#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AATK	9625	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	79094085	79094085	+	Silent	SNP	C	C	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:79094085C>G	ENST00000326724.4	-	11	3675	c.3651G>C	c.(3649-3651)ctG>ctC	p.L1217L	AATK_ENST00000417379.1_Silent_p.L1114L	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1217					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AGGTCTCGGACAGCAGGCTGG	0.667																																					p.L1217L		.											.	AATK	933	0			c.G3651C						.						26.0	31.0	30.0					17																	79094085		2147	4235	6382	SO:0001819	synonymous_variant	9625	exon11			CTCGGACAGCAGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3651G>C	17.37:g.79094085C>G		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	39.0	NM_001080395	O75136|Q6ZN31|Q86X28	Silent	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	C	8.746	0.920116	0.17982	.	.	ENSG00000181409	ENST00000417379	.	.	.	3.98	2.9	0.33743	.	.	.	.	.	T	0.56381	0.1981	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50792	-0.8786	4	.	.	.	.	7.9182	0.29831	0.0:0.5191:0.3869:0.094	.	.	.	.	S	1170	.	.	C	-	2	0	AATK	76708680	0.013000	0.17824	0.991000	0.47740	0.832000	0.47134	-0.192000	0.09587	0.843000	0.35070	0.313000	0.20887	TGT	.		0.667	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
ABCB6	10058	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220075719	220075719	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:220075719C>A	ENST00000265316.3	-	15	2396	c.2080G>T	c.(2080-2082)Gat>Tat	p.D694Y	ABCB6_ENST00000439002.2_Missense_Mutation_p.D648Y	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	694	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCACCTCATCATTCCCAGCT	0.547																																					p.D694Y		.											.	ABCB6	153	0			c.G2080T						.						86.0	76.0	79.0					2																	220075719		2203	4300	6503	SO:0001583	missense	10058	exon15			CCTCATCATTCCC	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.2080G>T	2.37:g.220075719C>A	ENSP00000265316:p.Asp694Tyr	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	41.0	NM_005689	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	SNP	ENST00000265316.3	37	CCDS2436.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.411|6.411	0.444004|0.444004	0.12164|0.12164	.|.	.|.	ENSG00000115657|ENSG00000115657	ENST00000265316;ENST00000439002|ENST00000295750	D;D|.	0.91068|.	-2.78;-2.78|.	4.7|4.7	-1.52|-1.52	0.08637|0.08637	ATPase, AAA+ type, core (1);ABC transporter-like (2);|.	0.915309|.	0.09535|.	N|.	0.789071|.	T|T	0.47192|0.47192	0.1432|0.1432	M|M	0.83852|0.83852	2.665|2.665	0.09310|0.09310	N|N	0.999999|0.999999	B;P|.	0.34892|.	0.297;0.474|.	B;B|.	0.40506|.	0.105;0.331|.	T|T	0.48175|0.48175	-0.9058|-0.9058	10|5	0.87932|.	D|.	0|.	0.686|0.686	2.4059|2.4059	0.04413|0.04413	0.1079:0.4165:0.2131:0.2625|0.1079:0.4165:0.2131:0.2625	.|.	648;694|.	Q9NP58-4;Q9NP58|.	.;ABCB6_HUMAN|.	Y|I	694;648|541	ENSP00000265316:D694Y;ENSP00000394333:D648Y|.	ENSP00000265316:D694Y|.	D|M	-|-	1|3	0|0	ABCB6|ABCB6	219783963|219783963	0.010000|0.010000	0.17322|0.17322	0.000000|0.000000	0.03702|0.03702	0.022000|0.022000	0.10575|0.10575	0.588000|0.588000	0.23924|0.23924	-0.096000|-0.096000	0.12329|0.12329	-0.903000|-0.903000	0.02851|0.02851	GAT|ATG	.		0.547	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
ABCC9	10060	hgsc.bcm.edu;bcgsc.ca	37	12	22012588	22012588	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr12:22012588T>C	ENST00000261201.4	-	20	2436	c.2437A>G	c.(2437-2439)Agt>Ggt	p.S813G	RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000261200.4_Missense_Mutation_p.S813G|ABCC9_ENST00000345162.2_Missense_Mutation_p.S777G	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	813	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TGTCCCCCACTCAGGTTGATG	0.383																																					p.S813G		.											.	ABCC9	96	0			c.A2437G						.						170.0	171.0	170.0					12																	22012588		2203	4300	6503	SO:0001583	missense	10060	exon20			CCCCACTCAGGTT	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2437A>G	12.37:g.22012588T>C	ENSP00000261201:p.Ser813Gly	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_005691	O60707	Missense_Mutation	SNP	ENST00000261201.4	37	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.169044	0.78339	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.98822	-5.16;-5.16;-5.16;-5.16	4.71	4.71	0.59529	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.99530	0.9832	H	0.99211	4.47	0.80722	D	1	P;D	0.89917	0.941;1.0	P;D	0.91635	0.766;0.999	D	0.97698	1.0183	10	0.87932	D	0	-17.5591	14.3377	0.66603	0.0:0.0:0.0:1.0	.	813;813	O60706;O60706-2	ABCC9_HUMAN;.	G	813;440;813;777	ENSP00000261200:S813G;ENSP00000440521:S440G;ENSP00000261201:S813G;ENSP00000261202:S777G	ENSP00000261200:S813G	S	-	1	0	ABCC9	21903855	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.854000	0.86942	1.982000	0.57802	0.383000	0.25322	AGT	.		0.383	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
ADAMTS18	170692	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	77327037	77327037	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:77327037C>A	ENST00000282849.5	-	20	3543	c.3125G>T	c.(3124-3126)gGc>gTc	p.G1042V	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1042	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						AAGCACACAGCCCTCCTGCAG	0.602																																					p.G1042V		.											.	ADAMTS18	1036	0			c.G3125T						.						88.0	82.0	84.0					16																	77327037		2198	4300	6498	SO:0001583	missense	170692	exon20			ACACAGCCCTCCT	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3125G>T	16.37:g.77327037C>A	ENSP00000282849:p.Gly1042Val	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	23.0	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	5.352	0.250201	0.10130	.	.	ENSG00000140873	ENST00000282849	T	0.59638	0.25	6.02	6.02	0.97574	.	0.159420	0.52532	D	0.000077	T	0.38585	0.1046	N	0.11131	0.1	0.58432	D	0.999998	B;B	0.10296	0.003;0.002	B;B	0.14023	0.002;0.01	T	0.25710	-1.0124	10	0.15066	T	0.55	.	15.7552	0.78018	0.0:0.8545:0.1455:0.0	.	1042;1042	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	V	1042	ENSP00000282849:G1042V	ENSP00000282849:G1042V	G	-	2	0	ADAMTS18	75884538	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	1.304000	0.33482	2.850000	0.98022	0.650000	0.86243	GGC	.		0.602	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
AKAP4	8852	hgsc.bcm.edu;bcgsc.ca	37	X	49963345	49963345	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chrX:49963345T>C	ENST00000376056.2	-	2	209	c.59A>G	c.(58-60)tAc>tGc	p.Y20C	AKAP4_ENST00000376064.3_Missense_Mutation_p.Y20C|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.Y20C|AKAP4_ENST00000358526.2_Missense_Mutation_p.Y29C					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TTCTGGGTTGTAGAGATCTAC	0.423																																					p.Y29C		.											.	AKAP4	540	0			c.A86G						.						121.0	92.0	102.0					X																	49963345		2203	4300	6503	SO:0001583	missense	8852	exon2			GGGTTGTAGAGAT	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.59A>G	X.37:g.49963345T>C	ENSP00000365224:p.Tyr20Cys	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	7.0	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	T	10.08	1.251060	0.22880	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064;ENST00000448865;ENST00000437370	T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06	5.02	5.02	0.67125	.	0.000000	0.46442	D	0.000284	T	0.62502	0.2433	M	0.78801	2.425	0.25657	N	0.986043	D;D	0.76494	0.999;0.999	D;D	0.81914	0.994;0.995	T	0.58165	-0.7684	9	.	.	.	-11.9723	10.2373	0.43290	0.0:0.0:0.0:1.0	.	29;20	Q5JQC9;A6ND82	AKAP4_HUMAN;.	C	20;20;29;20;20;20	ENSP00000365224:Y20C;ENSP00000365226:Y20C;ENSP00000351327:Y29C;ENSP00000365232:Y20C;ENSP00000402403:Y20C;ENSP00000412279:Y20C	.	Y	-	2	0	AKAP4	49850085	1.000000	0.71417	0.999000	0.59377	0.052000	0.14988	3.990000	0.56965	1.683000	0.51011	0.486000	0.48141	TAC	.		0.423	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
ARFGEF1	10565	hgsc.bcm.edu;bcgsc.ca	37	8	68113709	68113709	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr8:68113709G>C	ENST00000262215.3	-	37	5649	c.5260C>G	c.(5260-5262)Ctt>Gtt	p.L1754V	ARFGEF1_ENST00000517955.1_5'UTR|ARFGEF1_ENST00000518230.1_Missense_Mutation_p.L592V|ARFGEF1_ENST00000520381.1_Missense_Mutation_p.L1208V	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1754					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TACTTCAAAAGCCTCTGCTGG	0.587																																					p.L1754V		.											.	ARFGEF1	294	0			c.C5260G						.						63.0	58.0	59.0					8																	68113709		2203	4300	6503	SO:0001583	missense	10565	exon37			TCAAAAGCCTCTG	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.5260C>G	8.37:g.68113709G>C	ENSP00000262215:p.Leu1754Val	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	349.0	16.0	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514446	0.64522	.	.	ENSG00000066777	ENST00000520381;ENST00000262215;ENST00000518789;ENST00000518230	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.42	5.42	0.78866	.	0.144113	0.48286	D	0.000193	T	0.71779	0.3380	M	0.88842	2.985	0.58432	D	0.99999	D;P;B;P	0.89917	1.0;0.89;0.435;0.89	D;P;B;P	0.87578	0.998;0.486;0.266;0.486	T	0.74973	-0.3481	10	0.51188	T	0.08	.	12.5629	0.56293	0.0772:0.0:0.9228:0.0	.	1754;1232;578;1208	Q9Y6D6;Q59FY5;B3KMS9;E5RIF2	BIG1_HUMAN;.;.;.	V	1208;1754;85;592	ENSP00000428429:L1208V;ENSP00000262215:L1754V;ENSP00000429560:L85V;ENSP00000430891:L592V	ENSP00000262215:L1754V	L	-	1	0	ARFGEF1	68276263	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.826000	0.62715	2.717000	0.92951	0.650000	0.86243	CTT	.		0.587	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
ARFIP1	27236	hgsc.bcm.edu;bcgsc.ca	37	4	153803996	153803996	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr4:153803996A>G	ENST00000451320.2	+	7	919	c.755A>G	c.(754-756)gAt>gGt	p.D252G	ARFIP1_ENST00000353617.2_Missense_Mutation_p.D252G|ARFIP1_ENST00000405727.2_Missense_Mutation_p.D220G|ARFIP1_ENST00000356064.3_Missense_Mutation_p.D220G|ARFIP1_ENST00000429148.2_Missense_Mutation_p.D72G			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	252	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)			ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					ACCATTGAAGATACATTAATG	0.348																																					p.D252G		.											.	ARFIP1	91	0			c.A755G						.						89.0	91.0	90.0					4																	153803996		2203	4300	6503	SO:0001583	missense	27236	exon7			TTGAAGATACATT	U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.755A>G	4.37:g.153803996A>G	ENSP00000395083:p.Asp252Gly	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	4.0	NM_001025595	Q2M2X4|Q3SYL4|Q9Y2X6	Missense_Mutation	SNP	ENST00000451320.2	37	CCDS34080.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.737579	0.89482	.	.	ENSG00000164144	ENST00000451320;ENST00000429148;ENST00000353617;ENST00000405727;ENST00000356064	D;D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11;-3.11	6.17	6.17	0.99709	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.96476	0.8850	M	0.84948	2.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.96901	0.9660	10	0.87932	D	0	-24.5395	16.8222	0.85835	1.0:0.0:0.0:0.0	.	72;220;252	B4DS69;Q2M2X4;P53367	.;.;ARFP1_HUMAN	G	252;72;252;220;220	ENSP00000395083:D252G;ENSP00000396653:D72G;ENSP00000296557:D252G;ENSP00000384189:D220G;ENSP00000348360:D220G	ENSP00000296557:D252G	D	+	2	0	ARFIP1	154023446	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	GAT	.		0.348	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365032.1	NM_014447	
ARHGEF26	26084	hgsc.bcm.edu;bcgsc.ca	37	3	153839867	153839867	+	Missense_Mutation	SNP	T	T	C	rs200926651	byFrequency	TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:153839867T>C	ENST00000356448.4	+	2	370	c.86T>C	c.(85-87)gTt>gCt	p.V29A	ARHGEF26_ENST00000465093.1_Missense_Mutation_p.V29A|ARHGEF26-AS1_ENST00000491862.1_RNA|ARHGEF26-AS1_ENST00000480639.1_RNA|ARHGEF26-AS1_ENST00000467912.1_RNA|ARHGEF26_ENST00000465817.1_Missense_Mutation_p.V29A|ARHGEF26-AS1_ENST00000479270.1_RNA	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	29			V -> L (in dbSNP:rs12493885). {ECO:0000269|PubMed:12697679, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15133129, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:21406692}.		endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						CCCCACCAGGTTCTGGGCCGG	0.627																																					p.V29A	GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	.											.	ARHGEF26	47	0			c.T86C						.						19.0	22.0	21.0					3																	153839867		1948	4153	6101	SO:0001583	missense	26084	exon2			ACCAGGTTCTGGG	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.86T>C	3.37:g.153839867T>C	ENSP00000348828:p.Val29Ala	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	11.0	NM_001251962	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	ENST00000356448.4	37	CCDS46938.1	.	.	.	.	.	.	.	.	.	.	T	12.15	1.851263	0.32699	.	.	ENSG00000114790	ENST00000356448;ENST00000465093;ENST00000465817	T;T;T	0.55234	0.53;0.53;2.31	4.49	0.538	0.17150	.	1.110460	0.06940	N	0.812561	T	0.30230	0.0758	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24297	-1.0164	10	0.51188	T	0.08	-4.6961	5.2467	0.15500	0.0:0.196:0.2513:0.5526	.	29;29	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	A	29	ENSP00000348828:V29A;ENSP00000423418:V29A;ENSP00000423295:V29A	ENSP00000348828:V29A	V	+	2	0	ARHGEF26	155322557	0.088000	0.21588	0.872000	0.34217	0.713000	0.41058	0.303000	0.19210	0.555000	0.29079	0.459000	0.35465	GTT	.		0.627	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595	
ASAP2	8853	hgsc.bcm.edu;bcgsc.ca	37	2	9515031	9515031	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:9515031T>C	ENST00000281419.3	+	17	2044	c.1704T>C	c.(1702-1704)gaT>gaC	p.D568D	ASAP2_ENST00000315273.4_Silent_p.D568D	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	568					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						CTTATGCTGATGGTGTGGATC	0.483																																					p.D568D		.											.	ASAP2	90	0			c.T1704C						.						96.0	97.0	96.0					2																	9515031		2203	4300	6503	SO:0001819	synonymous_variant	8853	exon17			TGCTGATGGTGTG	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1704T>C	2.37:g.9515031T>C		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_001135191	D6W4Y8	Silent	SNP	ENST00000281419.3	37	CCDS1661.1																																																																																			.		0.483	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
ASCC3	10973	hgsc.bcm.edu;bcgsc.ca	37	6	101312035	101312035	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr6:101312035T>C	ENST00000369162.2	-	3	490	c.146A>G	c.(145-147)aAg>aGg	p.K49R	ASCC3_ENST00000369143.2_Missense_Mutation_p.K49R|ASCC3_ENST00000522650.1_Missense_Mutation_p.K49R	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	49					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TTTTATTATCTTCTTCCATGT	0.294																																					p.K49R		.											.	ASCC3	96	0			c.A146G						.						99.0	110.0	107.0					6																	101312035		2201	4298	6499	SO:0001583	missense	10973	exon3			ATTATCTTCTTCC	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.146A>G	6.37:g.101312035T>C	ENSP00000358159:p.Lys49Arg	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	5.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	T	14.69	2.609906	0.46527	.	.	ENSG00000112249	ENST00000369162;ENST00000522650;ENST00000324723;ENST00000369143	T;T;T	0.58506	0.42;0.33;0.79	5.32	4.16	0.48862	.	0.108694	0.64402	D	0.000009	T	0.55955	0.1953	L	0.59436	1.845	0.26722	N	0.970765	B;D;B;B	0.71674	0.022;0.998;0.022;0.003	B;D;B;B	0.78314	0.018;0.991;0.018;0.005	T	0.51748	-0.8666	10	0.41790	T	0.15	.	9.1586	0.37007	0.0:0.0868:0.0:0.9132	.	49;49;49;49	Q4G1A0;Q9H5A2;E7EW23;Q8N3C0	.;.;.;HELC1_HUMAN	R	49	ENSP00000358159:K49R;ENSP00000430769:K49R;ENSP00000320777:K49R	ENSP00000320777:K49R	K	-	2	0	ASCC3	101418756	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	5.069000	0.64370	0.861000	0.35504	0.533000	0.62120	AAG	.		0.294	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
ATXN7L1	222255	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	105283324	105283324	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr7:105283324C>G	ENST00000419735.3	-	5	868	c.823G>C	c.(823-825)Ggc>Cgc	p.G275R	ATXN7L1_ENST00000477775.1_Missense_Mutation_p.G151R|ATXN7L1_ENST00000472910.1_5'UTR	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	275										endometrium(1)|large_intestine(4)|lung(5)	10						TTTTTGGTGCCATTTTGGTGT	0.463																																					p.G275R		.											.	ATXN7L1	90	0			c.G823C						.						446.0	342.0	373.0					7																	105283324		692	1591	2283	SO:0001583	missense	222255	exon5			TGGTGCCATTTTG	AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.823G>C	7.37:g.105283324C>G	ENSP00000410759:p.Gly275Arg	Somatic	309.0	0.0		WXS	Illumina HiSeq	Phase_I	480.0	125.0	NM_020725	A4D0Q2|B4DTS1|Q8N2T0	Missense_Mutation	SNP	ENST00000419735.3	37	CCDS47682.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285886	0.80803	.	.	ENSG00000146776	ENST00000419735;ENST00000477775;ENST00000472195	T;T;T	0.15487	2.46;2.43;2.42	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.36441	0.0967	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.961;1.0	T	0.00802	-1.1560	10	0.52906	T	0.07	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	59;151;275	A4D0Q3;Q9ULK2-3;Q9ULK2	.;.;AT7L1_HUMAN	R	275;151;151	ENSP00000410759:G275R;ENSP00000418476:G151R;ENSP00000419566:G151R	ENSP00000410759:G275R	G	-	1	0	ATXN7L1	105070560	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.546000	0.60705	2.941000	0.99782	0.655000	0.94253	GGC	.		0.463	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349037.2		
ATXN7L3	56970	hgsc.bcm.edu;bcgsc.ca	37	17	42273429	42273429	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:42273429T>C	ENST00000454077.2	-	6	516	c.517A>G	c.(517-519)Aga>Gga	p.R173G	CTB-175E5.7_ENST00000586560.1_RNA|ATXN7L3_ENST00000389384.4_Missense_Mutation_p.R166G|ATXN7L3_ENST00000593073.1_Intron	NM_020218.1	NP_064603.1			ataxin 7-like 3											kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GACTTGGATCTTCGAGGGGAA	0.502																																					p.R173G		.											.	ATXN7L3	68	0			c.A517G						.						91.0	89.0	90.0					17																	42273429		1852	4093	5945	SO:0001583	missense	56970	exon6			TGGATCTTCGAGG	AK056002	CCDS42345.1, CCDS45697.1	17q21	2010-03-10			ENSG00000087152	ENSG00000087152			25416	protein-coding gene	gene with protein product						15115762	Standard	NM_001098833		Approved	DKFZp761G2113	uc002ifz.3	Q14CW9		ENST00000454077.2:c.517A>G	17.37:g.42273429T>C	ENSP00000397259:p.Arg173Gly	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_020218		Missense_Mutation	SNP	ENST00000454077.2	37	CCDS45697.1	.	.	.	.	.	.	.	.	.	.	T	14.90	2.674091	0.47781	.	.	ENSG00000087152	ENST00000454077;ENST00000389384	.	.	.	4.95	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.66499	0.2795	L	0.46157	1.445	0.58432	D	0.999999	D;D	0.61080	0.982;0.989	P;D	0.75020	0.715;0.985	T	0.67975	-0.5531	9	0.59425	D	0.04	.	10.5191	0.44907	0.0:0.0:0.1623:0.8377	.	166;173	Q14CW9;Q14CW9-2	AT7L3_HUMAN;.	G	173;166	.	ENSP00000374035:R166G	R	-	1	2	ATXN7L3	39628955	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.526000	0.60566	1.858000	0.53909	0.454000	0.30748	AGA	.		0.502	ATXN7L3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457724.1		
BAZ2A	11176	hgsc.bcm.edu;bcgsc.ca	37	12	56997486	56997486	+	Splice_Site	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr12:56997486T>C	ENST00000551812.1	-	17	3238		c.e17-2		BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000379441.3_Splice_Site|BAZ2A_ENST00000179765.5_Splice_Site|BAZ2A_ENST00000549884.1_Splice_Site	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A						chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GTTTTCAGCCTTGAAATAGAT	0.542																																					.		.											.	BAZ2A	22	0			c.3045-2A>G						.						42.0	40.0	41.0					12																	56997486		1932	4135	6067	SO:0001630	splice_region_variant	11176	exon18			TCAGCCTTGAAAT	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.3045-2A>G	12.37:g.56997486T>C		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Splice_Site	SNP	ENST00000551812.1	37	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.385176	0.42308	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549884	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0842	0.48078	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	BAZ2A	55283753	1.000000	0.71417	0.985000	0.45067	0.517000	0.34286	4.145000	0.58065	1.940000	0.56252	0.533000	0.62120	.	.		0.542	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	Intron
BCAR1	9564	hgsc.bcm.edu;bcgsc.ca	37	16	75269535	75269535	+	Missense_Mutation	SNP	G	G	T	rs376153187		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:75269535G>T	ENST00000162330.5	-	5	1388	c.1262C>A	c.(1261-1263)cCg>cAg	p.P421Q	BCAR1_ENST00000538440.2_Missense_Mutation_p.P421Q|BCAR1_ENST00000418647.3_Missense_Mutation_p.P467Q|BCAR1_ENST00000546196.1_Missense_Mutation_p.P392Q|BCAR1_ENST00000542031.2_Missense_Mutation_p.P419Q|BCAR1_ENST00000535626.2_Missense_Mutation_p.P273Q|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000420641.3_Missense_Mutation_p.P439Q|BCAR1_ENST00000393422.2_Missense_Mutation_p.P439Q|BCAR1_ENST00000393420.6_Missense_Mutation_p.P439Q	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	421					actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GCCCTCTGCCGGGGCTTCACG	0.687																																					p.P467Q		.											.	BCAR1	1145	0			c.C1400A						.						21.0	26.0	24.0					16																	75269535		2197	4298	6495	SO:0001583	missense	9564	exon6			TCTGCCGGGGCTT	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.1262C>A	16.37:g.75269535G>T	ENSP00000162330:p.Pro421Gln	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	10.0	NM_001170714	B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	ENST00000162330.5	37	CCDS10915.1	.	.	.	.	.	.	.	.	.	.	G	1.871	-0.460203	0.04508	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000535626;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T;T	0.37584	1.3;1.84;1.61;1.41;1.61;1.19;1.38;1.3;3.11	3.91	0.522	0.17053	.	0.693744	0.12978	N	0.423522	T	0.27697	0.0681	L	0.34521	1.04	0.09310	N	0.999999	P;P;P;P;P;P;P;P;B	0.46952	0.64;0.887;0.819;0.755;0.755;0.64;0.874;0.64;0.33	B;P;B;B;B;B;B;B;B	0.49683	0.238;0.619;0.301;0.299;0.417;0.171;0.394;0.157;0.157	T	0.09796	-1.0658	10	0.28530	T	0.3	-7.8402	0.9398	0.01353	0.2195:0.1783:0.4197:0.1826	.	439;273;467;419;439;439;421;421;211	B4DIW5;F5GXV6;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945;B3KWE2	.;.;.;.;.;.;.;BCAR1_HUMAN;.	Q	421;439;439;421;467;273;439;419;392	ENSP00000162330:P421Q;ENSP00000377074:P439Q;ENSP00000392708:P439Q;ENSP00000443841:P421Q;ENSP00000391669:P467Q;ENSP00000440370:P273Q;ENSP00000377072:P439Q;ENSP00000440415:P419Q;ENSP00000442161:P392Q	ENSP00000162330:P421Q	P	-	2	0	BCAR1	73827036	0.004000	0.15560	0.007000	0.13788	0.002000	0.02628	0.235000	0.17948	0.411000	0.25702	-0.384000	0.06662	CCG	.		0.687	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269017.1	NM_014567	
BRD2	6046	hgsc.bcm.edu;bcgsc.ca	37	6	32945598	32945598	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr6:32945598T>C	ENST00000374825.4	+	9	3095	c.1394T>C	c.(1393-1395)gTc>gCc	p.V465A	BRD2_ENST00000374831.4_Missense_Mutation_p.V465A|BRD2_ENST00000443797.2_Missense_Mutation_p.V345A|BRD2_ENST00000449085.2_Missense_Mutation_p.V418A|BRD2_ENST00000395287.1_Missense_Mutation_p.V465A|BRD2_ENST00000395289.2_Missense_Mutation_p.V465A	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	465					chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						CCTTTACCAGTCTCTACTGCC	0.488																																					p.V465A		.											.	BRD2	398	0			c.T1394C						.						126.0	135.0	132.0					6																	32945598		1511	2708	4219	SO:0001583	missense	6046	exon9			TACCAGTCTCTAC	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1394T>C	6.37:g.32945598T>C	ENSP00000363958:p.Val465Ala	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	291.0	19.0	NM_005104	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	ENST00000374825.4	37	CCDS4762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.34|11.34	1.609980|1.609980	0.28712|0.28712	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000449025|ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	.|T;T;T;T;T;T	.|0.06933	.|3.41;3.41;3.39;3.24;3.39;3.37	5.63|5.63	4.47|4.47	0.54385|0.54385	.|Bromodomain (1);	.|0.305062	.|0.23670	.|N	.|0.045736	T|T	0.01320|0.01320	0.0043|0.0043	N|N	0.16478|0.16478	0.41|0.41	0.42077|0.42077	D|D	0.991233|0.991233	.|B;B	.|0.15141	.|0.005;0.012	.|B;B	.|0.15870	.|0.014;0.014	T|T	0.42430|0.42430	-0.9452|-0.9452	5|10	.|0.06891	.|T	.|0.86	-9.8783|-9.8783	5.5595|5.5595	0.17135|0.17135	0.0:0.1763:0.0:0.8237|0.0:0.1763:0.0:0.8237	.|.	.|465;465	.|A2AAU0;P25440	.|.;BRD2_HUMAN	P|A	471|465;465;465;345;465;418	.|ENSP00000363958:V465A;ENSP00000363964:V465A;ENSP00000378704:V465A;ENSP00000413495:V345A;ENSP00000378702:V465A;ENSP00000409145:V418A	.|ENSP00000363958:V465A	S|V	+|+	1|2	0|0	BRD2|BRD2	33053576|33053576	0.410000|0.410000	0.25376|0.25376	0.975000|0.975000	0.42487|0.42487	0.990000|0.990000	0.78478|0.78478	0.895000|0.895000	0.28363|0.28363	2.363000|2.363000	0.80096|0.80096	0.523000|0.523000	0.50628|0.50628	TCT|GTC	.		0.488	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
CACNA1B	774	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140772543	140772543	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr9:140772543C>T	ENST00000371372.1	+	1	303	c.158C>T	c.(157-159)gCg>gTg	p.A53V	CACNA1B_ENST00000371355.4_Missense_Mutation_p.A53V|CACNA1B_ENST00000277551.2_Missense_Mutation_p.A53V|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A53V|CACNA1B_ENST00000277549.5_5'UTR|RP11-188C12.3_ENST00000371390.1_RNA|CACNA1B_ENST00000371363.1_Missense_Mutation_p.A53V	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	53					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GCGCAGCGCGCGCGGACCATG	0.721																																					p.A53V		.											.	CACNA1B	138	0			c.C158T						.						24.0	28.0	27.0					9																	140772543		2013	4175	6188	SO:0001583	missense	774	exon1			AGCGCGCGCGGAC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.158C>T	9.37:g.140772543C>T	ENSP00000360423:p.Ala53Val	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	75.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708039	0.89018	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.97404	-4.36;-4.37;-4.32;-4.34;-4.35	3.46	3.46	0.39613	.	0.000000	0.64402	U	0.000003	D	0.96219	0.8767	M	0.83953	2.67	0.80722	D	1	B	0.24533	0.105	B	0.11329	0.006	D	0.95823	0.8851	10	0.87932	D	0	.	13.975	0.64268	0.0:1.0:0.0:0.0	.	53	B1AQK6	.	V	53	ENSP00000360423:A53V;ENSP00000277551:A53V;ENSP00000360414:A53V;ENSP00000360408:A53V;ENSP00000360406:A53V	ENSP00000277551:A53V	A	+	2	0	CACNA1B	139892364	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.994000	0.63901	1.497000	0.48584	0.298000	0.19748	GCG	.		0.721	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CCDC136	64753	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	128455707	128455707	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr7:128455707A>C	ENST00000297788.4	+	16	3452	c.3085A>C	c.(3085-3087)Aaa>Caa	p.K1029Q	CCDC136_ENST00000471729.1_Intron|CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000464832.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	1029						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						CAGCCAGAGGAAATTAGATGG	0.507																																					p.K1029Q		.											.	CCDC136	24	0			c.A3085C						.						34.0	34.0	34.0					7																	128455707		1946	4129	6075	SO:0001583	missense	64753	exon16			CAGAGGAAATTAG		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.3085A>C	7.37:g.128455707A>C	ENSP00000297788:p.Lys1029Gln	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	73.0	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	37	CCDS47704.1	.	.	.	.	.	.	.	.	.	.	A	7.458	0.644011	0.14451	.	.	ENSG00000128596	ENST00000297788;ENST00000397697	T	0.31510	1.49	4.82	0.68	0.17980	.	1.619910	0.03252	N	0.181948	T	0.19327	0.0464	L	0.34521	1.04	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.10450	0.005;0.003	T	0.10086	-1.0645	10	0.08837	T	0.75	0.8604	1.0683	0.01616	0.222:0.2189:0.3982:0.1609	.	1029;1029	Q96JN2-4;Q96JN2	.;CC136_HUMAN	Q	1029	ENSP00000297788:K1029Q	ENSP00000297788:K1029Q	K	+	1	0	CCDC136	128242943	0.000000	0.05858	0.000000	0.03702	0.057000	0.15508	0.216000	0.17585	0.004000	0.14682	-0.468000	0.05107	AAA	.		0.507	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
CDC42	998	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	22413358	22413358	+	Splice_Site	DEL	A	A	-			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:22413358delA	ENST00000344548.3	+	6	736	c.485delA	c.(484-486)cag>cg	p.Q162fs	CDC42_ENST00000498236.1_3'UTR|CDC42_ENST00000315554.8_Splice_Site_p.Q162fs|CDC42_ENST00000421089.2_Splice_Site_p.Q204fs|CDC42_ENST00000400259.1_Splice_Site_p.Q162fs	NM_001039802.1	NP_001034891.1	P60953	CDC42_HUMAN	cell division cycle 42	162					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cellular protein localization (GO:0034613)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell-cell adhesion (GO:0090136)|epithelial-mesenchymal cell signaling (GO:0060684)|establishment of Golgi localization (GO:0051683)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|keratinization (GO:0031424)|keratinocyte development (GO:0003334)|macrophage differentiation (GO:0030225)|multicellular organism growth (GO:0035264)|muscle cell differentiation (GO:0042692)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of gene expression (GO:0010629)|negative regulation of protein complex assembly (GO:0031333)|neuron fate determination (GO:0048664)|nuclear migration (GO:0007097)|nucleus localization (GO:0051647)|organelle transport along microtubule (GO:0072384)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of JNK cascade (GO:0046330)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of synapse structural plasticity (GO:0051835)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of filopodium assembly (GO:0051489)|regulation of mitosis (GO:0007088)|regulation of protein catabolic process (GO:0042176)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein kinase activity (GO:0045859)|regulation of protein stability (GO:0031647)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|sprouting angiogenesis (GO:0002040)|submandibular salivary gland formation (GO:0060661)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	apical part of cell (GO:0045177)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|spindle midzone (GO:0051233)	apolipoprotein A-I receptor binding (GO:0034191)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)	12		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0452)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.35e-07)|COAD - Colon adenocarcinoma(152;7.73e-06)|GBM - Glioblastoma multiforme(114;8.62e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000649)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00767)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.207)		GCACTTACACAGGTAAGAATG	0.443																																					p.Q162fs		.											.	CDC42	1084	0			c.485delA						.						123.0	123.0	123.0					1																	22413358		2203	4300	6503	SO:0001630	splice_region_variant	998	exon5			TTACACAGGTAAG	BC018266	CCDS221.1, CCDS222.1	1p36.1	2013-01-17	2013-01-17		ENSG00000070831	ENSG00000070831			1736	protein-coding gene	gene with protein product	"""GTP binding protein, 25kDa"""	116952	"""cell division cycle 42 (GTP-binding protein, 25kD)"", ""cell division cycle 42 (GTP binding protein, 25kDa)"""			2124704, 2122236	Standard	NM_001039802		Approved	G25K, CDC42Hs	uc001bfr.3	P60953	OTTHUMG00000002753	ENST00000344548.3:c.486+1A>-	1.37:g.22413358delA		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	51.0	NM_001791	P21181|P25763|Q7L8R5|Q9UDI2	Frame_Shift_Del	DEL	ENST00000344548.3	37	CCDS221.1																																																																																			.		0.443	CDC42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007787.1	NM_001791	Frame_Shift_Del
CECR1	51816	hgsc.bcm.edu;bcgsc.ca	37	22	17662863	17662863	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr22:17662863A>G	ENST00000399839.1	-	9	1559	c.1289T>C	c.(1288-1290)aTg>aCg	p.M430T	CECR1_ENST00000330232.4_Missense_Mutation_p.M189T|CECR1_ENST00000399837.2_Missense_Mutation_p.M430T|CECR1_ENST00000262607.3_Missense_Mutation_p.M430T|CECR1_ENST00000449907.2_Missense_Mutation_p.M388T	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	430					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				CCCAGTGGCCATCAGAGTGGC	0.512																																					p.M430T		.											.	CECR1	91	0			c.T1289C						.						86.0	76.0	79.0					22																	17662863		2203	4300	6503	SO:0001583	missense	51816	exon8			GTGGCCATCAGAG	AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.1289T>C	22.37:g.17662863A>G	ENSP00000382733:p.Met430Thr	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_017424	A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Missense_Mutation	SNP	ENST00000399839.1	37	CCDS13742.1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.564220	0.45694	.	.	ENSG00000093072	ENST00000399839;ENST00000330232;ENST00000262607;ENST00000449907;ENST00000399837	D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62	3.92	3.92	0.45320	Adenosine/AMP deaminase (1);	0.124034	0.64402	D	0.000001	D	0.90940	0.7152	M	0.86028	2.79	0.49687	D	0.99981	D;D	0.89917	1.0;0.982	D;P	0.81914	0.995;0.875	D	0.92061	0.5656	10	0.72032	D	0.01	.	12.8002	0.57582	1.0:0.0:0.0:0.0	.	430;189	Q9NZK5;Q9NZK5-2	CECR1_HUMAN;.	T	430;189;430;388;430	ENSP00000382733:M430T;ENSP00000332871:M189T;ENSP00000262607:M430T;ENSP00000406443:M388T;ENSP00000382731:M430T	ENSP00000262607:M430T	M	-	2	0	CECR1	16042863	1.000000	0.71417	0.162000	0.22713	0.435000	0.31806	6.006000	0.70724	1.407000	0.46875	0.454000	0.30748	ATG	.		0.512	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1		
CELSR2	1952	ucsc.edu;bcgsc.ca	37	1	109813221	109813221	+	Splice_Site	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:109813221A>G	ENST00000271332.3	+	24	7543	c.7482A>G	c.(7480-7482)acA>acG	p.T2494T		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2494					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCTTCATCACAGGTACTCCCA	0.617																																					p.T2494T	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.A7482G						.						67.0	51.0	56.0					1																	109813221		2203	4300	6503	SO:0001630	splice_region_variant	1952	exon24			CATCACAGGTACT	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7483+1A>G	1.37:g.109813221A>G		Somatic	94.0	0.0		WXS	Illumina HiSeq	.	147.0	90.0	NM_001408	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																			.		0.617	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	Silent
CENPJ	55835	hgsc.bcm.edu;bcgsc.ca	37	13	25480336	25480336	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr13:25480336A>G	ENST00000381884.4	-	7	2025	c.1840T>C	c.(1840-1842)Tct>Cct	p.S614P	CENPJ_ENST00000545981.1_Missense_Mutation_p.S614P	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	614					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		GGGGTGGAAGACATCCGGTGA	0.433																																					p.S614P		.											.	CENPJ	92	0			c.T1840C						.						94.0	92.0	93.0					13																	25480336		2203	4300	6503	SO:0001583	missense	55835	exon7			TGGAAGACATCCG	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.1840T>C	13.37:g.25480336A>G	ENSP00000371308:p.Ser614Pro	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	6.0	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.091830	0.76756	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.67698	-0.28;0.25	6.02	6.02	0.97574	.	0.135337	0.49916	D	0.000122	T	0.81683	0.4874	M	0.76574	2.34	0.48901	D	0.999729	D	0.89917	1.0	D	0.85130	0.997	D	0.83582	0.0118	10	0.72032	D	0.01	.	15.5319	0.75970	1.0:0.0:0.0:0.0	.	614	Q9HC77	CENPJ_HUMAN	P	614	ENSP00000371308:S614P;ENSP00000441090:S614P	ENSP00000371308:S614P	S	-	1	0	CENPJ	24378336	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.924000	0.70054	2.299000	0.77371	0.528000	0.53228	TCT	.		0.433	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
CHMP5	51510	hgsc.bcm.edu;bcgsc.ca	37	9	33271180	33271180	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr9:33271180A>G	ENST00000223500.8	+	5	483	c.346A>G	c.(346-348)Atg>Gtg	p.M116V	CHMP5_ENST00000419016.2_Missense_Mutation_p.M116V	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5	116					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			AGTAAAGGAAATGAAGAAGGC	0.353																																					p.M116V		.											.	CHMP5	91	0			c.A346G						.						164.0	144.0	151.0					9																	33271180		2203	4300	6503	SO:0001583	missense	51510	exon5			AAGGAAATGAAGA	AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765	ENST00000223500.8:c.346A>G	9.37:g.33271180A>G	ENSP00000223500:p.Met116Val	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	6.0	NM_016410	B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Missense_Mutation	SNP	ENST00000223500.8	37	CCDS6537.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.172728	0.78452	.	.	ENSG00000086065	ENST00000223500;ENST00000419016	T;T	0.79653	-1.29;-1.29	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.86222	0.5881	M	0.87328	2.875	0.58432	D	0.999999	P;B	0.36712	0.566;0.416	B;B	0.43990	0.438;0.403	D	0.88094	0.2815	10	0.87932	D	0	-9.9225	14.049	0.64725	1.0:0.0:0.0:0.0	.	116;116	B4DIR6;Q9NZZ3	.;CHMP5_HUMAN	V	116	ENSP00000223500:M116V;ENSP00000442725:M116V	ENSP00000223500:M116V	M	+	1	0	CHMP5	33261180	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.879000	0.92398	2.259000	0.74868	0.529000	0.55759	ATG	.		0.353	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410	
CLTCL1	8218	ucsc.edu;bcgsc.ca	37	22	19189003	19189003	+	Splice_Site	SNP	A	A	C	rs112507727|rs11386977|rs72564418		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr22:19189003A>C	ENST00000263200.10	-	23	3674	c.3602T>G	c.(3601-3603)gTt>gGt	p.V1201G	CLTCL1_ENST00000442042.2_5'UTR|CLTCL1_ENST00000427926.1_Intron|CLTCL1_ENST00000353891.5_Splice_Site_p.V1201G	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1201	Heavy chain arm.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					GCGGTCTCCAACTACGGATAA	0.478			T	?	ALCL																																p.V1201G		.		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	CLTCL1	230	0			c.T3602G						.						72.0	76.0	75.0					22																	19189003		1943	4159	6102	SO:0001630	splice_region_variant	8218	exon23			TCTCCAACTACGG		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.3601-1T>G	22.37:g.19189003A>C		Somatic	108.0	0.0		WXS	Illumina HiSeq	.	102.0	0.0	NM_001835	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	A	12.67	2.006462	0.35415	.	.	ENSG00000070371	ENST00000353891;ENST00000263200	T;T	0.30182	1.54;1.54	3.33	2.29	0.28610	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.59266	0.2181	M	0.92412	3.305	0.80722	D	1	B;D	0.61697	0.164;0.99	P;D	0.74023	0.634;0.982	T	0.61594	-0.7031	9	0.87932	D	0	.	8.4062	0.32616	0.9032:0.0:0.0968:0.0	.	1201;1201	P53675-2;P53675	.;CLH2_HUMAN	G	1201	ENSP00000439662:V1201G;ENSP00000445677:V1201G	ENSP00000445677:V1201G	V	-	2	0	CLTCL1	17569003	1.000000	0.71417	0.877000	0.34402	0.118000	0.20060	5.230000	0.65321	0.355000	0.24131	-0.589000	0.04120	GTT	A|0.500;C|0.500		0.478	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	Missense_Mutation
CNOT1	23019	hgsc.bcm.edu;bcgsc.ca	37	16	58562491	58562491	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:58562491T>C	ENST00000317147.5	-	44	6673	c.6341A>G	c.(6340-6342)cAt>cGt	p.H2114R	CNOT1_ENST00000569240.1_Missense_Mutation_p.H2109R|CNOT1_ENST00000245138.4_Missense_Mutation_p.H965R	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	2114					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GAACCCATAATGGTAATCACA	0.398																																					p.H2114R		.											.	CNOT1	95	0			c.A6341G						.						93.0	94.0	94.0					16																	58562491		2198	4300	6498	SO:0001583	missense	23019	exon44			CCATAATGGTAAT	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.6341A>G	16.37:g.58562491T>C	ENSP00000320949:p.His2114Arg	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_016284	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.811403	0.90707	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000546037;ENST00000245138;ENST00000394200	T	0.56776	0.44	5.73	5.73	0.89815	CCR4-Not complex component, Not1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80502	0.4635	H	0.94925	3.6	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.998;0.997	D	0.86096	0.1553	10	0.72032	D	0.01	.	16.0096	0.80391	0.0:0.0:0.0:1.0	.	965;2114;2109	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	R	2114;808;119;965;2109	ENSP00000320949:H2114R	ENSP00000245138:H965R	H	-	2	0	CNOT1	57119992	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.015000	0.88690	2.184000	0.69523	0.477000	0.44152	CAT	.		0.398	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
COBL	23242	ucsc.edu;bcgsc.ca;mdanderson.org	37	7	51287588	51287588	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr7:51287588T>G	ENST00000265136.7	-	2	260	c.95A>C	c.(94-96)cAt>cCt	p.H32P	COBL_ENST00000395542.2_Missense_Mutation_p.H32P|COBL_ENST00000395540.2_Missense_Mutation_p.H32P|COBL_ENST00000441453.1_Missense_Mutation_p.H32P	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	32					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					ACTGTGCACATGCAGAGTGGC	0.582																																					p.H32P	NSCLC(189;2119 2138 12223 30818 34679)	.											.	COBL	95	0			c.A95C						.						32.0	33.0	33.0					7																	51287588		2203	4298	6501	SO:0001583	missense	23242	exon2			TGCACATGCAGAG	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.95A>C	7.37:g.51287588T>G	ENSP00000265136:p.His32Pro	Somatic	118.0	1.0		WXS	Illumina HiSeq	.	182.0	79.0	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	T	9.925	1.213369	0.22289	.	.	ENSG00000106078	ENST00000265136;ENST00000395542;ENST00000395540;ENST00000441453;ENST00000449281	T;T	0.11604	2.76;2.77	5.73	3.22	0.36961	Cordon-bleu domain (1);	0.608855	0.14741	N	0.301167	T	0.07143	0.0181	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.28400	0.017;0.015;0.017;0.21	B;B;B;B	0.28991	0.037;0.029;0.037;0.097	T	0.30966	-0.9960	10	0.41790	T	0.15	.	5.4917	0.16779	0.0:0.0884:0.1747:0.7369	.	32;32;32;32	O75128-3;O75128-5;O75128-7;O75128	.;.;.;COBL_HUMAN	P	32;32;32;32;16	ENSP00000265136:H32P;ENSP00000378912:H32P	ENSP00000265136:H32P	H	-	2	0	COBL	51255082	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.127000	0.15790	1.103000	0.41568	0.533000	0.62120	CAT	.		0.582	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
CNTNAP2	26047	hgsc.bcm.edu;bcgsc.ca	37	7	147844667	147844667	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr7:147844667A>G	ENST00000361727.3	+	17	3155	c.2639A>G	c.(2638-2640)gAc>gGc	p.D880G	CNTNAP2_ENST00000538075.1_5'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	880	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTCAACGATGACCAGTGGCAC	0.567										HNSCC(39;0.1)																											p.D880G		.											.	CNTNAP2	100	0			c.A2639G						.						130.0	120.0	124.0					7																	147844667		2203	4300	6503	SO:0001583	missense	26047	exon17			ACGATGACCAGTG	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2639A>G	7.37:g.147844667A>G	ENSP00000354778:p.Asp880Gly	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	5.0	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615335	0.87359	.	.	ENSG00000174469	ENST00000361727	T	0.71341	-0.56	5.34	5.34	0.76211	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.56441	0.1985	N	0.04018	-0.295	0.80722	D	1	B	0.34103	0.437	P	0.44422	0.449	T	0.57207	-0.7851	10	0.17832	T	0.49	.	14.1814	0.65577	1.0:0.0:0.0:0.0	.	880	Q9UHC6	CNTP2_HUMAN	G	880	ENSP00000354778:D880G	ENSP00000354778:D880G	D	+	2	0	CNTNAP2	147475600	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.233000	0.95337	2.029000	0.59856	0.459000	0.35465	GAC	.		0.567	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
COG4	25839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70548316	70548316	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:70548316C>T	ENST00000323786.5	-	4	487	c.466G>A	c.(466-468)Gag>Aag	p.E156K	COG4_ENST00000564653.1_Missense_Mutation_p.E156K|COG4_ENST00000393612.4_Missense_Mutation_p.E152K	NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	152					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				GCAGCCTGCTCATAATCTTCA	0.517																																					p.E156K		.											.	COG4	90	0			c.G466A						.						110.0	94.0	99.0					16																	70548316		2198	4300	6498	SO:0001583	missense	25839	exon4			CCTGCTCATAATC	AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.466G>A	16.37:g.70548316C>T	ENSP00000315775:p.Glu156Lys	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	24.0	NM_015386	B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	ENST00000323786.5	37	CCDS10892.2	.	.	.	.	.	.	.	.	.	.	C	36	5.840835	0.97009	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000393612;ENST00000534772	T;T;T	0.41758	0.99;0.99;0.99	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.69700	0.3140	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.992;0.999	T	0.74003	-0.3804	10	0.87932	D	0	-19.7913	19.4155	0.94694	0.0:1.0:0.0:0.0	.	151;152	Q6PIW8;Q9H9E3	.;COG4_HUMAN	K	156;152;152;79	ENSP00000315775:E156K;ENSP00000377236:E152K;ENSP00000461912:E79K	ENSP00000315775:E156K	E	-	1	0	COG4	69105817	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.342000	0.79310	2.589000	0.87451	0.561000	0.74099	GAG	.		0.517	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250326.3		
CORIN	10699	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	47695047	47695047	+	Missense_Mutation	SNP	C	C	T	rs143738568		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr4:47695047C>T	ENST00000273857.4	-	6	852	c.853G>A	c.(853-855)Ggg>Agg	p.G285R	CORIN_ENST00000504584.1_Missense_Mutation_p.G285R|CORIN_ENST00000502252.1_Missense_Mutation_p.G218R|CORIN_ENST00000508498.1_Missense_Mutation_p.G146R|CORIN_ENST00000505909.1_Missense_Mutation_p.G285R	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	285	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						TGCAGTTTCCCGGGGATGCAG	0.463																																					p.G285R		.											.	CORIN	91	0			c.G853A						.						143.0	129.0	133.0					4																	47695047		2203	4300	6503	SO:0001583	missense	10699	exon6			GTTTCCCGGGGAT	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.853G>A	4.37:g.47695047C>T	ENSP00000273857:p.Gly285Arg	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	48.0	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	37	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	T	6.621	0.483004	0.12581	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	D;D;D;D;D	0.95205	-3.64;-3.64;-3.64;-3.64;-3.64	5.54	-1.94	0.07571	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.695685	0.14811	N	0.297050	T	0.79257	0.4415	N	0.02775	-0.495	0.09310	N	1	B;B;B;B;B	0.10296	0.0;0.001;0.003;0.001;0.0	B;B;B;B;B	0.13407	0.001;0.001;0.009;0.005;0.001	T	0.70070	-0.4973	10	0.14656	T	0.56	.	2.4803	0.04586	0.0963:0.2274:0.3147:0.3616	.	285;285;218;146;285	B7Z4R1;B4E2W9;B4E1Y7;B4DZA3;Q9Y5Q5	.;.;.;.;CORIN_HUMAN	R	285;146;218;285;285	ENSP00000273857:G285R;ENSP00000425597:G146R;ENSP00000424212:G218R;ENSP00000425401:G285R;ENSP00000423216:G285R	ENSP00000273857:G285R	G	-	1	0	CORIN	47389804	0.190000	0.23276	0.499000	0.27577	0.955000	0.61496	0.181000	0.16880	-0.467000	0.06932	-0.530000	0.04314	GGG	C|1.000;G|0.000		0.463	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
CTNND2	1501	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	11159822	11159822	+	Silent	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr5:11159822G>A	ENST00000304623.8	-	12	2214	c.2025C>T	c.(2023-2025)atC>atT	p.I675I	CTNND2_ENST00000458100.2_Silent_p.I242I|CTNND2_ENST00000359640.2_Silent_p.I675I|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Silent_p.I584I|CTNND2_ENST00000503622.1_Silent_p.I338I	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	675					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGGCATCCTGGATGATTGGCA	0.483																																					p.I675I		.											.	CTNND2	293	0			c.C2025T						.						177.0	163.0	168.0					5																	11159822		2203	4300	6503	SO:0001819	synonymous_variant	1501	exon12			ATCCTGGATGATT	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2025C>T	5.37:g.11159822G>A		Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	329.0	66.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	CCDS3881.1																																																																																			.		0.483	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
CYP3A4	1576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	99364063	99364063	+	Nonsense_Mutation	SNP	G	G	A	rs138105638		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr7:99364063G>A	ENST00000336411.2	-	9	985	c.802C>T	c.(802-804)Cga>Tga	p.R268*	RP11-757A13.1_ENST00000608397.1_RNA|CYP3A4_ENST00000354593.2_Nonsense_Mutation_p.R118*	NM_001202855.2|NM_017460.5	NP_001189784.1|NP_059488.2	P08684	CP3A4_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 4	268					alkaloid catabolic process (GO:0009822)|androgen metabolic process (GO:0008209)|calcitriol biosynthetic process from calciol (GO:0036378)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|lipid metabolic process (GO:0006629)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	albendazole monooxygenase activity (GO:0047638)|caffeine oxidase activity (GO:0034875)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)|quinine 3-monooxygenase activity (GO:0050591)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)|taurochenodeoxycholate 6alpha-hydroxylase activity (GO:0033780)|testosterone 6-beta-hydroxylase activity (GO:0050649)|vitamin D 24-hydroxylase activity (GO:0070576)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(3)|central_nervous_system(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Abiraterone(DB05812)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetazolamide(DB00819)|Adinazolam(DB00546)|ado-trastuzumab emtansine(DB05773)|Albendazole(DB00518)|Alclometasone(DB00240)|Aldesleukin(DB00041)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Alimemazine(DB01246)|Aliskiren(DB01258)|Allylestrenol(DB01431)|Almotriptan(DB00918)|Alogliptin(DB06203)|Alosetron(DB00969)|Alprazolam(DB00404)|Ambroxol(DB06742)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Arsenic trioxide(DB01169)|Artemether(DB06697)|Asenapine(DB06216)|Astemizole(DB00637)|Atazanavir(DB01072)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Avanafil(DB06237)|Axitinib(DB06626)|Azatadine(DB00719)|Azelastine(DB00972)|Azithromycin(DB00207)|Bedaquiline(DB08903)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bezafibrate(DB01393)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bisoprolol(DB00612)|Boceprevir(DB08873)|Bortezomib(DB00188)|Bosentan(DB00559)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Brinzolamide(DB01194)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Brompheniramine(DB00835)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Buspirone(DB00490)|Busulfan(DB01008)|Cabazitaxel(DB06772)|Cabergoline(DB00248)|Cabozantinib(DB08875)|Caffeine(DB00201)|Calcitriol(DB00136)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Caspofungin(DB00520)|Cefradine(DB01333)|Celecoxib(DB00482)|Cephalexin(DB00567)|Cevimeline(DB00185)|Chenodeoxycholic acid(DB06777)|Chloramphenicol(DB00446)|Chlordiazepoxide(DB00475)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clemastine(DB00283)|Clevidipine(DB04920)|Clindamycin(DB01190)|Clobazam(DB00349)|Clofazimine(DB00845)|Clofibrate(DB00636)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonazepam(DB01068)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Codeine(DB00318)|Colchicine(DB01394)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cortisone acetate(DB01380)|Crizotinib(DB08865)|Cyclobenzaprine(DB00924)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Cytarabine(DB00987)|Dabrafenib(DB08912)|Dalfopristin(DB01764)|Danazol(DB01406)|Dantrolene(DB01219)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Deferasirox(DB01609)|Delavirdine(DB00705)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Dicloxacillin(DB00485)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydrocodeine(DB01551)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Disopyramide(DB00280)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dofetilide(DB00204)|Dolasetron(DB00757)|Dolutegravir(DB08930)|Domperidone(DB01184)|Donepezil(DB00843)|Dorzolamide(DB00869)|Doxepin(DB01142)|Doxorubicin(DB00997)|Doxycycline(DB00254)|Dronabinol(DB00470)|Dronedarone(DB04855)|Dutasteride(DB01126)|Econazole(DB01127)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Epinephrine(DB00668)|Eplerenone(DB00700)|Ergocalciferol(DB00153)|Ergoloid mesylate(DB01049)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Estradiol valerate/Dienogest(DB08866)|Estradiol(DB00783)|Estramustine(DB01196)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Etravirine(DB06414)|Everolimus(DB01590)|Exemestane(DB00990)|Ezetimibe(DB00973)|Famciclovir(DB00426)|Felbamate(DB00949)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Finasteride(DB01216)|Fingolimod(DB08868)|Flucloxacillin(DB00301)|Fluconazole(DB00196)|Flunisolide(DB00180)|Flunitrazepam(DB01544)|Fluorometholone(DB00324)|Fluoxetine(DB00472)|Flurazepam(DB00690)|Flutamide(DB00499)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosamprenavir(DB01319)|Fosphenytoin(DB01320)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Glipizide(DB01067)|Glyburide(DB01016)|Granisetron(DB00889)|Griseofulvin(DB00400)|Guanethidine(DB01170)|Guanfacine(DB01018)|Halofantrine(DB01218)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Hydralazine(DB01275)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|Indacaterol(DB05039)|Indapamide(DB00808)|Indinavir(DB00224)|Ipratropium bromide(DB00332)|Irbesartan(DB01029)|Irinotecan(DB00762)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ixabepilone(DB04845)|Josamycin(DB01321)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Levomethadyl Acetate(DB01227)|Levomilnacipran(DB08918)|Levonorgestrel(DB00367)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Lisuride(DB00589)|Lomitapide(DB08827)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumefantrine(DB06708)|Lurasidone(DB08815)|MACITENTAN(DB08932)|Maraviroc(DB04835)|Mebendazole(DB00643)|Medroxyprogesterone Acetate(DB00603)|Mefloquine(DB00358)|Meloxicam(DB00814)|Mequitazine(DB01071)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Methylergometrine(DB00353)|Methylprednisolone(DB00959)|Methyltestosterone(DB06710)|Metronidazole(DB00916)|Metyrapone(DB01011)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mirtazapine(DB00370)|Mitoxantrone(DB01204)|Modafinil(DB00745)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nafcillin(DB00607)|Naloxone(DB01183)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nitric Oxide(DB00435)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Olopatadine(DB00768)|Omeprazole(DB00338)|Ondansetron(DB00904)|Orlistat(DB01083)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paramethasone(DB01384)|Paricalcitol(DB00910)|Pazopanib(DB06589)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perampanel(DB08883)|Pergolide(DB01186)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenoxybenzamine(DB00925)|Phenprocoumon(DB00946)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pilocarpine(DB01085)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Prazepam(DB01588)|Praziquantel(DB01058)|Prednisolone(DB00860)|Prednisone(DB00635)|Primaquine(DB01087)|Primidone(DB00794)|Probenecid(DB01032)|Prochlorperazine(DB00433)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Pyridostigmine(DB00545)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Quinupristin(DB01369)|Rabeprazole(DB01129)|Raloxifene(DB00481)|Ramelteon(DB00980)|Ranitidine(DB00863)|Ranolazine(DB00243)|Reboxetine(DB00234)|Regorafenib(DB08896)|Repaglinide(DB00912)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rifapentine(DB01201)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Rimonabant(DB06155)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rivastigmine(DB00989)|Rolitetracycline(DB01301)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosuvastatin(DB01098)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Rufinamide(DB06201)|Ruxolitinib(DB08877)|Salbutamol(DB01001)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Selegiline(DB01037)|Sertindole(DB06144)|Sertraline(DB01104)|Sevoflurane(DB01236)|Sibutramine(DB01105)|Sildenafil(DB00203)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Sitaxentan(DB06268)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sufentanil(DB00708)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfanilamide(DB00259)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Tamsulosin(DB00706)|Tasosartan(DB01349)|Telaprevir(DB05521)|Telithromycin(DB00976)|Temazepam(DB00231)|Temozolomide(DB00853)|Temsirolimus(DB06287)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Thiopental(DB00599)|Thiotepa(DB04572)|Tiagabine(DB00906)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tioconazole(DB01007)|Tiotropium(DB01409)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tofisopam(DB08811)|Tolterodine(DB01036)|Tolvaptan(DB06212)|Topiramate(DB00273)|Topotecan(DB01030)|Toremifene(DB00539)|Trabectedin(DB05109)|Tramadol(DB00193)|Trametinib(DB08911)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Tretinoin(DB00755)|Triamcinolone(DB00620)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vandetanib(DB05294)|Vardenafil(DB00862)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Yohimbine(DB01392)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Zidovudine(DB00495)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)|Zopiclone(DB01198)	AAATCCACTCGGTGCTAGAAG	0.448																																					p.R268X		.											.	CYP3A4	517	0			c.C802T						.	G	stop/ARG,stop/ARG	1,4405	2.1+/-5.4	0,1,2202	94.0	92.0	93.0		799,802	1.9	0.2	7	dbSNP_134	93	0,8600		0,0,4300	no	stop-gained,stop-gained	CYP3A4	NM_001202855.2,NM_017460.5	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	267/503,268/504	99364063	1,13005	2203	4300	6503	SO:0001587	stop_gained	1576	exon9			CCACTCGGTGCTA	AF280107	CCDS5674.1	7q21.1	2011-06-21	2003-01-14		ENSG00000160868	ENSG00000160868	1.1.1.161	"""Cytochrome P450s"""	2637	protein-coding gene	gene with protein product		124010	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 4"""	CYP3A3		8269949, 1391968	Standard	NM_001202855		Approved		uc003urv.2	P08684	OTTHUMG00000156651	ENST00000336411.2:c.802C>T	7.37:g.99364063G>A	ENSP00000337915:p.Arg268*	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	26.0	NM_017460	P05184|Q16757|Q9UK50	Nonsense_Mutation	SNP	ENST00000336411.2	37	CCDS5674.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267773	0.80469	2.27E-4	0.0	ENSG00000160868	ENST00000354593;ENST00000336411	.	.	.	3.87	1.92	0.25849	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.6971	0.12809	0.1102:0.0:0.5124:0.3773	.	.	.	.	X	118;268	.	ENSP00000337915:R268X	R	-	1	2	CYP3A4	99201999	0.290000	0.24343	0.204000	0.23530	0.958000	0.62258	0.489000	0.22387	0.193000	0.20303	0.491000	0.48974	CGA	G|1.000;A|0.000		0.448	CYP3A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345059.1		
DCUN1D1	54165	hgsc.bcm.edu;bcgsc.ca	37	3	182665124	182665124	+	Splice_Site	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:182665124T>C	ENST00000292782.4	-	6	757		c.e6-2		DCUN1D1_ENST00000469954.1_Splice_Site	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1							ubiquitin ligase complex (GO:0000151)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			ATGATGTTCCTATTTAAAAAA	0.294																																					.		.											.	DCUN1D1	91	0			c.604-2A>G						.						103.0	98.0	99.0					3																	182665124		2199	4298	6497	SO:0001630	splice_region_variant	54165	exon7			TGTTCCTATTTAA	AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.604-2A>G	3.37:g.182665124T>C		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_020640	B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Splice_Site	SNP	ENST00000292782.4	37	CCDS3240.1	.	.	.	.	.	.	.	.	.	.	T	19.59	3.855373	0.71719	.	.	ENSG00000043093	ENST00000292782;ENST00000458486;ENST00000469954	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4861	0.75569	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DCUN1D1	184147818	1.000000	0.71417	0.995000	0.50966	0.840000	0.47671	7.671000	0.83941	2.048000	0.60808	0.460000	0.39030	.	.		0.294	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350658.1	NM_020640	Intron
DCX	1641	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	X	110574142	110574142	+	Intron	SNP	G	G	T	rs371447966		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chrX:110574142G>T	ENST00000338081.3	-	5	1346				DCX_ENST00000371993.2_Intron|DCX_ENST00000496551.1_5'UTR|DCX_ENST00000356220.3_Missense_Mutation_p.N312K|DCX_ENST00000356915.2_Missense_Mutation_p.N312K|DCX_ENST00000488120.1_Intron	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin						axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						CGTCTTGGTCGTTACCTGAGT	0.522																																					p.N312K		.											.	DCX	554	0			c.C936A						.						322.0	256.0	279.0					X																	110574142		2203	4300	6503	SO:0001627	intron_variant	1641	exon5			TTGGTCGTTACCT	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.1174+4C>A	X.37:g.110574142G>T		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	70.0	NM_001195553	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	ENST00000338081.3	37	CCDS14556.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.65|14.65	2.600082|2.600082	0.46318|0.46318	.|.	.|.	ENSG00000077279|ENSG00000077279	ENST00000356915;ENST00000356220|ENST00000358070	T;T|.	0.21543|.	2.0;2.0|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.256890|.	0.31797|.	N|.	0.007046|.	T|T	0.40670|0.40670	0.1126|0.1126	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	P|.	0.35401|.	0.499|.	B|.	0.31442|.	0.13|.	T|T	0.30238|0.30238	-0.9985|-0.9985	10|5	0.06236|.	T|.	0.91|.	.|.	11.7176|11.7176	0.51663|0.51663	0.0827:0.0:0.9173:0.0|0.0827:0.0:0.9173:0.0	.|.	381|.	B4DM53|.	.|.	K|K	312|385	ENSP00000349385:N312K;ENSP00000348553:N312K|.	ENSP00000348553:N312K|.	N|T	-|-	3|2	2|0	DCX|DCX	110460798|110460798	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.209000|4.209000	0.58493|0.58493	2.238000|2.238000	0.73509|0.73509	0.594000|0.594000	0.82650|0.82650	AAC|ACG	.		0.522	DCX-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357058.1	NM_178153	
DEPDC5	9681	hgsc.bcm.edu;bcgsc.ca	37	22	32215113	32215113	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr22:32215113A>G	ENST00000382112.3	+	21	1842	c.1772A>G	c.(1771-1773)tAc>tGc	p.Y591C	DEPDC5_ENST00000382111.2_Missense_Mutation_p.Y591C|DEPDC5_ENST00000400246.1_Missense_Mutation_p.Y591C|DEPDC5_ENST00000535622.1_Missense_Mutation_p.Y591C|DEPDC5_ENST00000382105.2_Missense_Mutation_p.Y591C|DEPDC5_ENST00000266091.3_Missense_Mutation_p.Y591C|DEPDC5_ENST00000400249.2_Missense_Mutation_p.Y591C|DEPDC5_ENST00000536766.1_Missense_Mutation_p.Y563C|DEPDC5_ENST00000400248.2_Missense_Mutation_p.Y591C	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	591					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CCTGGTGGATACACGCCCCAG	0.562																																					p.Y591C		.											.	DEPDC5	519	0			c.A1772G						.						148.0	152.0	151.0					22																	32215113		2115	4226	6341	SO:0001583	missense	9681	exon22			GTGGATACACGCC	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1772A>G	22.37:g.32215113A>G	ENSP00000371546:p.Tyr591Cys	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	8.0	NM_001242897	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	A	16.48	3.134531	0.56828	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T;T	0.31510	1.5;1.49;1.88;1.91;1.86;1.49;1.91;1.86;1.91	5.68	2.25	0.28309	.	0.128121	0.53938	N	0.000042	T	0.33177	0.0854	N	0.22421	0.69	0.80722	D	1	D;B;D;D;D;D	0.76494	0.999;0.003;0.999;0.999;0.997;0.999	P;B;D;D;D;D	0.79784	0.884;0.009;0.993;0.927;0.947;0.965	T	0.07986	-1.0744	10	0.39692	T	0.17	.	5.3509	0.16036	0.7256:0.0:0.1443:0.1301	.	591;563;591;591;591;591	B9EGN9;F5GYZ8;B4DH93;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	C	591;563;591;591;591;591;591;591;591;591	ENSP00000440210:Y591C;ENSP00000441358:Y563C;ENSP00000266091:Y591C;ENSP00000383108:Y591C;ENSP00000383105:Y591C;ENSP00000371539:Y591C;ENSP00000371546:Y591C;ENSP00000371545:Y591C;ENSP00000383107:Y591C	ENSP00000266091:Y591C	Y	+	2	0	DEPDC5	30545113	1.000000	0.71417	0.364000	0.25888	0.883000	0.51084	3.586000	0.53950	0.436000	0.26393	0.460000	0.39030	TAC	.		0.562	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
DISP1	84976	hgsc.bcm.edu;bcgsc.ca	37	1	223177971	223177971	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:223177971C>A	ENST00000284476.6	+	8	3396	c.3232C>A	c.(3232-3234)Cgc>Agc	p.R1078S		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	1078					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		CTCTCTGAGTCGCGTGGGCTC	0.592																																					p.R1078S		.											.	DISP1	68	0			c.C3232A						.						73.0	70.0	71.0					1																	223177971		2203	4300	6503	SO:0001583	missense	84976	exon10			CTGAGTCGCGTGG	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.3232C>A	1.37:g.223177971C>A	ENSP00000284476:p.Arg1078Ser	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	239.0	22.0	NM_032890	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	37	CCDS1536.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752065	0.89753	.	.	ENSG00000154309	ENST00000284476	T	0.15256	2.44	5.95	5.95	0.96441	.	0.190252	0.56097	D	0.000039	T	0.34366	0.0895	L	0.44542	1.39	0.80722	D	1	D	0.65815	0.995	D	0.66497	0.944	T	0.00400	-1.1763	10	0.23302	T	0.38	-38.7962	20.3719	0.98893	0.0:1.0:0.0:0.0	.	1078	Q96F81	DISP1_HUMAN	S	1078	ENSP00000284476:R1078S	ENSP00000284476:R1078S	R	+	1	0	DISP1	221244594	1.000000	0.71417	0.971000	0.41717	0.927000	0.56198	5.829000	0.69316	2.826000	0.97356	0.491000	0.48974	CGC	.		0.592	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890	
DMBT1	1755	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	124402895	124402895	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr10:124402895G>A	ENST00000338354.3	+	53	7329	c.7223G>A	c.(7222-7224)cGa>cAa	p.R2408Q	DMBT1_ENST00000359586.6_Missense_Mutation_p.R1128Q|DMBT1_ENST00000368955.3_Missense_Mutation_p.R2398Q|DMBT1_ENST00000344338.3_Missense_Mutation_p.R2398Q|DMBT1_ENST00000330163.4_Missense_Mutation_p.R1780Q|DMBT1_ENST00000368909.3_Missense_Mutation_p.R2408Q|DMBT1_ENST00000368956.2_Missense_Mutation_p.R1780Q			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2408					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CCCCCACGCCGAGAAGAGGAG	0.622																																					p.R2408Q	Ovarian(182;93 2026 18125 22222 38972)	.											.	DMBT1	494	0			c.G7223A						.						29.0	32.0	31.0					10																	124402895		1942	4134	6076	SO:0001583	missense	1755	exon53			CACGCCGAGAAGA		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.7223G>A	10.37:g.124402895G>A	ENSP00000342210:p.Arg2408Gln	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	46.0	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	G	10.20	1.284184	0.23392	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	T;T;T;T;T;T;T	0.23950	1.93;1.92;1.88;1.93;1.92;1.88;1.91	4.38	-8.09	0.01090	.	0.736603	0.10817	U	0.630867	T	0.06234	0.0161	N	0.08118	0	0.09310	N	1	B;P;B;B;B;B;B	0.39717	0.013;0.684;0.013;0.013;0.013;0.013;0.007	B;B;B;B;B;B;B	0.26094	0.003;0.066;0.002;0.004;0.004;0.004;0.002	T	0.19128	-1.0315	10	0.49607	T	0.09	.	1.2818	0.02042	0.2559:0.1826:0.3749:0.1866	.	1128;2388;1657;2537;1780;2398;2408	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	Q	2408;2537;2408;2408;2408;2407;1780;2398;1780;1780;2408;2398;1780;554;1128	ENSP00000342210:R2408Q;ENSP00000343175:R2398Q;ENSP00000327747:R1780Q;ENSP00000357905:R2408Q;ENSP00000357951:R2398Q;ENSP00000357952:R1780Q;ENSP00000352593:R1128Q	ENSP00000331522:R1780Q	R	+	2	0	DMBT1	124392885	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.977000	0.03782	-2.400000	0.00579	-2.511000	0.00188	CGA	.		0.622	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
DNAH6	1768	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84954804	84954804	+	Silent	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:84954804C>T	ENST00000237449.6	+	60	9992	c.9984C>T	c.(9982-9984)acC>acT	p.T3328T	DNAH6_ENST00000389394.3_Silent_p.T3328T			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3328					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TGTTCAATACCACCATTGAAA	0.393																																					p.T3328T		.											.	DNAH6	69	0			c.C9984T						.						103.0	84.0	90.0					2																	84954804		692	1591	2283	SO:0001819	synonymous_variant	1768	exon61			CAATACCACCATT	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.9984C>T	2.37:g.84954804C>T		Somatic	222.0	0.0		WXS	Illumina HiSeq	Phase_I	193.0	65.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.393	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DPRX	503834	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54140025	54140025	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr19:54140025T>A	ENST00000376650.1	+	3	410	c.359T>A	c.(358-360)gTg>gAg	p.V120E		NM_001012728.1	NP_001012746.1	A6NFQ7	DPRX_HUMAN	divergent-paired related homeobox	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(4)|large_intestine(1)|lung(7)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.013)		ATCGGCCTGGTGTACACGGGT	0.562																																					p.V120E		.											.	DPRX	90	0			c.T359A						.						133.0	105.0	114.0					19																	54140025		2203	4300	6503	SO:0001583	missense	503834	exon3			GCCTGGTGTACAC		CCDS33103.1	19q13.42	2011-06-20			ENSG00000204595	ENSG00000204595		"""Homeoboxes / PRD class"""	32166	protein-coding gene	gene with protein product		611165					Standard	NM_001012728		Approved		uc002qcf.1	A6NFQ7		ENST00000376650.1:c.359T>A	19.37:g.54140025T>A	ENSP00000365838:p.Val120Glu	Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	52.0	NM_001012728		Missense_Mutation	SNP	ENST00000376650.1	37	CCDS33103.1	.	.	.	.	.	.	.	.	.	.	t	9.525	1.109197	0.20714	.	.	ENSG00000204595	ENST00000376650	D	0.94376	-3.41	1.45	1.45	0.22620	.	.	.	.	.	D	0.91432	0.7296	N	0.24115	0.695	0.09310	N	1	D	0.76494	0.999	D	0.71184	0.972	T	0.82014	-0.0667	9	0.29301	T	0.29	.	5.0324	0.14417	0.0:0.0:0.0:1.0	.	120	A6NFQ7	DPRX_HUMAN	E	120	ENSP00000365838:V120E	ENSP00000365838:V120E	V	+	2	0	DPRX	58831837	0.014000	0.17966	0.004000	0.12327	0.002000	0.02628	1.273000	0.33121	0.918000	0.36919	0.459000	0.35465	GTG	.		0.562	DPRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409880.1	NM_001012728	
DSCAM	1826	hgsc.bcm.edu;bcgsc.ca	37	21	41434820	41434820	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr21:41434820T>C	ENST00000400454.1	-	28	5372	c.4895A>G	c.(4894-4896)aAg>aGg	p.K1632R		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1632					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				AGCTAAACTCTTTGCATCTGG	0.348																																					p.K1632R	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.A4895G						.						127.0	117.0	120.0					21																	41434820		1865	4102	5967	SO:0001583	missense	1826	exon28			AAACTCTTTGCAT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4895A>G	21.37:g.41434820T>C	ENSP00000383303:p.Lys1632Arg	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.845118	0.91197	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.60040	0.22;0.34	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.60869	0.2302	L	0.36672	1.1	0.42313	D	0.992225	D	0.63880	0.993	P	0.54629	0.757	T	0.60677	-0.7216	10	0.38643	T	0.18	.	15.5822	0.76452	0.0:0.0:0.0:1.0	.	1632	O60469	DSCAM_HUMAN	R	1632;1384	ENSP00000383303:K1632R;ENSP00000385342:K1384R	ENSP00000383303:K1632R	K	-	2	0	DSCAM	40356690	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.349000	0.79376	2.210000	0.71456	0.533000	0.62120	AAG	.		0.348	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
DUS1L	64118	hgsc.bcm.edu;bcgsc.ca	37	17	80020818	80020818	+	Silent	SNP	A	A	G	rs372985546		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:80020818A>G	ENST00000354321.7	-	4	914	c.429T>C	c.(427-429)ccT>ccC	p.P143P	DUS1L_ENST00000306796.5_Silent_p.P143P			Q6P1R4	DUS1L_HUMAN	dihydrouridine synthase 1-like (S. cerevisiae)	143							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	6	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			TGCACGTGACAGGAACAGAGA	0.612																																					p.P143P		.											.	DUS1L	91	0			c.T429C						.						60.0	59.0	59.0					17																	80020818		2202	4300	6502	SO:0001819	synonymous_variant	64118	exon5			CGTGACAGGAACA		CCDS32775.1	17q25.3	2005-08-09				ENSG00000169718			30086	protein-coding gene	gene with protein product						12477932	Standard	NM_022156		Approved	PP3111, DUS1	uc002kdr.4	Q6P1R4		ENST00000354321.7:c.429T>C	17.37:g.80020818A>G		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	4.0	NM_022156	A6NHV4|Q96AI3	Silent	SNP	ENST00000354321.7	37	CCDS32775.1																																																																																			.		0.612	DUS1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442347.1	NM_022156	
DYNC2H1	79659	hgsc.bcm.edu;bcgsc.ca	37	11	102991458	102991458	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr11:102991458T>C	ENST00000375735.2	+	8	1319	c.1175T>C	c.(1174-1176)aTt>aCt	p.I392T	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.I392T|DYNC2H1_ENST00000334267.7_Missense_Mutation_p.I392T	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	392	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GAAAAGATTATTGCACCTGCG	0.308																																					p.I392T		.											.	DYNC2H1	68	0			c.T1175C						.						37.0	36.0	36.0					11																	102991458		1807	4061	5868	SO:0001583	missense	79659	exon8			AGATTATTGCACC	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.1175T>C	11.37:g.102991458T>C	ENSP00000364887:p.Ile392Thr	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	T	18.15	3.560736	0.65538	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093	T;T;T	0.56776	0.44;0.44;0.44	5.2	4.08	0.47627	Dynein heavy chain, domain-1 (1);	0.537912	0.15256	U	0.272042	T	0.66416	0.2787	M	0.73598	2.24	0.53688	D	0.999979	B;P;P	0.41188	0.084;0.741;0.734	B;P;P	0.53809	0.022;0.735;0.617	T	0.66460	-0.5918	10	0.87932	D	0	.	10.8046	0.46509	0.0:0.0744:0.0:0.9256	.	392;392;392	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	T	392	ENSP00000364887:I392T;ENSP00000334021:I392T;ENSP00000381167:I392T	ENSP00000334021:I392T	I	+	2	0	DYNC2H1	102496668	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.790000	0.62453	0.939000	0.37446	0.528000	0.53228	ATT	.		0.308	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
ECEL1	9427	hgsc.bcm.edu;broad.mit.edu	37	2	233350834	233350834	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:233350834T>C	ENST00000304546.1	-	2	740	c.530A>G	c.(529-531)cAg>cGg	p.Q177R	ECEL1_ENST00000409941.1_Missense_Mutation_p.Q177R	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	177					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CACCTTGCGCTgggccgcgcc	0.716																																					p.Q177R		.											.	ECEL1	90	0			c.A530G						.						4.0	5.0	5.0					2																	233350834		1993	3987	5980	SO:0001583	missense	9427	exon2			TTGCGCTGGGCCG	Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.530A>G	2.37:g.233350834T>C	ENSP00000302051:p.Gln177Arg	Somatic	9.0	0.0		WXS	Illumina HiSeq	Phase_I	9.0	5.0	NM_004826	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	ENST00000304546.1	37	CCDS2493.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.403395	0.62288	.	.	ENSG00000171551	ENST00000304546;ENST00000409941	T;T	0.73897	-0.79;-0.79	5.33	4.13	0.48395	Peptidase M13 (1);	0.135808	0.47455	D	0.000230	T	0.56247	0.1972	N	0.11255	0.115	0.35224	D	0.776337	B;B	0.31153	0.31;0.025	B;B	0.29862	0.108;0.016	T	0.64980	-0.6279	10	0.87932	D	0	-17.2238	12.0726	0.53626	0.0:0.0:0.1442:0.8557	.	177;177	O95672-2;O95672	.;ECEL1_HUMAN	R	177	ENSP00000302051:Q177R;ENSP00000386333:Q177R	ENSP00000302051:Q177R	Q	-	2	0	ECEL1	233059078	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.682000	0.68182	0.822000	0.34565	0.528000	0.53228	CAG	.		0.716	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826	
ELAVL3	1995	hgsc.bcm.edu;bcgsc.ca	37	19	11565448	11565448	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr19:11565448T>C	ENST00000359227.3	-	7	1421	c.997A>G	c.(997-999)Acc>Gcc	p.T333A	ELAVL3_ENST00000438662.2_Missense_Mutation_p.T326A	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	333	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						TCATAGTTGGTCATGGTCACG	0.587																																					p.T333A		.											.	ELAVL3	92	0			c.A997G						.						157.0	112.0	127.0					19																	11565448		2203	4300	6503	SO:0001583	missense	1995	exon7			AGTTGGTCATGGT		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.997A>G	19.37:g.11565448T>C	ENSP00000352162:p.Thr333Ala	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	6.0	NM_001420	Q16135|Q96CL8|Q96QS9	Missense_Mutation	SNP	ENST00000359227.3	37	CCDS32912.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.769848	0.49680	.	.	ENSG00000196361	ENST00000359227;ENST00000438662	T;T	0.15487	2.42;2.42	4.59	3.55	0.40652	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.105378	0.64402	D	0.000005	T	0.07999	0.0200	N	0.03115	-0.41	0.53688	D	0.999978	B;B	0.27951	0.195;0.075	B;B	0.31016	0.123;0.051	T	0.30238	-0.9985	10	0.37606	T	0.19	.	9.5834	0.39501	0.1575:0.0:0.0:0.8425	.	333;326	Q14576;Q14576-2	ELAV3_HUMAN;.	A	333;326	ENSP00000352162:T333A;ENSP00000390878:T326A	ENSP00000352162:T333A	T	-	1	0	ELAVL3	11426448	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.576000	0.82467	0.598000	0.29829	0.352000	0.21897	ACC	.		0.587	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458827.2	NM_001420	
EPHA3	2042	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	89480505	89480505	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:89480505C>G	ENST00000336596.2	+	13	2567	c.2342C>G	c.(2341-2343)aCa>aGa	p.T781R	EPHA3_ENST00000494014.1_Missense_Mutation_p.T781R	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	781	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GCTTATACAACAAGAGTGAGT	0.388										TSP Lung(6;0.00050)																											p.T781R		.											.	EPHA3	1500	0			c.C2342G						.						94.0	90.0	92.0					3																	89480505		2203	4300	6503	SO:0001583	missense	2042	exon13			ATACAACAAGAGT	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2342C>G	3.37:g.89480505C>G	ENSP00000337451:p.Thr781Arg	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	83.0	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279726	0.80692	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	D;D	0.82081	-1.57;-1.57	5.33	5.33	0.75918	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88702	0.6508	L	0.48362	1.52	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87033	0.2136	9	.	.	.	.	19.3726	0.94495	0.0:1.0:0.0:0.0	.	781	P29320	EPHA3_HUMAN	R	781	ENSP00000337451:T781R;ENSP00000419190:T781R	.	T	+	2	0	EPHA3	89563195	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	7.776000	0.85560	2.648000	0.89879	0.585000	0.79938	ACA	.		0.388	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
EYS	346007	hgsc.bcm.edu;bcgsc.ca	37	6	66094287	66094287	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr6:66094287T>C	ENST00000370621.3	-	8	1817	c.1291A>G	c.(1291-1293)Aga>Gga	p.R431G	EYS_ENST00000370618.3_Missense_Mutation_p.R431G|EYS_ENST00000503581.1_Missense_Mutation_p.R431G|EYS_ENST00000370616.2_Missense_Mutation_p.R431G|EYS_ENST00000342421.5_Missense_Mutation_p.R431G|EYS_ENST00000393380.2_Missense_Mutation_p.R431G			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	431					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ACTTTGAATCTTCCAATTATA	0.313																																					p.R431G		.											.	EYS	660	0			c.A1291G						.						88.0	87.0	87.0					6																	66094287		2202	4293	6495	SO:0001583	missense	346007	exon8			TGAATCTTCCAAT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1291A>G	6.37:g.66094287T>C	ENSP00000359655:p.Arg431Gly	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_001142801	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	T	14.87	2.664843	0.47572	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	T;T;T;T;T;T	0.10477	2.87;2.87;2.87;2.87;2.87;2.87	6.07	-1.86	0.07760	.	.	.	.	.	T	0.00906	0.0030	N	0.05280	-0.08	0.22675	N	0.998868	B;B;B	0.18166	0.009;0.009;0.026	B;B;B	0.14578	0.007;0.007;0.011	T	0.47861	-0.9084	9	0.10636	T	0.68	.	2.1204	0.03724	0.1229:0.306:0.126:0.4451	.	431;431;431	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	G	431	ENSP00000424243:R431G;ENSP00000359655:R431G;ENSP00000359650:R431G;ENSP00000377042:R431G;ENSP00000341818:R431G;ENSP00000359652:R431G	ENSP00000341818:R431G	R	-	1	2	EYS	66151008	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.504000	0.35726	-0.071000	0.12886	0.533000	0.62120	AGA	.		0.313	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FAM160B1	57700	hgsc.bcm.edu;bcgsc.ca	37	10	116608429	116608429	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr10:116608429A>G	ENST00000369248.4	+	13	2071	c.1736A>G	c.(1735-1737)gAc>gGc	p.D579G	FAM160B1_ENST00000369250.3_Missense_Mutation_p.D579G	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	579										NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						GTACCGGATGACGCAAAATCC	0.403																																					p.D579G		.											.	FAM160B1	91	0			c.A1736G						.						112.0	88.0	96.0					10																	116608429		2203	4300	6503	SO:0001583	missense	57700	exon13			CGGATGACGCAAA	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.1736A>G	10.37:g.116608429A>G	ENSP00000358251:p.Asp579Gly	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	4.0	NM_020940	Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	37	CCDS31290.1	.	.	.	.	.	.	.	.	.	.	A	19.31	3.803348	0.70682	.	.	ENSG00000151553	ENST00000369248;ENST00000369250	T;T	0.66460	-0.21;-0.21	5.58	5.58	0.84498	.	0.083461	0.85682	D	0.000000	T	0.47801	0.1465	N	0.08118	0	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.18561	0.022;0.005	T	0.41502	-0.9505	10	0.21540	T	0.41	-13.1897	16.0529	0.80775	1.0:0.0:0.0:0.0	.	579;579	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	G	579	ENSP00000358251:D579G;ENSP00000358253:D579G	ENSP00000358251:D579G	D	+	2	0	FAM160B1	116598419	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.971000	0.93419	2.257000	0.74773	0.459000	0.35465	GAC	.		0.403	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	XM_049351	
FAM186A	121006	hgsc.bcm.edu;bcgsc.ca	37	12	50749223	50749223	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr12:50749223T>C	ENST00000327337.5	-	4	1391	c.1392A>G	c.(1390-1392)aaA>aaG	p.K464K	FAM186A_ENST00000543111.1_Silent_p.K464K	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	464				KKA -> TKG (in Ref. 2; AL833333). {ECO:0000305}.													CATATGTGGCTTTTTTGTGGC	0.388																																					p.K464K	NSCLC(138;1796 1887 12511 19463 37884)	.											.	FAM186A	68	0			c.A1392G						.						149.0	103.0	117.0					12																	50749223		692	1591	2283	SO:0001819	synonymous_variant	121006	exon4			TGTGGCTTTTTTG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.1392A>G	12.37:g.50749223T>C		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	5.0	NM_001145475		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																			.		0.388	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
FANCD2	2177	hgsc.bcm.edu;broad.mit.edu	37	3	10108949	10108949	+	Silent	SNP	T	T	C	rs201487858		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:10108949T>C	ENST00000419585.1	+	26	2603	c.2442T>C	c.(2440-2442)acT>acC	p.T814T	FANCD2_ENST00000383806.1_Silent_p.T814T|FANCD2_ENST00000383807.1_Silent_p.T814T|FANCD2_ENST00000287647.3_Silent_p.T814T			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	814					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		AGGTGCTCACTCGGTTAAAGC	0.413			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.T814T		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	229	0			c.T2442C						.						96.0	83.0	87.0					3																	10108949		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon26	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GCTCACTCGGTTA	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2442T>C	3.37:g.10108949T>C		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	6.0	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																			T|0.998;C|0.002		0.413	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
FDXR	2232	hgsc.bcm.edu;bcgsc.ca	37	17	72860316	72860316	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:72860316T>C	ENST00000293195.5	-	9	1034	c.956A>G	c.(955-957)gAt>gGt	p.D319G	GRIN2C_ENST00000578159.1_5'Flank|FDXR_ENST00000581969.1_5'Flank|FDXR_ENST00000583917.1_Missense_Mutation_p.D291G|FDXR_ENST00000544854.1_Missense_Mutation_p.D267G|FDXR_ENST00000413947.2_Missense_Mutation_p.D350G|FDXR_ENST00000582944.1_Missense_Mutation_p.D311G|FDXR_ENST00000420580.2_Missense_Mutation_p.D279G|FDXR_ENST00000581530.1_Missense_Mutation_p.D325G|FDXR_ENST00000442102.2_Missense_Mutation_p.D362G|FDXR_ENST00000455107.2_Missense_Mutation_p.D275G	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	319					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	CCGCCGCCCATCTGGTGAGGG	0.672																																					p.D362G		.											.	FDXR	226	0			c.A1085G						.						22.0	27.0	25.0					17																	72860316		2199	4293	6492	SO:0001583	missense	2232	exon9			CGCCCATCTGGTG	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.956A>G	17.37:g.72860316T>C	ENSP00000293195:p.Asp319Gly	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	6.0	NM_001258012	B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	ENST00000293195.5	37	CCDS58593.1	.	.	.	.	.	.	.	.	.	.	T	15.54	2.864812	0.51482	.	.	ENSG00000161513	ENST00000420580;ENST00000544854;ENST00000293195;ENST00000455107;ENST00000442102;ENST00000413947	T;T;T;T;T	0.26067	1.76;2.72;2.72;2.72;2.72	4.58	4.58	0.56647	.	0.100098	0.64402	D	0.000003	T	0.26593	0.0650	L	0.41236	1.265	0.80722	D	1	B;B;B;B;B;B;B;B;B;B	0.24651	0.043;0.108;0.001;0.012;0.0;0.001;0.0;0.012;0.0;0.006	B;B;B;B;B;B;B;B;B;B	0.33799	0.025;0.17;0.006;0.032;0.002;0.005;0.007;0.032;0.007;0.019	T	0.08289	-1.0729	10	0.52906	T	0.07	-6.4927	13.6354	0.62219	0.0:0.0:0.0:1.0	.	279;362;350;317;267;350;319;311;319;325	B4DQQ4;B4DHX5;E7EQC1;B4DDI9;B7Z7G2;B4DDI7;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;.;.;.;ADRO_HUMAN;.	G	279;267;325;275;362;350	ENSP00000414172:D279G;ENSP00000445432:D267G;ENSP00000390875:D275G;ENSP00000416515:D362G;ENSP00000408595:D350G	ENSP00000293195:D325G	D	-	2	0	FDXR	70371911	0.569000	0.26643	0.742000	0.31022	0.940000	0.58332	2.017000	0.40981	1.713000	0.51359	0.459000	0.35465	GAT	.		0.672	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110	
FREM1	158326	hgsc.bcm.edu;bcgsc.ca	37	9	14863881	14863881	+	Silent	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr9:14863881A>G	ENST00000380880.3	-	3	1038	c.255T>C	c.(253-255)ctT>ctC	p.L85L	FREM1_ENST00000380881.4_Silent_p.L85L|FREM1_ENST00000422223.2_Silent_p.L85L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	85					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		CTTCGTTGGGAAGGAAATGGC	0.413																																					p.L85L		.											.	FREM1	138	0			c.T255C						.						108.0	103.0	105.0					9																	14863881		1935	4139	6074	SO:0001819	synonymous_variant	158326	exon4			GTTGGGAAGGAAA	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.255T>C	9.37:g.14863881A>G		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	4.0	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	CCDS47952.1																																																																																			.		0.413	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
GGA2	23062	hgsc.bcm.edu;bcgsc.ca	37	16	23481435	23481435	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:23481435A>G	ENST00000309859.4	-	15	1584	c.1502T>C	c.(1501-1503)cTc>cCc	p.L501P	GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	501	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		GGAGAAGTGGAGCAGAATTCT	0.552																																					p.L501P		.											.	GGA2	91	0			c.T1502C						.						69.0	70.0	69.0					16																	23481435		2197	4300	6497	SO:0001583	missense	23062	exon15			AAGTGGAGCAGAA	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.1502T>C	16.37:g.23481435A>G	ENSP00000311962:p.Leu501Pro	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_015044	D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	ENST00000309859.4	37	CCDS10611.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.182572	0.78677	.	.	ENSG00000103365	ENST00000309859	T	0.51071	0.72	4.93	4.93	0.64822	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, gamma-adaptin, appendage (2);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);	0.156761	0.42053	D	0.000762	T	0.69006	0.3063	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.74047	-0.3790	10	0.87932	D	0	-21.3672	12.8236	0.57707	1.0:0.0:0.0:0.0	.	501	Q9UJY4	GGA2_HUMAN	P	501	ENSP00000311962:L501P	ENSP00000311962:L501P	L	-	2	0	GGA2	23388936	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.094000	0.89533	1.958000	0.56883	0.459000	0.35465	CTC	.		0.552	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		
GLS	2744	hgsc.bcm.edu;bcgsc.ca	37	2	191765310	191765310	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:191765310T>C	ENST00000320717.3	+	4	884	c.626T>C	c.(625-627)gTt>gCt	p.V209A	GLS_ENST00000338435.4_Missense_Mutation_p.V209A	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	209					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	AGCAACATTGTTTTGTTGACA	0.308																																					p.V209A		.											.	GLS	92	0			c.T626C						.						113.0	106.0	108.0					2																	191765310		2203	4298	6501	SO:0001583	missense	2744	exon4			ACATTGTTTTGTT	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.626T>C	2.37:g.191765310T>C	ENSP00000317379:p.Val209Ala	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	4.0	NM_014905	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	37	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	T	16.93	3.256801	0.59321	.	.	ENSG00000115419	ENST00000320717;ENST00000338435	T;T	0.46819	0.98;0.86	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.52208	0.1720	M	0.79475	2.455	0.80722	D	1	B;B	0.21821	0.008;0.061	B;B	0.25140	0.01;0.058	T	0.50338	-0.8840	10	0.32370	T	0.25	-18.3999	15.9423	0.79768	0.0:0.0:0.0:1.0	.	209;209	O94925;O94925-3	GLSK_HUMAN;.	A	209	ENSP00000317379:V209A;ENSP00000340689:V209A	ENSP00000317379:V209A	V	+	2	0	GLS	191473555	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.980000	0.88113	2.223000	0.72356	0.455000	0.32223	GTT	.		0.308	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
GNA13	10672	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	63014373	63014373	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:63014373G>A	ENST00000439174.2	-	3	804	c.559C>T	c.(559-561)Cca>Tca	p.P187S	GNA13_ENST00000541118.1_Missense_Mutation_p.P92S	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	187					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						ACACTTACTGGTTCTCCAAGT	0.303																																					p.P187S		.											.	GNA13	227	0			c.C559T						.						132.0	139.0	137.0					17																	63014373		2203	4299	6502	SO:0001583	missense	10672	exon3			TTACTGGTTCTCC	L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.559C>T	17.37:g.63014373G>A	ENSP00000400717:p.Pro187Ser	Somatic	200.0	0.0		WXS	Illumina HiSeq	Phase_I	244.0	59.0	NM_006572	B2R977|B7Z7R0|F5H1G8|Q8TD70	Missense_Mutation	SNP	ENST00000439174.2	37	CCDS11661.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.679744	0.29783	.	.	ENSG00000120063	ENST00000439174;ENST00000541118;ENST00000239138	D;D	0.89123	-2.47;-2.47	4.95	0.565	0.17309	G protein alpha subunit, helical insertion (2);	0.864625	0.10553	N	0.661221	D	0.82921	0.5142	L	0.48260	1.515	0.47009	D	0.999289	B	0.02656	0.0	B	0.01281	0.0	T	0.75048	-0.3455	10	0.37606	T	0.19	.	7.1178	0.25427	0.1565:0.2824:0.5612:0.0	.	187	Q14344	GNA13_HUMAN	S	187;92;162	ENSP00000400717:P187S;ENSP00000439647:P92S	ENSP00000239138:P162S	P	-	1	0	GNA13	60444835	0.839000	0.29477	1.000000	0.80357	0.996000	0.88848	0.044000	0.13992	0.679000	0.31345	0.655000	0.94253	CCA	.		0.303	GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445720.1	NM_006572	
GPR155	151556	ucsc.edu;bcgsc.ca;mdanderson.org	37	2	175318476	175318476	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:175318476G>A	ENST00000392552.2	-	11	2103	c.1865C>T	c.(1864-1866)tCg>tTg	p.S622L	GPR155_ENST00000295500.4_Missense_Mutation_p.S622L|GPR155_ENST00000392551.2_Missense_Mutation_p.S622L	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	622					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						TTTCTCAAACGAAGGAATCAC	0.413																																					p.S622L		.											.	GPR155	91	0			c.C1865T						.						226.0	221.0	223.0					2																	175318476		2203	4300	6503	SO:0001583	missense	151556	exon12			TCAAACGAAGGAA	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.1865C>T	2.37:g.175318476G>A	ENSP00000376335:p.Ser622Leu	Somatic	95.0	1.0		WXS	Illumina HiSeq	.	93.0	36.0	NM_001033045	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	ENST00000392552.2	37	CCDS2259.1	.	.	.	.	.	.	.	.	.	.	g	13.29	2.193039	0.38707	.	.	ENSG00000163328	ENST00000392552;ENST00000510236;ENST00000392551;ENST00000295500	T;T;T	0.51071	0.72;0.72;0.72	5.99	5.99	0.97316	.	0.282367	0.36444	N	0.002598	T	0.32010	0.0815	N	0.21448	0.665	0.46654	D	0.999145	B;P	0.50066	0.152;0.931	B;B	0.33295	0.049;0.161	T	0.21211	-1.0252	10	0.48119	T	0.1	-7.5954	17.2254	0.86969	0.0:0.0:1.0:0.0	.	102;622	F5H464;Q7Z3F1	.;GP155_HUMAN	L	622;102;622;622	ENSP00000376335:S622L;ENSP00000376334:S622L;ENSP00000295500:S622L	ENSP00000295500:S622L	S	-	2	0	GPR155	175026722	1.000000	0.71417	0.949000	0.38748	0.046000	0.14306	5.179000	0.65043	2.857000	0.98124	0.645000	0.84053	TCG	.		0.413	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529	
GPR98	84059	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	89968413	89968413	+	Silent	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr5:89968413A>G	ENST00000405460.2	+	22	4899	c.4803A>G	c.(4801-4803)ggA>ggG	p.G1601G	GPR98_ENST00000450321.2_3'UTR	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1601	Calx-beta 11. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GAACCAGAGGAGCTCTGGATT	0.368																																					p.G1601G		.											.	GPR98	103	0			c.A4803G						.						174.0	158.0	163.0					5																	89968413		1866	4103	5969	SO:0001819	synonymous_variant	84059	exon22			CAGAGGAGCTCTG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4803A>G	5.37:g.89968413A>G		Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	372.0	83.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	37	CCDS47246.1																																																																																			.		0.368	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
HINT3	135114	hgsc.bcm.edu;bcgsc.ca	37	6	126278232	126278232	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr6:126278232A>C	ENST00000229633.5	+	1	306	c.109A>C	c.(109-111)Aag>Cag	p.K37Q		NM_138571.4	NP_612638.3	Q9NQE9	HINT3_HUMAN	histidine triad nucleotide binding protein 3	37						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(1)|lung(1)|stomach(1)	4				UCEC - Uterine corpus endometrioid carcinoma (4;0.153)|GBM - Glioblastoma multiforme(226;0.0321)		AGCCGCTGGCAAGTCACCAGA	0.677											OREG0017649	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K37Q		.											.	HINT3	90	0			c.A109C						.						27.0	21.0	23.0					6																	126278232		1869	3645	5514	SO:0001583	missense	135114	exon1			GCTGGCAAGTCAC	AK057688	CCDS5133.1	6q22.33	2007-12-04			ENSG00000111911	ENSG00000111911			18468	protein-coding gene	gene with protein product		609998				11805111	Standard	NM_138571		Approved	FLJ33126	uc003qal.4	Q9NQE9	OTTHUMG00000015514	ENST00000229633.5:c.109A>C	6.37:g.126278232A>C	ENSP00000229633:p.Lys37Gln	Somatic	117.0	0.0	1548	WXS	Illumina HiSeq	Phase_I	187.0	8.0	NM_138571	B3KQ91|Q8N0Y9	Missense_Mutation	SNP	ENST00000229633.5	37	CCDS5133.1	.	.	.	.	.	.	.	.	.	.	A	9.072	0.997150	0.19043	.	.	ENSG00000111911	ENST00000229633	D	0.91351	-2.83	4.51	-1.37	0.09056	Histidine triad-like motif (1);	1.335400	0.04646	N	0.406141	T	0.63861	0.2547	N	0.19112	0.55	0.09310	N	1	B	0.23806	0.091	B	0.19148	0.024	T	0.56111	-0.8033	10	0.19147	T	0.46	-33.9008	4.8889	0.13717	0.3582:0.2836:0.3582:0.0	.	37	Q9NQE9	HINT3_HUMAN	Q	37	ENSP00000229633:K37Q	ENSP00000229633:K37Q	K	+	1	0	HINT3	126319925	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.402000	0.07223	-0.523000	0.06409	0.374000	0.22700	AAG	.		0.677	HINT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042090.1	NM_138571	
HSF4	3299	hgsc.bcm.edu;bcgsc.ca	37	16	67203201	67203201	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:67203201A>G	ENST00000521374.1	+	12	1274	c.1274A>G	c.(1273-1275)gAg>gGg	p.E425G	NOL3_ENST00000432069.2_5'Flank|HSF4_ENST00000421453.1_Missense_Mutation_p.E395G|HSF4_ENST00000264009.8_Missense_Mutation_p.E425G|NOL3_ENST00000564053.1_5'Flank|HSF4_ENST00000584272.1_Missense_Mutation_p.E395G			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	425					camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		TTGGTTCCAGAGCGGGGTGAG	0.592																																					p.E425G		.											.	HSF4	90	0			c.A1274G						.						33.0	37.0	36.0					16																	67203201		1987	4169	6156	SO:0001583	missense	3299	exon14			TTCCAGAGCGGGG	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.1274A>G	16.37:g.67203201A>G	ENSP00000430947:p.Glu425Gly	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_001040667	Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	37	CCDS42175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.0|21.0	4.086265|4.086265	0.76642|0.76642	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374|ENST00000520304	.|.	.|.	.|.	4.73|4.73	4.73|4.73	0.59995|0.59995	.|.	0.000000|.	0.51477|.	D|.	0.000086|.	T|T	0.47673|0.47673	0.1458|0.1458	L|L	0.32530|0.32530	0.975|0.975	0.37856|0.37856	D|D	0.929561|0.929561	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.80764|.	0.994;0.986|.	T|T	0.49341|0.49341	-0.8950|-0.8950	9|5	0.27785|.	T|.	0.31|.	-31.7262|-31.7262	10.5258|10.5258	0.44948|0.44948	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	395;425|.	Q9ULV5-2;Q9ULV5|.	.;HSF4_HUMAN|.	G|G	395;425;349;425|101	.|.	ENSP00000264009:E425G|.	E|S	+|+	2|1	0|0	HSF4|HSF4	65760702|65760702	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.946000|0.946000	0.59487|0.59487	2.915000|2.915000	0.48805|0.48805	1.958000|1.958000	0.56883|0.56883	0.533000|0.533000	0.62120|0.62120	GAG|AGC	.		0.592	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375080.1	NM_001538	
IL18RAP	8807	hgsc.bcm.edu;bcgsc.ca	37	2	103067460	103067460	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:103067460A>G	ENST00000264260.2	+	11	1952	c.1363A>G	c.(1363-1365)Aga>Gga	p.R455G	IL18RAP_ENST00000409369.1_Missense_Mutation_p.R313G	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	455	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						TTTGCTTGAAAGAGATGTGGC	0.423																																					p.R455G		.											.	IL18RAP	95	0			c.A1363G						.						84.0	85.0	85.0					2																	103067460		2203	4300	6503	SO:0001583	missense	8807	exon11			CTTGAAAGAGATG	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.1363A>G	2.37:g.103067460A>G	ENSP00000264260:p.Arg455Gly	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_003853	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.008323	0.75046	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.12147	2.71;2.71	5.66	3.2	0.36748	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.64402	D	0.000002	T	0.43344	0.1243	M	0.89904	3.07	0.46078	D	0.99885	D	0.89917	1.0	D	0.91635	0.999	T	0.50259	-0.8849	10	0.87932	D	0	.	12.928	0.58270	0.7721:0.2279:0.0:0.0	.	455	O95256	I18RA_HUMAN	G	455;313	ENSP00000264260:R455G;ENSP00000387201:R313G	ENSP00000264260:R455G	R	+	1	2	IL18RAP	102433892	1.000000	0.71417	0.975000	0.42487	0.958000	0.62258	5.769000	0.68865	0.383000	0.24910	0.528000	0.53228	AGA	.		0.423	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853	
IQSEC3	440073	ucsc.edu;bcgsc.ca;mdanderson.org	37	12	271222	271222	+	Silent	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr12:271222C>A	ENST00000538872.1	+	8	2692	c.2574C>A	c.(2572-2574)ggC>ggA	p.G858G	IQSEC3_ENST00000382841.2_Silent_p.G555G|RP11-598F7.5_ENST00000540136.1_RNA|IQSEC3_ENST00000326261.4_Silent_p.G858G			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	858	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CCATTGTGGGCATGAAGACAG	0.493																																					p.G858G		.											.	IQSEC3	560	0			c.C2574A						.						136.0	95.0	109.0					12																	271222		2203	4300	6503	SO:0001819	synonymous_variant	440073	exon8			TGTGGGCATGAAG	AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.2574C>A	12.37:g.271222C>A		Somatic	120.0	1.0		WXS	Illumina HiSeq	.	81.0	41.0	NM_001170738	A6NIF2|A6NKV9|Q8TB43	Silent	SNP	ENST00000538872.1	37	CCDS53728.1																																																																																			.		0.493	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902	
KCNC1	3746	broad.mit.edu;mdanderson.org	37	11	17757951	17757951	+	Silent	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr11:17757951G>A	ENST00000379472.3	+	1	432	c.402G>A	c.(400-402)gcG>gcA	p.A134A	KCNC1_ENST00000265969.6_Silent_p.A134A	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	134					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	CCGACGACGCGGACGCCGACG	0.721																																					p.A134A		.											.	KCNC1	91	0			c.G402A						.						10.0	13.0	12.0					11																	17757951		2185	4270	6455	SO:0001819	synonymous_variant	3746	exon1			CGACGCGGACGCC	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.402G>A	11.37:g.17757951G>A		Somatic	10.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	8.0	NM_004976	K4DI87	Silent	SNP	ENST00000379472.3	37	CCDS7827.1																																																																																			.		0.721	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976	
CFAP74	85452	hgsc.bcm.edu;bcgsc.ca	37	1	1887022	1887022	+	IGR	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:1887022A>G								TMEM52 (36310 upstream) : C1orf222 (32540 downstream)																							AAGGCCTAGGAAAATTCTCTA	0.537																																					p.S762P		.											.	KIAA1751	69	0			c.T2284C						.						74.0	79.0	78.0					1																	1887022		1887	4091	5978	SO:0001628	intergenic_variant	85452	exon18			CCTAGGAAAATTC																													1.37:g.1887022A>G		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	8.0	NM_001080484		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	A	9.318	1.057357	0.19907	.	.	ENSG00000142609	ENST00000270720	.	.	.	1.45	-1.37	0.09056	.	0.228496	0.26556	N	0.023701	T	0.15565	0.0375	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08452	-1.0721	9	0.87932	D	0	.	6.1345	0.20223	0.7187:0.0:0.2813:0.0	.	762	Q9C0B2	K1751_HUMAN	P	762	.	ENSP00000270720:S762P	S	-	1	0	C1orf222	1876882	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.572000	0.05881	-1.085000	0.03088	-1.489000	0.00976	TCC	.	0	0.537								
KIAA2026	158358	hgsc.bcm.edu;bcgsc.ca	37	9	5921058	5921058	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr9:5921058T>C	ENST00000399933.3	-	8	4937	c.4938A>G	c.(4936-4938)tcA>tcG	p.S1646S	KIAA2026_ENST00000381461.2_Silent_p.S1616S	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1646										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CTGCTCTTGCTGAAGAAACCA	0.428																																					p.S1646S		.											.	KIAA2026	92	0			c.A4938G						.						99.0	94.0	96.0					9																	5921058		1856	4100	5956	SO:0001819	synonymous_variant	158358	exon8			TCTTGCTGAAGAA	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.4938A>G	9.37:g.5921058T>C		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	5.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37																																																																																				.		0.428	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
KIFC2	90990	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	8	145693366	145693366	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr8:145693366C>T	ENST00000301332.2	+	7	1183	c.806C>T	c.(805-807)cCg>cTg	p.P269L	CYHR1_ENST00000306145.5_5'Flank|CYHR1_ENST00000438911.2_5'Flank|CTD-2517M22.16_ENST00000525461.1_RNA|KIFC2_ENST00000301331.5_Missense_Mutation_p.P17L|CYHR1_ENST00000403000.2_5'Flank|CYHR1_ENST00000424149.2_5'Flank	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2	269	Gln-rich.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			ATCAGGGCTCCGCAGGTACTC	0.677																																					p.P269L		.											.	KIFC2	92	0			c.C806T						.						12.0	15.0	14.0					8																	145693366		2178	4270	6448	SO:0001583	missense	90990	exon7			GGGCTCCGCAGGT	AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.806C>T	8.37:g.145693366C>T	ENSP00000301332:p.Pro269Leu	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	218.0	25.0	NM_145754	E9PHB2|Q96NN6	Missense_Mutation	SNP	ENST00000301332.2	37	CCDS6427.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.755500	0.49362	.	.	ENSG00000167702	ENST00000301332;ENST00000301331	T;T	0.71461	-0.57;-0.51	4.22	2.34	0.29019	.	0.251086	0.21037	N	0.081232	T	0.49236	0.1545	N	0.24115	0.695	0.23640	N	0.997228	B	0.16802	0.019	B	0.14578	0.011	T	0.23762	-1.0179	10	0.14252	T	0.57	-9.219	6.5852	0.22616	0.1789:0.7215:0.0:0.0996	.	269	Q96AC6	KIFC2_HUMAN	L	269;17	ENSP00000301332:P269L;ENSP00000301331:P17L	ENSP00000301331:P17L	P	+	2	0	KIFC2	145664174	0.000000	0.05858	0.331000	0.25455	0.036000	0.12997	0.282000	0.18829	0.486000	0.27676	0.655000	0.94253	CCG	.		0.677	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382052.2	NM_145754	
KRAS	3845	hgsc.bcm.edu;bcgsc.ca	37	12	25368464	25368464	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr12:25368464T>C	ENST00000256078.4	-	5	544	c.481A>G	c.(481-483)Agg>Ggg	p.R161G	KRAS_ENST00000311936.3_Intron|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	161					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)		UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CGGATCTCCCTCACCAATGTA	0.348		119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.R161G	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	.	KRAS	92875	0			c.A481G						.						119.0	114.0	116.0					12																	25368464		2203	4300	6503	SO:0001583	missense	3845	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	TCTCCCTCACCAA	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.481A>G	12.37:g.25368464T>C	ENSP00000256078:p.Arg161Gly	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	4.0	NM_033360	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	T	19.90	3.913542	0.72983	.	.	ENSG00000133703	ENST00000256078	T	0.71579	-0.58	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.85225	0.5648	M	0.88906	2.99	0.80722	D	1	D	0.71674	0.998	D	0.70016	0.967	D	0.87762	0.2599	10	0.87932	D	0	.	12.0477	0.53489	0.0:0.0:0.1538:0.8462	.	161	P01116	RASK_HUMAN	G	161	ENSP00000256078:R161G	ENSP00000256078:R161G	R	-	1	2	KRAS	25259731	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.695000	0.54749	2.254000	0.74563	0.482000	0.46254	AGG	.		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
L1CAM	3897	hgsc.bcm.edu;bcgsc.ca	37	X	153128287	153128287	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chrX:153128287A>G	ENST00000370060.1	-	29	3794	c.3605T>C	c.(3604-3606)cTg>cCg	p.L1202P	L1CAM_ENST00000370057.3_Missense_Mutation_p.L1202P|L1CAM_ENST00000361981.3_Missense_Mutation_p.L1193P|L1CAM_ENST00000361699.4_Missense_Mutation_p.L1198P|L1CAM_ENST00000538883.1_Missense_Mutation_p.L1200P|L1CAM_ENST00000543994.1_Missense_Mutation_p.L1204P|L1CAM_ENST00000370055.1_Missense_Mutation_p.L1193P	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1202					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTCACTGCCCAGGGGCTTGAT	0.592																																					p.L1202P		.											.	L1CAM	138	0			c.T3605C						.						74.0	55.0	61.0					X																	153128287		2203	4300	6503	SO:0001583	missense	3897	exon28			CTGCCCAGGGGCT	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3605T>C	X.37:g.153128287A>G	ENSP00000359077:p.Leu1202Pro	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_000425	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.428003	0.43122	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000370058;ENST00000361699	D;D;D;D;D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07;-2.07;-2.07;-2.07;-2.07	4.6	4.6	0.57074	.	0.000000	0.42053	D	0.000762	D	0.87740	0.6253	L	0.40543	1.245	0.80722	D	1	D;P;D	0.76494	0.999;0.86;0.999	D;P;D	0.77004	0.921;0.535;0.989	D	0.86471	0.1785	10	0.36615	T	0.2	.	12.0976	0.53763	1.0:0.0:0.0:0.0	.	1193;1198;1202	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	P	1202;1204;1202;1200;1193;1193;98;1198	ENSP00000359077:L1202P;ENSP00000438430:L1204P;ENSP00000359074:L1202P;ENSP00000439645:L1200P;ENSP00000354712:L1193P;ENSP00000359072:L1193P;ENSP00000359075:L98P;ENSP00000355380:L1198P	ENSP00000355380:L1198P	L	-	2	0	L1CAM	152781481	0.169000	0.23002	1.000000	0.80357	0.786000	0.44442	0.772000	0.26647	1.697000	0.51169	0.430000	0.28490	CTG	.		0.592	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
LMBRD1	55788	hgsc.bcm.edu;bcgsc.ca	37	6	70490443	70490443	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr6:70490443A>G	ENST00000370577.3	-	3	479	c.250T>C	c.(250-252)Tgg>Cgg	p.W84R	LMBRD1_ENST00000370570.1_Missense_Mutation_p.W11R	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	84					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						GCATTAGCCCAGTCCTAGGAT	0.338																																					p.W84R		.											.	LMBRD1	91	0			c.T250C						.						112.0	108.0	109.0					6																	70490443		2203	4300	6503	SO:0001583	missense	55788	exon3			TAGCCCAGTCCTA	AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.250T>C	6.37:g.70490443A>G	ENSP00000359609:p.Trp84Arg	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	4.0	NM_018368	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	ENST00000370577.3	37	CCDS4969.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.012555	0.75161	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.35973	1.28;1.99	5.67	5.67	0.87782	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.57740	0.2074	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66444	-0.5922	10	0.87932	D	0	-4.874	15.0854	0.72148	1.0:0.0:0.0:0.0	.	84	Q9NUN5	LMBD1_HUMAN	R	84;11	ENSP00000359609:W84R;ENSP00000359602:W11R	ENSP00000359602:W11R	W	-	1	0	LMBRD1	70547164	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.469000	0.73555	2.149000	0.67028	0.379000	0.24179	TGG	.		0.338	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368	
LPA	4018	hgsc.bcm.edu;bcgsc.ca	37	6	161022116	161022116	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr6:161022116T>C	ENST00000316300.5	-	19	3004	c.2960A>G	c.(2959-2961)aAc>aGc	p.N987S	LPA_ENST00000447678.1_Missense_Mutation_p.N987S			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3495	Kringle 9. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TCGGCAGTAGTTCTTGATCAA	0.443																																					p.N987S		.											.	LPA	74	0			c.A2960G						.						67.0	70.0	69.0					6																	161022116		2164	4289	6453	SO:0001583	missense	4018	exon20			CAGTAGTTCTTGA	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2960A>G	6.37:g.161022116T>C	ENSP00000321334:p.Asn987Ser	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_005577	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	t	15.59	2.877383	0.51801	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.71934	-0.61;-0.61	2.31	2.31	0.28768	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.79143	0.4396	M	0.92691	3.335	0.20489	N	0.999899	P	0.50156	0.932	D	0.67103	0.949	T	0.67910	-0.5548	9	0.72032	D	0.01	.	6.4002	0.21634	0.0:0.0:0.0:1.0	.	3495	P08519	APOA_HUMAN	S	987	ENSP00000321334:N987S;ENSP00000395608:N987S	ENSP00000321334:N987S	N	-	2	0	LPA	160942106	1.000000	0.71417	0.726000	0.30738	0.371000	0.29859	4.141000	0.58038	1.041000	0.40125	0.172000	0.16884	AAC	.		0.443	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
LY75	4065	hgsc.bcm.edu;bcgsc.ca	37	2	160732083	160732083	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:160732083T>C	ENST00000263636.4	-	12	1873	c.1846A>G	c.(1846-1848)Agc>Ggc	p.S616G	LY75_ENST00000553424.1_Missense_Mutation_p.S616G|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.S616G|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.S616G|LY75_ENST00000554112.1_Missense_Mutation_p.S616G	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	616	C-type lectin 3. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		GCTTTGAAGCTTCTGCAGTCC	0.517																																					p.S616G		.											.	LY75	90	0			c.A1846G						.						129.0	137.0	134.0					2																	160732083		2203	4300	6503	SO:0001583	missense	4065	exon12			TGAAGCTTCTGCA	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.1846A>G	2.37:g.160732083T>C	ENSP00000263636:p.Ser616Gly	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	5.0	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	37	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	T	16.69	3.193623	0.58017	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07	5.07	5.07	0.68467	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.352983	0.20491	N	0.091293	T	0.28400	0.0702	M	0.64404	1.975	0.37230	D	0.905635	B;P;P;B	0.36483	0.27;0.499;0.555;0.264	B;B;B;B	0.40982	0.232;0.234;0.345;0.085	T	0.19128	-1.0315	10	0.41790	T	0.15	-0.6067	14.1143	0.65142	0.0:0.0:0.0:1.0	.	234;616;616;616	Q59H44;O60449-3;O60449;O60449-2	.;.;LY75_HUMAN;.	G	616	ENSP00000451511:S616G;ENSP00000451446:S616G;ENSP00000263636:S616G;ENSP00000423463:S616G;ENSP00000421035:S616G	ENSP00000423463:S616G	S	-	1	0	LY75;LY75-CD302	160440329	0.634000	0.27190	0.644000	0.29465	0.982000	0.71751	2.598000	0.46223	2.029000	0.59856	0.460000	0.39030	AGC	.		0.517	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
MAGEB16	139604	hgsc.bcm.edu;bcgsc.ca	37	X	35820408	35820408	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chrX:35820408A>G	ENST00000399989.1	+	2	374	c.95A>G	c.(94-96)aAg>aGg	p.K32R	MAGEB16_ENST00000399992.1_Missense_Mutation_p.K64R|MAGEB16_ENST00000399985.1_Missense_Mutation_p.K32R|MAGEB16_ENST00000399987.1_Missense_Mutation_p.K32R|MAGEB16_ENST00000399988.1_Missense_Mutation_p.K32R	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	32										breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						CAGGTCTCCAAGGCTCTGGAG	0.552																																					p.K32R		.											.	MAGEB16	66	0			c.A95G						.						41.0	42.0	41.0					X																	35820408		2022	4171	6193	SO:0001583	missense	139604	exon2			TCTCCAAGGCTCT		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.95A>G	X.37:g.35820408A>G	ENSP00000382871:p.Lys32Arg	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	4.0	NM_001099921	A8MU30	Missense_Mutation	SNP	ENST00000399989.1	37	CCDS43927.1	.	.	.	.	.	.	.	.	.	.	A	3.125	-0.179717	0.06380	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.04317	3.65;3.65;3.65;3.65;3.65	3.02	-6.03	0.02185	Melanoma associated antigen, MAGE, N-terminal (1);	1.111270	0.06703	N	0.771751	T	0.03651	0.0104	L	0.34521	1.04	0.09310	N	1	B	0.18013	0.025	B	0.18263	0.021	T	0.42344	-0.9457	10	0.48119	T	0.1	.	4.6746	0.12706	0.2246:0.0:0.4599:0.3155	.	32	A2A368	MAGBG_HUMAN	R	32;64;32;32;32	ENSP00000382870:K32R;ENSP00000382874:K64R;ENSP00000382869:K32R;ENSP00000382871:K32R;ENSP00000382867:K32R	ENSP00000382867:K32R	K	+	2	0	MAGEB16	35730329	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.720000	0.04969	-1.864000	0.01148	0.423000	0.28283	AAG	.		0.552	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1		
MECOM	2122	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	169099249	169099249	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:169099249C>T	ENST00000494292.1	-	2	198	c.101G>A	c.(100-102)gGa>gAa	p.G34E	MECOM_ENST00000485957.1_5'UTR	NM_004991.3	NP_004982.2	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	34					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GCTGGCTACTCCATCTGCATC	0.448																																					p.G34E		.											.	MECOM	853	0			c.G101A						.						58.0	59.0	58.0					3																	169099249		1929	4136	6065	SO:0001583	missense	2122	exon2			GCTACTCCATCTG	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000494292.1:c.101G>A	3.37:g.169099249C>T	ENSP00000417899:p.Gly34Glu	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	51.0	NM_004991	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000494292.1	37		.	.	.	.	.	.	.	.	.	.	C	16.78	3.218032	0.58560	.	.	ENSG00000085276	ENST00000494292;ENST00000486748	T	0.06687	3.27	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000012	T	0.28732	0.0712	M	0.63428	1.95	0.80722	D	1	D;P	0.76494	0.999;0.72	D;B	0.71656	0.974;0.346	T	0.00068	-1.2139	10	0.54805	T	0.06	.	20.1184	0.97949	0.0:1.0:0.0:0.0	.	34;34	Q13465;Q03112-3	MDS1_HUMAN;.	E	34;58	ENSP00000417899:G34E	ENSP00000419537:G58E	G	-	2	0	MECOM	170581943	1.000000	0.71417	0.982000	0.44146	0.033000	0.12548	5.030000	0.64128	2.775000	0.95449	0.650000	0.86243	GGA	.		0.448	MECOM-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000351517.3	NM_005241, NM_004991	
MKNK2	2872	hgsc.bcm.edu;bcgsc.ca	37	19	2041918	2041918	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr19:2041918A>G	ENST00000591601.1	-	10	901	c.866T>C	c.(865-867)cTc>cCc	p.L289P	MKNK2_ENST00000309340.7_Missense_Mutation_p.L289P|MKNK2_ENST00000541165.1_Missense_Mutation_p.L158P|MKNK2_ENST00000591588.1_Missense_Mutation_p.L33P|MKNK2_ENST00000250896.3_Missense_Mutation_p.L289P|MKNK2_ENST00000591142.1_Missense_Mutation_p.L33P|MKNK2_ENST00000588014.1_Missense_Mutation_p.L33P			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	289	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTAGCCGCTGAGTAGGATATA	0.687																																					p.L289P		.											.	MKNK2	978	0			c.T866C						.						26.0	22.0	23.0					19																	2041918		2129	4174	6303	SO:0001583	missense	2872	exon11			CCGCTGAGTAGGA	AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.866T>C	19.37:g.2041918A>G	ENSP00000467811:p.Leu289Pro	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_017572	Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Missense_Mutation	SNP	ENST00000591601.1	37	CCDS12080.1	.	.	.	.	.	.	.	.	.	.	A	16.53	3.150244	0.57151	.	.	ENSG00000099875	ENST00000309340;ENST00000250896;ENST00000541165;ENST00000545627	T;T;T	0.53206	0.63;0.63;0.63	4.08	4.08	0.47627	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.79470	0.4451	H	0.98487	4.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.998;0.999	D	0.86533	0.1823	10	0.87932	D	0	-9.2055	12.3786	0.55293	1.0:0.0:0.0:0.0	.	94;289;289;191	Q59GN5;Q9HBH9;Q9HBH9-2;Q9NT28	.;MKNK2_HUMAN;.;.	P	289;289;158;229	ENSP00000309485:L289P;ENSP00000250896:L289P;ENSP00000438904:L158P	ENSP00000250896:L289P	L	-	2	0	MKNK2	1992918	1.000000	0.71417	1.000000	0.80357	0.116000	0.19942	8.803000	0.91915	1.712000	0.51347	0.454000	0.30748	CTC	.		0.687	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449312.1	NM_199054	
MRPS5	64969	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	95767468	95767468	+	Splice_Site	SNP	C	C	A	rs199914429		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:95767468C>A	ENST00000272418.2	-	8	972	c.764G>T	c.(763-765)gGt>gTt	p.G255V		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	255	S5 DRBM. {ECO:0000255|PROSITE- ProRule:PRU00268}.				translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						AATAGAAAAACCTTTAAACAA	0.323																																					p.G255V		.											.	MRPS5	92	0			c.G764T						.						36.0	34.0	35.0					2																	95767468		2202	4299	6501	SO:0001630	splice_region_variant	64969	exon8			GAAAAACCTTTAA	AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.764-1G>T	2.37:g.95767468C>A		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	23.0	NM_031902	Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Missense_Mutation	SNP	ENST00000272418.2	37	CCDS2010.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.319758	0.60524	.	.	ENSG00000144029	ENST00000272418	.	.	.	5.32	5.32	0.75619	Ribosomal protein S5, N-terminal, conserved site (1);Ribosomal protein S5, N-terminal (2);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.88347	0.6412	H	0.98027	4.13	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92102	0.5689	9	0.87932	D	0	.	14.8467	0.70264	0.0:1.0:0.0:0.0	.	255	P82675	RT05_HUMAN	V	255	.	ENSP00000272418:G255V	G	-	2	0	MRPS5	95131195	1.000000	0.71417	1.000000	0.80357	0.342000	0.28953	5.298000	0.65710	2.634000	0.89283	0.591000	0.81541	GGT	C|0.999;G|0.000		0.323	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252772.1	NM_031902	Missense_Mutation
APEH	327	hgsc.bcm.edu;bcgsc.ca	37	3	49722913	49722913	+	IGR	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:49722913C>T	ENST00000296456.5	+	0	3220				MST1_ENST00000383728.3_3'UTR|MST1_ENST00000449682.2_Missense_Mutation_p.D472N|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCTGGGGGGTCCAGGATTGAT	0.592																																					p.D472N		.											.	MST1	278	0			c.G1414A						.						29.0	32.0	31.0					3																	49722913		2202	4299	6501	SO:0001628	intergenic_variant	4485	exon12			GGGGGTCCAGGAT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49722913C>T		Somatic	262.0	0.0		WXS	Illumina HiSeq	Phase_I	553.0	46.0	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.481708	0.26598	.	.	ENSG00000173531	ENST00000449682	T	0.79940	-1.32	4.78	2.98	0.34508	.	0.707688	0.11995	N	0.509451	T	0.60392	0.2265	N	0.08118	0	0.80722	D	1	B	0.21753	0.06	B	0.26094	0.066	T	0.44436	-0.9328	10	0.10636	T	0.68	.	8.1354	0.31052	0.0:0.8059:0.0:0.1941	.	472	G3XAK1	.	N	472	ENSP00000414287:D472N	ENSP00000414287:D472N	D	-	1	0	MST1	49697917	1.000000	0.71417	0.995000	0.50966	0.784000	0.44337	3.079000	0.50104	0.689000	0.31550	0.655000	0.94253	GAC	.		0.592	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
MTF1	4520	hgsc.bcm.edu;bcgsc.ca	37	1	38288327	38288327	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:38288327T>C	ENST00000373036.4	-	9	1373	c.1233A>G	c.(1231-1233)acA>acG	p.T411T		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	411					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTGAATTTCCTGTGGATGGCG	0.478																																					p.T411T		.											.	MTF1	92	0			c.A1233G						.						71.0	79.0	76.0					1																	38288327		2203	4300	6503	SO:0001819	synonymous_variant	4520	exon9			ATTTCCTGTGGAT	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.1233A>G	1.37:g.38288327T>C		Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_005955	B2RAK6|Q96CB1	Silent	SNP	ENST00000373036.4	37	CCDS30676.1																																																																																			.		0.478	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	
MUC2	4583	hgsc.bcm.edu;bcgsc.ca	37	11	1094691	1094691	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr11:1094691G>T	ENST00000441003.2	+	31	5806	c.5779G>T	c.(5779-5781)Ggg>Tgg	p.G1927W	MUC2_ENST00000333592.6_Missense_Mutation_p.G215W|MUC2_ENST00000361558.6_Missense_Mutation_p.G65W	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4289					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TACCACGACCGGGTCATCTTC	0.632																																					p.G1923W		.											.	MUC2	90	0			c.G5767T						.						78.0	97.0	90.0					11																	1094691		2117	4220	6337	SO:0001583	missense	4583	exon32			ACGACCGGGTCAT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5779G>T	11.37:g.1094691G>T	ENSP00000415183:p.Gly1927Trp	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	7.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	10.79	1.449554	0.26074	.	.	ENSG00000198788	ENST00000441003;ENST00000361558;ENST00000333592	T;T;T	0.41758	2.56;0.99;2.9	1.97	-1.24	0.09435	.	.	.	.	.	T	0.40171	0.1106	L	0.51422	1.61	0.09310	N	1	D	0.63880	0.993	P	0.49665	0.618	T	0.31613	-0.9937	9	0.66056	D	0.02	.	5.8132	0.18477	0.5036:0.0:0.4964:0.0	.	1927	E7EUV1	.	W	1927;65;215	ENSP00000415183:G1927W;ENSP00000354885:G65W;ENSP00000331373:G215W	ENSP00000331373:G215W	G	+	1	0	MUC2	1084691	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-2.996000	0.00655	-0.225000	0.09913	0.479000	0.44913	GGG	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195508423	195508423	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:195508423G>A	ENST00000463781.3	-	2	10487	c.10028C>T	c.(10027-10029)aCc>aTc	p.T3343I	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3343I	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCACAGGGGTGGTGTCACC	0.602																																					p.T3343I		.											.	MUC4	90	0			c.C10028T						.						32.0	24.0	27.0					3																	195508423		680	1573	2253	SO:0001583	missense	4585	exon2			ACAGGGGTGGTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10028C>T	3.37:g.195508423G>A	ENSP00000417498:p.Thr3343Ile	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	304.0	115.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	6.308	0.424985	0.11987	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.33;1.3	1.03	1.03	0.20045	.	.	.	.	.	T	0.17365	0.0417	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.37346	0.247	T	0.09885	-1.0654	8	.	.	.	.	7.5882	0.28006	0.0:0.0:1.0:0.0	.	3215	E7ESK3	.	I	3343	ENSP00000417498:T3343I;ENSP00000420243:T3343I	.	T	-	2	0	MUC4	196993202	0.000000	0.05858	0.008000	0.14137	0.030000	0.12068	-1.756000	0.01813	0.494000	0.27859	0.089000	0.15464	ACC	.		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MYO5C	55930	hgsc.bcm.edu;bcgsc.ca	37	15	52571842	52571842	+	Silent	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr15:52571842A>G	ENST00000261839.7	-	3	329	c.168T>C	c.(166-168)tcT>tcC	p.S56S	MYO5C_ENST00000541028.1_5'UTR|MIR1266_ENST00000408125.1_RNA|MYO5C_ENST00000443683.2_5'UTR	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	56						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		GTGGAGGCAGAGATTCTGGAT	0.468																																					p.S56S		.											.	MYO5C	145	0			c.T168C						.						47.0	46.0	46.0					15																	52571842		1862	4110	5972	SO:0001819	synonymous_variant	55930	exon3			AGGCAGAGATTCT	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.168T>C	15.37:g.52571842A>G		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_018728	Q6P1W8	Silent	SNP	ENST00000261839.7	37	CCDS42036.1																																																																																			.		0.468	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
NDUFAF1	51103	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41688824	41688824	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr15:41688824C>A	ENST00000260361.4	-	2	815	c.434G>T	c.(433-435)gGa>gTa	p.G145V		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	145					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		ACTTCTGCCTCCAATCGTCTT	0.488																																					p.G145V		.											.	NDUFAF1	91	0			c.G434T						.						91.0	86.0	88.0					15																	41688824		2203	4300	6503	SO:0001583	missense	51103	exon2			CTGCCTCCAATCG	AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.434G>T	15.37:g.41688824C>A	ENSP00000260361:p.Gly145Val	Somatic	250.0	0.0		WXS	Illumina HiSeq	Phase_I	269.0	94.0	NM_016013	Q9BVZ5	Missense_Mutation	SNP	ENST00000260361.4	37	CCDS10075.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487384	0.84854	.	.	ENSG00000137806	ENST00000260361	D	0.88741	-2.42	4.7	4.7	0.59300	NADH:ubiquinone oxidoreductase intermediate-associated protein 30 (1);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.95544	0.8552	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96545	0.9403	10	0.87932	D	0	-13.2143	18.0656	0.89389	0.0:1.0:0.0:0.0	.	145	Q9Y375	CIA30_HUMAN	V	145	ENSP00000260361:G145V	ENSP00000260361:G145V	G	-	2	0	NDUFAF1	39476116	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.624000	0.83124	2.334000	0.79466	0.449000	0.29647	GGA	.		0.488	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252692.2	NM_016013	
MYO9A	4649	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	72193622	72193622	+	Silent	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr15:72193622G>A	ENST00000356056.5	-	23	3532	c.3060C>T	c.(3058-3060)ctC>ctT	p.L1020L	MYO9A_ENST00000566885.1_Silent_p.L640L|MYO9A_ENST00000424560.1_Silent_p.L1020L|MYO9A_ENST00000564571.1_Silent_p.L1020L|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Silent_p.L1001L	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1020					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TGATTCTGCGGAGCACCTCTT	0.458																																					p.L1020L		.											.	MYO9A	93	0			c.C3060T						.						114.0	97.0	102.0					15																	72193622		2199	4297	6496	SO:0001819	synonymous_variant	4649	exon23			TCTGCGGAGCACC	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.3060C>T	15.37:g.72193622G>A		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	57.0	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Silent	SNP	ENST00000356056.5	37	CCDS10239.1																																																																																			.		0.458	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
NFX1	4799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33295418	33295418	+	Silent	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr9:33295418G>A	ENST00000379540.3	+	2	1088	c.1026G>A	c.(1024-1026)acG>acA	p.T342T	NFX1_ENST00000379521.4_Silent_p.T342T|NFX1_ENST00000318524.6_Silent_p.T342T	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	342					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		ATGTGGAAACGCACACAGGTA	0.363																																					p.T342T		.											.	NFX1	91	0			c.G1026A						.						57.0	55.0	56.0					9																	33295418		2203	4300	6503	SO:0001819	synonymous_variant	4799	exon2			GGAAACGCACACA	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1026G>A	9.37:g.33295418G>A		Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	14.0	NM_147134	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Silent	SNP	ENST00000379540.3	37	CCDS6538.1																																																																																			.		0.363	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
NUP93	9688	hgsc.bcm.edu;bcgsc.ca	37	16	56867148	56867148	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:56867148A>G	ENST00000308159.5	+	13	1488	c.1367A>G	c.(1366-1368)aAc>aGc	p.N456S	NUP93_ENST00000569842.1_Missense_Mutation_p.N456S|NUP93_ENST00000564887.1_Missense_Mutation_p.N333S|NUP93_ENST00000542526.1_Missense_Mutation_p.N333S	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	456					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TTTACGGTGAACCAGCAACCC	0.562																																					p.N456S	Colon(33;610 796 1305 1705 38917)	.											.	NUP93	205	0			c.A1367G						.						147.0	127.0	134.0					16																	56867148		2198	4300	6498	SO:0001583	missense	9688	exon13			CGGTGAACCAGCA	D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.1367A>G	16.37:g.56867148A>G	ENSP00000310668:p.Asn456Ser	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	6.0	NM_014669	B3KPQ8|Q14705	Missense_Mutation	SNP	ENST00000308159.5	37	CCDS10769.1	.	.	.	.	.	.	.	.	.	.	A	12.63	1.996597	0.35226	.	.	ENSG00000102900	ENST00000308159;ENST00000542526	T;T	0.40225	1.04;1.04	5.53	5.53	0.82687	.	0.078415	0.85682	D	0.000000	T	0.24661	0.0598	N	0.08118	0	0.48452	D	0.999656	B	0.10296	0.003	B	0.14578	0.011	T	0.09552	-1.0669	10	0.15952	T	0.53	-15.9651	15.6915	0.77457	1.0:0.0:0.0:0.0	.	456	Q8N1F7	NUP93_HUMAN	S	456;333	ENSP00000310668:N456S;ENSP00000440235:N333S	ENSP00000310668:N456S	N	+	2	0	NUP93	55424649	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	5.315000	0.65810	2.107000	0.64212	0.533000	0.62120	AAC	.		0.562	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669	
OSBPL6	114880	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179226415	179226415	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:179226415C>G	ENST00000190611.4	+	13	1536	c.1160C>G	c.(1159-1161)tCt>tGt	p.S387C	OSBPL6_ENST00000315022.2_Missense_Mutation_p.S391C|OSBPL6_ENST00000359685.3_Missense_Mutation_p.S387C|OSBPL6_ENST00000392505.2_Missense_Mutation_p.S412C|OSBPL6_ENST00000409631.1_Missense_Mutation_p.S387C|OSBPL6_ENST00000357080.4_Missense_Mutation_p.S356C|OSBPL6_ENST00000409045.3_Missense_Mutation_p.S356C	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	387					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CCAGTGCATTCTCTTTTGAAG	0.413																																					p.S412C		.											.	OSBPL6	69	0			c.C1235G						.						101.0	97.0	98.0					2																	179226415		2203	4300	6503	SO:0001583	missense	114880	exon14			TGCATTCTCTTTT	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.1160C>G	2.37:g.179226415C>G	ENSP00000190611:p.Ser387Cys	Somatic	258.0	0.0		WXS	Illumina HiSeq	Phase_I	234.0	91.0	NM_001201480	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.087567	0.76642	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.14391	2.6;2.62;2.51;2.63;2.62;2.62;2.6	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.37210	0.0995	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;1.0;0.999;1.0;0.999;1.0	D;D;D;D;D;D	0.91635	0.96;0.999;0.987;0.999;0.993;0.997	T	0.01468	-1.1347	10	0.59425	D	0.04	-12.2188	19.6657	0.95891	0.0:1.0:0.0:0.0	.	356;391;387;412;387;356	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	C	412;387;356;356;387;387;391	ENSP00000376293:S412C;ENSP00000352713:S387C;ENSP00000349591:S356C;ENSP00000387248:S356C;ENSP00000190611:S387C;ENSP00000386885:S387C;ENSP00000318723:S391C	ENSP00000190611:S387C	S	+	2	0	OSBPL6	178934661	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.262000	0.72514	2.744000	0.94065	0.655000	0.94253	TCT	.		0.413	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
PBX4	80714	hgsc.bcm.edu;bcgsc.ca	37	19	19681414	19681414	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr19:19681414T>C	ENST00000251203.9	-	3	708	c.422A>G	c.(421-423)gAg>gGg	p.E141G		NM_025245.2	NP_079521.1	Q9BYU1	PBX4_HUMAN	pre-B-cell leukemia homeobox 4	141					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|XY body (GO:0001741)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(4)|ovary(1)|prostate(3)	9						TTTCTCTAGCTCAGAGTGGTA	0.483																																					p.E141G		.											.	PBX4	154	0			c.A422G						.						73.0	68.0	70.0					19																	19681414		2203	4300	6503	SO:0001583	missense	80714	exon3			TCTAGCTCAGAGT	AJ300182	CCDS12406.1	19p13.11	2014-09-11	2007-01-30		ENSG00000105717			"""Homeoboxes / TALE class"""	13403	protein-coding gene	gene with protein product		608127	"""pre-B-cell leukemia transcription factor 4"""				Standard	NM_025245		Approved		uc002nmy.3	Q9BYU1	OTTHUMG00000172310	ENST00000251203.9:c.422A>G	19.37:g.19681414T>C	ENSP00000251203:p.Glu141Gly	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	5.0	NM_025245	A5D8Y0|B3KUK9	Missense_Mutation	SNP	ENST00000251203.9	37	CCDS12406.1	.	.	.	.	.	.	.	.	.	.	T	19.16	3.773765	0.69992	.	.	ENSG00000105717	ENST00000251203	T	0.50813	0.73	3.47	3.47	0.39725	PBX (1);	0.000000	0.85682	D	0.000000	T	0.66829	0.2829	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.70669	-0.4808	10	0.87932	D	0	-15.0187	10.0195	0.42035	0.0:0.0:0.0:1.0	.	141	Q9BYU1	PBX4_HUMAN	G	141	ENSP00000251203:E141G	ENSP00000251203:E141G	E	-	2	0	PBX4	19542414	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.825000	0.75293	1.451000	0.47736	0.414000	0.27820	GAG	.		0.483	PBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417784.6		
PCF11	51585	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	82877693	82877693	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr11:82877693T>C	ENST00000298281.4	+	5	2206	c.1754T>C	c.(1753-1755)gTa>gCa	p.V585A		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	585					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AAGGAGAATGTAGAAAACTGG	0.393																																					p.V585A		.											.	PCF11	23	0			c.T1754C						.						67.0	66.0	66.0					11																	82877693		1815	4038	5853	SO:0001583	missense	51585	exon5			AGAATGTAGAAAA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1754T>C	11.37:g.82877693T>C	ENSP00000298281:p.Val585Ala	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	57.0	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	T	4.321	0.058962	0.08339	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.50548	1.75;0.74;0.76	6.07	6.07	0.98685	.	0.819345	0.10731	N	0.640597	T	0.28797	0.0714	N	0.08118	0	0.09310	N	0.999999	B;B	0.10296	0.003;0.0	B;B	0.04013	0.001;0.001	T	0.15578	-1.0432	9	.	.	.	.	11.1894	0.48677	0.0:0.0761:0.0:0.9239	.	585;585	E9PQ01;O94913	.;PCF11_HUMAN	A	585	ENSP00000298281:V585A;ENSP00000434540:V585A;ENSP00000431567:V585A	.	V	+	2	0	PCF11	82555341	1.000000	0.71417	0.653000	0.29593	0.954000	0.61252	4.381000	0.59587	2.326000	0.78906	0.533000	0.62120	GTA	.		0.393	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
PDZD7	79955	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	102777929	102777929	+	Silent	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr10:102777929G>A	ENST00000370215.3	-	9	1674	c.1449C>T	c.(1447-1449)gaC>gaT	p.D483D		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	483						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CTCTGCGCCCGTCCCGCGCTA	0.617																																					p.D483D		.											.	PDZD7	136	0			c.C1449T						.						81.0	77.0	79.0					10																	102777929		2203	4300	6503	SO:0001819	synonymous_variant	79955	exon9			GCGCCCGTCCCGC	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.1449C>T	10.37:g.102777929G>A		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	39.0	NM_001195263	D5FJ77|Q8N321	Silent	SNP	ENST00000370215.3	37	CCDS31269.1	.	.	.	.	.	.	.	.	.	.	G	0.204	-1.042112	0.01997	.	.	ENSG00000186862	ENST00000433616	.	.	.	4.12	-4.62	0.03370	.	.	.	.	.	T	0.35278	0.0926	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.34079	-0.9843	4	.	.	.	.	13.4053	0.60908	0.6497:0.0:0.3503:0.0	.	.	.	.	M	58	.	.	T	-	2	0	PDZD7	102767919	0.000000	0.05858	0.003000	0.11579	0.079000	0.17450	-1.754000	0.01816	-1.446000	0.01945	-1.164000	0.01763	ACG	.		0.617	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895	
PDCD11	22984	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	105174798	105174798	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr10:105174798G>A	ENST00000369797.3	+	12	1502	c.1408G>A	c.(1408-1410)Gtg>Atg	p.V470M		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	470	S1 motif 5. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TGGGATGCTGGTGAAGGTGGG	0.517																																					p.V470M		.											.	PDCD11	275	0			c.G1408A						.						109.0	92.0	98.0					10																	105174798		2203	4300	6503	SO:0001583	missense	22984	exon12			ATGCTGGTGAAGG	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.1408G>A	10.37:g.105174798G>A	ENSP00000358812:p.Val470Met	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	48.0	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656309	0.67586	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.71103	-0.54	5.35	2.44	0.29823	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.115848	0.64402	D	0.000018	D	0.84848	0.5563	H	0.95260	3.645	0.58432	D	0.999998	D	0.58268	0.982	P	0.59761	0.863	D	0.84585	0.0663	10	0.34782	T	0.22	-8.7672	11.3229	0.49433	0.0:0.1226:0.6225:0.2549	.	470	Q14690	RRP5_HUMAN	M	470	ENSP00000358812:V470M	ENSP00000358812:V470M	V	+	1	0	PDCD11	105164788	1.000000	0.71417	0.997000	0.53966	0.769000	0.43574	5.224000	0.65288	0.324000	0.23333	-0.183000	0.12914	GTG	.		0.517	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
PHF11	51131	hgsc.bcm.edu;bcgsc.ca	37	13	50098318	50098318	+	Silent	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr13:50098318A>G	ENST00000378319.3	+	8	776	c.735A>G	c.(733-735)ccA>ccG	p.P245P	PHF11_ENST00000488958.1_Silent_p.P206P|PHF11_ENST00000357596.3_Silent_p.P206P	NM_001040443.1	NP_001035533.1	Q9UIL8	PHF11_HUMAN	PHD finger protein 11	245					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(3)|lung(1)	4		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		ATTCAATTCCAGAAAAACTCA	0.333																																					p.P245P		.											.	PHF11	90	0			c.A735G						.						51.0	55.0	54.0					13																	50098318		2203	4296	6499	SO:0001819	synonymous_variant	51131	exon8			AATTCCAGAAAAA	AB011031	CCDS31975.1, CCDS41887.1	13q14.11	2014-05-20			ENSG00000136147	ENSG00000136147		"""Zinc fingers, PHD-type"""	17024	protein-coding gene	gene with protein product	"""IgE responsiveness (atopic)"""	607796				10508479, 15057823	Standard	XM_005266417		Approved	NY-REN-34, BCAP, IGER	uc001vdb.3	Q9UIL8	OTTHUMG00000016916	ENST00000378319.3:c.735A>G	13.37:g.50098318A>G		Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	4.0	NM_001040443	Q5W0A4|Q5W0A6|Q9Y5A2	Silent	SNP	ENST00000378319.3	37	CCDS31975.1	.	.	.	.	.	.	.	.	.	.	A	0.020	-1.433803	0.01108	.	.	ENSG00000136147	ENST00000426879	.	.	.	4.27	-8.53	0.00916	.	.	.	.	.	T	0.14743	0.0356	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.20672	-1.0268	4	.	.	.	-1.7604	1.0353	0.01547	0.2341:0.1021:0.3428:0.321	.	.	.	.	R	200	.	.	Q	+	2	0	PHF11	48996319	0.020000	0.18652	0.001000	0.08648	0.000000	0.00434	-0.837000	0.04377	-1.470000	0.01888	-1.286000	0.01371	CAG	.		0.333	PHF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044915.1	NM_016119	
PHKA1	5255	hgsc.bcm.edu;bcgsc.ca	37	X	71873287	71873287	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chrX:71873287T>C	ENST00000373542.4	-	11	1294	c.1135A>G	c.(1135-1137)Agg>Ggg	p.R379G	PHKA1_ENST00000339490.3_Missense_Mutation_p.R379G|PHKA1_ENST00000541944.1_Missense_Mutation_p.R379G|PHKA1_ENST00000373539.3_Missense_Mutation_p.R379G|PHKA1_ENST00000373545.3_Missense_Mutation_p.R379G	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	379					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TGACTCACCCTGTCAGGAGGA	0.428																																					p.R379G		.											.	PHKA1	134	0			c.A1135G						.						81.0	65.0	70.0					X																	71873287		2203	4300	6503	SO:0001583	missense	5255	exon11			TCACCCTGTCAGG		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1135A>G	X.37:g.71873287T>C	ENSP00000362643:p.Arg379Gly	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	4.0	NM_001172436	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	T	15.44	2.833627	0.50951	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68;-2.68	5.08	5.08	0.68730	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.047373	0.85682	D	0.000000	D	0.84284	0.5438	L	0.29908	0.895	0.41772	D	0.989773	B;B;B	0.22851	0.03;0.014;0.076	B;B;B	0.25759	0.027;0.023;0.063	T	0.79626	-0.1725	10	0.24483	T	0.36	-19.5286	11.8025	0.52135	0.0:0.0:0.0:1.0	.	379;379;379	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	G	379	ENSP00000362646:R379G;ENSP00000362643:R379G;ENSP00000441251:R379G;ENSP00000342469:R379G;ENSP00000362640:R379G	ENSP00000342469:R379G	R	-	1	2	PHKA1	71790012	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	5.416000	0.66417	1.688000	0.51068	0.430000	0.28490	AGG	.		0.428	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
PICK1	9463	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	38470994	38470994	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr22:38470994C>T	ENST00000404072.3	+	13	1450	c.1103C>T	c.(1102-1104)aCa>aTa	p.T368I	RP5-1039K5.13_ENST00000445483.1_RNA|PICK1_ENST00000356976.3_Missense_Mutation_p.T368I	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	368					ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					GCGCACACCACATTGGCCTAT	0.617																																					p.T368I		.											.	PICK1	226	0			c.C1103T						.						84.0	63.0	70.0					22																	38470994		2203	4300	6503	SO:0001583	missense	9463	exon13			ACACCACATTGGC	AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.1103C>T	22.37:g.38470994C>T	ENSP00000385205:p.Thr368Ile	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	46.0	NM_012407	B3KS52|O95906	Missense_Mutation	SNP	ENST00000404072.3	37	CCDS13965.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.863168	0.32884	.	.	ENSG00000100151	ENST00000404072;ENST00000356976	T;T	0.31510	1.49;1.49	4.33	3.21	0.36854	.	0.147994	0.64402	D	0.000013	T	0.24509	0.0594	L	0.47716	1.5	0.37753	D	0.926044	B	0.34103	0.437	B	0.27076	0.076	T	0.23547	-1.0185	10	0.32370	T	0.25	-16.1603	13.831	0.63380	0.0:0.8456:0.1544:0.0	.	368	Q9NRD5	PICK1_HUMAN	I	368	ENSP00000385205:T368I;ENSP00000349465:T368I	ENSP00000349465:T368I	T	+	2	0	PICK1	36800940	0.937000	0.31787	1.000000	0.80357	0.634000	0.38068	2.210000	0.42816	2.124000	0.65301	0.561000	0.74099	ACA	.		0.617	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321569.2	NM_012407	
PLA2G12B	84647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	74702445	74702445	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr10:74702445C>A	ENST00000373032.3	-	2	357	c.265G>T	c.(265-267)Ggc>Tgc	p.G89C		NM_032562.2	NP_115951.2	Q9BX93	PG12B_HUMAN	phospholipase A2, group XIIB	89					cholesterol homeostasis (GO:0042632)|lipid catabolic process (GO:0016042)|triglyceride homeostasis (GO:0070328)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	9	Prostate(51;0.0198)					AAATAGGAGCCGCAGCCATTG	0.468																																					p.G89C		.											.	PLA2G12B	91	0			c.G265T						.						49.0	49.0	49.0					10																	74702445		2203	4300	6503	SO:0001583	missense	84647	exon2			AGGAGCCGCAGCC	AF349540	CCDS7319.1	10q22.1	2008-09-19	2004-01-13	2004-01-14	ENSG00000138308	ENSG00000138308	3.1.1.4		18555	protein-coding gene	gene with protein product		611653	"""phospholipase A2, group XIII"""	PLA2G13			Standard	NM_032562		Approved		uc001jtf.1	Q9BX93	OTTHUMG00000018446	ENST00000373032.3:c.265G>T	10.37:g.74702445C>A	ENSP00000362123:p.Gly89Cys	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	27.0	NM_032562	B7ZL23|Q52LB2|Q96Q99	Missense_Mutation	SNP	ENST00000373032.3	37	CCDS7319.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595133	0.66219	.	.	ENSG00000138308	ENST00000373032	.	.	.	5.17	1.18	0.20946	Phospholipase A2 (1);	0.114987	0.85682	D	0.000000	T	0.58424	0.2121	L	0.56280	1.765	0.36214	D	0.851564	P;D	0.55172	0.949;0.97	P;P	0.57846	0.828;0.776	T	0.64525	-0.6387	9	0.87932	D	0	-8.8295	9.261	0.37612	0.0:0.2118:0.0:0.7882	.	89;89	B7ZL23;Q9BX93	.;PG12B_HUMAN	C	89	.	ENSP00000362123:G89C	G	-	1	0	PLA2G12B	74372451	1.000000	0.71417	0.999000	0.59377	0.936000	0.57629	1.490000	0.35573	0.046000	0.15833	-0.459000	0.05422	GGC	.		0.468	PLA2G12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048598.1	NM_032562	
PLCZ1	89869	hgsc.bcm.edu;bcgsc.ca	37	12	18872429	18872429	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr12:18872429A>G	ENST00000266505.7	-	5	768	c.505T>C	c.(505-507)Tca>Cca	p.S169P	PLCZ1_ENST00000435379.1_Intron|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000539875.1_Intron|PLCZ1_ENST00000447925.2_Missense_Mutation_p.S167P|PLCZ1_ENST00000541695.1_Missense_Mutation_p.S32P					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					GTGTTATGTGAAGATGAAATA	0.264																																					p.S169P		.											.	PLCZ1	228	0			c.T505C						.						56.0	58.0	57.0					12																	18872429		2202	4289	6491	SO:0001583	missense	89869	exon5			TATGTGAAGATGA	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000266505.7:c.505T>C	12.37:g.18872429A>G	ENSP00000266505:p.Ser169Pro	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_033123		Missense_Mutation	SNP	ENST00000266505.7	37	CCDS8680.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443784	0.83993	.	.	ENSG00000139151	ENST00000266505;ENST00000447925;ENST00000541695;ENST00000541966	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.28	5.28	0.74379	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.64402	D	0.000001	D	0.86973	0.6062	H	0.98407	4.225	0.54753	D	0.999988	D	0.89917	1.0	D	0.97110	1.0	D	0.91848	0.5489	10	0.87932	D	0	.	14.3734	0.66857	1.0:0.0:0.0:0.0	.	169	Q86YW0	PLCZ1_HUMAN	P	169;167;32;65	ENSP00000266505:S169P;ENSP00000402358:S167P;ENSP00000443349:S32P;ENSP00000444383:S65P	ENSP00000266505:S169P	S	-	1	0	PLCZ1	18763696	1.000000	0.71417	0.993000	0.49108	0.937000	0.57800	8.664000	0.91139	1.994000	0.58287	0.482000	0.46254	TCA	.		0.264	PLCZ1-001	KNOWN	NAGNAG_splice_site|non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401667.3	NM_033123	
PNLIPRP3	119548	hgsc.bcm.edu;bcgsc.ca	37	10	118231366	118231366	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr10:118231366A>G	ENST00000369230.3	+	10	1293	c.1147A>G	c.(1147-1149)Aaa>Gaa	p.K383E		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	383	PLAT.				lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		GGCAGTTAGGAAAACTGGGGA	0.483																																					p.K383E		.											.	PNLIPRP3	91	0			c.A1147G						.						128.0	136.0	133.0					10																	118231366		2203	4300	6503	SO:0001583	missense	119548	exon10			GTTAGGAAAACTG	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.1147A>G	10.37:g.118231366A>G	ENSP00000358232:p.Lys383Glu	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	6.0	NM_001011709		Missense_Mutation	SNP	ENST00000369230.3	37	CCDS31292.1	.	.	.	.	.	.	.	.	.	.	A	12.17	1.858868	0.32884	.	.	ENSG00000203837	ENST00000369230	T	0.64991	-0.13	4.18	1.81	0.25067	Lipoxygenase, LH2 (2);Lipase/lipooxygenase, PLAT/LH2 (1);	0.871930	0.09589	N	0.781766	T	0.54838	0.1883	L	0.47716	1.5	0.09310	N	1	B	0.16396	0.017	B	0.26614	0.071	T	0.51426	-0.8707	10	0.62326	D	0.03	.	6.8165	0.23833	0.8008:0.0:0.1992:0.0	.	383	Q17RR3	LIPR3_HUMAN	E	383	ENSP00000358232:K383E	ENSP00000358232:K383E	K	+	1	0	PNLIPRP3	118221356	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.003000	0.12901	0.252000	0.21531	0.482000	0.46254	AAA	.		0.483	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404	
POLR2A	5430	hgsc.bcm.edu;bcgsc.ca	37	17	7416095	7416095	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:7416095A>G	ENST00000322644.6	+	28	5008	c.4609A>G	c.(4609-4611)Agt>Ggt	p.S1537G		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1537					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				CTCTATAGGGAGTGGAATGAC	0.622																																					p.S1537G		.											.	POLR2A	91	0			c.A4609G						.						64.0	74.0	71.0					17																	7416095		2203	4300	6503	SO:0001583	missense	5430	exon28			ATAGGGAGTGGAA			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.4609A>G	17.37:g.7416095A>G	ENSP00000314949:p.Ser1537Gly	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	4.0	NM_000937	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	A	8.797	0.931934	0.18131	.	.	ENSG00000181222	ENST00000535204;ENST00000545644;ENST00000322644	T	0.71103	-0.54	4.04	4.04	0.47022	.	0.822365	0.10722	N	0.641652	T	0.53594	0.1806	N	0.11201	0.11	0.80722	D	1	B	0.15719	0.014	B	0.15484	0.013	T	0.47142	-0.9140	10	0.44086	T	0.13	-2.128	12.4264	0.55548	1.0:0.0:0.0:0.0	.	1537	P24928	RPB1_HUMAN	G	1493;436;1537	ENSP00000314949:S1537G	ENSP00000314949:S1537G	S	+	1	0	SLC35G6	7356819	1.000000	0.71417	0.992000	0.48379	0.254000	0.26022	8.174000	0.89682	1.819000	0.53055	0.374000	0.22700	AGT	.		0.622	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
PRAME	23532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	22892685	22892685	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr22:22892685T>C	ENST00000398741.1	-	5	722	c.416A>G	c.(415-417)aAc>aGc	p.N139S	PRAME_ENST00000543184.1_Missense_Mutation_p.N139S|PRAME_ENST00000398743.2_Missense_Mutation_p.N139S|PRAME_ENST00000405655.3_Missense_Mutation_p.N139S|PRAME_ENST00000539862.1_Missense_Mutation_p.N123S|PRAME_ENST00000424204.2_Missense_Mutation_p.N123S|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000402697.1_Missense_Mutation_p.N139S	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	139					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		ACTGGCCCTGTTTCCAGACCA	0.493																																					p.N139S	Melanoma(73;1707 1838 15168 27201)	.											.	PRAME	515	0			c.A416G						.						77.0	72.0	74.0					22																	22892685		2203	4300	6503	SO:0001583	missense	23532	exon5			GCCCTGTTTCCAG	U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.416A>G	22.37:g.22892685T>C	ENSP00000381726:p.Asn139Ser	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	21.0	NM_206954	B2R6Y7|O43481|Q8IXN8	Missense_Mutation	SNP	ENST00000398741.1	37	CCDS13801.1	.	.	.	.	.	.	.	.	.	.	.	0.809	-0.752527	0.03041	.	.	ENSG00000185686	ENST00000398743;ENST00000543184;ENST00000398741;ENST00000405655;ENST00000539862;ENST00000402697;ENST00000424204;ENST00000439106;ENST00000420709	T;T;T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9;0.9;2.56;2.56	3.02	-0.399	0.12415	.	1.549960	0.03983	N	0.293671	T	0.12774	0.0310	N	0.00462	-1.47	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.11817	-1.0572	10	0.27785	T	0.31	.	3.8691	0.09029	0.1273:0.0:0.4273:0.4454	.	139	P78395	PRAME_HUMAN	S	139;139;139;139;123;139;123;139;139	ENSP00000381728:N139S;ENSP00000445675:N139S;ENSP00000381726:N139S;ENSP00000384343:N139S;ENSP00000445097:N123S;ENSP00000385198:N139S;ENSP00000407342:N123S;ENSP00000407320:N139S;ENSP00000412318:N139S	ENSP00000381726:N139S	N	-	2	0	PRAME	21222685	0.000000	0.05858	0.001000	0.08648	0.036000	0.12997	-1.283000	0.02796	-0.012000	0.14223	-0.396000	0.06452	AAC	.		0.493	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321644.1	NM_206953	
PSAT1	29968	hgsc.bcm.edu;bcgsc.ca	37	9	80923403	80923403	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr9:80923403A>G	ENST00000376588.3	+	6	712	c.644A>G	c.(643-645)gAc>gGc	p.D215G	PSAT1_ENST00000347159.2_Missense_Mutation_p.D215G	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	215					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						GTCCGTGATGACCTGCTGGGG	0.517																																					p.D215G	Colon(34;187 791 10662 18313 37609)	.											.	PSAT1	91	0			c.A644G						.						141.0	119.0	127.0					9																	80923403		2203	4300	6503	SO:0001583	missense	29968	exon6			GTGATGACCTGCT	BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.644A>G	9.37:g.80923403A>G	ENSP00000365773:p.Asp215Gly	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	6.0	NM_021154	Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Missense_Mutation	SNP	ENST00000376588.3	37	CCDS6660.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.929233	0.92389	.	.	ENSG00000135069	ENST00000421149;ENST00000347159;ENST00000376588	T;T	0.65732	-0.17;-0.17	5.59	5.59	0.84812	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.83083	0.5177	M	0.91717	3.235	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.73380	0.945;0.98	D	0.87222	0.2254	10	0.87932	D	0	-13.1243	15.7658	0.78126	1.0:0.0:0.0:0.0	.	215;215	Q9Y617-2;Q9Y617	.;SERC_HUMAN	G	39;215;215	ENSP00000317606:D215G;ENSP00000365773:D215G	ENSP00000317606:D215G	D	+	2	0	PSAT1	80113223	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.899000	0.92544	2.131000	0.65755	0.455000	0.32223	GAC	.		0.517	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052777.1	NM_021154	
PTPN5	84867	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18763990	18763990	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr11:18763990G>A	ENST00000358540.2	-	7	974	c.544C>T	c.(544-546)Cgc>Tgc	p.R182C	PTPN5_ENST00000396170.1_Missense_Mutation_p.R150C|PTPN5_ENST00000396171.4_Missense_Mutation_p.R182C|PTPN5_ENST00000496201.2_5'UTR|PTPN5_ENST00000477854.1_5'UTR|PTPN5_ENST00000396167.2_Missense_Mutation_p.R150C|PTPN5_ENST00000396168.1_Missense_Mutation_p.R158C|RP11-1081L13.4_ENST00000527285.1_RNA	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	182					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						ACTGACTGGCGCCTGTCCTCA	0.632																																					p.R182C		.											.	PTPN5	229	0			c.C544T						.						47.0	50.0	49.0					11																	18763990		2199	4293	6492	SO:0001583	missense	84867	exon7			ACTGGCGCCTGTC	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.544C>T	11.37:g.18763990G>A	ENSP00000351342:p.Arg182Cys	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	60.0	NM_032781	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	37	CCDS7845.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699138	0.88830	.	.	ENSG00000110786	ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T	0.05025	3.51;3.68;3.51;3.68;3.54	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.15565	0.0375	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.02797	-1.1109	10	0.87932	D	0	.	16.3618	0.83270	0.0:0.0:1.0:0.0	.	182;150	P54829;B3KXG7	PTN5_HUMAN;.	C	182;150;182;150;158	ENSP00000351342:R182C;ENSP00000379473:R150C;ENSP00000379474:R182C;ENSP00000379470:R150C;ENSP00000379471:R158C	ENSP00000351342:R182C	R	-	1	0	PTPN5	18720566	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.080000	0.94040	2.290000	0.77057	0.561000	0.74099	CGC	.		0.632	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970	
PUM1	9698	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	31441332	31441332	+	Missense_Mutation	SNP	C	C	T	rs551662997		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:31441332C>T	ENST00000257075.5	-	11	1607	c.1514G>A	c.(1513-1515)cGt>cAt	p.R505H	PUM1_ENST00000373741.4_Missense_Mutation_p.R541H|PUM1_ENST00000424085.2_Missense_Mutation_p.R263H|PUM1_ENST00000426105.2_Missense_Mutation_p.R505H|PUM1_ENST00000423018.2_Missense_Mutation_p.R409H|PUM1_ENST00000373742.2_Missense_Mutation_p.R446H|PUM1_ENST00000373747.3_Missense_Mutation_p.R506H|PUM1_ENST00000490546.1_5'UTR|SNORD85_ENST00000363311.1_RNA|PUM1_ENST00000440538.2_Missense_Mutation_p.R506H	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	505	Ala-rich.|Gln-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GGCTCCTCCACGGAGAACCTG	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		19035	0.0		0.0	False		,,,				2504	0.001				p.R505H		.											.	PUM1	92	0			c.G1514A						.						89.0	83.0	85.0					1																	31441332		2203	4300	6503	SO:0001583	missense	9698	exon11			CCTCCACGGAGAA	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.1514G>A	1.37:g.31441332C>T	ENSP00000257075:p.Arg505His	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	22.0	NM_014676	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	37	CCDS338.1	.	.	.	.	.	.	.	.	.	.	C	36	5.706510	0.96821	.	.	ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742	T;T;T;T;T;T;T;T	0.25579	1.94;1.92;2.04;2.04;1.99;2.02;2.24;1.79	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.52158	0.1717	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.998;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.83275	0.996;0.976;0.996;0.989;0.996;0.996;0.996;0.996	T	0.47623	-0.9103	10	0.72032	D	0.01	-7.3314	20.3627	0.98863	0.0:1.0:0.0:0.0	.	446;409;541;506;505;505;506;505	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.;.;.;.;PUM1_HUMAN;.;.;.	H	263;505;506;243;505;506;541;409;446	ENSP00000400141:R263H;ENSP00000257075:R505H;ENSP00000362852:R506H;ENSP00000391723:R505H;ENSP00000401777:R506H;ENSP00000362846:R541H;ENSP00000399440:R409H;ENSP00000362847:R446H	ENSP00000257075:R505H	R	-	2	0	PUM1	31213919	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.701000	0.84566	2.885000	0.99019	0.655000	0.94253	CGT	.		0.493	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
PZP	5858	hgsc.bcm.edu;bcgsc.ca	37	12	9349247	9349247	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr12:9349247T>C	ENST00000261336.2	-	9	930	c.902A>G	c.(901-903)cAc>cGc	p.H301R	PZP_ENST00000381997.2_Missense_Mutation_p.H170R	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	301					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						CATTTTGGTGTGTACTTGTTG	0.398																																					p.H301R	Melanoma(125;1402 1695 4685 34487 38571)	.											.	PZP	157	0			c.A902G						.						146.0	141.0	143.0					12																	9349247		2203	4300	6503	SO:0001583	missense	5858	exon9			TTGGTGTGTACTT	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.902A>G	12.37:g.9349247T>C	ENSP00000261336:p.His301Arg	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	T	5.429	0.264282	0.10294	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.32753	1.64;1.44	3.57	2.4	0.29515	.	0.940200	0.08770	N	0.896414	T	0.10937	0.0267	N	0.01352	-0.895	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.26258	-1.0108	10	0.34782	T	0.22	.	5.8195	0.18520	0.0:0.1321:0.0:0.8679	.	170;301	P20742-2;P20742	.;PZP_HUMAN	R	301;170	ENSP00000261336:H301R;ENSP00000371427:H170R	ENSP00000261336:H301R	H	-	2	0	PZP	9240514	0.003000	0.15002	0.016000	0.15963	0.006000	0.05464	0.144000	0.16135	0.546000	0.28920	0.374000	0.22700	CAC	.		0.398	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
RAD23B	5887	hgsc.bcm.edu;bcgsc.ca	37	9	110091920	110091920	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr9:110091920A>G	ENST00000358015.3	+	10	1564	c.1213A>G	c.(1213-1215)Aac>Gac	p.N405D	RAD23B_ENST00000416373.2_Missense_Mutation_p.N333D	NM_001244713.1|NM_002874.4	NP_001231642.1|NP_002865.1	P54727	RD23B_HUMAN	RAD23 homolog B (S. cerevisiae)	405					DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|XPC complex (GO:0071942)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)			breast(3)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						TCTACAGCAGAACTTTGATGA	0.398								Direct reversal of damage;Nucleotide excision repair (NER)																													p.N405D		.											.	RAD23B	228	0			c.A1213G						.						77.0	77.0	77.0					9																	110091920		2203	4300	6503	SO:0001583	missense	5887	exon10			CAGCAGAACTTTG		CCDS6769.1, CCDS59138.1	9q31.2	2008-07-21	2001-11-28		ENSG00000119318	ENSG00000119318			9813	protein-coding gene	gene with protein product	"""XP-C repair complementing protein"", ""XP-C repair complementing complex 58 kDa"""	600062	"""RAD23 (S. cerevisiae) homolog B"""			7851894, 8168482	Standard	NM_002874		Approved	HHR23B, P58, HR23B	uc004bde.3	P54727	OTTHUMG00000020446	ENST00000358015.3:c.1213A>G	9.37:g.110091920A>G	ENSP00000350708:p.Asn405Asp	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_002874	B3KWK8|G5E9P0|Q7Z5K8|Q8WUB0	Missense_Mutation	SNP	ENST00000358015.3	37	CCDS6769.1	.	.	.	.	.	.	.	.	.	.	A	16.99	3.272855	0.59649	.	.	ENSG00000119318	ENST00000358015;ENST00000416373	T;T	0.55052	0.54;0.54	4.85	4.85	0.62838	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.62356	0.2421	L	0.38531	1.155	0.80722	D	1	D;P	0.63880	0.993;0.609	D;B	0.70935	0.971;0.168	T	0.64106	-0.6485	10	0.51188	T	0.08	-2.3866	14.7172	0.69277	1.0:0.0:0.0:0.0	.	384;405	B7Z4W4;P54727	.;RD23B_HUMAN	D	405;333	ENSP00000350708:N405D;ENSP00000405623:N333D	ENSP00000350708:N405D	N	+	1	0	RAD23B	109131741	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.943000	0.63554	1.942000	0.56320	0.460000	0.39030	AAC	.		0.398	RAD23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053548.1	NM_002874	
RAI1	10743	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	17700882	17700882	+	Silent	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:17700882C>A	ENST00000353383.1	+	3	5089	c.4620C>A	c.(4618-4620)ctC>ctA	p.L1540L	RAI1_ENST00000261641.6_Silent_p.L1540L	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1540					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		GGAAGCGCCTCACTCGGGGCC	0.667																																					p.L1540L		.											.	RAI1	91	0			c.C4620A						.						57.0	69.0	65.0					17																	17700882		2203	4300	6503	SO:0001819	synonymous_variant	10743	exon3			GCGCCTCACTCGG	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.4620C>A	17.37:g.17700882C>A		Somatic	227.0	0.0		WXS	Illumina HiSeq	Phase_I	256.0	87.0	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	ENST00000353383.1	37	CCDS11188.1																																																																																			.		0.667	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
RAP1GDS1	5910	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	99313179	99313179	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr4:99313179T>C	ENST00000408927.3	+	6	698	c.585T>C	c.(583-585)aaT>aaC	p.N195N	RAP1GDS1_ENST00000264572.7_Intron|RAP1GDS1_ENST00000408900.3_Silent_p.N146N|RAP1GDS1_ENST00000453712.2_Silent_p.N196N|RAP1GDS1_ENST00000339360.5_Silent_p.N196N|RAP1GDS1_ENST00000380158.4_Silent_p.N147N	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	195					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		ACTGCCAAAATGCAGCTCTTA	0.348			T	NUP98	T-ALL																																p.N196N		.		Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	.	RAP1GDS1	660	0			c.T588C						.						101.0	97.0	98.0					4																	99313179		1847	4080	5927	SO:0001819	synonymous_variant	5910	exon6			CCAAAATGCAGCT		CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.585T>C	4.37:g.99313179T>C		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	31.0	NM_001100426	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Silent	SNP	ENST00000408927.3	37	CCDS43253.1	.	.	.	.	.	.	.	.	.	.	T	10.10	1.256495	0.22965	.	.	ENSG00000138698	ENST00000509501	.	.	.	5.75	3.3	0.37823	.	.	.	.	.	T	0.57888	0.2084	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53373	-0.8448	4	.	.	.	-18.1237	8.3318	0.32191	0.0:0.2137:0.0:0.7863	.	.	.	.	R	47	.	.	C	+	1	0	RAP1GDS1	99532202	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.469000	0.35343	0.966000	0.38159	0.374000	0.22700	TGC	.		0.348	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363273.2	NM_001100426	
RETSAT	54884	hgsc.bcm.edu;bcgsc.ca	37	2	85578072	85578072	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:85578072T>C	ENST00000295802.4	-	3	540	c.428A>G	c.(427-429)cAg>cGg	p.Q143R	RETSAT_ENST00000263854.6_Missense_Mutation_p.Q143R|RETSAT_ENST00000457495.2_Missense_Mutation_p.Q82R	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	143					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	CCAGTCCAGCTGCCCTTCAGT	0.517																																					p.Q143R		.											.	RETSAT	70	0			c.A428G						.						70.0	68.0	69.0					2																	85578072		2203	4300	6503	SO:0001583	missense	54884	exon3			TCCAGCTGCCCTT	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.428A>G	2.37:g.85578072T>C	ENSP00000295802:p.Gln143Arg	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	7.0	NM_017750	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	CCDS1972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	33|33	5.205535|5.205535	0.95033|0.95033	.|.	.|.	ENSG00000042445|ENSG00000042445	ENST00000295802;ENST00000263854;ENST00000457495|ENST00000409984	T;T|.	0.58358|.	2.0;0.34|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77658|0.77658	0.4163|0.4163	M|M	0.83384|0.83384	2.64|2.64	0.58432|0.58432	D|D	0.999999|0.999999	P;P|.	0.46784|.	0.537;0.884|.	B;B|.	0.43155|.	0.236;0.41|.	T|T	0.79460|0.79460	-0.1794|-0.1794	9|5	.|.	.|.	.|.	-25.9613|-25.9613	14.4967|14.4967	0.67694|0.67694	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	82;143|.	G5E9N3;Q6NUM9|.	.;RETST_HUMAN|.	R|G	143;143;82|82	ENSP00000295802:Q143R;ENSP00000405040:Q82R|.	.|.	Q|S	-|-	2|1	0|0	RETSAT|RETSAT	85431583|85431583	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.914000|7.914000	0.87478|0.87478	2.311000|2.311000	0.77944|0.77944	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.		0.517	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750	
RIPK3	11035	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	14	24805506	24805506	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr14:24805506C>T	ENST00000216274.5	-	10	1650	c.1432G>A	c.(1432-1434)Ggc>Agc	p.G478S	RIPK3_ENST00000554338.1_5'Flank|ADCY4_ENST00000396747.3_5'Flank|ADCY4_ENST00000418030.2_5'Flank|ADCY4_ENST00000310677.4_5'Flank|ADCY4_ENST00000554068.2_5'Flank|ADCY4_ENST00000558563.1_5'Flank|RP11-934B9.3_ENST00000555591.1_Intron	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	478					activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		GGTGCCAAGCCCCATGTGGGC	0.567																																					p.G478S	Pancreas(58;918 1191 4668 13304 15331)	.											.	RIPK3	946	0			c.G1432A						.						89.0	91.0	90.0					14																	24805506		2203	4300	6503	SO:0001583	missense	11035	exon10			CCAAGCCCCATGT	AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.1432G>A	14.37:g.24805506C>T	ENSP00000216274:p.Gly478Ser	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	38.0	NM_006871	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Missense_Mutation	SNP	ENST00000216274.5	37	CCDS9628.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.524751	0.44969	.	.	ENSG00000129465	ENST00000216274	T	0.77098	-1.07	4.2	-2.27	0.06846	.	1.815640	0.02715	N	0.113376	T	0.62539	0.2436	L	0.27053	0.805	0.09310	N	1	B	0.26363	0.147	B	0.18263	0.021	T	0.43653	-0.9378	10	0.29301	T	0.29	1.2926	5.4134	0.16360	0.0:0.2791:0.4437:0.2772	.	478	Q9Y572	RIPK3_HUMAN	S	478	ENSP00000216274:G478S	ENSP00000216274:G478S	G	-	1	0	RIPK3	23875346	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.006000	0.03671	-0.484000	0.06763	-0.176000	0.13171	GGC	.		0.567	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871	
RNASEL	6041	ucsc.edu;bcgsc.ca	37	1	182550475	182550475	+	Missense_Mutation	SNP	C	C	T	rs375872977		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:182550475C>T	ENST00000367559.3	-	5	2043	c.1790G>A	c.(1789-1791)cGg>cAg	p.R597Q	RNASEL_ENST00000539397.1_Missense_Mutation_p.R597Q|RNASEL_ENST00000444138.1_Missense_Mutation_p.R597Q	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	597	KEN. {ECO:0000255|PROSITE- ProRule:PRU00725}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						TCCCACATTCCGAAGCGTCCT	0.413																																					p.R597Q		.											.	RNASEL	336	0			c.G1790A						.	C	GLN/ARG	0,4406		0,0,2203	210.0	199.0	203.0		1790	5.4	0.1	1		203	1,8599	1.2+/-3.3	0,1,4299	no	missense	RNASEL	NM_021133.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	597/742	182550475	1,13005	2203	4300	6503	SO:0001583	missense	6041	exon5			ACATTCCGAAGCG	L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1790G>A	1.37:g.182550475C>T	ENSP00000356530:p.Arg597Gln	Somatic	157.0	1.0		WXS	Illumina HiSeq	.	268.0	44.0	NM_021133	Q5W0L2|Q6AI46	Missense_Mutation	SNP	ENST00000367559.3	37	CCDS1347.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298078	0.81025	0.0	1.16E-4	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	T;T;T	0.30981	1.51;1.51;1.51	5.4	5.4	0.78164	KEN domain, ribonuclease activator (2);	0.221665	0.29444	N	0.012140	T	0.57917	0.2086	M	0.80982	2.52	0.09310	N	0.999992	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.55127	-0.8189	10	0.66056	D	0.02	-19.9812	14.6533	0.68814	0.0:1.0:0.0:0.0	.	597;597	Q6AI46;Q05823	.;RN5A_HUMAN	Q	597	ENSP00000356530:R597Q;ENSP00000411147:R597Q;ENSP00000440844:R597Q	ENSP00000356530:R597Q	R	-	2	0	RNASEL	180817098	0.003000	0.15002	0.129000	0.21949	0.929000	0.56500	1.396000	0.34531	2.527000	0.85204	0.650000	0.86243	CGG	.		0.413	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085189.1	NM_021133	
RNF121	55298	hgsc.bcm.edu;bcgsc.ca	37	11	71671841	71671841	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr11:71671841T>C	ENST00000361756.3	+	3	508	c.147T>C	c.(145-147)gcT>gcC	p.A49A	RNF121_ENST00000530137.1_Silent_p.A17A|RNF121_ENST00000545854.1_5'UTR|RNF121_ENST00000490867.1_3'UTR|RNF121_ENST00000393713.3_Silent_p.A17A|RNF121_ENST00000533380.1_Silent_p.A17A	NM_018320.4	NP_060790.2	Q9H920	RN121_HUMAN	ring finger protein 121	49						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|urinary_tract(1)	13						GCCATGAAGCTATGCATGCTG	0.552																																					p.A49A		.											.	RNF121	226	0			c.T147C						.						143.0	102.0	116.0					11																	71671841		2200	4293	6493	SO:0001819	synonymous_variant	55298	exon3			TGAAGCTATGCAT	AK001961	CCDS8203.1, CCDS73343.1	11q13.3	2008-02-05			ENSG00000137522	ENSG00000137522		"""RING-type (C3HC4) zinc fingers"""	21070	protein-coding gene	gene with protein product							Standard	NM_018320		Approved	FLJ11099	uc001ora.3	Q9H920	OTTHUMG00000157023	ENST00000361756.3:c.147T>C	11.37:g.71671841T>C		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	5.0	NM_018320	B3KSW8|Q6IA57|Q6P449|Q96DB4	Silent	SNP	ENST00000361756.3	37	CCDS8203.1																																																																																			.		0.552	RNF121-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347132.1	NM_018320	
RPL11	6135	hgsc.bcm.edu;bcgsc.ca	37	1	24022333	24022333	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:24022333A>G	ENST00000374550.3	+	5	487	c.442A>G	c.(442-444)Aca>Gca	p.T148A	RPL11_ENST00000482370.1_3'UTR	NM_000975.3|NM_001199802.1	NP_000966.2|NP_001186731.1	P62913	RL11_HUMAN	ribosomal protein L11	148					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein localization to nucleus (GO:0034504)|protein targeting (GO:0006605)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		GAAGCGCAGGACAGGCTGCAT	0.527																																					p.T148A		.											.	RPL11	226	0			c.A442G						.						73.0	62.0	66.0					1																	24022333		2202	4299	6501	SO:0001583	missense	6135	exon5			CGCAGGACAGGCT	L05092	CCDS238.1	1p36.1-p35	2011-04-06			ENSG00000142676	ENSG00000142676		"""L ribosomal proteins"""	10301	protein-coding gene	gene with protein product		604175				9582194, 10343117	Standard	NM_000975		Approved	L11	uc001bhk.3	P62913	OTTHUMG00000002926	ENST00000374550.3:c.442A>G	1.37:g.24022333A>G	ENSP00000363676:p.Thr148Ala	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	7.0	NM_000975	P25121|P39026|Q8TDH2|Q9Y674	Missense_Mutation	SNP	ENST00000374550.3	37	CCDS238.1	.	.	.	.	.	.	.	.	.	.	A	16.93	3.257612	0.59321	.	.	ENSG00000142676	ENST00000374550;ENST00000458455	T;T	0.74632	-0.86;-0.86	5.7	5.7	0.88788	Ribosomal protein L5 domain (2);	0.102168	0.64402	D	0.000003	T	0.71065	0.3296	L	0.52823	1.66	0.50467	D	0.999872	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.66567	-0.5891	10	0.41790	T	0.15	-12.3044	15.9514	0.79843	1.0:0.0:0.0:0.0	.	147;148	P62913-2;P62913	.;RL11_HUMAN	A	148;146	ENSP00000363676:T148A;ENSP00000398888:T146A	ENSP00000363676:T148A	T	+	1	0	RPL11	23894920	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.779000	0.68948	2.171000	0.68590	0.482000	0.46254	ACA	.		0.527	RPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008168.1	NM_000975	
SALL1	6299	hgsc.bcm.edu;bcgsc.ca	37	16	51173561	51173561	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:51173561G>A	ENST00000251020.4	-	2	2605	c.2572C>T	c.(2572-2574)Ctc>Ttc	p.L858F	SALL1_ENST00000440970.1_Missense_Mutation_p.L761F|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	858					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GACATCTCGAGGGGCAAAGGC	0.527																																					p.L858F	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1	98	0			c.C2572T						.						98.0	95.0	96.0					16																	51173561		2198	4300	6498	SO:0001583	missense	6299	exon2			TCTCGAGGGGCAA	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2572C>T	16.37:g.51173561G>A	ENSP00000251020:p.Leu858Phe	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	8.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	6.849	0.525946	0.13066	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.57107	0.42;0.42	5.37	5.37	0.77165	.	0.382264	0.26784	N	0.022518	T	0.47691	0.1459	L	0.55990	1.75	0.37039	D	0.897036	P	0.48162	0.906	B	0.38378	0.272	T	0.53599	-0.8416	10	0.17369	T	0.5	.	19.1142	0.93331	0.0:0.0:1.0:0.0	.	858	Q9NSC2	SALL1_HUMAN	F	858;761;822	ENSP00000251020:L858F;ENSP00000407914:L761F	ENSP00000251020:L858F	L	-	1	0	SALL1	49731062	1.000000	0.71417	0.966000	0.40874	0.016000	0.09150	5.613000	0.67688	2.515000	0.84797	0.460000	0.39030	CTC	.		0.527	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
SAP130	79595	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	128712861	128712861	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:128712861C>A	ENST00000259235.3	-	15	2223	c.2094G>T	c.(2092-2094)atG>atT	p.M698I	SAP130_ENST00000259234.6_Missense_Mutation_p.M706I|SAP130_ENST00000357702.5_Missense_Mutation_p.M733I	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	698					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.M733I(1)|p.M698I(1)		NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		ATACAGTCTCCATGGACACAG	0.468																																					p.M733I		.											.	SAP130	94	2	Substitution - Missense(2)	lung(2)	c.G2199T						.						97.0	105.0	102.0					2																	128712861		2203	4300	6503	SO:0001583	missense	79595	exon16			AGTCTCCATGGAC	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.2094G>T	2.37:g.128712861C>A	ENSP00000259235:p.Met698Ile	Somatic	188.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	61.0	NM_001145928	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	ENST00000259235.3	37	CCDS2153.1	.	.	.	.	.	.	.	.	.	.	C	7.865	0.726937	0.15439	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.33	4.44	0.53790	.	0.593501	0.18602	N	0.136411	T	0.24275	0.0588	N	0.08118	0	0.28868	N	0.895108	B;B;B;B;B	0.18166	0.013;0.001;0.001;0.026;0.0	B;B;B;B;B	0.17979	0.006;0.001;0.001;0.02;0.0	T	0.07424	-1.0773	9	0.24483	T	0.36	-0.3078	14.3007	0.66346	0.0:0.9271:0.0:0.0729	.	733;706;698;263;335	B7ZLM3;Q96DP1;Q9H0E3;Q9H0E3-2;B3KRT9	.;.;SP130_HUMAN;.;.	I	733;698;706	.	ENSP00000259234:M706I	M	-	3	0	SAP130	128429331	1.000000	0.71417	0.998000	0.56505	0.242000	0.25591	1.559000	0.36320	2.502000	0.84385	0.632000	0.83419	ATG	.		0.468	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	
SATB1	6304	hgsc.bcm.edu;bcgsc.ca	37	3	18427925	18427925	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:18427925G>T	ENST00000338745.6	-	8	3119	c.1385C>A	c.(1384-1386)cCc>cAc	p.P462H	SATB1_ENST00000417717.2_Missense_Mutation_p.P462H|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Missense_Mutation_p.P462H	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	462					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GCTGATGAGGGGGGCAGGACC	0.512																																					p.P462H		.											.	SATB1	228	0			c.C1385A						.						161.0	172.0	168.0					3																	18427925		2203	4300	6503	SO:0001583	missense	6304	exon8			ATGAGGGGGGCAG		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.1385C>A	3.37:g.18427925G>T	ENSP00000341024:p.Pro462His	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	9.0	NM_002971	B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	37	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801329	0.31869	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717	T;T;T	0.48522	0.81;0.81;0.81	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.57592	0.2064	N	0.19112	0.55	0.80722	D	1	D;B	0.71674	0.998;0.059	D;B	0.69824	0.966;0.038	T	0.58901	-0.7554	10	0.59425	D	0.04	-0.8987	20.8794	0.99867	0.0:0.0:1.0:0.0	.	462;462	Q01826-2;Q01826	.;SATB1_HUMAN	H	462	ENSP00000341024:P462H;ENSP00000399708:P462H;ENSP00000399518:P462H	ENSP00000341024:P462H	P	-	2	0	SATB1	18402929	1.000000	0.71417	0.996000	0.52242	0.229000	0.25112	7.876000	0.87215	2.941000	0.99782	0.655000	0.94253	CCC	.		0.512	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
SCAMP3	10067	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	155227359	155227359	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:155227359T>C	ENST00000302631.3	-	6	714	c.607A>G	c.(607-609)Atc>Gtc	p.I203V	FAM189B_ENST00000472550.1_5'Flank|SCAMP3_ENST00000355379.3_Missense_Mutation_p.I177V|SCAMP3_ENST00000472397.1_5'UTR|FAM189B_ENST00000350210.2_5'Flank|FAM189B_ENST00000368368.3_5'Flank|FAM189B_ENST00000361361.2_5'Flank	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	203					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			ACCCAGAGGATAGAAAGCCCA	0.562																																					p.I203V		.											.	SCAMP3	93	0			c.A607G						.						73.0	74.0	74.0					1																	155227359		2203	4300	6503	SO:0001583	missense	10067	exon6			AGAGGATAGAAAG	AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.607A>G	1.37:g.155227359T>C	ENSP00000307275:p.Ile203Val	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	284.0	175.0	NM_005698	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Missense_Mutation	SNP	ENST00000302631.3	37	CCDS1105.1	.	.	.	.	.	.	.	.	.	.	.	14.96	2.692259	0.48202	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	T;T	0.20200	2.09;2.09	4.92	1.05	0.20165	.	0.167506	0.50627	D	0.000115	T	0.18635	0.0447	M	0.71036	2.16	0.46874	D	0.999233	P;B;B	0.39352	0.669;0.099;0.23	P;B;B	0.46320	0.512;0.3;0.149	T	0.04413	-1.0953	10	0.62326	D	0.03	-10.7064	12.6247	0.56623	0.0:0.0:0.315:0.685	.	203;177;203	Q6FHJ5;O14828-2;O14828	.;.;SCAM3_HUMAN	V	203;177	ENSP00000307275:I203V;ENSP00000347540:I177V	ENSP00000307275:I203V	I	-	1	0	SCAMP3	153493983	1.000000	0.71417	0.983000	0.44433	0.889000	0.51656	4.098000	0.57748	0.003000	0.14656	-0.396000	0.06452	ATC	.		0.562	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087399.1	NM_005698	
SCN4A	6329	hgsc.bcm.edu;bcgsc.ca	37	17	62048557	62048557	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:62048557A>G	ENST00000435607.1	-	5	744	c.668T>C	c.(667-669)gTg>gCg	p.V223A	CTC-264K15.6_ENST00000577329.1_lincRNA|SCN4A_ENST00000578147.1_Missense_Mutation_p.V223A	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	223					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGCCCGCAGCACCCGGAAGGT	0.642																																					p.V223A		.											.	SCN4A	93	0			c.T668C						.						24.0	27.0	26.0					17																	62048557		1917	4132	6049	SO:0001583	missense	6329	exon5			CGCAGCACCCGGA	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.668T>C	17.37:g.62048557A>G	ENSP00000396320:p.Val223Ala	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	5.0	NM_000334	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.228631	0.79576	.	.	ENSG00000007314	ENST00000435607	D	0.98835	-5.17	4.22	4.22	0.49857	Ion transport (1);	0.124247	0.53938	D	0.000053	D	0.98969	0.9649	M	0.83852	2.665	0.54753	D	0.999984	D	0.63880	0.993	D	0.72075	0.976	D	0.99421	1.0933	10	0.72032	D	0.01	.	12.5717	0.56341	1.0:0.0:0.0:0.0	.	223	P35499	SCN4A_HUMAN	A	223	ENSP00000396320:V223A	ENSP00000396320:V223A	V	-	2	0	SCN4A	59402289	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.087000	0.94110	1.894000	0.54839	0.379000	0.24179	GTG	.		0.642	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
SEC31B	25956	hgsc.bcm.edu;bcgsc.ca	37	10	102275905	102275905	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr10:102275905T>C	ENST00000370345.3	-	3	248	c.151A>G	c.(151-153)Agg>Ggg	p.R51G	SEC31B_ENST00000451524.1_Missense_Mutation_p.R51G|NDUFB8_ENST00000531258.1_3'UTR|NDUFB8_ENST00000557395.1_3'UTR|SEC31B_ENST00000370329.5_Missense_Mutation_p.R51G|SEC31B_ENST00000535773.1_5'UTR	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	51					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GAAGGGTCCCTGAAATCAACC	0.458																																					p.R51G		.											.	SEC31B	91	0			c.A151G						.						93.0	88.0	89.0					10																	102275905		2203	4300	6503	SO:0001583	missense	25956	exon3			GGTCCCTGAAATC	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.151A>G	10.37:g.102275905T>C	ENSP00000359370:p.Arg51Gly	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	4.0	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	T	12.44	1.938920	0.34189	.	.	ENSG00000075826	ENST00000370345;ENST00000451524;ENST00000370329	T;T;T	0.57595	0.76;0.39;0.49	5.89	3.53	0.40419	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.215458	0.49916	D	0.000121	T	0.32376	0.0827	N	0.19112	0.55	0.80722	D	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.08055	0.001;0.003;0.001;0.001	T	0.06643	-1.0815	10	0.33141	T	0.24	-12.9283	5.7669	0.18231	0.0:0.1432:0.1424:0.7144	.	51;51;51;51	B4DGE3;Q9NQW1-5;E9PKR7;Q9NQW1	.;.;.;SC31B_HUMAN	G	51	ENSP00000359370:R51G;ENSP00000391178:R51G;ENSP00000359354:R51G	ENSP00000359354:R51G	R	-	1	2	SEC31B	102265895	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.025000	0.30090	0.473000	0.27368	0.454000	0.30748	AGG	.		0.458	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
SEMA3D	223117	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	84644405	84644405	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr7:84644405G>A	ENST00000284136.6	-	14	1716	c.1673C>T	c.(1672-1674)gCa>gTa	p.A558V	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	558	PSI.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TCGAGAGCATGCATTTCCATC	0.453																																					p.A558V	Ovarian(63;442 1191 17318 29975 31528)	.											.	SEMA3D	138	0			c.C1673T						.						126.0	114.0	118.0					7																	84644405		2203	4300	6503	SO:0001583	missense	223117	exon14			GAGCATGCATTTC	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1673C>T	7.37:g.84644405G>A	ENSP00000284136:p.Ala558Val	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	35.0	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760243	0.69763	.	.	ENSG00000153993	ENST00000284136	T	0.21932	1.98	5.75	5.75	0.90469	.	0.381500	0.32935	N	0.005473	T	0.23054	0.0557	L	0.50993	1.605	0.80722	D	1	B	0.33583	0.418	B	0.24394	0.053	T	0.02610	-1.1134	10	0.72032	D	0.01	.	19.9361	0.97143	0.0:0.0:1.0:0.0	.	558	O95025	SEM3D_HUMAN	V	558	ENSP00000284136:A558V	ENSP00000284136:A558V	A	-	2	0	SEMA3D	84482341	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	7.674000	0.83992	2.720000	0.93068	0.561000	0.74099	GCA	.		0.453	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
SETD1A	9739	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	30976976	30976976	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:30976976G>A	ENST00000262519.8	+	8	2460	c.1774G>A	c.(1774-1776)Ggc>Agc	p.G592S		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	592	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CGACCGGGGTGGCTCACCCCC	0.677																																					p.G592S		.											.	SETD1A	93	0			c.G1774A						.						23.0	27.0	25.0					16																	30976976		2194	4289	6483	SO:0001583	missense	9739	exon8			CGGGGTGGCTCAC	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1774G>A	16.37:g.30976976G>A	ENSP00000262519:p.Gly592Ser	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	34.0	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446036	0.43429	.	.	ENSG00000099381	ENST00000262519	D	0.93859	-3.3	4.41	4.41	0.53225	.	0.476082	0.19592	N	0.110587	T	0.80969	0.4726	N	0.11427	0.14	0.20638	N	0.999879	P	0.38473	0.633	B	0.30782	0.12	T	0.71533	-0.4564	10	0.25751	T	0.34	.	5.4932	0.16787	0.1012:0.0:0.6995:0.1993	.	592	O15047	SET1A_HUMAN	S	592	ENSP00000262519:G592S	ENSP00000262519:G592S	G	+	1	0	SETD1A	30884477	0.970000	0.33590	0.997000	0.53966	0.985000	0.73830	2.685000	0.46959	2.269000	0.75478	0.561000	0.74099	GGC	.		0.677	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
SI	6476	hgsc.bcm.edu;bcgsc.ca	37	3	164758754	164758754	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:164758754T>C	ENST00000264382.3	-	18	2195	c.2133A>G	c.(2131-2133)gaA>gaG	p.E711E		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	711	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTGCTACTGTTTCTCCAAACA	0.328										HNSCC(35;0.089)																											p.E711E		.											.	SI	104	0			c.A2133G						.						138.0	137.0	138.0					3																	164758754		2203	4300	6503	SO:0001819	synonymous_variant	6476	exon18			TACTGTTTCTCCA	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.2133A>G	3.37:g.164758754T>C		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	CCDS3196.1																																																																																			.		0.328	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
SIK3	23387	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	116744713	116744713	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr11:116744713T>C	ENST00000292055.4	-	12	1348	c.1313A>G	c.(1312-1314)cAg>cGg	p.Q438R	SIK3_ENST00000446921.2_Missense_Mutation_p.Q448R|SIK3_ENST00000375288.1_5'UTR|SIK3_ENST00000542607.1_Missense_Mutation_p.Q390R|SIK3_ENST00000434315.2_Missense_Mutation_p.Q337R|SIK3_ENST00000375300.1_Missense_Mutation_p.Q496R	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	438					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GAATGGAGCCTGGGGGTTGAC	0.478																																					p.Q438R		.											.	SIK3	919	0			c.A1313G						.						99.0	101.0	100.0					11																	116744713		2201	4296	6497	SO:0001583	missense	23387	exon12			GGAGCCTGGGGGT	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.1313A>G	11.37:g.116744713T>C	ENSP00000292055:p.Gln438Arg	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	30.0	NM_025164	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	37	CCDS8379.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.506538	0.64410	.	.	ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315	T;T;T;T	0.72835	-0.56;-0.6;-0.69;-0.18	5.33	4.18	0.49190	Protein kinase-like domain (1);	0.000000	0.37530	U	0.002048	T	0.75287	0.3829	L	0.38531	1.155	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.75020	0.985;0.918;0.985	T	0.72679	-0.4220	10	0.36615	T	0.2	.	12.3471	0.55126	0.0:0.0:0.1415:0.8585	.	390;337;438	A1A5A8;A1A5A9;Q9Y2K2	.;.;SIK3_HUMAN	R	496;438;390;337	ENSP00000364449:Q496R;ENSP00000292055:Q438R;ENSP00000438108:Q390R;ENSP00000415873:Q337R	ENSP00000292055:Q438R	Q	-	2	0	SIK3	116249923	1.000000	0.71417	0.409000	0.26459	0.484000	0.33280	7.503000	0.81632	0.843000	0.35070	-0.321000	0.08615	CAG	.		0.478	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164	
SLAIN2	57606	hgsc.bcm.edu;bcgsc.ca	37	4	48384604	48384604	+	Silent	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr4:48384604A>G	ENST00000264313.6	+	5	1300	c.882A>G	c.(880-882)gcA>gcG	p.A294A	SLAIN2_ENST00000512093.1_Silent_p.A101A	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	294					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						AAGAATATGCAGCCACCACGT	0.338																																					p.A294A		.											.	.	.	0			c.A882G						.						50.0	45.0	47.0					4																	48384604		1936	4123	6059	SO:0001819	synonymous_variant	57606	exon5			ATATGCAGCCACC	BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.882A>G	4.37:g.48384604A>G		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	4.0	NM_020846	A8K4P1|Q8N5R3	Silent	SNP	ENST00000264313.6	37	CCDS47051.1																																																																																			.		0.338	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365807.4	NM_020846	
SLC22A2	6582	hgsc.bcm.edu;bcgsc.ca	37	6	160671613	160671613	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr6:160671613T>C	ENST00000366953.3	-	3	898	c.640A>G	c.(640-642)Agc>Ggc	p.S214G	SLC22A2_ENST00000366952.1_Missense_Mutation_p.S193G|SLC22A2_ENST00000491092.1_5'UTR	NM_003058.3	NP_003049.2	O15244	S22A2_HUMAN	solute carrier family 22 (organic cation transporter), member 2	214					body fluid secretion (GO:0007589)|drug transmembrane transport (GO:0006855)|histamine transport (GO:0051608)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|organic cation transport (GO:0015695)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|steroid binding (GO:0005496)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(16)|prostate(2)|skin(1)	27		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Chlorphenamine(DB01114)|Choline(DB00122)|Cimetidine(DB00501)|Cisplatin(DB00515)|Cladribine(DB00242)|Cocaine(DB00907)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Desipramine(DB01151)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Famotidine(DB00927)|Flurazepam(DB00690)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Memantine(DB01043)|Metformin(DB00331)|Metoprolol(DB00264)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Oxprenolol(DB01580)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Propranolol(DB00571)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Reserpine(DB00206)|Thiamine(DB00152)|Tubocurarine(DB01199)|Vinblastine(DB00570)|Zidovudine(DB00495)	CCTGCTTTGCTGACCAGTCCT	0.458																																					p.S214G		.											.	SLC22A2	154	0			c.A640G						.						126.0	117.0	120.0					6																	160671613		2203	4300	6503	SO:0001583	missense	6582	exon3			CTTTGCTGACCAG	X98333	CCDS5276.1	6q25.3	2013-05-22			ENSG00000112499	ENSG00000112499		"""Solute carriers"""	10966	protein-coding gene	gene with protein product		602608				9605850	Standard	NM_003058		Approved	OCT2	uc003qtf.3	O15244	OTTHUMG00000015950	ENST00000366953.3:c.640A>G	6.37:g.160671613T>C	ENSP00000355920:p.Ser214Gly	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	4.0	NM_003058	Q5T7Q6|Q6PIQ8|Q8NG62|Q9NQB9	Missense_Mutation	SNP	ENST00000366953.3	37	CCDS5276.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.268361	0.40095	.	.	ENSG00000112499	ENST00000366953;ENST00000366952	T;T	0.74209	-0.82;-0.82	5.43	5.43	0.79202	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.103676	0.64402	D	0.000002	T	0.69628	0.3132	M	0.70275	2.135	0.36461	D	0.866699	P;B;B	0.36330	0.548;0.337;0.315	P;B;B	0.44673	0.457;0.261;0.169	T	0.69888	-0.5023	10	0.20046	T	0.44	.	15.6414	0.77006	0.0:0.0:0.0:1.0	.	214;214;214	O15244-3;O15244;O15244-2	.;S22A2_HUMAN;.	G	214;193	ENSP00000355920:S214G;ENSP00000355919:S193G	ENSP00000355919:S193G	S	-	1	0	SLC22A2	160591603	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.767000	0.62286	2.279000	0.76181	0.533000	0.62120	AGC	.		0.458	SLC22A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042943.1	NM_003058	
SLC47A2	146802	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	19583316	19583316	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:19583316C>A	ENST00000325411.5	-	16	1587	c.1537G>T	c.(1537-1539)Gca>Tca	p.A513S	SLC47A2_ENST00000350657.5_Missense_Mutation_p.A491S|SLC47A2_ENST00000463318.1_5'UTR	NM_152908.3	NP_690872.2	Q86VL8	S47A2_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 2	513					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antiporter activity (GO:0015297)|drug transmembrane transporter activity (GO:0015238)			endometrium(2)|kidney(3)|large_intestine(2)|lung(1)|ovary(1)	9	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)				Aciclovir(DB00787)	GTGCTCTCTGCTCTCTGCTGC	0.493																																					p.A513S		.											.	SLC47A2	90	0			c.G1537T						.						107.0	89.0	95.0					17																	19583316		2203	4300	6503	SO:0001583	missense	146802	exon16			TCTCTGCTCTCTG	AB250364	CCDS11211.1, CCDS58530.1	17p11.2	2013-07-17	2013-07-17		ENSG00000180638	ENSG00000180638		"""Solute carriers"""	26439	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 2"""	609833				16996621, 16807400	Standard	NM_152908		Approved	FLJ31196, MATE2, MATE2-K	uc002gwf.4	Q86VL8	OTTHUMG00000059464	ENST00000325411.5:c.1537G>T	17.37:g.19583316C>A	ENSP00000326671:p.Ala513Ser	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	28.0	NM_152908	A0JBX9|A0P8Z7|Q63HJ9|Q8IV44|Q96NA1	Missense_Mutation	SNP	ENST00000325411.5	37	CCDS11211.1	.	.	.	.	.	.	.	.	.	.	C	4.854	0.158712	0.09236	.	.	ENSG00000180638	ENST00000350657;ENST00000325411	T;T	0.29397	1.57;1.59	4.04	-8.08	0.01094	.	2.099700	0.02651	U	0.106463	T	0.12008	0.0292	N	0.14661	0.345	0.09310	N	1	B;B;B	0.24186	0.099;0.037;0.001	B;B;B	0.25405	0.06;0.048;0.002	T	0.24584	-1.0156	10	0.06891	T	0.86	1.1802	1.9074	0.03280	0.2094:0.2109:0.1039:0.4758	.	477;491;513	Q86VL8-3;Q86VL8-4;Q86VL8	.;.;S47A2_HUMAN	S	491;513	ENSP00000338084:A491S;ENSP00000326671:A513S	ENSP00000326671:A513S	A	-	1	0	SLC47A2	19523908	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.977000	0.01495	-2.180000	0.00766	-0.251000	0.11542	GCA	.		0.493	SLC47A2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132242.2	NM_152908	
SLC9C1	285335	hgsc.bcm.edu;bcgsc.ca	37	3	111888153	111888153	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr3:111888153T>C	ENST00000305815.5	-	24	3194	c.2942A>G	c.(2941-2943)cAc>cGc	p.H981R	SLC9C1_ENST00000487372.1_Missense_Mutation_p.H933R	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	981					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										ATCATACAAGTGAGTTTTGGG	0.318																																					p.H981R		.											.	.	.	0			c.A2942G						.						88.0	87.0	87.0					3																	111888153		2203	4300	6503	SO:0001583	missense	285335	exon24			TACAAGTGAGTTT	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.2942A>G	3.37:g.111888153T>C	ENSP00000306627:p.His981Arg	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	T	13.95	2.389764	0.42410	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	D;D	0.92348	-3.02;-3.02	5.83	4.65	0.58169	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.499344	0.19936	N	0.102757	D	0.90655	0.7069	L	0.52364	1.645	0.09310	N	1	P;D	0.54397	0.713;0.966	P;P	0.52109	0.596;0.69	T	0.81206	-0.1038	10	0.15066	T	0.55	-0.562	9.0919	0.36617	0.1632:0.0:0.0:0.8368	.	933;981	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	R	981;933	ENSP00000306627:H981R;ENSP00000420688:H933R	ENSP00000306627:H981R	H	-	2	0	SLC9A10	113370843	0.981000	0.34729	0.003000	0.11579	0.008000	0.06430	2.740000	0.47418	0.993000	0.38866	0.491000	0.48974	CAC	.		0.318	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
SMCHD1	23347	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	2750117	2750117	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr18:2750117C>A	ENST00000320876.6	+	31	4342	c.4004C>A	c.(4003-4005)cCt>cAt	p.P1335H	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.P1335H	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1335					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GTTTTTGCCCCTAGGTAAGAA	0.368																																					p.P1335H		.											.	SMCHD1	46	0			c.C4004A						.						121.0	108.0	112.0					18																	2750117		1839	4087	5926	SO:0001583	missense	23347	exon31			TTGCCCCTAGGTA	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.4004C>A	18.37:g.2750117C>A	ENSP00000326603:p.Pro1335His	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	23.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.932066	0.52866	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.28454	1.61;1.62	5.96	5.96	0.96718	.	0.052669	0.85682	D	0.000000	T	0.52484	0.1737	M	0.67953	2.075	0.43133	D	0.994877	D	0.76494	0.999	P	0.60173	0.87	T	0.51942	-0.8641	10	0.72032	D	0.01	-7.2361	18.1738	0.89754	0.0:1.0:0.0:0.0	.	1335	A6NHR9	SMHD1_HUMAN	H	1335	ENSP00000326603:P1335H;ENSP00000261598:P1335H	ENSP00000261598:P1335H	P	+	2	0	SMCHD1	2740117	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.754000	0.62191	2.826000	0.97356	0.655000	0.94253	CCT	.		0.368	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
SNX18	112574	hgsc.bcm.edu;bcgsc.ca	37	5	53813856	53813856	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr5:53813856A>G	ENST00000326277.3	+	1	264	c.74A>G	c.(73-75)gAg>gGg	p.E25G	SNX18_ENST00000381410.4_Missense_Mutation_p.E25G|SNX18_ENST00000343017.6_Missense_Mutation_p.E25G	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	25	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				CGAGAGCACGAGGTGCTGAGC	0.706																																					p.E25G		.											.	SNX18	226	0			c.A74G						.						7.0	8.0	8.0					5																	53813856		2148	4207	6355	SO:0001583	missense	112574	exon1			AGCACGAGGTGCT	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.74A>G	5.37:g.53813856A>G	ENSP00000317332:p.Glu25Gly	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	4.0	NM_052870	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Missense_Mutation	SNP	ENST00000326277.3	37	CCDS3962.1	.	.	.	.	.	.	.	.	.	.	A	19.48	3.835950	0.71373	.	.	ENSG00000178996	ENST00000343017;ENST00000381410;ENST00000326277	T;T;T	0.58506	0.33;0.33;0.33	3.82	3.82	0.43975	Src homology-3 domain (4);	0.142348	0.51477	D	0.000099	T	0.77164	0.4090	M	0.86805	2.84	0.58432	D	0.999998	D;D	0.71674	0.998;0.982	D;P	0.81914	0.995;0.82	T	0.81671	-0.0827	10	0.87932	D	0	-26.2397	12.4182	0.55506	1.0:0.0:0.0:0.0	.	25;25	Q96RF0;Q96RF0-2	SNX18_HUMAN;.	G	25	ENSP00000342276:E25G;ENSP00000370817:E25G;ENSP00000317332:E25G	ENSP00000317332:E25G	E	+	2	0	SNX18	53849613	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	6.472000	0.73567	1.589000	0.49982	0.254000	0.18369	GAG	.		0.706	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2		
SOS2	6655	hgsc.bcm.edu;bcgsc.ca	37	14	50647366	50647366	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr14:50647366T>C	ENST00000216373.5	-	7	1167	c.893A>G	c.(892-894)cAg>cGg	p.Q298R	SOS2_ENST00000555794.1_5'UTR|SOS2_ENST00000543680.1_Missense_Mutation_p.Q298R	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	298	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					AAGAATGTCCTGTGATAATGT	0.313																																					p.Q298R		.											.	SOS2	849	0			c.A893G						.						77.0	77.0	77.0					14																	50647366		2203	4300	6503	SO:0001583	missense	6655	exon7			ATGTCCTGTGATA	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.893A>G	14.37:g.50647366T>C	ENSP00000216373:p.Gln298Arg	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	4.0	NM_006939	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	T	8.883	0.952136	0.18431	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.62941	-0.01;-0.01	5.6	5.6	0.85130	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.46833	0.1413	N	0.25485	0.75	0.80722	D	1	B;B	0.14805	0.011;0.002	B;B	0.16289	0.015;0.01	T	0.43196	-0.9406	10	0.06099	T	0.92	.	15.829	0.78736	0.0:0.0:0.0:1.0	.	298;298	B7ZKT6;Q07890	.;SOS2_HUMAN	R	298	ENSP00000216373:Q298R;ENSP00000445328:Q298R	ENSP00000216373:Q298R	Q	-	2	0	SOS2	49717116	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.033000	0.88852	2.122000	0.65172	0.529000	0.55759	CAG	.		0.313	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
SPRR2G	6706	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	153122487	153122487	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:153122487C>T	ENST00000368748.4	-	2	138	c.100G>A	c.(100-102)Gag>Aag	p.E34K		NM_001014291.3	NP_001014313.1	Q9BYE4	SPR2G_HUMAN	small proline-rich protein 2G	34	3 X 9 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				endometrium(1)|lung(1)|skin(1)	3	all_lung(78;1.78e-30)|Lung NSC(65;7.29e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGGTAAGGCTCAGGGCACTTC	0.612																																					p.E34K		.											.	SPRR2G	68	0			c.G100A						.						151.0	115.0	127.0					1																	153122487		2203	4300	6503	SO:0001583	missense	6706	exon2			AAGGCTCAGGGCA	AF333957	CCDS30868.1	1q21-q22	2008-02-05			ENSG00000159516	ENSG00000159516			11267	protein-coding gene	gene with protein product						8325635, 11279051	Standard	NM_001014291		Approved		uc009wod.2	Q9BYE4	OTTHUMG00000014399	ENST00000368748.4:c.100G>A	1.37:g.153122487C>T	ENSP00000357737:p.Glu34Lys	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	74.0	NM_001014291		Missense_Mutation	SNP	ENST00000368748.4	37	CCDS30868.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687891	0.29962	.	.	ENSG00000159516	ENST00000368748	T	0.43688	0.94	4.64	3.68	0.42216	.	.	.	.	.	T	0.40372	0.1114	.	.	.	0.09310	N	1	P	0.52061	0.95	P	0.55391	0.775	T	0.11446	-1.0587	8	0.87932	D	0	-15.1488	10.7082	0.45966	0.0:0.8074:0.1925:0.0	.	34	Q9BYE4	SPR2G_HUMAN	K	34	ENSP00000357737:E34K	ENSP00000357737:E34K	E	-	1	0	SPRR2G	151389111	0.000000	0.05858	0.055000	0.19348	0.062000	0.15995	-0.303000	0.08210	2.414000	0.81942	0.609000	0.83330	GAG	.		0.612	SPRR2G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040057.1		
SPRY1	10252	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	124322782	124322782	+	Silent	SNP	G	G	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr4:124322782G>A	ENST00000394339.2	+	2	376	c.36G>A	c.(34-36)tcG>tcA	p.S12S	SPRY1_ENST00000339241.1_Silent_p.S12S	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	12					epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						GTGGCAGTTCGTTAGTTGTGA	0.453																																					p.S12S		.											.	SPRY1	660	0			c.G36A						.						172.0	181.0	178.0					4																	124322782		2203	4300	6503	SO:0001819	synonymous_variant	10252	exon2			CAGTTCGTTAGTT	AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.36G>A	4.37:g.124322782G>A		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	59.0	NM_001258039	D3DNX6|Q6PNE0	Silent	SNP	ENST00000394339.2	37	CCDS3731.1																																																																																			.		0.453	SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256711.1		
SRRM2	23524	hgsc.bcm.edu;bcgsc.ca	37	16	2812846	2812846	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:2812846T>C	ENST00000301740.8	+	11	2866	c.2317T>C	c.(2317-2319)Ttg>Ctg	p.L773L		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	773	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AAAATCTCGCTTGTCTTTGAG	0.517																																					p.L773L		.											.	SRRM2	93	0			c.T2317C						.						160.0	164.0	163.0					16																	2812846		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon11			TCTCGCTTGTCTT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2317T>C	16.37:g.2812846T>C		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																			.		0.517	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
STARD13	90627	hgsc.bcm.edu;bcgsc.ca	37	13	33684128	33684128	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr13:33684128A>G	ENST00000336934.5	-	12	3045	c.2929T>C	c.(2929-2931)Tgg>Cgg	p.W977R	STARD13_ENST00000255486.4_Missense_Mutation_p.W969R|STARD13_ENST00000399365.3_Missense_Mutation_p.W859R	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	977	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		TCCTCGTCCCACAGGTGGCGC	0.587											OREG0022359	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W977R		.											.	STARD13	94	0			c.T2929C						.						163.0	139.0	147.0					13																	33684128		2203	4300	6503	SO:0001583	missense	90627	exon12			CGTCCCACAGGTG	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2929T>C	13.37:g.33684128A>G	ENSP00000338785:p.Trp977Arg	Somatic	145.0	0.0	841	WXS	Illumina HiSeq	Phase_I	114.0	5.0	NM_178006	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	37	CCDS9348.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.589348	0.86851	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934	D;D;D	0.94457	-3.43;-3.43;-3.43	5.34	5.34	0.76211	Lipid-binding START (3);START-like domain (1);	0.000000	0.85682	D	0.000000	D	0.97751	0.9262	M	0.91717	3.235	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98813	1.0744	10	0.87932	D	0	.	15.6106	0.76713	1.0:0.0:0.0:0.0	.	942;977;969	Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;STA13_HUMAN;.	R	859;969;977	ENSP00000382300:W859R;ENSP00000255486:W969R;ENSP00000338785:W977R	ENSP00000255486:W969R	W	-	1	0	STARD13	32582128	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.181000	0.94874	2.147000	0.66899	0.533000	0.62120	TGG	.		0.587	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466	
SYCP2	10388	hgsc.bcm.edu;bcgsc.ca	37	20	58489043	58489043	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr20:58489043C>T	ENST00000357552.3	-	12	1042	c.817G>A	c.(817-819)Gga>Aga	p.G273R	SYCP2_ENST00000371001.2_Missense_Mutation_p.G273R			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	273					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CTTTTGTCTCCAAGCATGCCA	0.294																																					p.G273R		.											.	SYCP2	525	0			c.G817A						.						68.0	65.0	66.0					20																	58489043		2201	4298	6499	SO:0001583	missense	10388	exon11			TGTCTCCAAGCAT	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.817G>A	20.37:g.58489043C>T	ENSP00000350162:p.Gly273Arg	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	6.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	37	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.152350	0.78001	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.04809	3.55;3.55;3.55	4.91	4.91	0.64330	.	0.101773	0.43110	D	0.000601	T	0.24812	0.0602	M	0.80422	2.495	0.44282	D	0.99714	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	T	0.01743	-1.1283	10	0.87932	D	0	-22.4929	18.4759	0.90792	0.0:1.0:0.0:0.0	.	273;273	A2A341;Q9BX26	.;SYCP2_HUMAN	R	273	ENSP00000360040:G273R;ENSP00000350162:G273R;ENSP00000402456:G273R	ENSP00000350162:G273R	G	-	1	0	SYCP2	57922438	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.736000	0.68597	2.430000	0.82344	0.655000	0.94253	GGA	.		0.294	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
TBC1D15	64786	hgsc.bcm.edu;bcgsc.ca	37	12	72300901	72300901	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr12:72300901T>C	ENST00000550746.1	+	12	1398	c.1334T>C	c.(1333-1335)aTg>aCg	p.M445T	TBC1D15_ENST00000485960.2_Missense_Mutation_p.M428T|TBC1D15_ENST00000319106.8_Missense_Mutation_p.M436T|TBC1D15_ENST00000393309.3_Missense_Mutation_p.M199T|TBC1D15_ENST00000548679.1_3'UTR	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	445	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ACCTACTGTATGTATGATTTT	0.289																																					p.M445T		.											.	TBC1D15	90	0			c.T1334C						.						177.0	159.0	165.0					12																	72300901		2202	4298	6500	SO:0001583	missense	64786	exon12			ACTGTATGTATGA	AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.1334T>C	12.37:g.72300901T>C	ENSP00000448182:p.Met445Thr	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	4.0	NM_022771	B4DMT9|B9A6L6|J3KNI9|Q9HA83	Missense_Mutation	SNP	ENST00000550746.1	37	CCDS31858.1	.	.	.	.	.	.	.	.	.	.	T	18.67	3.673062	0.67928	.	.	ENSG00000121749	ENST00000550746;ENST00000319106;ENST00000485960;ENST00000393309	T;T;T;T	0.04234	3.67;3.67;3.67;3.67	5.09	5.09	0.68999	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.19604	0.0471	M	0.68317	2.08	0.80722	D	1	D;D;D	0.65815	0.995;0.994;0.993	D;D;P	0.77004	0.989;0.981;0.901	T	0.00256	-1.1873	10	0.72032	D	0.01	-13.8343	14.8798	0.70522	0.0:0.0:0.0:1.0	.	436;428;445	E9PH93;Q8TC07-2;Q8TC07	.;.;TBC15_HUMAN	T	445;436;428;199	ENSP00000448182:M445T;ENSP00000318262:M436T;ENSP00000420678:M428T;ENSP00000376986:M199T	ENSP00000318262:M436T	M	+	2	0	TBC1D15	70587168	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	1.919000	0.55581	0.528000	0.53228	ATG	.		0.289	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351266.2	NM_022771	
TCP11L1	55346	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	33083146	33083146	+	Silent	SNP	C	C	T	rs145755006		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr11:33083146C>T	ENST00000334274.4	+	7	1246	c.846C>T	c.(844-846)caC>caT	p.H282H	TCP11L1_ENST00000324357.9_Silent_p.H61H|TCP11L1_ENST00000432887.1_Silent_p.H282H|TCP11L1_ENST00000531632.2_Silent_p.H282H	NM_018393.3	NP_060863.3	Q9NUJ3	T11L1_HUMAN	t-complex 11, testis-specific-like 1	282						microtubule (GO:0005874)				kidney(1)|liver(2)|lung(2)|skin(1)	6						AGTATAAACACGCCCTGCCAG	0.532																																					p.H282H		.											.	TCP11L1	90	0			c.C846T						.	C	,	0,4404		0,0,2202	56.0	56.0	56.0		846,846	-2.5	0.5	11	dbSNP_134	56	2,8594	2.2+/-6.3	0,2,4296	no	coding-synonymous,coding-synonymous	TCP11L1	NM_001145541.1,NM_018393.3	,	0,2,6498	TT,TC,CC		0.0233,0.0,0.0154	,	282/510,282/510	33083146	2,12998	2202	4298	6500	SO:0001819	synonymous_variant	55346	exon7			TAAACACGCCCTG	BC041696	CCDS7882.1	11p13	2014-08-12	2012-09-20		ENSG00000176148	ENSG00000176148			25655	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 1"""				Standard	NM_001145541		Approved	FLJ11336	uc010rei.2	Q9NUJ3	OTTHUMG00000165303	ENST00000334274.4:c.846C>T	11.37:g.33083146C>T		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	29.0	NM_001145541	D3DR01|Q8IVX4	Silent	SNP	ENST00000334274.4	37	CCDS7882.1																																																																																			C|1.000;T|0.000		0.532	TCP11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383377.4	NM_018393	
TEX15	56154	hgsc.bcm.edu;bcgsc.ca	37	8	30703400	30703400	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr8:30703400T>C	ENST00000256246.2	-	1	3208	c.3134A>G	c.(3133-3135)gAc>gGc	p.D1045G	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1045					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ACCTTGAAGGTCACAACTTTC	0.333																																					p.D1045G		.											.	TEX15	97	0			c.A3134G						.						66.0	70.0	68.0					8																	30703400		2203	4295	6498	SO:0001583	missense	56154	exon1			TGAAGGTCACAAC	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.3134A>G	8.37:g.30703400T>C	ENSP00000256246:p.Asp1045Gly	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	T	18.15	3.560018	0.65538	.	.	ENSG00000133863	ENST00000256246	T	0.26957	1.7	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000005	T	0.46054	0.1373	L	0.55481	1.735	0.43766	D	0.99628	D	0.89917	1.0	D	0.81914	0.995	T	0.42682	-0.9437	10	0.87932	D	0	.	13.5087	0.61499	0.0:0.0:0.0:1.0	.	1045	Q9BXT5	TEX15_HUMAN	G	1045	ENSP00000256246:D1045G	ENSP00000256246:D1045G	D	-	2	0	TEX15	30822942	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	4.331000	0.59273	2.180000	0.69256	0.383000	0.25322	GAC	.		0.333	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
TP53	7157	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	C	T	rs587782144		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:7578457C>T	ENST00000269305.4	-	5	662	c.473G>A	c.(472-474)cGc>cAc	p.R158H	TP53_ENST00000445888.2_Missense_Mutation_p.R158H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R158H|TP53_ENST00000420246.2_Missense_Mutation_p.R158H|TP53_ENST00000455263.2_Missense_Mutation_p.R158H|TP53_ENST00000413465.2_Missense_Mutation_p.R158H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	158	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R158L(77)|p.R158H(74)|p.R158P(9)|p.R65L(8)|p.0?(8)|p.R26L(8)|p.R158fs(6)|p.R158fs*11(6)|p.R65H(5)|p.R26H(5)|p.R158_A159insX(4)|p.R65fs(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R26fs(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R26fs*11(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R65fs*11(1)|p.R156fs*20(1)|p.R158C(1)|p.V157_I162delVRAMAI(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCATGGCGCGGACGCGGGT	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R158H	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	244	Substitution - Missense(188)|Deletion - Frameshift(19)|Deletion - In frame(13)|Complex(10)|Whole gene deletion(8)|Insertion - In frame(4)|Complex - frameshift(2)	lung(78)|central_nervous_system(33)|oesophagus(20)|haematopoietic_and_lymphoid_tissue(19)|large_intestine(18)|upper_aerodigestive_tract(12)|stomach(12)|urinary_tract(9)|prostate(7)|kidney(6)|liver(6)|breast(5)|bone(4)|soft_tissue(3)|ovary(3)|pancreas(3)|thyroid(2)|biliary_tract(2)|vulva(1)|thymus(1)	c.G473A	GRCh37	CM994513	TP53	M		.						49.0	51.0	50.0					17																	7578457		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATGGCGCGGACGC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.473G>A	17.37:g.7578457C>T	ENSP00000269305:p.Arg158His	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	53.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306299	0.40795	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110116	0.64402	D	0.000010	D	0.99809	0.9917	M	0.77486	2.375	0.58432	D	0.999999	D;P;D;D;P;P;D	0.89917	0.998;0.631;0.984;0.982;0.831;0.48;1.0	P;B;P;P;P;B;D	0.97110	0.907;0.274;0.76;0.751;0.516;0.242;1.0	D	0.96738	0.9544	10	0.87932	D	0	-10.4795	12.6491	0.56751	0.0:0.9196:0.0:0.0804	.	119;158;158;65;158;158;158	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	158;158;158;158;158;158;147;65;26;65;26;158	ENSP00000410739:R158H;ENSP00000352610:R158H;ENSP00000269305:R158H;ENSP00000398846:R158H;ENSP00000391127:R158H;ENSP00000391478:R158H;ENSP00000425104:R26H;ENSP00000423862:R65H;ENSP00000424104:R158H	ENSP00000269305:R158H	R	-	2	0	TP53	7519182	1.000000	0.71417	0.034000	0.17996	0.175000	0.22909	7.775000	0.85489	1.514000	0.48869	-0.140000	0.14226	CGC	.		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
THRA	7067	hgsc.bcm.edu;bcgsc.ca	37	17	38230771	38230771	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:38230771T>C	ENST00000264637.4	+	2	610	c.30T>C	c.(28-30)tgT>tgC	p.C10C	THRA_ENST00000584985.1_Silent_p.C10C|THRA_ENST00000450525.2_Silent_p.C10C|THRA_ENST00000546243.1_Silent_p.C10C|THRA_ENST00000394121.4_Silent_p.C10C	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	10	Modulating.				cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	AGGTGGAGTGTGGGTCAGACC	0.582																																					p.C10C		.											.	THRA	186	0			c.T30C						.						191.0	161.0	171.0					17																	38230771		2203	4300	6503	SO:0001819	synonymous_variant	7067	exon2			GGAGTGTGGGTCA	J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.30T>C	17.37:g.38230771T>C		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	5.0	NM_001190918	A8K3B5|P21205|Q8N6A1|Q96H73	Silent	SNP	ENST00000264637.4	37	CCDS11360.1																																																																																			.		0.582	THRA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257160.2		
TPR	7175	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	186319458	186319458	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:186319458T>G	ENST00000367478.4	-	21	2969	c.2673A>C	c.(2671-2673)aaA>aaC	p.K891N	TPR_ENST00000474852.1_5'Flank	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	891					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTAATAGTTCTTTTGTGTTAA	0.323			T	NTRK1	papillary thyroid																																p.K891N		.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	228	0			c.A2673C						.						186.0	170.0	175.0					1																	186319458		1821	4081	5902	SO:0001583	missense	7175	exon21			TAGTTCTTTTGTG	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2673A>C	1.37:g.186319458T>G	ENSP00000356448:p.Lys891Asn	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	108.0	NM_003292	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	T	18.66	3.671956	0.67928	.	.	ENSG00000047410	ENST00000367478	T	0.28454	1.61	5.88	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.47173	0.1431	M	0.65498	2.005	0.58432	D	0.999995	D	0.89917	1.0	D	0.69307	0.963	T	0.42616	-0.9441	10	0.46703	T	0.11	.	6.3881	0.21572	0.0:0.3132:0.0:0.6868	.	891	P12270	TPR_HUMAN	N	891	ENSP00000356448:K891N	ENSP00000356448:K891N	K	-	3	2	TPR	184586081	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.793000	0.47845	1.015000	0.39444	-0.366000	0.07423	AAA	.		0.323	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
TTN	7273	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	179427959	179427959	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:179427959T>C	ENST00000591111.1	-	276	78201	c.77977A>G	c.(77977-77979)Acc>Gcc	p.T25993A	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T18761A|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T18694A|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.T18569A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T25066A|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T27634A|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25993	Fibronectin type-III 89. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAAGCTTGGTCACTGTGAAC	0.448																																					p.T27634A		.											.	TTN	636	0			c.A82900G						.						123.0	124.0	123.0					2																	179427959		2011	4186	6197	SO:0001583	missense	7273	exon326			GCTTGGTCACTGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.77977A>G	2.37:g.179427959T>C	ENSP00000465570:p.Thr25993Ala	Somatic	304.0	0.0		WXS	Illumina HiSeq	Phase_I	321.0	108.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	18.10	3.548853	0.65311	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.65	5.65	0.86999	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.59348	0.2187	L	0.50993	1.605	0.49582	D	0.999803	P;P;P;P	0.44090	0.826;0.826;0.826;0.826	P;P;P;P	0.45195	0.473;0.473;0.473;0.473	T	0.64402	-0.6416	9	0.87932	D	0	.	15.861	0.79021	0.0:0.0:0.0:1.0	.	18569;18694;18761;25993	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	25066;18569;18761;18694;18567	ENSP00000343764:T25066A;ENSP00000434586:T18569A;ENSP00000340554:T18761A;ENSP00000352154:T18694A	ENSP00000340554:T18761A	T	-	1	0	TTN	179136205	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.991000	0.88244	2.152000	0.67230	0.379000	0.24179	ACC	.		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179500233	179500233	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:179500233C>T	ENST00000591111.1	-	177	37119	c.36895G>A	c.(36895-36897)Gaa>Aaa	p.E12299K	TTN_ENST00000342175.6_Missense_Mutation_p.E5067K|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E5000K|TTN_ENST00000460472.2_Missense_Mutation_p.E4875K|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E11372K|TTN_ENST00000589042.1_Missense_Mutation_p.E13940K|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12299	Ig-like 82.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAATATCTTCTGGCATAGCA	0.353																																					p.E13940K		.											.	TTN	636	0			c.G41818A						.						91.0	79.0	83.0					2																	179500233		1849	4088	5937	SO:0001583	missense	7273	exon227			TATCTTCTGGCAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36895G>A	2.37:g.179500233C>T	ENSP00000465570:p.Glu12299Lys	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	49.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	18.12	3.552617	0.65425	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.94	5.94	0.96194	Immunoglobulin subtype (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46268	0.1384	L	0.50333	1.59	0.48830	D	0.999713	P;P;P;P	0.38922	0.651;0.651;0.651;0.651	B;B;B;B	0.33521	0.165;0.165;0.165;0.165	T	0.50591	-0.8810	9	0.87932	D	0	.	20.3658	0.98878	0.0:1.0:0.0:0.0	.	4875;5000;5067;12299	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	11372;4875;5067;5000;4875	ENSP00000343764:E11372K;ENSP00000434586:E4875K;ENSP00000340554:E5067K;ENSP00000352154:E5000K	ENSP00000340554:E5067K	E	-	1	0	TTN	179208478	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.866000	0.63005	2.820000	0.97059	0.650000	0.86243	GAA	.		0.353	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBR1	197131	hgsc.bcm.edu;bcgsc.ca	37	15	43314950	43314950	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr15:43314950T>C	ENST00000290650.4	-	26	2867	c.2789A>G	c.(2788-2790)cAa>cGa	p.Q930R	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	930					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AGGAGCTTTTTGAAGCTGTTG	0.348																																					p.Q930R		.											.	UBR1	91	0			c.A2789G						.						98.0	99.0	99.0					15																	43314950		2203	4298	6501	SO:0001583	missense	197131	exon26			GCTTTTTGAAGCT		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.2789A>G	15.37:g.43314950T>C	ENSP00000290650:p.Gln930Arg	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	4.0	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	T	18.32	3.597076	0.66332	.	.	ENSG00000159459	ENST00000290650;ENST00000546274	T	0.58506	0.33	4.77	4.77	0.60923	.	0.125005	0.53938	D	0.000041	T	0.51058	0.1652	L	0.53249	1.67	0.80722	D	1	P;P	0.38922	0.57;0.651	B;B	0.35114	0.196;0.165	T	0.51996	-0.8634	10	0.29301	T	0.29	-13.5412	14.7539	0.69549	0.0:0.0:0.0:1.0	.	930;930	B4DYL2;Q8IWV7	.;UBR1_HUMAN	R	930	ENSP00000290650:Q930R	ENSP00000290650:Q930R	Q	-	2	0	UBR1	41102242	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.280000	0.65603	2.134000	0.65973	0.528000	0.53228	CAA	.		0.348	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
UNC80	285175	hgsc.bcm.edu;bcgsc.ca	37	2	210809878	210809878	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr2:210809878A>G	ENST00000439458.1	+	45	7036	c.6956A>G	c.(6955-6957)gAg>gGg	p.E2319G	UNC80_ENST00000272845.6_Missense_Mutation_p.E2314G	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2319					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GACATCTTAGAGCTGGTCAAA	0.428																																					p.E2319G		.											.	UNC80	90	0			c.A6956G						.						68.0	61.0	63.0					2																	210809878		692	1591	2283	SO:0001583	missense	285175	exon45			TCTTAGAGCTGGT	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.6956A>G	2.37:g.210809878A>G	ENSP00000391088:p.Glu2319Gly	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	4.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284413	0.80803	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.37058	1.22;1.22	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.47192	0.1432	N	0.26042	0.785	0.80722	D	1	D	0.61080	0.989	D	0.72982	0.979	T	0.38436	-0.9661	10	0.35671	T	0.21	-22.4997	16.1299	0.81422	1.0:0.0:0.0:0.0	.	2319	Q8N2C7	UNC80_HUMAN	G	2319;2314	ENSP00000391088:E2319G;ENSP00000272845:E2314G	ENSP00000272845:E2314G	E	+	2	0	UNC80	210518123	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.527000	0.90594	2.215000	0.71742	0.528000	0.53228	GAG	.		0.428	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
VMP1	81671	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	57808841	57808841	+	Missense_Mutation	SNP	C	C	T	rs543321998		TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:57808841C>T	ENST00000262291.4	+	2	344	c.34C>T	c.(34-36)Cgt>Tgt	p.R12C	VMP1_ENST00000536180.1_5'UTR|VMP1_ENST00000545362.1_Missense_Mutation_p.R12C|VMP1_ENST00000537567.1_5'UTR|VMP1_ENST00000539763.1_5'UTR	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	12					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						TGACCAGAGACGTGTAGCAAT	0.348													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14778	0.0		0.0	False		,,,				2504	0.0				p.R12C		.											.	VMP1	226	0			c.C34T						.						107.0	104.0	105.0					17																	57808841		2203	4300	6503	SO:0001583	missense	81671	exon2			CAGAGACGTGTAG		CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.34C>T	17.37:g.57808841C>T	ENSP00000262291:p.Arg12Cys	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	31.0	NM_030938	B4DVV9|Q9H0P4|Q9P089	Missense_Mutation	SNP	ENST00000262291.4	37	CCDS11619.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508102	0.85282	.	.	ENSG00000062716	ENST00000262291;ENST00000545362	.	.	.	5.04	5.04	0.67666	.	0.226055	0.44285	D	0.000464	T	0.60090	0.2242	L	0.40543	1.245	0.80722	D	1	D;D	0.64830	0.994;0.987	P;B	0.50049	0.629;0.409	T	0.64114	-0.6483	9	0.56958	D	0.05	-6.6801	18.4015	0.90518	0.0:1.0:0.0:0.0	.	12;12	F5H2J3;Q96GC9	.;VMP1_HUMAN	C	12	.	ENSP00000262291:R12C	R	+	1	0	VMP1	55163623	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.624000	0.61254	2.320000	0.78422	0.460000	0.39030	CGT	.		0.348	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1	NM_030938	
VWA9	81556	hgsc.bcm.edu;bcgsc.ca	37	15	65871932	65871932	+	Silent	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr15:65871932A>G	ENST00000395644.4	-	12	1706	c.1371T>C	c.(1369-1371)gcT>gcC	p.A457A	VWA9_ENST00000567744.1_Silent_p.A493A|VWA9_ENST00000442903.3_Silent_p.A421A|VWA9_ENST00000431261.2_Silent_p.A378A|VWA9_ENST00000420799.2_Silent_p.A400A|VWA9_ENST00000569491.1_Silent_p.A407A|VWA9_ENST00000313182.2_Silent_p.A457A			Q96SY0	VWA9_HUMAN	von Willebrand factor A domain containing 9	457																	CCAGCATGTCAGCCACCCCTT	0.552																																					p.A439A		.											.	.	.	0			c.T1317C						.						70.0	61.0	64.0					15																	65871932		2201	4299	6500	SO:0001819	synonymous_variant	81556	exon12			CATGTCAGCCACC	AL136662	CCDS55969.1, CCDS45283.1	15q22.31	2012-09-27	2012-09-27	2012-09-27	ENSG00000138614	ENSG00000138614			25372	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 44"""	C15orf44		11230166	Standard	NM_001136043		Approved	DKFZP564O1664	uc010uja.2	Q96SY0	OTTHUMG00000133159	ENST00000395644.4:c.1371T>C	15.37:g.65871932A>G		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	5.0	NM_001207058	B4DDI6|B4DVD5|Q49AH8|Q96HX5|Q9H0S5	Silent	SNP	ENST00000395644.4	37																																																																																				.		0.552	VWA9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420604.3	NM_030800	
CFAP43	80217	hgsc.bcm.edu;bcgsc.ca	37	10	105971830	105971830	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr10:105971830A>G	ENST00000278064.2	-	5	785	c.460T>C	c.(460-462)Tat>Cat	p.Y154H	WDR96_ENST00000428666.1_Missense_Mutation_p.Y224H|WDR96_ENST00000357060.3_Missense_Mutation_p.Y224H|WDR96_ENST00000369720.1_Missense_Mutation_p.Y154H|WDR96_ENST00000369719.1_Missense_Mutation_p.Y154H																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACGGGACCATAGATGAGATCT	0.493																																					p.Y224H		.											.	WDR96	95	0			c.T670C						.						86.0	79.0	82.0					10																	105971830		2203	4300	6503	SO:0001583	missense	80217	exon5			GACCATAGATGAG																												ENST00000278064.2:c.460T>C	10.37:g.105971830A>G	ENSP00000278064:p.Tyr154His	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	4.0	NM_025145		Missense_Mutation	SNP	ENST00000278064.2	37		.	.	.	.	.	.	.	.	.	.	A	14.99	2.699136	0.48307	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064;ENST00000369720;ENST00000369719	T;T;T;T;T	0.48201	2.41;2.4;2.39;1.41;0.82	5.51	5.51	0.81932	WD40 repeat-like-containing domain (1);	0.000000	0.34676	N	0.003774	T	0.57330	0.2046	M	0.74258	2.255	0.31682	N	0.642947	B;P;P	0.51653	0.41;0.947;0.786	B;P;B	0.50270	0.113;0.636;0.321	T	0.65446	-0.6166	10	0.27082	T	0.32	.	14.6028	0.68453	1.0:0.0:0.0:0.0	.	224;224;224	Q8NDM7-5;B4DHB6;Q8NDM7	.;.;WDR96_HUMAN	H	224;224;154;154;154	ENSP00000349568:Y224H;ENSP00000400289:Y224H;ENSP00000278064:Y154H;ENSP00000358734:Y154H;ENSP00000358733:Y154H	ENSP00000278064:Y154H	Y	-	1	0	WDR96	105961820	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	3.888000	0.56204	2.101000	0.63845	0.533000	0.62120	TAT	.		0.493	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1		
WHSC1L1	54904	hgsc.bcm.edu;bcgsc.ca	37	8	38178646	38178646	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr8:38178646A>G	ENST00000317025.8	-	8	2270	c.1753T>C	c.(1753-1755)Tct>Cct	p.S585P	WHSC1L1_ENST00000316985.3_Missense_Mutation_p.S585P|WHSC1L1_ENST00000433384.2_Missense_Mutation_p.S585P|WHSC1L1_ENST00000525081.1_5'Flank|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.S585P	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	585					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TCTGATTCAGAACGAGTTCTA	0.358			T	NUP98	AML																																p.S585P		.		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	.	WHSC1L1	658	0			c.T1753C						.						176.0	159.0	165.0					8																	38178646		2203	4300	6503	SO:0001583	missense	54904	exon8			ATTCAGAACGAGT	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.1753T>C	8.37:g.38178646A>G	ENSP00000313983:p.Ser585Pro	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_017778	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	SNP	ENST00000317025.8	37	CCDS43729.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.770502	0.90108	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502;ENST00000316985;ENST00000528627	D;D;D;T	0.95238	-3.65;-3.65;-3.65;-0.9	5.71	5.71	0.89125	.	0.000000	0.47455	U	0.000226	D	0.96175	0.8753	L	0.50333	1.59	0.58432	D	0.999995	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.91635	0.994;0.997;0.999;0.994	D	0.96409	0.9303	10	0.56958	D	0.05	.	15.9628	0.79945	1.0:0.0:0.0:0.0	.	585;585;585;585	B7ZL11;Q9BZ95-2;Q9BZ95-3;Q9BZ95	.;.;.;NSD3_HUMAN	P	585;585;522;585;585;51	ENSP00000393284:S585P;ENSP00000313983:S585P;ENSP00000434730:S585P;ENSP00000313410:S585P	ENSP00000313410:S585P	S	-	1	0	WHSC1L1	38297803	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.060000	0.89464	2.166000	0.68216	0.482000	0.46254	TCT	.		0.358	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3	NM_023034	
WIPF2	147179	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38430226	38430226	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr17:38430226T>C	ENST00000323571.4	+	6	1395	c.1155T>C	c.(1153-1155)tcT>tcC	p.S385S	WIPF2_ENST00000583130.1_Silent_p.S385S|WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000585043.1_Silent_p.S385S|WIPF2_ENST00000536600.1_Silent_p.S127S|WIPF2_ENST00000394103.3_Silent_p.S127S	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	385					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						ACAGAGATTCTATCACCACTG	0.602										HNSCC(43;0.11)																											p.S385S		.											.	WIPF2	93	0			c.T1155C						.						136.0	114.0	121.0					17																	38430226		2203	4300	6503	SO:0001819	synonymous_variant	147179	exon6			AGATTCTATCACC	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.1155T>C	17.37:g.38430226T>C		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	24.0	NM_133264	A8K0L3|Q658J8|Q71RE1|Q8TE44	Silent	SNP	ENST00000323571.4	37	CCDS11364.1																																																																																			.		0.602	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264	
XPNPEP1	7511	hgsc.bcm.edu;bcgsc.ca	37	10	111635319	111635319	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr10:111635319T>C	ENST00000502935.1	-	15	1477	c.1358A>G	c.(1357-1359)gAg>gGg	p.E453G	XPNPEP1_ENST00000322238.8_Intron|XPNPEP1_ENST00000369683.1_Missense_Mutation_p.E339G|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.E410G					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		AAGGTACACCTCATCCAGGGA	0.438																																					p.E453G		.											.	XPNPEP1	94	0			c.A1358G						.						127.0	103.0	111.0					10																	111635319		2203	4300	6503	SO:0001583	missense	7511	exon15			TACACCTCATCCA		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1358A>G	10.37:g.111635319T>C	ENSP00000421566:p.Glu453Gly	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	4.0	NM_020383		Missense_Mutation	SNP	ENST00000502935.1	37	CCDS7560.2	.	.	.	.	.	.	.	.	.	.	T	25.6	4.659386	0.88154	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000369680	T;T;T	0.77358	-1.09;-1.09;-1.09	5.43	5.43	0.79202	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	T	0.77425	0.4128	N	0.24115	0.695	0.54753	D	0.999988	D	0.89917	1.0	D	0.77557	0.99	T	0.71813	-0.4479	10	0.06891	T	0.86	-23.1133	14.3486	0.66685	0.0:0.0:0.0:1.0	.	410	Q9NQW7	XPP1_HUMAN	G	453;339;410	ENSP00000421566:E453G;ENSP00000358697:E339G;ENSP00000358694:E410G	ENSP00000358694:E410G	E	-	2	0	XPNPEP1	111625309	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	5.682000	0.68182	2.179000	0.69175	0.533000	0.62120	GAG	.		0.438	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2		
YTHDF2	51441	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	29069727	29069727	+	Silent	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr1:29069727A>G	ENST00000373812.3	+	4	1307	c.945A>G	c.(943-945)ccA>ccG	p.P315P	YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000541996.1_Silent_p.P265P|YTHDF2_ENST00000542507.1_Silent_p.P315P	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2	315	Localization to mRNA processing bodies (P-bodies).				humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		ACAATAGCCCACCAGTGGCTC	0.577																																					p.P315P		.											.	YTHDF2	92	0			c.A945G						.						47.0	48.0	47.0					1																	29069727		1985	4151	6136	SO:0001819	synonymous_variant	51441	exon4			TAGCCCACCAGTG	AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.945A>G	1.37:g.29069727A>G		Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	373.0	47.0	NM_016258	A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	Silent	SNP	ENST00000373812.3	37	CCDS41296.1																																																																																			.		0.577	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010335.1	NM_016258	
ZBTB14	7541	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	5291325	5291325	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr18:5291325C>A	ENST00000357006.4	-	4	1220	c.882G>T	c.(880-882)aaG>aaT	p.K294N	ZBTB14_ENST00000400143.3_Missense_Mutation_p.K294N	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	294					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)										GTTTCTCATGCTTCCTCAATC	0.478																																					p.K294N		.											.	.	.	0			c.G882T						.						98.0	89.0	92.0					18																	5291325		2203	4300	6503	SO:0001583	missense	7541	exon4			CTCATGCTTCCTC	D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.882G>T	18.37:g.5291325C>A	ENSP00000349503:p.Lys294Asn	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	43.0	NM_001243702	O00403|Q2TB80	Missense_Mutation	SNP	ENST00000357006.4	37	CCDS11837.1	.	.	.	.	.	.	.	.	.	.	C	9.860	1.195990	0.22037	.	.	ENSG00000198081	ENST00000357006;ENST00000400143	T;T	0.20598	2.06;2.06	5.8	3.05	0.35203	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.103499	0.64402	D	0.000006	T	0.18509	0.0444	L	0.33668	1.02	0.54753	D	0.999989	D	0.57257	0.979	P	0.48368	0.575	T	0.02031	-1.1226	10	0.33940	T	0.23	-20.0419	7.9098	0.29785	0.0:0.5701:0.0:0.4299	.	294	O43829	ZF161_HUMAN	N	294	ENSP00000349503:K294N;ENSP00000383009:K294N	ENSP00000349503:K294N	K	-	3	2	ZFP161	5281325	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	0.666000	0.25097	0.361000	0.24292	0.650000	0.86243	AAG	.		0.478	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254425.1	NM_003409	
ZDHHC2	51201	hgsc.bcm.edu;bcgsc.ca	37	8	17067945	17067945	+	Silent	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr8:17067945T>C	ENST00000262096.8	+	10	1601	c.906T>C	c.(904-906)ccT>ccC	p.P302P		NM_016353.4	NP_057437.1	Q9UIJ5	ZDHC2_HUMAN	zinc finger, DHHC-type containing 2	302					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|recycling endosome membrane (GO:0055038)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|pancreas(1)|stomach(1)	8				Colorectal(111;0.0697)|COAD - Colon adenocarcinoma(73;0.244)		ACCAGGATCCTGAACAAGCAT	0.348																																					p.P302P		.											.	.	.	0			c.T906C						.						77.0	72.0	73.0					8																	17067945		1835	4094	5929	SO:0001819	synonymous_variant	51201	exon10			GGATCCTGAACAA	AB023584	CCDS47810.1	8p22	2008-05-15			ENSG00000104219	ENSG00000104219		"""Zinc fingers, DHHC-type"""	18469	protein-coding gene	gene with protein product						10918388	Standard	NM_016353		Approved	ZNF372	uc003wxe.3	Q9UIJ5	OTTHUMG00000163860	ENST00000262096.8:c.906T>C	8.37:g.17067945T>C		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_016353	D3DSP5	Silent	SNP	ENST00000262096.8	37	CCDS47810.1																																																																																			.		0.348	ZDHHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376014.2	NM_016353	
ZNF347	84671	hgsc.bcm.edu;bcgsc.ca	37	19	53645764	53645764	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr19:53645764T>C	ENST00000334197.7	-	5	385	c.317A>G	c.(316-318)aAg>aGg	p.K106R	ZNF347_ENST00000452676.2_Missense_Mutation_p.K107R|ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Missense_Mutation_p.K107R	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	106					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		TGTATTACTCTTCCCTTTGTG	0.358																																					p.K107R	Melanoma(64;205 1597 17324 45721)	.											.	ZNF347	90	0			c.A320G						.						60.0	53.0	55.0					19																	53645764		2203	4299	6502	SO:0001583	missense	84671	exon5			TTACTCTTCCCTT	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.317A>G	19.37:g.53645764T>C	ENSP00000334146:p.Lys106Arg	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	5.0	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	T	3.500	-0.102088	0.06967	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.07021	3.23;3.23	2.57	-1.34	0.09143	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	P;B	0.42908	0.793;0.316	B;B	0.37780	0.258;0.098	T	0.28138	-1.0053	9	0.18710	T	0.47	.	0.3772	0.00389	0.2189:0.1429:0.2244:0.4138	.	107;106	G5E9N4;Q96SE7	.;ZN347_HUMAN	R	106;107	ENSP00000334146:K106R;ENSP00000405218:K107R	ENSP00000334146:K106R	K	-	2	0	ZNF347	58337576	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.782000	0.04643	-0.596000	0.05821	-0.256000	0.11100	AAG	.		0.358	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
ZNF598	90850	hgsc.bcm.edu;bcgsc.ca	37	16	2053113	2053113	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:2053113A>G	ENST00000563630.1	-	3	421	c.179T>C	c.(178-180)cTg>cCg	p.L60P	ZNF598_ENST00000431526.1_Missense_Mutation_p.L115P|ZNF598_ENST00000562103.1_Missense_Mutation_p.L60P			Q86UK7	ZN598_HUMAN	zinc finger protein 598	115							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						CTCGTGCTGCAGCAGCTGCCT	0.687																																					p.L115P		.											.	ZNF598	432	0			c.T344C						.						8.0	11.0	10.0					16																	2053113		2009	4154	6163	SO:0001583	missense	90850	exon5			TGCTGCAGCAGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.179T>C	16.37:g.2053113A>G	ENSP00000455882:p.Leu60Pro	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_178167	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000563630.1	37		.	.	.	.	.	.	.	.	.	.	.	20.4	3.991751	0.74703	.	.	ENSG00000167962	ENST00000431526	T	0.32272	1.46	4.73	3.65	0.41850	.	0.000000	0.64402	D	0.000002	T	0.55417	0.1919	M	0.86097	2.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60870	-0.7177	10	0.87932	D	0	-15.1366	8.9718	0.35910	0.912:0.0:0.088:0.0	.	115	Q86UK7	ZN598_HUMAN	P	115	ENSP00000411409:L115P	ENSP00000411409:L115P	L	-	2	0	ZNF598	1993114	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.552000	0.67281	1.773000	0.52216	0.533000	0.62120	CTG	.		0.687	ZNF598-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000434439.1	NM_178167	
ZNF423	23090	hgsc.bcm.edu;bcgsc.ca	37	16	49672029	49672029	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr16:49672029T>C	ENST00000561648.1	-	4	1087	c.1034A>G	c.(1033-1035)cAc>cGc	p.H345R	ZNF423_ENST00000562520.1_Missense_Mutation_p.H285R|ZNF423_ENST00000567169.1_Missense_Mutation_p.H228R|ZNF423_ENST00000262383.2_Missense_Mutation_p.H345R|ZNF423_ENST00000562871.1_Missense_Mutation_p.H285R|ZNF423_ENST00000563137.2_Missense_Mutation_p.H285R|ZNF423_ENST00000535559.1_Missense_Mutation_p.H228R	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	345					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGGCTGCCGGTGGCTGTCCAG	0.632																																					p.H345R		.											.	ZNF423	228	0			c.A1034G						.						54.0	48.0	50.0					16																	49672029		2198	4300	6498	SO:0001583	missense	23090	exon4			TGCCGGTGGCTGT	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1034A>G	16.37:g.49672029T>C	ENSP00000455426:p.His345Arg	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	6.0	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.417281	0.42918	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	D;D	0.88975	-2.45;-2.45	5.0	5.0	0.66597	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.046152	0.85682	D	0.000000	D	0.94003	0.8079	M	0.89904	3.07	0.44055	D	0.996797	D	0.57899	0.981	P	0.56163	0.793	D	0.94876	0.8034	9	.	.	.	.	14.7223	0.69317	0.0:0.0:0.0:1.0	.	345	Q2M1K9	ZN423_HUMAN	R	345;228	ENSP00000262383:H345R;ENSP00000442321:H228R	.	H	-	2	0	ZNF423	48229530	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.139000	0.71728	1.891000	0.54761	0.459000	0.35465	CAC	.		0.632	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
ZNF841	284371	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	19	52569542	52569542	+	Silent	SNP	A	A	G			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr19:52569542A>G	ENST00000426391.2	-	5	1796	c.1245T>C	c.(1243-1245)caT>caC	p.H415H	ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000594295.1_Silent_p.H531H|CTC-471J1.2_ENST00000569091.1_RNA|ZNF841_ENST00000389534.4_Silent_p.H531H|ZNF841_ENST00000359973.2_Intron			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						GAATTCTCTGATGTACAGTTA	0.398																																					p.H531H		.											.	.	.	0			c.T1593C						.						99.0	91.0	94.0					19																	52569542		692	1591	2283	SO:0001819	synonymous_variant	284371	exon7			TCTCTGATGTACA	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.1245T>C	19.37:g.52569542A>G		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	4.0	NM_001136499	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Silent	SNP	ENST00000426391.2	37																																																																																				.		0.398	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	
ZNF761	388561	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	19	53959189	53959189	+	RNA	SNP	T	T	C			TCGA-DD-A39Y-01A-11D-A20W-10	TCGA-DD-A39Y-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8cf411-5c5e-428b-b586-681ff7341d19	913c971b-4d3d-445d-92b6-feda7a575e32	g.chr19:53959189T>C	ENST00000454407.1	+	0	1881							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		AAGCTTTCCGTTTCAAATCAA	0.423																																					p.R476R		.											.	ZNF761	91	0			c.T1428C						.						76.0	80.0	78.0					19																	53959189		2203	4300	6503			388561	exon7			TTTCCGTTTCAAA	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959189T>C		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	10.0	NM_001008401	Q6ZNB9	Silent	SNP	ENST00000454407.1	37																																																																																				.		0.423	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
