonymous_variant	55757	exon15			CACGTGTACTATA	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.1674A>G	13.37:g.96599294T>C		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	261.0	105.0	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Silent	SNP	ENST00000376747.3	37	CCDS9480.1																																																																																			.		0.303	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
WASF2	10163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	27739169	27739169	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr1:27739169C>T	ENST00000430629.2	-	7	936	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	WASF2_ENST00000536657.1_Missense_Mutation_p.V241M	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	241					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		CTTGCATCCACGTTTTCAACA	0.493																																					p.V241M		.											.	WASF2	228	0			c.G721A						.						179.0	158.0	165.0					1																	27739169		2203	4300	6503	SO:0001583	missense	10163	exon7			CATCCACGTTTTC	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.721G>A	1.37:g.27739169C>T	ENSP00000396211:p.Val241Met	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	228.0	88.0	NM_006990	B4DZN0|O60794|Q9UDY7	Missense_Mutation	SNP	ENST00000430629.2	37	CCDS304.1	.	.	.	.	.	.	.	.	.	.	C	9.400	1.077732	0.20227	.	.	ENSG00000158195	ENST00000430629;ENST00000536657	T	0.45276	0.9	5.51	-1.37	0.09056	.	0.630246	0.16535	N	0.210185	T	0.16811	0.0404	N	0.08118	0	0.09310	N	0.999997	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.26360	-1.0105	10	0.13108	T	0.6	0.4698	6.928	0.24426	0.1277:0.2917:0.0:0.5806	.	241;241	B4DZN0;Q9Y6W5	.;WASF2_HUMAN	M	241	ENSP00000396211:V241M	ENSP00000396211:V241M	V	-	1	0	WASF2	27611756	0.000000	0.05858	0.063000	0.19743	0.517000	0.34286	-1.404000	0.02494	-0.405000	0.07599	0.557000	0.71058	GTG	.		0.493	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009516.1	NM_006990	
ZNF326	284695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	90487903	90487903	+	Splice_Site	SNP	A	A	C			TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr1:90487903A>C	ENST00000340281.4	+	11	1543	c.1400A>C	c.(1399-1401)aAg>aCg	p.K467T	ZNF326_ENST00000370447.3_Splice_Site_p.K378T|ZNF326_ENST00000455342.2_Splice_Site_p.K261T	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	467					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		CGTTTTGTTAAGGTAAGATTT	0.303																																					p.K467T		.											.	ZNF326	91	0			c.A1400C						.						158.0	176.0	170.0					1																	90487903		2203	4299	6502	SO:0001630	splice_region_variant	284695	exon11			TTGTTAAGGTAAG	BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.1401+1A>C	1.37:g.90487903A>C		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	395.0	76.0	NM_182976	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Missense_Mutation	SNP	ENST00000340281.4	37	CCDS727.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.549695	0.86127	.	.	ENSG00000162664	ENST00000394590;ENST00000340281;ENST00000370447;ENST00000455342	T;T;T	0.56275	0.47;0.47;0.47	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.63815	0.2543	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.69026	-0.5254	10	0.87932	D	0	-14.7564	15.4524	0.75282	1.0:0.0:0.0:0.0	.	467;467	A8MYX1;Q5BKZ1	.;ZN326_HUMAN	T	467;467;378;261	ENSP00000340796:K467T;ENSP00000359476:K378T;ENSP00000403470:K261T	ENSP00000340796:K467T	K	+	2	0	ZNF326	90260491	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.335000	0.79234	2.104000	0.64026	0.482000	0.46254	AAG	.		0.303	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	Missense_Mutation
SMIM7	79086	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	16770916	16770917	+	Missense_Mutation	DNP	GA	GA	TT	rs11555682	byFrequency	TCGA-DD-A1EJ-01A-11D-A152-10	TCGA-DD-A1EJ-10A-01D-A152-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c681cd9-25fb-42ac-aa6b-bb962882fa22	ff037e6b-c763-416f-91ef-bf0ec01a4225	g.chr19:16770916_16770917GA>TT	ENST00000487416.2	-	1	51_52	c.5_6TC>AA	c.(4-6)aTC>aAA	p.I2K	SMIM7_ENST00000397349.2_5'Flank|SMIM7_ENST00000358726.6_Missense_Mutation_p.I2K|TMEM38A_ENST00000187762.2_5'Flank|CTC-429P9.4_ENST00000600705.1_Missense_Mutation_p.I2K|CTC-429P9.4_ENST00000593962.1_5'Flank|SMIM7_ENST00000597711.1_Missense_Mutation_p.I2K	NM_024104.3	NP_077009.2	Q9BQ49	SMIM7_HUMAN	small integral membrane protein 7	2						integral component of membrane (GO:0016021)											GGATGTCTCCGATCATCGTTAC	0.609																																					p.I2K		.											.	.	.	0			.						.																																			SO:0001583	missense	79086	.			GTCTCCGATCATC	AK025602	CCDS12348.2, CCDS74307.1	19p13.11	2012-10-26	2012-10-26	2012-10-26	ENSG00000214046	ENSG00000214046			28419	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 42"""	C19orf42		12477932	Standard	NM_024104		Approved	MGC2747	uc002ner.3	Q9BQ49	OTTHUMG00000149895	ENST00000487416.2:c.5_6delinsTT	19.37:g.16770916_16770917delinsTT	ENSP00000417147:p.Ile2Lys	Somatic	304.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	13.0	.	A8MX44	Missense_Mutation	DNP	ENST00000487416.2	37	CCDS12348.2																																																																																			.		0.609	SMIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313801.2	NM_024104	
