#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA2	20	hgsc.bcm.edu;bcgsc.ca	37	9	139913717	139913717	+	Silent	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr9:139913717A>G	ENST00000371605.3	-	10	1611	c.1464T>C	c.(1462-1464)taT>taC	p.Y488Y	ABCA2_ENST00000492260.1_5'UTR|ABCA2_ENST00000341511.6_Silent_p.Y489Y|ABCA2_ENST00000265662.5_Silent_p.Y489Y			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	488					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		AGACCTGGGCATAGTGAGTCA	0.637																																					p.Y519Y		.											.	ABCA2	90	0			c.T1557C						.						39.0	46.0	44.0					9																	139913717		2069	4201	6270	SO:0001819	synonymous_variant	20	exon11			CTGGGCATAGTGA	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.1464T>C	9.37:g.139913717A>G		Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Silent	SNP	ENST00000371605.3	37		.	.	.	.	.	.	.	.	.	.	a	10.84	1.464995	0.26335	.	.	ENSG00000107331	ENST00000470535	.	.	.	3.58	-2.81	0.05805	.	.	.	.	.	T	0.56093	0.1962	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54820	-0.8236	4	.	.	.	.	11.4306	0.50038	0.5697:0.0:0.4303:0.0	.	.	.	.	R	100	.	.	C	-	1	0	ABCA2	139033538	0.950000	0.32346	0.956000	0.39512	0.992000	0.81027	0.002000	0.13061	-0.412000	0.07519	0.398000	0.26397	TGC	.		0.637	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
ABCA4	24	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	94502755	94502755	+	Silent	SNP	C	C	A	rs147884766	byFrequency	TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:94502755C>A	ENST00000370225.3	-	25	3845	c.3759G>T	c.(3757-3759)acG>acT	p.T1253T		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1253			T -> M (in FFM; unknown pathological significance). {ECO:0000269|PubMed:11385708}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGTCAGCCAGCGTCTCCTCCA	0.483																																					p.T1253T		.											.	ABCA4	162	0			c.G3759T						.						106.0	108.0	107.0					1																	94502755		2203	4300	6503	SO:0001819	synonymous_variant	24	exon25			AGCCAGCGTCTCC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3759G>T	1.37:g.94502755C>A		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	35.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																			C|0.998;T|0.002		0.483	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
ACACB	32	hgsc.bcm.edu;bcgsc.ca	37	12	109617834	109617834	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:109617834T>C	ENST00000338432.7	+	11	1879	c.1760T>C	c.(1759-1761)gTg>gCg	p.V587A	ACACB_ENST00000543080.1_3'UTR|ACACB_ENST00000377848.3_Missense_Mutation_p.V587A|ACACB_ENST00000377854.5_Missense_Mutation_p.V587A			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	587	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CGCTTGCAGGTGGAACATCCC	0.557																																					p.V587A		.											.	ACACB	98	0			c.T1760C						.						106.0	93.0	97.0					12																	109617834		2203	4300	6503	SO:0001583	missense	32	exon10			TGCAGGTGGAACA	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1760T>C	12.37:g.109617834T>C	ENSP00000341044:p.Val587Ala	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.880874	0.91740	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	D;D;D	0.97598	-4.45;-4.45;-4.45	4.89	4.89	0.63831	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.99171	0.9713	H	0.99104	4.43	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98671	1.0688	10	0.87932	D	0	.	14.4983	0.67704	0.0:0.0:0.0:1.0	.	587	O00763	ACACB_HUMAN	A	587	ENSP00000341044:V587A;ENSP00000367079:V587A;ENSP00000367085:V587A	ENSP00000341044:V587A	V	+	2	0	ACACB	108102217	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.929000	0.87595	1.835000	0.53391	0.533000	0.62120	GTG	.		0.557	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
ADAM23	8745	hgsc.bcm.edu;bcgsc.ca	37	2	207414830	207414830	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:207414830T>C	ENST00000264377.3	+	9	1207	c.879T>C	c.(877-879)ggT>ggC	p.G293G	ADAM23_ENST00000374415.3_Silent_p.G293G|ADAM23_ENST00000374416.1_Silent_p.G293G	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	293					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CATCACGTGGTATATTTGAAG	0.308																																					p.G293G	Melanoma(194;1127 2130 19620 24042 27855)	.											.	ADAM23	228	0			c.T879C						.						83.0	83.0	83.0					2																	207414830		2202	4296	6498	SO:0001819	synonymous_variant	8745	exon9			ACGTGGTATATTT	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.879T>C	2.37:g.207414830T>C		Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	4.0	NM_003812	A2RU59	Silent	SNP	ENST00000264377.3	37	CCDS2369.1																																																																																			.		0.308	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	
ADAMTS20	80070	hgsc.bcm.edu;bcgsc.ca	37	12	43856718	43856718	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:43856718T>C	ENST00000389420.3	-	11	1593	c.1594A>G	c.(1594-1596)Aca>Gca	p.T532A	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.T532A	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	532	Disintegrin.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CCGCAGTCTGTTCCATCTGCT	0.438																																					p.T532A		.											.	ADAMTS20	795	0			c.A1594G						.						148.0	113.0	125.0					12																	43856718		2203	4300	6503	SO:0001583	missense	80070	exon11			AGTCTGTTCCATC	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1594A>G	12.37:g.43856718T>C	ENSP00000374071:p.Thr532Ala	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	T	21.2	4.111586	0.77210	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.70869	-0.34;-0.52	4.87	4.87	0.63330	.	0.000000	0.53938	D	0.000045	D	0.89451	0.6719	H	0.97564	4.03	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.93193	0.6585	10	0.87932	D	0	.	15.1967	0.73096	0.0:0.0:0.0:1.0	.	532	P59510	ATS20_HUMAN	A	532	ENSP00000374071:T532A;ENSP00000448341:T532A	ENSP00000374068:T532A	T	-	1	0	ADAMTS20	42142985	1.000000	0.71417	0.985000	0.45067	0.744000	0.42396	7.559000	0.82265	2.123000	0.65237	0.533000	0.62120	ACA	.		0.438	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
ALDH1A2	8854	hgsc.bcm.edu;bcgsc.ca	37	15	58306387	58306387	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:58306387T>C	ENST00000249750.4	-	2	977	c.210A>G	c.(208-210)caA>caG	p.Q70Q	ALDH1A2_ENST00000347587.3_Silent_p.Q70Q|ALDH1A2_ENST00000537372.1_Silent_p.Q49Q|ALDH1A2_ENST00000558231.1_Silent_p.Q41Q|ALDH1A2_ENST00000559517.1_5'Flank	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	70					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	TGTCTGCTTCTTGAACTTCAC	0.423																																					p.Q70Q		.											.	ALDH1A2	226	0			c.A210G						.						111.0	106.0	108.0					15																	58306387		2192	4292	6484	SO:0001819	synonymous_variant	8854	exon2			TGCTTCTTGAACT	AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.210A>G	15.37:g.58306387T>C		Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	5.0	NM_003888	B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Silent	SNP	ENST00000249750.4	37	CCDS10163.1																																																																																			.		0.423	ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255869.1		
ALMS1	7840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	73716837	73716837	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:73716837A>G	ENST00000264448.6	+	10	7859	c.7748A>G	c.(7747-7749)aAg>aGg	p.K2583R	AC096546.1_ENST00000408160.1_RNA|ALMS1_ENST00000409009.1_Missense_Mutation_p.K2541R	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2583					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AGCCATGAAAAGGGATGTTTC	0.458																																					p.K2583R		.											.	ALMS1	142	0			c.A7748G						.						124.0	118.0	120.0					2																	73716837		1918	4116	6034	SO:0001583	missense	7840	exon10			ATGAAAAGGGATG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.7748A>G	2.37:g.73716837A>G	ENSP00000264448:p.Lys2583Arg	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	22.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	A	13.46	2.242566	0.39598	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.10860	2.83;2.83	4.45	3.31	0.37934	.	0.000000	0.52532	D	0.000080	T	0.09949	0.0244	L	0.48642	1.525	0.80722	D	1	P;P;P	0.41597	0.756;0.756;0.756	B;B;B	0.39805	0.31;0.31;0.31	T	0.08229	-1.0732	10	0.51188	T	0.08	.	6.6531	0.22973	0.8956:0.0:0.1044:0.0	.	2583;2541;2583	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	R	2541;2583	ENSP00000386627:K2541R;ENSP00000264448:K2583R	ENSP00000264448:K2583R	K	+	2	0	ALMS1	73570345	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	1.674000	0.37544	1.041000	0.40125	0.528000	0.53228	AAG	.		0.458	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
SFT2D2	375035	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	168216136	168216136	+	3'UTR	SNP	A	A	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:168216136A>C	ENST00000271375.4	+	0	4913				ANKRD36BP1_ENST00000358576.4_RNA	NM_199344.2	NP_955376.1			SFT2 domain containing 2											lung(3)|skin(1)	4	all_hematologic(923;0.215)					TCTTTTAAGTATTTCTTTTCC	0.333																																					.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	84832	.			TTAAGTATTTCTT	AL035297	CCDS1271.1	1q24.2	2008-02-05			ENSG00000213064	ENSG00000213064			25140	protein-coding gene	gene with protein product							Standard	NM_199344		Approved	UNQ512, dJ747L4.C1.2	uc001gfi.4	O95562	OTTHUMG00000034650	ENST00000271375.4:c.*4358A>C	1.37:g.168216136A>C		Somatic	266.0	1.0		WXS	Illumina HiSeq	Phase_I	200.0	58.0	.		RNA	SNP	ENST00000271375.4	37	CCDS1271.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.207083	0.39003	.	.	ENSG00000214262	ENST00000358576	.	.	.	0.827	0.827	0.18835	.	.	.	.	.	T	0.30103	0.0754	.	.	.	.	.	.	.	.	.	.	.	.	T	0.18903	-1.0322	4	0.87932	D	0	.	5.8276	0.18562	1.0:0.0:0.0:0.0	.	.	.	.	D	50	.	ENSP00000351384:Y50D	Y	-	1	0	ANKRD36BP1	166482760	1.000000	0.71417	0.423000	0.26634	0.313000	0.28021	1.198000	0.32223	0.609000	0.30018	0.172000	0.16884	TAC	.		0.333	SFT2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083827.2	NM_199344	
AP1G1	164	hgsc.bcm.edu;bcgsc.ca	37	16	71779499	71779499	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr16:71779499T>C	ENST00000299980.4	-	18	2190	c.1749A>G	c.(1747-1749)agA>agG	p.R583R	AP1G1_ENST00000569748.1_Silent_p.R583R|AP1G1_ENST00000433195.2_Silent_p.R606R|AP1G1_ENST00000564155.1_Silent_p.R8R|AP1G1_ENST00000423132.2_Silent_p.R586R|AP1G1_ENST00000393512.3_Silent_p.R586R	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	583					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TGACAGGCATTCTCTCAAGTA	0.448																																					p.R586R		.											.	AP1G1	92	0			c.A1758G						.						163.0	157.0	159.0					16																	71779499		2198	4300	6498	SO:0001819	synonymous_variant	164	exon19			AGGCATTCTCTCA	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.1749A>G	16.37:g.71779499T>C		Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_001030007	O75709|O75842|Q9UG09|Q9Y3U4	Silent	SNP	ENST00000299980.4	37	CCDS32480.1																																																																																			.		0.448	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
AP1G1	164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	71798318	71798318	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr16:71798318C>A	ENST00000299980.4	-	9	1294	c.853G>T	c.(853-855)Gga>Tga	p.G285*	AP1G1_ENST00000569748.1_Nonsense_Mutation_p.G285*|AP1G1_ENST00000433195.2_Nonsense_Mutation_p.G308*|AP1G1_ENST00000423132.2_Nonsense_Mutation_p.G288*|AP1G1_ENST00000393512.3_Nonsense_Mutation_p.G288*	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	285					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				ATAGCATTTCCTACATTTTTA	0.363																																					p.G288X		.											.	AP1G1	92	0			c.G862T						.						84.0	75.0	78.0					16																	71798318		2197	4300	6497	SO:0001587	stop_gained	164	exon10			CATTTCCTACATT	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.853G>T	16.37:g.71798318C>A	ENSP00000299980:p.Gly285*	Somatic	255.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	65.0	NM_001030007	O75709|O75842|Q9UG09|Q9Y3U4	Nonsense_Mutation	SNP	ENST00000299980.4	37	CCDS32480.1	.	.	.	.	.	.	.	.	.	.	C	46	12.949327	0.99708	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195;ENST00000538574;ENST00000425422	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-12.4855	19.7714	0.96367	0.0:1.0:0.0:0.0	.	.	.	.	X	285;288;288;308;156;370	.	ENSP00000299980:G285X	G	-	1	0	AP1G1	70355819	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.666000	0.90696	0.655000	0.94253	GGA	.		0.363	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
AQR	9716	hgsc.bcm.edu;bcgsc.ca	37	15	35166047	35166047	+	Silent	SNP	A	A	G	rs368882712		TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:35166047A>G	ENST00000156471.5	-	30	3804	c.3579T>C	c.(3577-3579)ccT>ccC	p.P1193P		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	1193					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AGTAAGGATTAGGTTCAGATT	0.373																																					p.P1193P		.											.	AQR	135	0			c.T3579C						.	A		0,3674		0,0,1837	85.0	85.0	85.0		3579	-3.1	1.0	15		85	1,8161		0,1,4080	no	coding-synonymous	AQR	NM_014691.2		0,1,5917	GG,GA,AA		0.0123,0.0,0.0084		1193/1486	35166047	1,11835	1837	4081	5918	SO:0001819	synonymous_variant	9716	exon30			AGGATTAGGTTCA	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.3579T>C	15.37:g.35166047A>G		Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Silent	SNP	ENST00000156471.5	37	CCDS42013.1																																																																																			.		0.373	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
AP4E1	23431	hgsc.bcm.edu;bcgsc.ca	37	15	51289911	51289911	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:51289911A>G	ENST00000261842.5	+	18	2841	c.2735A>G	c.(2734-2736)gAa>gGa	p.E912G	AP4E1_ENST00000560508.1_Missense_Mutation_p.E837G	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	912					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		GAAACTACTGAATACATACAC	0.348																																					p.E912G		.											.	AP4E1	90	0			c.A2735G						.						66.0	68.0	67.0					15																	51289911		2196	4294	6490	SO:0001583	missense	23431	exon18			CTACTGAATACAT	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2735A>G	15.37:g.51289911A>G	ENSP00000261842:p.Glu912Gly	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	4.0	NM_007347	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	ENST00000261842.5	37	CCDS32240.1	.	.	.	.	.	.	.	.	.	.	A	11.94	1.789433	0.31685	.	.	ENSG00000081014	ENST00000261842	T	0.19532	2.14	5.2	5.2	0.72013	Coatomer, beta subunit, C-terminal (1);	0.109704	0.64402	D	0.000008	T	0.20536	0.0494	L	0.43152	1.355	0.41394	D	0.987639	B	0.12013	0.005	B	0.10450	0.005	T	0.02444	-1.1158	10	0.41790	T	0.15	-16.8814	14.2599	0.66078	1.0:0.0:0.0:0.0	.	912	Q9UPM8	AP4E1_HUMAN	G	912	ENSP00000261842:E912G	ENSP00000261842:E912G	E	+	2	0	AP4E1	49077203	0.967000	0.33354	0.905000	0.35620	0.662000	0.39071	2.870000	0.48451	1.966000	0.57179	0.383000	0.25322	GAA	.		0.348	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1		
ARRB2	409	hgsc.bcm.edu;bcgsc.ca	37	17	4624255	4624255	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr17:4624255A>G	ENST00000269260.2	+	15	1384	c.1151A>G	c.(1150-1152)gAt>gGt	p.D384G	ARRB2_ENST00000381488.6_Missense_Mutation_p.D369G|ARRB2_ENST00000575877.1_3'UTR|ARRB2_ENST00000574954.1_Missense_Mutation_p.D192G|ARRB2_ENST00000346341.2_Missense_Mutation_p.D381G|ARRB2_ENST00000571206.1_Missense_Mutation_p.D192G|ARRB2_ENST00000412477.3_Missense_Mutation_p.D405G|ARRB2_ENST00000572457.1_Missense_Mutation_p.D192G	NM_001257328.1|NM_001257330.1|NM_004313.3	NP_001244257.1|NP_001244259.1|NP_004304.1	P32121	ARRB2_HUMAN	arrestin, beta 2	384	Interaction with AP2B1.|Interaction with TRAF6.				adult walking behavior (GO:0007628)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell chemotaxis (GO:0060326)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|Notch signaling pathway (GO:0007219)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|receptor internalization (GO:0031623)|regulation of androgen receptor signaling pathway (GO:0060765)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	angiotensin receptor binding (GO:0031701)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|ubiquitin protein ligase binding (GO:0031625)			large_intestine(1)|liver(2)|lung(3)|prostate(1)	7						GCCACAGATGATGACATTGTG	0.567																																					p.D405G		.											.	ARRB2	522	0			c.A1214G						.						192.0	149.0	164.0					17																	4624255		2203	4300	6503	SO:0001583	missense	409	exon15			CAGATGATGACAT		CCDS11050.1, CCDS11051.1, CCDS58504.1, CCDS58505.1, CCDS59276.1	17p13	2008-12-11			ENSG00000141480	ENSG00000141480			712	protein-coding gene	gene with protein product	"""arrestin 3"""	107941		ARR2		7695743	Standard	NM_001257329		Approved	BARR2, DKFZp686L0365	uc002fyl.3	P32121	OTTHUMG00000090759	ENST00000269260.2:c.1151A>G	17.37:g.4624255A>G	ENSP00000269260:p.Asp384Gly	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	4.0	NM_001257328	B4DLW0|B5B0C0|B7WPL3|D3DTK2|H0Y688|Q0Z8D3|Q2PP19|Q6ICT3|Q8N7Y2|Q9UEQ6	Missense_Mutation	SNP	ENST00000269260.2	37	CCDS11050.1	.	.	.	.	.	.	.	.	.	.	A	12.77	2.036839	0.35893	.	.	ENSG00000141480	ENST00000381488;ENST00000269260;ENST00000346341;ENST00000412477	T	0.20738	2.05	4.16	4.16	0.48862	Immunoglobulin E-set (1);Arrestin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.24509	0.0594	L	0.52126	1.63	0.80722	D	1	B;P;P;B;B	0.39131	0.044;0.661;0.661;0.016;0.185	B;B;B;B;B	0.42798	0.048;0.398;0.398;0.024;0.109	T	0.03739	-1.1008	10	0.66056	D	0.02	-12.6481	11.4482	0.50136	1.0:0.0:0.0:0.0	.	405;381;396;369;384	B4DLW0;P32121-2;P32121-3;G5E980;P32121	.;.;.;.;ARRB2_HUMAN	G	396;384;369;385	ENSP00000269260:D384G	ENSP00000269260:D384G	D	+	2	0	ARRB2	4571004	1.000000	0.71417	0.504000	0.27639	0.438000	0.31896	6.685000	0.74543	1.885000	0.54596	0.450000	0.29827	GAT	.		0.567	ARRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439552.1	NM_004313	
ASGR2	433	hgsc.bcm.edu;bcgsc.ca	37	17	7011175	7011175	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr17:7011175T>C	ENST00000380952.2	-	5	668	c.404A>G	c.(403-405)cAg>cGg	p.Q135R	ASGR2_ENST00000254850.7_Missense_Mutation_p.Q111R|ASGR2_ENST00000355035.5_Missense_Mutation_p.Q135R|ASGR2_ENST00000446679.2_Missense_Mutation_p.Q116R	NM_001181.4|NM_001201352.1|NM_080912.3	NP_001172|NP_001188281.1|NP_550434	P07307	ASGR2_HUMAN	asialoglycoprotein receptor 2	135					bone mineralization (GO:0030282)|cell surface receptor signaling pathway (GO:0007166)|glycoprotein metabolic process (GO:0009100)|lipid homeostasis (GO:0055088)|receptor-mediated endocytosis (GO:0006898)|regulation of protein stability (GO:0031647)	integral component of membrane (GO:0016021)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|skin(3)|stomach(4)	18					Antihemophilic Factor(DB00025)	GTCCTGCTGCTGTTTCTCCAG	0.602																																					p.Q135R		.											.	ASGR2	91	0			c.A404G						.						277.0	169.0	206.0					17																	7011175		2203	4300	6503	SO:0001583	missense	433	exon5			TGCTGCTGTTTCT	M11025	CCDS11088.1, CCDS32544.1, CCDS45598.1	17p	2011-08-30			ENSG00000161944	ENSG00000161944		"""C-type lectin domain containing"""	743	protein-coding gene	gene with protein product		108361				3863106	Standard	NM_080912		Approved	CLEC4H2	uc002ger.3	P07307	OTTHUMG00000102158	ENST00000380952.2:c.404A>G	17.37:g.7011175T>C	ENSP00000370339:p.Gln135Arg	Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	6.0	NM_080912	A6NLV8|A8MT12|D3DTM9|D3DTN0|O00448|Q03969	Missense_Mutation	SNP	ENST00000380952.2	37	CCDS32544.1	.	.	.	.	.	.	.	.	.	.	T	11.81	1.748814	0.30955	.	.	ENSG00000161944	ENST00000355035;ENST00000254850;ENST00000380952;ENST00000446679;ENST00000450034	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	3.46	1.01	0.19927	Hepatic lectin, N-terminal (1);	0.700616	0.11929	N	0.515868	T	0.13756	0.0333	L	0.29908	0.895	0.09310	N	1	P;P;B;P;P;P	0.43352	0.704;0.617;0.203;0.589;0.766;0.804	B;B;B;B;B;P	0.47346	0.388;0.121;0.221;0.405;0.283;0.544	T	0.22103	-1.0226	10	0.15499	T	0.54	.	5.7864	0.18336	0.4399:0.0:0.0:0.5601	.	111;111;135;130;116;135	B4E1D2;P07307-3;P07307;Q7Z4G9;P07307-2;D3DTN0	.;.;ASGR2_HUMAN;.;.;.	R	135;111;135;116;111	ENSP00000347140:Q135R;ENSP00000254850:Q111R;ENSP00000370339:Q135R;ENSP00000405844:Q116R	ENSP00000254850:Q111R	Q	-	2	0	ASGR2	6951899	0.006000	0.16342	0.266000	0.24541	0.420000	0.31355	0.716000	0.25836	0.152000	0.19188	0.496000	0.49642	CAG	.		0.602	ASGR2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000220003.1	NM_080914	
ASXL1	171023	hgsc.bcm.edu;bcgsc.ca	37	20	31024706	31024706	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr20:31024706T>C	ENST00000375687.4	+	13	4615	c.4191T>C	c.(4189-4191)ggT>ggC	p.G1397G	ASXL1_ENST00000306058.5_Silent_p.G1392G	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1397					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						AACTGGTGGGTCACTTGGAAG	0.547			"""F, N, Mis"""		"""MDS, CMML"""																																p.G1397G		.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	2057	0			c.T4191C						.						99.0	104.0	102.0					20																	31024706		2203	4300	6503	SO:0001819	synonymous_variant	171023	exon12			GGTGGGTCACTTG	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.4191T>C	20.37:g.31024706T>C		Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	5.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	ENST00000375687.4	37	CCDS13201.1																																																																																			.		0.547	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	96798729	96798729	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr14:96798729C>A	ENST00000359933.4	-	10	2274	c.1381G>T	c.(1381-1383)Gag>Tag	p.E461*		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	461					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TCAAGGAACTCTCCCCAAGTG	0.348																																					p.E461X		.											.	ATG2B	93	0			c.G1381T						.						118.0	111.0	113.0					14																	96798729		1830	4081	5911	SO:0001587	stop_gained	55102	exon10			GGAACTCTCCCCA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.1381G>T	14.37:g.96798729C>A	ENSP00000353010:p.Glu461*	Somatic	367.0	1.0		WXS	Illumina HiSeq	Phase_I	226.0	84.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Nonsense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	C	47	13.186436	0.99726	.	.	ENSG00000066739	ENST00000359933	.	.	.	5.55	5.55	0.83447	.	1.863070	0.05717	U	0.596957	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	13.2253	0.59911	0.0:0.9175:0.0:0.0825	.	.	.	.	X	461	.	ENSP00000353010:E461X	E	-	1	0	ATG2B	95868482	1.000000	0.71417	0.911000	0.35937	0.882000	0.50991	2.272000	0.43373	2.606000	0.88127	0.655000	0.94253	GAG	.		0.348	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
ATG2B	55102	hgsc.bcm.edu;bcgsc.ca	37	14	96809538	96809538	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr14:96809538A>G	ENST00000359933.4	-	5	1555	c.662T>C	c.(661-663)cTt>cCt	p.L221P		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	221					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AGAGAGCTGAAGTAACTTGTG	0.413																																					p.L221P		.											.	ATG2B	93	0			c.T662C						.						106.0	102.0	104.0					14																	96809538		1897	4125	6022	SO:0001583	missense	55102	exon5			AGCTGAAGTAACT	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.662T>C	14.37:g.96809538A>G	ENSP00000353010:p.Leu221Pro	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	4.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	A	24.3	4.514933	0.85389	.	.	ENSG00000066739	ENST00000359933	T	0.15139	2.45	5.27	5.27	0.74061	.	0.198408	0.31636	U	0.007305	T	0.32882	0.0844	L	0.47190	1.495	0.80722	D	1	D	0.71674	0.998	P	0.62014	0.897	T	0.03795	-1.1003	10	0.72032	D	0.01	.	15.1796	0.72945	1.0:0.0:0.0:0.0	.	221	Q96BY7	ATG2B_HUMAN	P	221	ENSP00000353010:L221P	ENSP00000353010:L221P	L	-	2	0	ATG2B	95879291	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.730000	0.91510	1.995000	0.58328	0.482000	0.46254	CTT	.		0.413	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
ATP8B3	148229	hgsc.bcm.edu;bcgsc.ca	37	19	1785272	1785272	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:1785272T>C	ENST00000310127.6	-	27	3656	c.3418A>G	c.(3418-3420)Acc>Gcc	p.T1140A	ATP8B3_ENST00000525591.1_Missense_Mutation_p.T1103A|ATP8B3_ENST00000539485.1_Missense_Mutation_p.T1150A	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1140					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACAGGGCGGTCCAGTACTTG	0.602																																					p.T1140A		.											.	.	.	0			c.A3418G						.						41.0	50.0	47.0					19																	1785272		2192	4289	6481	SO:0001583	missense	148229	exon27			GGGCGGTCCAGTA	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3418A>G	19.37:g.1785272T>C	ENSP00000311336:p.Thr1140Ala	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	5.0	NM_138813	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.094821	0.56075	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.62364	0.03;0.03;0.03	4.49	4.49	0.54785	.	0.055995	0.64402	D	0.000001	D	0.84844	0.5562	H	0.97540	4.025	0.40442	D	0.980054	D;D	0.76494	0.996;0.999	D;D	0.66847	0.928;0.947	D	0.90200	0.4256	10	0.87932	D	0	.	12.9712	0.58513	0.0:0.0:0.0:1.0	.	1140;1103	O60423;Q7Z485	AT8B3_HUMAN;.	A	1140;1150;1103	ENSP00000311336:T1140A;ENSP00000443574:T1150A;ENSP00000437115:T1103A	ENSP00000311336:T1140A	T	-	1	0	ATP8B3	1736272	1.000000	0.71417	0.979000	0.43373	0.103000	0.19146	6.508000	0.73721	1.660000	0.50760	0.533000	0.62120	ACC	.		0.602	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
ATXN2	6311	hgsc.bcm.edu;bcgsc.ca	37	12	111963044	111963044	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:111963044T>C	ENST00000377617.3	-	6	1289	c.1128A>G	c.(1126-1128)gcA>gcG	p.A376A	ATXN2_ENST00000535949.1_Silent_p.A87A|ATXN2_ENST00000608853.1_Silent_p.A216A|ATXN2_ENST00000389153.4_Silent_p.A111A|ATXN2_ENST00000542287.2_Silent_p.A111A|ATXN2_ENST00000550104.1_Silent_p.A376A|ATXN2_ENST00000549455.1_5'UTR	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	376					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						TGAGTTCACCTGCATCCCAGG	0.433																																					p.A376A		.											.	ATXN2	136	0			c.A1128G						.						173.0	148.0	157.0					12																	111963044		2203	4300	6503	SO:0001819	synonymous_variant	6311	exon6			TTCACCTGCATCC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.1128A>G	12.37:g.111963044T>C		Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Silent	SNP	ENST00000377617.3	37	CCDS31902.1																																																																																			.		0.433	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
AXIN1	8312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	364598	364598	+	Frame_Shift_Del	DEL	C	C	-	rs377639730		TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr16:364598delC	ENST00000262320.3	-	3	1335	c.964delG	c.(964-966)gagfs	p.E322fs	AXIN1_ENST00000481769.1_5'UTR|AXIN1_ENST00000354866.3_Frame_Shift_Del_p.E322fs	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	322	Interaction with TP53. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.E322fs*92(1)|p.E322K(1)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CTCTGCTGCTCGCTGTCGTTG	0.622																																					p.E322fs		.											.	AXIN1	684	2	Substitution - Missense(1)|Deletion - Frameshift(1)	biliary_tract(1)|liver(1)	c.964delG						.						78.0	61.0	67.0					16																	364598		2203	4300	6503	SO:0001589	frameshift_variant	8312	exon3			GCTGCTCGCTGTC	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.964delG	16.37:g.364598delC	ENSP00000262320:p.Glu322fs	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	25.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Frame_Shift_Del	DEL	ENST00000262320.3	37	CCDS10405.1																																																																																			.		0.622	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
AZU1	566	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	828354	828354	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:828354C>G	ENST00000233997.2	+	2	204	c.183C>G	c.(181-183)ttC>ttG	p.F61L		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	61	Hydrophobic.|Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.|Possesses antibiotic activity.				cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGCCCGCTTCGTGATGACCG	0.672																																					p.F61L		.											.	AZU1	91	0			c.C183G						.						40.0	45.0	43.0					19																	828354		2203	4296	6499	SO:0001583	missense	566	exon2			CCGCTTCGTGATG	X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.183C>G	19.37:g.828354C>G	ENSP00000233997:p.Phe61Leu	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	11.0	NM_001700	P80014|Q52LG4|Q9UCM1|Q9UCT5	Missense_Mutation	SNP	ENST00000233997.2	37	CCDS12044.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.454192	0.43634	.	.	ENSG00000172232	ENST00000334630;ENST00000233997	D	0.92911	-3.13	2.4	-3.77	0.04346	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.92185	0.7522	L	0.50847	1.595	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83172	-0.0093	9	0.72032	D	0.01	.	3.7219	0.08460	0.0:0.2757:0.2063:0.518	.	61	P20160	CAP7_HUMAN	L	75;61	ENSP00000233997:F61L	ENSP00000233997:F61L	F	+	3	2	AZU1	779354	0.005000	0.15991	0.000000	0.03702	0.076000	0.17211	-0.577000	0.05847	-0.621000	0.05633	0.511000	0.50034	TTC	.		0.672	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457472.2	NM_001700	
BAI1	575	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	143603336	143603336	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr8:143603336C>T	ENST00000517894.1	+	21	3929	c.3035C>T	c.(3034-3036)aCg>aTg	p.T1012M	BAI1_ENST00000323289.5_Missense_Mutation_p.T1012M			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1012					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GTGGTGTGCACGCTGGTGGCC	0.697																																					p.T1012M		.											.	BAI1	1129	0			c.C3035T						.						26.0	33.0	31.0					8																	143603336		2197	4293	6490	SO:0001583	missense	575	exon20			TGTGCACGCTGGT	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3035C>T	8.37:g.143603336C>T	ENSP00000430945:p.Thr1012Met	Somatic	90.0	1.0		WXS	Illumina HiSeq	Phase_I	52.0	17.0	NM_001702		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	C	15.29	2.788721	0.49997	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.46819	0.86;0.86	3.64	3.64	0.41730	.	0.072156	0.53938	U	0.000046	T	0.58892	0.2154	M	0.67517	2.055	0.52099	D	0.999943	D	0.56968	0.978	P	0.54431	0.752	T	0.66520	-0.5903	10	0.87932	D	0	.	14.2993	0.66336	0.0:1.0:0.0:0.0	.	1012	E9PBK0	.	M	1012	ENSP00000430945:T1012M;ENSP00000313046:T1012M	ENSP00000313046:T1012M	T	+	2	0	BAI1	143600338	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	7.554000	0.82212	1.560000	0.49568	0.460000	0.39030	ACG	.		0.697	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
C15orf41	84529	hgsc.bcm.edu;bcgsc.ca	37	15	36989565	36989565	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:36989565T>C	ENST00000566621.1	+	8	768	c.518T>C	c.(517-519)cTt>cCt	p.L173P	C15orf41_ENST00000437989.2_Missense_Mutation_p.L173P|C15orf41_ENST00000338183.4_Missense_Mutation_p.L75P|C15orf41_ENST00000562877.1_Missense_Mutation_p.L75P|C15orf41_ENST00000567389.1_Missense_Mutation_p.L75P|C15orf41_ENST00000565792.1_3'UTR|C15orf41_ENST00000569302.1_Missense_Mutation_p.L173P	NM_001130010.1	NP_001123482.1	Q9Y2V0	CO041_HUMAN	chromosome 15 open reading frame 41	173										kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		AGAGACTTGCTTCTAGAGAAA	0.413																																					p.L173P		.											.	C15orf41	46	0			c.T518C						.						188.0	189.0	188.0					15																	36989565		1914	4139	6053	SO:0001583	missense	84529	exon8			ACTTGCTTCTAGA	BC006254	CCDS45215.1, CCDS45216.1	15q14	2012-05-31			ENSG00000186073	ENSG00000186073			26929	protein-coding gene	gene with protein product		615626					Standard	XM_005254719		Approved	HH114, MGC11326, FLJ22851	uc001zje.4	Q9Y2V0	OTTHUMG00000172659	ENST00000566621.1:c.518T>C	15.37:g.36989565T>C	ENSP00000455397:p.Leu173Pro	Somatic	210.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	6.0	NM_001130010	B2RD87	Missense_Mutation	SNP	ENST00000566621.1	37	CCDS45215.1	.	.	.	.	.	.	.	.	.	.	T	18.16	3.561220	0.65538	.	.	ENSG00000186073	ENST00000437989;ENST00000338183	T	0.62498	0.02	5.6	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.78123	0.4234	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.80037	-0.1550	10	0.87932	D	0	-11.632	11.6014	0.51006	0.0:0.07:0.0:0.93	.	173	Q9Y2V0	CO041_HUMAN	P	173;75	ENSP00000401362:L173P	ENSP00000342433:L75P	L	+	2	0	C15orf41	34776857	1.000000	0.71417	0.998000	0.56505	0.902000	0.53008	7.535000	0.82014	0.952000	0.37798	0.528000	0.53228	CTT	.		0.413	C15orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419741.1	NM_032499	
C2orf88	84281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	191064868	191064868	+	Silent	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:191064868G>A	ENST00000340623.4	+	2	693	c.282G>A	c.(280-282)ggG>ggA	p.G94G	C2orf88_ENST00000396974.2_Silent_p.G94G|C2orf88_ENST00000443551.2_Silent_p.G94G|C2orf88_ENST00000409870.1_Silent_p.G94G	NM_001042519.1|NM_001042520.1|NM_001042521.1|NM_032321.2	NP_001035984.1|NP_001035985.1|NP_001035986.1|NP_115697.2	Q9BSF0	SMAKA_HUMAN	chromosome 2 open reading frame 88	94						plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|lung(1)	3						AGAGTGAGGGGCCTTGAGGCT	0.428																																					p.G94G		.											.	C2orf88	68	0			c.G282A						.						132.0	129.0	130.0					2																	191064868		2027	4195	6222	SO:0001819	synonymous_variant	84281	exon2			TGAGGGGCCTTGA	BC005083	CCDS42792.1	2q32.2	2014-02-12	2009-04-08		ENSG00000187699	ENSG00000187699			28191	protein-coding gene	gene with protein product	"""small membrane AKAP"""	615117				23996002	Standard	NM_032321		Approved	MGC13057, smAKAP	uc002urt.3	Q9BSF0	OTTHUMG00000154361	ENST00000340623.4:c.282G>A	2.37:g.191064868G>A		Somatic	233.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	23.0	NM_001042519	D3DPI3|P0C876|Q53TC7	Silent	SNP	ENST00000340623.4	37	CCDS42792.1																																																																																			.		0.428	C2orf88-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334954.1	NM_032321	
C6orf223	221416	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	43970788	43970788	+	Silent	SNP	G	G	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:43970788G>T	ENST00000336600.5	+	4	674	c.654G>T	c.(652-654)cgG>cgT	p.R218R	C6orf223_ENST00000439969.2_3'UTR|RP5-1120P11.1_ENST00000422059.1_RNA|C6orf223_ENST00000442114.2_Silent_p.R198R|C6orf223_ENST00000448947.2_3'UTR|RP5-1120P11.1_ENST00000607590.1_RNA	NM_001171992.1|NM_153246.4	NP_001165463.1|NP_694978.2	Q8N319	CF223_HUMAN	chromosome 6 open reading frame 223	218										central_nervous_system(1)|lung(2)|pancreas(1)|prostate(1)|urinary_tract(1)	6	all_cancers(18;2.28e-07)|all_epithelial(2;1.62e-08)|Lung NSC(15;0.000172)|all_lung(25;0.000533)|Hepatocellular(11;0.00309)|Ovarian(13;0.0437)		all cancers(41;0.00141)|Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.217)			CAGGGGCACGGCTAATGCGCT	0.642																																					p.R218R		.											.	C6orf223	68	0			c.G654T						.						27.0	34.0	31.0					6																	43970788		2202	4298	6500	SO:0001819	synonymous_variant	221416	exon4			GGCACGGCTAATG	BC032706	CCDS34459.1, CCDS55016.1	6p21.1	2012-09-05			ENSG00000181577	ENSG00000181577			28692	protein-coding gene	gene with protein product						12477932	Standard	NM_153246		Approved	MGC45491	uc003own.3	Q8N319	OTTHUMG00000014753	ENST00000336600.5:c.654G>T	6.37:g.43970788G>T		Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	45.0	NM_153246	E9PB59|Q8N575	Silent	SNP	ENST00000336600.5	37	CCDS34459.1																																																																																			.		0.642	C6orf223-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040702.3	NM_153246	
CAPN1	823	hgsc.bcm.edu;bcgsc.ca	37	11	64977873	64977873	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:64977873T>C	ENST00000527323.1	+	19	2249	c.2009T>C	c.(2008-2010)gTc>gCc	p.V670A	CAPN1_ENST00000279247.6_Missense_Mutation_p.V670A|CAPN1_ENST00000524773.1_Missense_Mutation_p.V670A|CAPN1_ENST00000533820.1_Missense_Mutation_p.V670A|CAPN1_ENST00000533129.1_Missense_Mutation_p.V670A			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit	670	Domain IV.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		GACCTGGCGGTCGACTTTGAC	0.587																																					p.V670A		.											.	CAPN1	91	0			c.T2009C						.						55.0	58.0	57.0					11																	64977873		2010	4182	6192	SO:0001583	missense	823	exon20			TGGCGGTCGACTT	X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614	ENST00000527323.1:c.2009T>C	11.37:g.64977873T>C	ENSP00000431984:p.Val670Ala	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_001198869	Q2TTR0|Q6DHV4	Missense_Mutation	SNP	ENST00000527323.1	37	CCDS44644.1	.	.	.	.	.	.	.	.	.	.	T	18.19	3.569576	0.65765	.	.	ENSG00000014216	ENST00000533820;ENST00000533129;ENST00000524773;ENST00000279247;ENST00000259755;ENST00000527323	T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24	4.21	4.21	0.49690	EF-hand-like domain (1);	0.067866	0.64402	D	0.000015	T	0.43299	0.1241	M	0.79805	2.47	0.58432	D	0.999999	P	0.35527	0.507	B	0.37888	0.26	T	0.51919	-0.8644	10	0.87932	D	0	.	11.5655	0.50802	0.0:0.0:0.0:1.0	.	670	P07384	CAN1_HUMAN	A	670;670;670;670;616;670	ENSP00000435272:V670A;ENSP00000431686:V670A;ENSP00000434176:V670A;ENSP00000279247:V670A;ENSP00000431984:V670A	ENSP00000259755:V616A	V	+	2	0	CAPN1	64734449	0.971000	0.33674	0.989000	0.46669	0.751000	0.42716	7.682000	0.84083	1.701000	0.51217	0.460000	0.39030	GTC	.		0.587	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385325.1		
CCDC14	64770	hgsc.bcm.edu;bcgsc.ca	37	3	123634213	123634213	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:123634213C>T	ENST00000488653.2	-	13	2365	c.2275G>A	c.(2275-2277)Gat>Aat	p.D759N	CCDC14_ENST00000433542.2_Missense_Mutation_p.D718N|CCDC14_ENST00000485727.1_Missense_Mutation_p.D559N|CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000489746.1_Missense_Mutation_p.D559N|CCDC14_ENST00000310351.4_Missense_Mutation_p.D599N			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	759					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		CTCCCTTCATCAGAATCCTGT	0.398																																					p.D718N		.											.	CCDC14	68	0			c.G2152A						.						118.0	121.0	120.0					3																	123634213		2203	4300	6503	SO:0001583	missense	64770	exon12			CTTCATCAGAATC	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.2275G>A	3.37:g.123634213C>T	ENSP00000420180:p.Asp759Asn	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	4.0	NM_022757	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	ENST00000488653.2	37		.	.	.	.	.	.	.	.	.	.	C	17.79	3.475338	0.63737	.	.	ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697	T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63	5.23	5.23	0.72850	.	0.253594	0.33813	N	0.004522	T	0.53594	0.1806	L	0.50333	1.59	0.19775	N	0.999955	D;D;D	0.57571	0.98;0.98;0.963	P;P;P	0.53649	0.731;0.731;0.572	T	0.52245	-0.8601	10	0.72032	D	0.01	.	12.3288	0.55026	0.0:0.9232:0.0:0.0768	.	759;718;600	Q49A88;Q49A88-6;Q49A88-5	CCD14_HUMAN;.;.	N	759;599;559;559;718;740	ENSP00000420180:D759N;ENSP00000312031:D599N;ENSP00000418002:D559N;ENSP00000418403:D559N;ENSP00000395706:D718N;ENSP00000386866:D740N	ENSP00000312031:D599N	D	-	1	0	CCDC14	125116903	0.995000	0.38212	0.125000	0.21846	0.820000	0.46376	3.635000	0.54309	2.725000	0.93324	0.591000	0.81541	GAT	.		0.398	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757	
LINC00283	100874057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103397021	103397021	+	RNA	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr13:103397021G>A	ENST00000430111.1	+	0	1394									long intergenic non-protein coding RNA 283																		CATTTGATGTGTACTGAAACG	0.378																																					p.T2009I		.											.	.	.	0			c.C6026T						.						131.0	110.0	116.0					13																	103397021		692	1591	2283			643677	exon4			TGATGTGTACTGA			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103397021G>A		Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	52.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	37																																																																																				.		0.378	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
CCNK	8812	hgsc.bcm.edu;bcgsc.ca	37	14	99968554	99968554	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr14:99968554A>G	ENST00000389879.5	+	7	709	c.586A>G	c.(586-588)Acc>Gcc	p.T196A	CCNK_ENST00000555049.1_Missense_Mutation_p.T196A|CCNK_ENST00000557165.1_3'UTR	NM_001099402.1	NP_001092872.1	O75909	CCNK_HUMAN	cyclin K	196					cellular response to DNA damage stimulus (GO:0006974)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of cell cycle arrest (GO:0071157)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cyclin K-CDK12 complex (GO:0002944)|cyclin K-CDK13 complex (GO:0002945)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|endometrium(2)|lung(3)	6		all_cancers(154;0.224)|all_epithelial(191;0.0643)|Melanoma(154;0.0866)				TCTCTGCACCACCTTGTCACT	0.383																																					p.T196A		.											.	.	.	0			c.A586G						.						77.0	69.0	72.0					14																	99968554		1905	4111	6016	SO:0001583	missense	8812	exon7			TGCACCACCTTGT	AF060515	CCDS45160.1	14q32.2	2014-07-03			ENSG00000090061	ENSG00000090061			1596	protein-coding gene	gene with protein product		603544				9632813, 10574912	Standard	NM_001099402		Approved	CPR4	uc001ygi.4	O75909	OTTHUMG00000171495	ENST00000389879.5:c.586A>G	14.37:g.99968554A>G	ENSP00000374529:p.Thr196Ala	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_001099402	Q59FT6|Q86U16|Q96B63|Q9NNY9	Missense_Mutation	SNP	ENST00000389879.5	37	CCDS45160.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.748000	0.89663	.	.	ENSG00000090061	ENST00000437596;ENST00000216279;ENST00000380246;ENST00000389879;ENST00000557441;ENST00000555049	T;T;T	0.44881	0.91;0.91;0.91	5.8	5.8	0.92144	Cyclin-like (2);	0.046992	0.85682	D	0.000000	T	0.65923	0.2738	M	0.80847	2.515	0.80722	D	1	D;D	0.71674	0.998;0.986	D;P	0.65987	0.94;0.852	T	0.70517	-0.4850	10	0.66056	D	0.02	-21.3293	16.1596	0.81693	1.0:0.0:0.0:0.0	.	196;196	O75909;O75909-2	CCNK_HUMAN;.	A	196;198;198;196;196;196	ENSP00000374529:T196A;ENSP00000450792:T196A;ENSP00000452307:T196A	ENSP00000216279:T198A	T	+	1	0	CCNK	99038307	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.307000	0.96226	2.216000	0.71823	0.533000	0.62120	ACC	.		0.383	CCNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413721.1		
CD1E	913	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158325760	158325760	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:158325760G>A	ENST00000368167.3	+	4	1008	c.769G>A	c.(769-771)Ggg>Agg	p.G257R	CD1E_ENST00000368160.3_Missense_Mutation_p.G257R|CD1E_ENST00000368166.3_Missense_Mutation_p.G68R|CD1E_ENST00000444681.2_Missense_Mutation_p.G158R|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000368156.1_Missense_Mutation_p.G167R|CD1E_ENST00000452291.2_Missense_Mutation_p.G68R|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.G257R|CD1E_ENST00000368164.3_Missense_Mutation_p.G68R|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.G255R|CD1E_ENST00000368165.3_Missense_Mutation_p.G167R|CD1E_ENST00000368163.3_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	257	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.G257W(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					CACTCAGCGAGGGGACGTCCT	0.622																																					p.G257R		.											.	CD1E	93	1	Substitution - Missense(1)	lung(1)	c.G769A						.						114.0	110.0	111.0					1																	158325760		2203	4300	6503	SO:0001583	missense	913	exon4			CAGCGAGGGGACG	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.769G>A	1.37:g.158325760G>A	ENSP00000357149:p.Gly257Arg	Somatic	342.0	1.0		WXS	Illumina HiSeq	Phase_I	251.0	67.0	NM_001042584	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	CCDS41417.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.20|11.20	1.569581|1.569581	0.28003|0.28003	.|.	.|.	ENSG00000158488|ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368164;ENST00000368160;ENST00000368161;ENST00000368156|ENST00000368162	T;T;T;T;T;T;T;T;T;T|T	0.02812|0.02579	4.15;4.15;4.15;4.15;4.15;4.15;4.15;4.15;4.15;4.15|4.24	4.6|4.6	2.69|2.69	0.31865|0.31865	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);|.	0.314836|.	0.23782|.	N|.	0.044603|.	T|T	0.03695|0.03695	0.0105|0.0105	M|M	0.83774|0.83774	2.66|2.66	0.09310|0.09310	N|N	1|1	P;D;D;D;P;P;P;P;D;D;D;D;D|.	0.89917|.	0.843;0.998;0.998;0.998;0.929;0.907;0.931;0.914;0.994;0.998;1.0;0.961;0.992|.	P;P;P;P;P;P;P;P;P;D;D;P;P|.	0.91635|.	0.787;0.901;0.901;0.901;0.872;0.877;0.603;0.723;0.864;0.944;0.999;0.797;0.832|.	T|T	0.30268|0.30268	-0.9984|-0.9984	10|7	0.66056|0.49607	D|T	0.02|0.09	-7.087|-7.087	7.2054|7.2054	0.25905|0.25905	0.2087:0.0:0.7913:0.0|0.2087:0.0:0.7913:0.0	.|.	68;158;255;257;158;167;68;68;257;257;257;68;167|.	B4E057;B4E042;E7ET31;A2RRL5;E7EP01;P15812-5;P15812-9;P15812-10;P15812-2;P15812;P15812-3;P15812-8;P15812-6|.	.;.;.;.;.;.;.;.;.;CD1E_HUMAN;.;.;.|.	R|K	255;158;257;68;167;68;68;257;257;167|26	ENSP00000401957:G255R;ENSP00000402906:G158R;ENSP00000357149:G257R;ENSP00000416228:G68R;ENSP00000357147:G167R;ENSP00000357148:G68R;ENSP00000357146:G68R;ENSP00000357142:G257R;ENSP00000357143:G257R;ENSP00000357138:G167R|ENSP00000357144:R26K	ENSP00000357138:G167R|ENSP00000357144:R26K	G|R	+|+	1|2	0|0	CD1E|CD1E	156592384|156592384	0.001000|0.001000	0.12720|0.12720	0.099000|0.099000	0.21106|0.21106	0.019000|0.019000	0.09904|0.09904	0.503000|0.503000	0.22610|0.22610	1.174000|1.174000	0.42811|0.42811	-0.253000|-0.253000	0.11424|0.11424	GGG|AGG	.		0.622	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	
CDC27	996	hgsc.bcm.edu;bcgsc.ca	37	17	45247316	45247316	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr17:45247316C>T	ENST00000066544.3	-	4	437	c.344G>A	c.(343-345)tGc>tAc	p.C115Y	CDC27_ENST00000528748.1_5'UTR|RP5-867C24.5_ENST00000572193.1_RNA|CDC27_ENST00000446365.2_Missense_Mutation_p.C54Y|CDC27_ENST00000531206.1_Missense_Mutation_p.C115Y|CDC27_ENST00000527547.1_Missense_Mutation_p.C115Y	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	115					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AAGAGTAAAGCAAGCTGAATC	0.328																																					p.C115Y		.											.	CDC27	291	0			c.G344A						.						85.0	87.0	86.0					17																	45247316		2203	4299	6502	SO:0001583	missense	996	exon4			GTAAAGCAAGCTG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.344G>A	17.37:g.45247316C>T	ENSP00000066544:p.Cys115Tyr	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.44|19.44	3.827908|3.827908	0.71143|0.71143	.|.	.|.	ENSG00000004897|ENSG00000004897	ENST00000533415|ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	.|T;T;T;T;T	.|0.73681	.|-0.77;-0.77;-0.77;-0.77;-0.77	5.35|5.35	4.36|4.36	0.52297|0.52297	.|Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.|0.286342	.|0.39834	.|N	.|0.001241	T|T	0.80204|0.80204	0.4580|0.4580	L|L	0.49778|0.49778	1.585|1.585	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;D;D	.|0.65815	.|0.989;0.989;0.995;0.991	.|P;P;P;P	.|0.60345	.|0.832;0.814;0.861;0.873	T|T	0.82180|0.82180	-0.0585|-0.0585	6|10	0.66056|0.72032	D|D	0.02|0.01	-23.7538|-23.7538	13.94|13.94	0.64048|0.64048	0.0:0.8464:0.1536:0.0|0.0:0.8464:0.1536:0.0	.|.	.|54;115;115;115	.|B4DL80;G5EA36;G3V1C4;P30260	.|.;.;.;CDC27_HUMAN	T|Y	66|115;115;54;115;115	.|ENSP00000066544:C115Y;ENSP00000434614:C115Y;ENSP00000392802:C54Y;ENSP00000437339:C115Y;ENSP00000432105:C115Y	ENSP00000432211:A66T|ENSP00000066544:C115Y	A|C	-|-	1|2	0|0	CDC27|CDC27	42602315|42602315	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.960000|4.960000	0.63673|0.63673	1.350000|1.350000	0.45770|0.45770	0.655000|0.655000	0.94253|0.94253	GCT|TGC	.		0.328	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CDKAL1	54901	hgsc.bcm.edu;bcgsc.ca	37	6	21065331	21065331	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:21065331A>G	ENST00000378610.1	+	10	1118	c.1108A>G	c.(1108-1110)Aca>Gca	p.T370A	CDKAL1_ENST00000378624.4_Missense_Mutation_p.T300A|CDKAL1_ENST00000274695.4_Missense_Mutation_p.T370A			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	370					maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			TCCTGGAGAAACAGATCAGGA	0.353																																					p.T370A		.											.	CDKAL1	92	0			c.A1108G						.						83.0	83.0	83.0					6																	21065331		2203	4300	6503	SO:0001583	missense	54901	exon12			GGAGAAACAGATC	AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.1108A>G	6.37:g.21065331A>G	ENSP00000367873:p.Thr370Ala	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	5.0	NM_017774	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	37	CCDS4546.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.556035	0.86231	.	.	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	T;T;T	0.36878	1.23;1.23;1.23	5.76	5.76	0.90799	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	T	0.65565	0.2703	H	0.95504	3.68	0.80722	D	1	D;D	0.64830	0.994;0.99	D;D	0.66497	0.944;0.92	T	0.77520	-0.2557	10	0.87932	D	0	.	16.3634	0.83296	1.0:0.0:0.0:0.0	.	300;370	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	A	370;300;370	ENSP00000274695:T370A;ENSP00000367889:T300A;ENSP00000367873:T370A	ENSP00000274695:T370A	T	+	1	0	CDKAL1	21173310	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.910000	0.92685	2.324000	0.78689	0.533000	0.62120	ACA	.		0.353	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774	
CDKN3	1033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	54878223	54878223	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr14:54878223T>C	ENST00000541304.1	+	5	255	c.215T>C	c.(214-216)aTa>aCa	p.I72T	CDKN3_ENST00000335183.6_Missense_Mutation_p.I72T|CDKN3_ENST00000556102.2_Missense_Mutation_p.I72T|CDKN3_ENST00000442975.2_Missense_Mutation_p.I32T|CDKN3_ENST00000543789.2_Missense_Mutation_p.I72T|CDKN3_ENST00000458126.2_Missense_Mutation_p.I72T|CDKN3_ENST00000395577.2_Missense_Mutation_p.I26T|CDKN3_ENST00000556305.1_3'UTR			Q00526	CDK3_HUMAN	cyclin-dependent kinase inhibitor 3	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|stomach(1)	3						AGCTGTGGTATACAAGACATA	0.398																																					p.I72T	Pancreas(40;634 1012 9382 49950 52462)	.											.	CDKN3	838	0			c.T215C						.						76.0	72.0	74.0					14																	54878223		2203	4300	6503	SO:0001583	missense	1033	exon5			GTGGTATACAAGA	U02681	CCDS9716.1, CCDS45109.1	14q22	2011-08-25	2008-08-01		ENSG00000100526	ENSG00000100526		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1791	protein-coding gene	gene with protein product	"""kinase associated phosphatase"", ""cyclin-dependent kinase inhibitor"", ""CDK2-associated dual specificity phosphatase"""	123832				8242750, 7698009	Standard	NM_005192		Approved	KAP, CDI1	uc001xap.3	Q16667	OTTHUMG00000140302	ENST00000541304.1:c.215T>C	14.37:g.54878223T>C	ENSP00000445572:p.Ile72Thr	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	27.0	NM_005192		Missense_Mutation	SNP	ENST00000541304.1	37		.	.	.	.	.	.	.	.	.	.	T	19.20	3.780740	0.70222	.	.	ENSG00000100526	ENST00000335183;ENST00000543789;ENST00000442975;ENST00000458126;ENST00000556102;ENST00000541304;ENST00000439312;ENST00000395577	T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.67	4.53	0.55603	Cyclin-dependent kinase inhibitor 3, bac/eukaryotic (1);	0.158775	0.56097	D	0.000024	T	0.60104	0.2243	L	0.51422	1.61	0.41120	D	0.985802	B;P;P	0.44578	0.047;0.805;0.838	B;P;P	0.57679	0.213;0.732;0.825	T	0.60682	-0.7215	10	0.48119	T	0.1	-17.0445	9.7565	0.40506	0.0:0.077:0.0:0.923	.	32;72;72	Q16667-2;F8WDR6;Q16667	.;.;CDKN3_HUMAN	T	72;72;32;72;72;72;72;26	ENSP00000335357:I72T;ENSP00000440404:I72T;ENSP00000415333:I32T;ENSP00000396451:I72T;ENSP00000450711:I72T;ENSP00000445572:I72T;ENSP00000378944:I26T	ENSP00000335357:I72T	I	+	2	0	CDKN3	53947973	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.922000	0.40045	2.164000	0.68074	0.533000	0.62120	ATA	.		0.398	CDKN3-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000411158.1		
CEP152	22995	hgsc.bcm.edu;bcgsc.ca	37	15	49090248	49090248	+	Splice_Site	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:49090248A>G	ENST00000380950.2	-	3	275	c.88T>C	c.(88-90)Ttg>Ctg	p.L30L	CEP152_ENST00000399334.3_Splice_Site_p.L30L|CEP152_ENST00000325747.5_Splice_Site_p.L30L	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	30					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		AACTGCTGCAACTGAGTCAAA	0.493																																					p.L30L		.											.	CEP152	70	0			c.T88C						.						67.0	69.0	68.0					15																	49090248		2046	4203	6249	SO:0001630	splice_region_variant	22995	exon3			GCTGCAACTGAGT	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.88-1T>C	15.37:g.49090248A>G		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	4.0	NM_014985	E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	37	CCDS58361.1																																																																																			.		0.493	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	Silent
CHRND	1144	hgsc.bcm.edu;broad.mit.edu	37	2	233400022	233400022	+	Nonstop_Mutation	SNP	G	G	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:233400022G>T	ENST00000258385.3	+	12	1586	c.1554G>T	c.(1552-1554)taG>taT	p.*518Y	CHRND_ENST00000543200.1_Nonstop_Mutation_p.*503Y|CHRND_ENST00000457943.2_Nonstop_Mutation_p.*324Y	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	0					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	GCTTCATCTAGGGTGGGCCTG	0.612																																					p.X518Y		.											.	CHRND	155	0			c.G1554T						.						58.0	59.0	59.0					2																	233400022		2203	4300	6503	SO:0001578	stop_lost	1144	exon12			CATCTAGGGTGGG	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1554G>T	2.37:g.233400022G>T	ENSP00000258385:p.*518Tyrext*13	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_000751	A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	ENST00000258385.3	37	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	G	8.413	0.844661	0.16963	.	.	ENSG00000135902	ENST00000543200;ENST00000258385;ENST00000457943	.	.	.	4.97	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.611	0.51059	0.083:0.0:0.917:0.0	.	.	.	.	Y	503;518;324	.	.	X	+	3	2	CHRND	233108266	1.000000	0.71417	0.128000	0.21923	0.182000	0.23217	3.220000	0.51207	1.091000	0.41335	0.655000	0.94253	TAG	.		0.612	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2		
CMAS	55907	hgsc.bcm.edu;bcgsc.ca	37	12	22215331	22215331	+	Silent	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:22215331A>G	ENST00000229329.2	+	7	1207	c.1077A>G	c.(1075-1077)aaA>aaG	p.K359K		NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase	359					lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						AATGGAGAAAAGAAATGGGCC	0.373																																					p.K359K		.											.	CMAS	93	0			c.A1077G						.						152.0	170.0	164.0					12																	22215331		2203	4300	6503	SO:0001819	synonymous_variant	55907	exon7			GAGAAAAGAAATG	AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	ENST00000229329.2:c.1077A>G	12.37:g.22215331A>G		Somatic	255.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	6.0	NM_018686	Q96AX5|Q9NQZ0	Silent	SNP	ENST00000229329.2	37	CCDS8696.1																																																																																			.		0.373	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402235.1	NM_018686	
CNTN1	1272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	41318438	41318438	+	Silent	SNP	C	C	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:41318438C>G	ENST00000551295.2	+	6	597	c.480C>G	c.(478-480)ccC>ccG	p.P160P	CNTN1_ENST00000348761.2_Silent_p.P149P|CNTN1_ENST00000347616.1_Silent_p.P160P|CNTN1_ENST00000547702.1_Silent_p.P160P|CNTN1_ENST00000360099.3_Silent_p.P160P|CNTN1_ENST00000547849.1_Silent_p.P160P	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	160	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TCTGTGACCCCCCATACCATT	0.378																																					p.P160P		.											.	CNTN1	1149	0			c.C480G						.						121.0	102.0	109.0					12																	41318438		2203	4300	6503	SO:0001819	synonymous_variant	1272	exon6			TGACCCCCCATAC	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.480C>G	12.37:g.41318438C>G		Somatic	240.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	27.0	NM_001256063	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	ENST00000551295.2	37	CCDS8737.1																																																																																			.		0.378	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
CNTRL	11064	hgsc.bcm.edu;bcgsc.ca	37	9	123857201	123857201	+	Silent	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr9:123857201A>G	ENST00000373855.1	+	5	644	c.384A>G	c.(382-384)gaA>gaG	p.E128E	CNTRL_ENST00000373865.2_Silent_p.E128E|CNTRL_ENST00000238341.5_Silent_p.E128E			Q7Z7A1	CNTRL_HUMAN	centriolin	128					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TTAAACTTGAAGTACTGAATC	0.294																																					p.E128E		.											.	CNTRL	661	0			c.A384G						.						76.0	79.0	78.0					9																	123857201		2202	4296	6498	SO:0001819	synonymous_variant	11064	exon3			ACTTGAAGTACTG	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.384A>G	9.37:g.123857201A>G		Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	ENST00000373855.1	37	CCDS35118.1																																																																																			.		0.294	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
COQ3	51805	hgsc.bcm.edu;bcgsc.ca	37	6	99823850	99823850	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:99823850T>C	ENST00000254759.3	-	5	719	c.695A>G	c.(694-696)gAa>gGa	p.E232G	COQ3_ENST00000479163.1_5'Flank|COQ3_ENST00000369240.1_Intron|COQ3_ENST00000369242.1_Intron	NM_017421.3	NP_059117.3	Q9NZJ6	COQ3_HUMAN	coenzyme Q3 methyltransferase	232					glycerol metabolic process (GO:0006071)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2-polyprenyl-6-methoxy-1,4-benzoquinone methyltransferase activity (GO:0008425)|3-demethylubiquinone-9 3-O-methyltransferase activity (GO:0008689)|hexaprenyldihydroxybenzoate methyltransferase activity (GO:0004395)|O-methyltransferase activity (GO:0008171)			cervix(1)|lung(5)|upper_aerodigestive_tract(2)	8		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0625)		TAAAAATGTTTCTAGATCAAT	0.378																																					p.E232G		.											.	COQ3	91	0			c.A695G						.						156.0	151.0	153.0					6																	99823850		2203	4300	6503	SO:0001583	missense	51805	exon5			AATGTTTCTAGAT	AF193016	CCDS5042.1	6q21	2013-05-01	2013-05-01		ENSG00000132423	ENSG00000132423	2.1.1.114		18175	protein-coding gene	gene with protein product	"""polyprenyldihydroxybenzoate methyltransferase"""	605196	"""coenzyme Q3 homolog, methyltransferase (yeast)"", ""coenzyme Q3 homolog, methyltransferase (S. cerevisiae)"""			10777520	Standard	NM_017421		Approved	bA9819.1	uc003ppk.3	Q9NZJ6	OTTHUMG00000015264	ENST00000254759.3:c.695A>G	6.37:g.99823850T>C	ENSP00000254759:p.Glu232Gly	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_017421	B3KPX0|Q5T061|Q6P4F0|Q8IXG6|Q96BG1|Q9H0N1	Missense_Mutation	SNP	ENST00000254759.3	37	CCDS5042.1	.	.	.	.	.	.	.	.	.	.	T	17.06	3.293444	0.60086	.	.	ENSG00000132423	ENST00000254759	T	0.15487	2.42	5.49	5.49	0.81192	Methyltransferase type 11 (1);	0.152438	0.64402	D	0.000017	T	0.26011	0.0634	L	0.58969	1.84	0.80722	D	1	D	0.60160	0.987	D	0.64506	0.926	T	0.01048	-1.1469	10	0.38643	T	0.18	-8.7894	15.5817	0.76448	0.0:0.0:0.0:1.0	.	232	Q9NZJ6	COQ3_HUMAN	G	232	ENSP00000254759:E232G	ENSP00000254759:E232G	E	-	2	0	COQ3	99930571	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.606000	0.82863	2.090000	0.63153	0.459000	0.35465	GAA	.		0.378	COQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041602.1	NM_017421	
CPSF1	29894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145619449	145619449	+	Splice_Site	SNP	C	C	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr8:145619449C>A	ENST00000349769.3	-	33	3905	c.3811G>T	c.(3811-3813)Gtg>Ttg	p.V1271L	MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_Intron	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	1271					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)	p.V1271L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GCCCACATACCCAGAAAACCC	0.672																																					p.V1271L	NSCLC(133;1088 1848 27708 34777 35269)	.											.	CPSF1	91	1	Substitution - Missense(1)	lung(1)	c.G3811T						.						22.0	29.0	26.0					8																	145619449		2171	4258	6429	SO:0001630	splice_region_variant	29894	exon33			ACATACCCAGAAA	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.3811+1G>T	8.37:g.145619449C>A		Somatic	272.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	47.0	NM_013291	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255833	0.59321	.	.	ENSG00000071894	ENST00000349769	T	0.45276	0.9	5.06	5.06	0.68205	Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.53433	0.1796	M	0.73372	2.23	0.80722	D	1	B	0.28055	0.199	B	0.42214	0.38	T	0.51076	-0.8751	9	.	.	.	-35.4922	16.2654	0.82577	0.0:1.0:0.0:0.0	.	1271	Q10570	CPSF1_HUMAN	L	1271	ENSP00000339353:V1271L	.	V	-	1	0	CPSF1	145590257	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	7.284000	0.78650	2.514000	0.84764	0.555000	0.69702	GTG	.		0.672	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291	Missense_Mutation
CTAGE15	441294	broad.mit.edu;mdanderson.org	37	7	143270096	143270096	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr7:143270096A>C	ENST00000420911.2	+	1	1203	c.1186A>C	c.(1186-1188)Atg>Ctg	p.M396L	RNU6-162P_ENST00000516228.1_RNA	NM_001008747.1	NP_001008747.1	A4D2H0	CTGEF_HUMAN	CTAGE family, member 15	396						integral component of membrane (GO:0016021)											AGAAAATGAAATGAAACTCTA	0.348																																					p.M396L		.											.	.	.	0			c.A1186C						.						14.0	13.0	14.0					7																	143270096		1519	3427	4946	SO:0001583	missense	441294	exon1			AATGAAATGAAAC		CCDS64788.1	7q35	2013-02-25	2013-02-25	2013-02-25	ENSG00000176227	ENSG00000271079			37295	protein-coding gene	gene with protein product			"""CTAGE family, member 15, pseudogene"""	CTAGE15P			Standard	NM_001008747		Approved		uc011kth.3	A4D2H0	OTTHUMG00000153233	ENST00000420911.2:c.1186A>C	7.37:g.143270096A>C	ENSP00000474204:p.Met396Leu	Somatic	955.0	1.0		WXS	Illumina HiSeq	Phase_I	915.0	82.0	NM_001008747	A6H8Z8	Missense_Mutation	SNP	ENST00000420911.2	37																																																																																				.		0.348	CTAGE15-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000330280.2	NM_001008747	
CTH	1491	hgsc.bcm.edu;bcgsc.ca	37	1	70881689	70881689	+	Silent	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:70881689A>G	ENST00000370938.3	+	2	363	c.219A>G	c.(217-219)aaA>aaG	p.K73K	CTH_ENST00000464926.1_3'UTR|CTH_ENST00000411986.2_Silent_p.K73K|CTH_ENST00000346806.2_Silent_p.K73K	NM_001902.5	NP_001893.2	Q96IQ7	VSIG2_HUMAN	cystathionine gamma-lyase	0	Ig-like V-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						GCCTTGAAAAAGCAGTGGCAG	0.368																																					p.K73K		.											.	CTH	91	0			c.A219G						.						83.0	90.0	88.0					1																	70881689		2203	4300	6503	SO:0001819	synonymous_variant	1491	exon2			TGAAAAAGCAGTG	BC015807	CCDS650.1, CCDS651.1, CCDS53333.1	1p31.1	2014-06-24	2014-06-24		ENSG00000116761	ENSG00000116761	4.4.1.1		2501	protein-coding gene	gene with protein product		607657	"""cystathionase (cystathionine gamma-lyase)"""			1339280	Standard	NM_001902		Approved		uc001dfd.3	P32929	OTTHUMG00000009352	ENST00000370938.3:c.219A>G	1.37:g.70881689A>G		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_153742	O95791|Q9NX42	Silent	SNP	ENST00000370938.3	37	CCDS650.1																																																																																			.		0.368	CTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025918.1	NM_001902	
CTNNAL1	8727	hgsc.bcm.edu;bcgsc.ca	37	9	111734974	111734974	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr9:111734974T>C	ENST00000325551.4	-	9	1414	c.1328A>G	c.(1327-1329)cAg>cGg	p.Q443R	CTNNAL1_ENST00000488130.1_5'UTR|CTNNAL1_ENST00000374595.4_Missense_Mutation_p.Q443R|CTNNAL1_ENST00000325580.6_Intron	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	443					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		CTGCTCTTTCTGTTCAGAGAG	0.343																																					p.Q443R		.											.	CTNNAL1	228	0			c.A1328G						.						110.0	113.0	112.0					9																	111734974		2203	4300	6503	SO:0001583	missense	8727	exon9			TCTTTCTGTTCAG	AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.1328A>G	9.37:g.111734974T>C	ENSP00000320434:p.Gln443Arg	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_003798	B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Missense_Mutation	SNP	ENST00000325551.4	37	CCDS6775.1	.	.	.	.	.	.	.	.	.	.	T	19.01	3.744326	0.69418	.	.	ENSG00000119326	ENST00000374595;ENST00000325551	T;T	0.36157	1.27;1.27	6.17	6.17	0.99709	.	0.049382	0.85682	D	0.000000	T	0.49098	0.1537	M	0.63428	1.95	0.80722	D	1	D;P;D	0.53619	0.961;0.778;0.961	P;P;P	0.54924	0.764;0.452;0.764	T	0.36841	-0.9731	10	0.22706	T	0.39	-11.7007	14.7743	0.69713	0.0:0.0:0.0:1.0	.	443;443;443	B2RBI4;Q9UBT7-2;Q9UBT7	.;.;CTNL1_HUMAN	R	443	ENSP00000363723:Q443R;ENSP00000320434:Q443R	ENSP00000320434:Q443R	Q	-	2	0	CTNNAL1	110774795	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.702000	0.68332	2.371000	0.80710	0.533000	0.62120	CAG	.		0.343	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053577.1	NM_003798	
CXorf38	159013	hgsc.bcm.edu;bcgsc.ca	37	X	40489973	40489973	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chrX:40489973A>G	ENST00000327877.5	-	6	880	c.854T>C	c.(853-855)cTt>cCt	p.L285P	CXorf38_ENST00000378426.1_Missense_Mutation_p.L166P|CXorf38_ENST00000440784.2_Missense_Mutation_p.L200P|CXorf38_ENST00000378421.1_Missense_Mutation_p.L166P	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	285										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						GCCATTTCTAAGATCCTCATT	0.433																																					p.L285P		.											.	CXorf38	131	0			c.T854C						.						157.0	123.0	134.0					X																	40489973		2203	4300	6503	SO:0001583	missense	159013	exon6			TTTCTAAGATCCT	AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.854T>C	X.37:g.40489973A>G	ENSP00000330488:p.Leu285Pro	Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	4.0	NM_144970	B3KW28|D3DWB5|Q5JPF5|Q8N941	Missense_Mutation	SNP	ENST00000327877.5	37	CCDS14253.1	.	.	.	.	.	.	.	.	.	.	a	20.5	3.999416	0.74818	.	.	ENSG00000185753	ENST00000378426;ENST00000327877;ENST00000378421;ENST00000440784	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000002	T	0.78698	0.4324	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.68483	0.958;0.943	T	0.81046	-0.1110	10	0.87932	D	0	-20.1348	12.3606	0.55201	1.0:0.0:0.0:0.0	.	200;285	E7EN46;Q8TB03	.;CX038_HUMAN	P	166;285;166;200	ENSP00000367683:L166P;ENSP00000330488:L285P;ENSP00000367677:L166P;ENSP00000400019:L200P	ENSP00000330488:L285P	L	-	2	0	CXorf38	40374917	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	4.715000	0.61909	1.907000	0.55213	0.483000	0.47432	CTT	.		0.433	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060685.3	NM_144970	
CYB5R2	51700	hgsc.bcm.edu;bcgsc.ca	37	11	7687733	7687733	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:7687733T>C	ENST00000533558.1	-	8	1163	c.607A>G	c.(607-609)Act>Gct	p.T203A	CYB5R2_ENST00000524790.1_Missense_Mutation_p.T203A|CYB5R2_ENST00000299498.6_Missense_Mutation_p.T203A|CYB5R2_ENST00000528585.1_Intron|CYB5R2_ENST00000299497.9_Missense_Mutation_p.T203A			Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase 2	203					oxidation-reduction process (GO:0055114)|sterol biosynthetic process (GO:0016126)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCTGGGTGAGTCCTGGCAATT	0.517											OREG0020724	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T203A		.											.	CYB5R2	90	0			c.A607G						.						178.0	157.0	164.0					11																	7687733		2201	4296	6497	SO:0001583	missense	51700	exon8			GGTGAGTCCTGGC	AF169802	CCDS7780.1	11p15.4	2014-08-12			ENSG00000166394	ENSG00000166394	1.6.2.2		24376	protein-coding gene	gene with protein product		608342				10611283	Standard	XM_005252973		Approved		uc001mfm.3	Q6BCY4	OTTHUMG00000165665	ENST00000533558.1:c.607A>G	11.37:g.7687733T>C	ENSP00000437041:p.Thr203Ala	Somatic	168.0	0.0	643	WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_016229	Q9BVA3|Q9UF68|Q9UHJ0	Missense_Mutation	SNP	ENST00000533558.1	37	CCDS7780.1	.	.	.	.	.	.	.	.	.	.	T	3.364	-0.129798	0.06753	.	.	ENSG00000166394	ENST00000524790;ENST00000299498;ENST00000533558;ENST00000299497	D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05	5.79	3.49	0.39957	Oxidoreductase FAD/NAD(P)-binding (1);	0.372921	0.32081	N	0.006610	T	0.60958	0.2309	N	0.01751	-0.74	0.09310	N	1	B	0.06786	0.001	B	0.14023	0.01	T	0.50224	-0.8853	10	0.19590	T	0.45	-2.9356	6.7876	0.23682	0.0:0.0793:0.1546:0.7661	.	203	Q6BCY4	NB5R2_HUMAN	A	203	ENSP00000435916:T203A;ENSP00000299498:T203A;ENSP00000437041:T203A;ENSP00000299497:T203A	ENSP00000299497:T203A	T	-	1	0	CYB5R2	7644309	0.029000	0.19370	0.002000	0.10522	0.499000	0.33736	1.442000	0.35046	1.007000	0.39238	0.533000	0.62120	ACT	.		0.517	CYB5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385679.1	NM_016229	
DENND4A	10260	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	65968921	65968921	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:65968921C>G	ENST00000431932.2	-	23	4307	c.4099G>C	c.(4099-4101)Gaa>Caa	p.E1367Q	DENND4A_ENST00000443035.3_Missense_Mutation_p.E1410Q	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1367					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GAGGTAGATTCAGAATCCTGG	0.393																																					p.E1410Q		.											.	DENND4A	229	0			c.G4228C						.						80.0	75.0	77.0					15																	65968921		1851	4089	5940	SO:0001583	missense	10260	exon24			TAGATTCAGAATC	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.4099G>C	15.37:g.65968921C>G	ENSP00000396830:p.Glu1367Gln	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	5.0	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	37	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.440411	0.43326	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.05258	3.47;3.47	5.66	4.75	0.60458	.	1.745490	0.02428	N	0.083288	T	0.10035	0.0246	L	0.47716	1.5	0.47737	D	0.999507	B;B	0.32245	0.361;0.361	B;B	0.26864	0.074;0.074	T	0.33548	-0.9864	10	0.25751	T	0.34	.	14.6074	0.68489	0.0:0.93:0.0:0.07	.	1410;1367	E7EPL3;Q7Z401	.;MYCPP_HUMAN	Q	1410;1367	ENSP00000391167:E1410Q;ENSP00000396830:E1367Q	ENSP00000396830:E1367Q	E	-	1	0	DENND4A	63755975	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.997000	0.70646	1.412000	0.46977	0.655000	0.94253	GAA	.		0.393	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
DGKH	160851	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	42764600	42764600	+	Silent	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr13:42764600C>T	ENST00000337343.4	+	16	1995	c.1974C>T	c.(1972-1974)agC>agT	p.S658S	DGKH_ENST00000540693.1_Silent_p.S658S|DGKH_ENST00000379274.2_Silent_p.S522S|DGKH_ENST00000538674.1_Silent_p.S413S|DGKH_ENST00000536612.1_Silent_p.S522S|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000261491.5_Silent_p.S658S	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	658					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		ATTATGACAGCACAGAAACAG	0.378																																					p.S658S		.											.	DGKH	652	0			c.C1974T						.						113.0	110.0	111.0					13																	42764600		2203	4300	6503	SO:0001819	synonymous_variant	160851	exon17			TGACAGCACAGAA	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.1974C>T	13.37:g.42764600C>T		Somatic	116.0	1.0		WXS	Illumina HiSeq	Phase_I	58.0	26.0	NM_001204504	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Silent	SNP	ENST00000337343.4	37	CCDS9381.1																																																																																			.		0.378	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
DLGAP3	58512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	35334624	35334624	+	Silent	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:35334624G>A	ENST00000373347.1	-	9	2335	c.2067C>T	c.(2065-2067)ggC>ggT	p.G689G	DLGAP3_ENST00000235180.4_Silent_p.G689G			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	689					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				GGCCTGCCAGGCCCTCCAGCT	0.682																																					p.G689G		.											.	DLGAP3	71	0			c.C2067T						.						14.0	13.0	13.0					1																	35334624		2128	4110	6238	SO:0001819	synonymous_variant	58512	exon7			TGCCAGGCCCTCC	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.2067C>T	1.37:g.35334624G>A		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	25.0	NM_001080418	Q5TDD5|Q9H3X7	Silent	SNP	ENST00000373347.1	37	CCDS30670.1																																																																																			.		0.682	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234	
DNAH10	196385	hgsc.bcm.edu;bcgsc.ca	37	12	124305128	124305128	+	Splice_Site	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:124305128A>G	ENST00000409039.3	+	23	3673	c.3648A>G	c.(3646-3648)ggA>ggG	p.G1216G		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1216	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ATTTACTAGGAGTAGAGCTTT	0.333																																					p.G1216G		.											.	DNAH10	95	0			c.A3648G						.						65.0	67.0	66.0					12																	124305128		1826	4087	5913	SO:0001630	splice_region_variant	196385	exon23			ACTAGGAGTAGAG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3647-1A>G	12.37:g.124305128A>G		Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																			.		0.333	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		Silent
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	21	41455834	41455835	+	Splice_Site	DNP	CC	CC	GA			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr21:41455834_41455835CC>GA	ENST00000400454.1	-	24	4708_4709	c.4231_4232GG>TC	c.(4231-4233)GGa>TCa	p.G1411S		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1411	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TATCTTATTACCTCTGATAGAG	0.45																																					.|p.G1411X	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.4231+1G>C|c.G4231T						.																																			SO:0001630	splice_region_variant	1826	exon25|exon24			TTATTACCTCTGA|TATTACCTCTGAT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4231_4232delinsGA	21.37:g.41455834_41455835delinsGA		Somatic	131.0|134.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0|86.0	34.0|35.0	NM_001271534	O60468	Splice_Site|Nonsense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1																																																																																			.		0.450	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	Missense_Mutation
DZIP3	9666	hgsc.bcm.edu;bcgsc.ca	37	3	108367792	108367792	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:108367792A>G	ENST00000361582.3	+	17	2220	c.1990A>G	c.(1990-1992)Aag>Gag	p.K664E	DZIP3_ENST00000463306.1_Missense_Mutation_p.K664E	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	664	Poly-Lys.				protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						GAAAAAGAAGAAGACTAAGAA	0.239																																					p.K664E		.											.	DZIP3	91	0			c.A1990G						.						29.0	28.0	28.0					3																	108367792		2058	4163	6221	SO:0001583	missense	9666	exon17			AAGAAGAAGACTA	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.1990A>G	3.37:g.108367792A>G	ENSP00000355028:p.Lys664Glu	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	4.0	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	37	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	a	13.95	2.388769	0.42308	.	.	ENSG00000198919	ENST00000361582;ENST00000463306	T;T	0.31247	1.5;1.5	3.93	3.93	0.45458	.	0.266695	0.26727	N	0.022819	T	0.21881	0.0527	L	0.40543	1.245	0.22096	N	0.999363	B;B	0.31318	0.319;0.155	B;B	0.24155	0.051;0.051	T	0.13899	-1.0492	10	0.41790	T	0.15	-4.5124	9.4659	0.38813	1.0:0.0:0.0:0.0	.	282;664	D3DN61;Q86Y13	.;DZIP3_HUMAN	E	664	ENSP00000355028:K664E;ENSP00000419981:K664E	ENSP00000355028:K664E	K	+	1	0	DZIP3	109850482	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	2.118000	0.41949	2.001000	0.58596	0.459000	0.35465	AAG	.		0.239	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
E2F1	1869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	32265257	32265257	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr20:32265257T>A	ENST00000343380.5	-	5	954	c.815A>T	c.(814-816)cAg>cTg	p.Q272L	NECAB3_ENST00000375238.4_5'Flank|RP1-63M2.5_ENST00000606866.1_RNA	NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	272	Dimerization. {ECO:0000255}.|Required for interaction with TRIM28.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						GGCTTGGAGCTGGGTCTCAGG	0.612																																					p.Q272L		.											.	E2F1	838	0			c.A815T						.						92.0	84.0	87.0					20																	32265257		2203	4300	6503	SO:0001583	missense	1869	exon5			TGGAGCTGGGTCT		CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.815A>T	20.37:g.32265257T>A	ENSP00000345571:p.Gln272Leu	Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	47.0	NM_005225	Q13143|Q92768	Missense_Mutation	SNP	ENST00000343380.5	37	CCDS13224.1	.	.	.	.	.	.	.	.	.	.	T	14.51	2.556112	0.45487	.	.	ENSG00000101412	ENST00000343380	D	0.85088	-1.94	5.02	3.92	0.45320	.	0.199142	0.45606	D	0.000347	T	0.77287	0.4108	L	0.50333	1.59	0.40587	D	0.981456	P	0.41345	0.746	B	0.30943	0.122	T	0.77885	-0.2421	10	0.72032	D	0.01	-9.7838	10.331	0.43823	0.0:0.0778:0.0:0.9222	.	272	Q01094	E2F1_HUMAN	L	272	ENSP00000345571:Q272L	ENSP00000345571:Q272L	Q	-	2	0	E2F1	31728918	1.000000	0.71417	0.988000	0.46212	0.969000	0.65631	3.976000	0.56867	0.946000	0.37632	0.379000	0.24179	CAG	.		0.612	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078731.2		
EDEM1	9695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	5252876	5252876	+	Missense_Mutation	SNP	G	G	C	rs148682616		TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:5252876G>C	ENST00000256497.4	+	10	1788	c.1655G>C	c.(1654-1656)aGt>aCt	p.S552T	EDEM1_ENST00000445686.1_Missense_Mutation_p.S357T	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	552					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		TTCTTTCTCAGTGAGACCTGT	0.448																																					p.S552T		.											.	EDEM1	137	0			c.G1655C						.						111.0	103.0	106.0					3																	5252876		2203	4300	6503	SO:0001583	missense	9695	exon10			TTCTCAGTGAGAC	D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.1655G>C	3.37:g.5252876G>C	ENSP00000256497:p.Ser552Thr	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	31.0	NM_014674	A8K9C8|B4DXP3	Missense_Mutation	SNP	ENST00000256497.4	37	CCDS33686.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.777636	0.90195	.	.	ENSG00000134109	ENST00000256497;ENST00000445686	T;T	0.74002	-0.8;-0.8	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.90417	0.7000	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.92807	0.6261	10	0.72032	D	0.01	-17.1796	19.1382	0.93436	0.0:0.0:1.0:0.0	.	552	Q92611	EDEM1_HUMAN	T	552;357	ENSP00000256497:S552T;ENSP00000394099:S357T	ENSP00000256497:S552T	S	+	2	0	EDEM1	5227876	1.000000	0.71417	0.978000	0.43139	0.796000	0.44982	7.451000	0.80668	2.505000	0.84491	0.655000	0.94253	AGT	G|0.999;A|0.000		0.448	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337566.2	NM_014674	
EFHC2	80258	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	44109537	44109537	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chrX:44109537A>G	ENST00000420999.1	-	5	844	c.761T>C	c.(760-762)tTc>tCc	p.F254S		NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	254	DM10 2. {ECO:0000255|PROSITE- ProRule:PRU00665}.						calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						ATCACACAAGAAGTAATGCAG	0.448																																					p.F254S		.											.	EFHC2	135	0			c.T761C						.						81.0	70.0	74.0					X																	44109537		1934	4125	6059	SO:0001583	missense	80258	exon5			CACAAGAAGTAAT	AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.761T>C	X.37:g.44109537A>G	ENSP00000404232:p.Phe254Ser	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_025184	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Missense_Mutation	SNP	ENST00000420999.1	37	CCDS55405.1	.	.	.	.	.	.	.	.	.	.	A	10.76	1.441764	0.25900	.	.	ENSG00000183690	ENST00000333807;ENST00000420999;ENST00000378056	T;T	0.59083	0.29;0.29	5.8	3.31	0.37934	Uncharacterised domain DM10 (2);	0.238136	0.41712	D	0.000838	T	0.78046	0.4222	M	0.91090	3.175	0.38279	D	0.942374	D	0.71674	0.998	D	0.70935	0.971	T	0.80973	-0.1143	10	0.87932	D	0	-14.1999	10.4636	0.44594	0.4759:0.0:0.0:0.5241	.	254	Q5JST6	EFHC2_HUMAN	S	254;282;58	ENSP00000333823:F254S;ENSP00000404232:F282S	ENSP00000333823:F254S	F	-	2	0	EFHC2	43994481	1.000000	0.71417	0.017000	0.16124	0.019000	0.09904	2.001000	0.40825	0.257000	0.21650	-0.367000	0.07326	TTC	.		0.448	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184	
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	38337733	38337733	+	Splice_Site	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr5:38337733T>C	ENST00000354891.3	+	2	553		c.e2+2		EGFLAM_ENST00000322350.5_Splice_Site	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains						extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GGGTACACTGTGAGTACACGG	0.488																																					.	Colon(62;485 1295 3347 17454)	.											.	EGFLAM	187	0			c.207+2T>C						.						85.0	62.0	69.0					5																	38337733		2203	4299	6502	SO:0001630	splice_region_variant	133584	exon2			ACACTGTGAGTAC	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.207+2T>C	5.37:g.38337733T>C		Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	26.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Splice_Site	SNP	ENST00000354891.3	37	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.174520	0.57692	.	.	ENSG00000164318	ENST00000354891;ENST00000322350	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9606	0.71153	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	EGFLAM	38373490	1.000000	0.71417	1.000000	0.80357	0.530000	0.34684	4.791000	0.62460	2.171000	0.68590	0.533000	0.62120	.	.		0.488	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	Intron
EHBP1L1	254102	hgsc.bcm.edu;bcgsc.ca	37	11	65350029	65350029	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:65350029A>G	ENST00000309295.4	+	9	2151	c.1886A>G	c.(1885-1887)gAg>gGg	p.E629G		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	629	Glu-rich.					membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GCACAGTGTGAGGGACTGGAG	0.542																																					p.E629G		.											.	EHBP1L1	69	0			c.A1886G						.						59.0	65.0	63.0					11																	65350029		2008	4185	6193	SO:0001583	missense	254102	exon9			AGTGTGAGGGACT	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.1886A>G	11.37:g.65350029A>G	ENSP00000312671:p.Glu629Gly	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_001099409	Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	37	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.771561	0.49680	.	.	ENSG00000173442	ENST00000309295	T	0.69175	-0.38	4.44	2.04	0.26737	.	.	.	.	.	T	0.53384	0.1793	L	0.36672	1.1	0.09310	N	0.999999	B	0.10296	0.003	B	0.08055	0.003	T	0.49753	-0.8906	9	0.87932	D	0	.	6.5881	0.22632	0.696:0.0:0.304:0.0	.	629	Q8N3D4	EH1L1_HUMAN	G	629	ENSP00000312671:E629G	ENSP00000312671:E629G	E	+	2	0	EHBP1L1	65106605	0.764000	0.28473	0.011000	0.14972	0.008000	0.06430	1.848000	0.39309	0.581000	0.29539	0.383000	0.25322	GAG	.		0.542	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658	
EMILIN2	84034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	2890914	2890914	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr18:2890914G>T	ENST00000254528.3	+	4	948	c.789G>T	c.(787-789)aaG>aaT	p.K263N		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	263					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		AGGACATCAAGTCTGAATTGG	0.498																																					p.K263N		.											.	EMILIN2	93	0			c.G789T						.						47.0	50.0	49.0					18																	2890914		2203	4300	6503	SO:0001583	missense	84034	exon4			CATCAAGTCTGAA	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.789G>T	18.37:g.2890914G>T	ENSP00000254528:p.Lys263Asn	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	19.0	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.481739	0.44147	.	.	ENSG00000132205	ENST00000254528	T	0.36520	1.25	5.41	2.68	0.31781	.	0.372434	0.27715	N	0.018149	T	0.33118	0.0852	M	0.67953	2.075	0.32429	N	0.548359	P	0.40376	0.715	B	0.41723	0.365	T	0.36553	-0.9743	10	0.25106	T	0.35	-22.8633	5.1566	0.15038	0.348:0.0:0.5202:0.1318	.	263	Q9BXX0	EMIL2_HUMAN	N	263	ENSP00000254528:K263N	ENSP00000254528:K263N	K	+	3	2	EMILIN2	2880914	1.000000	0.71417	0.978000	0.43139	0.918000	0.54935	3.208000	0.51114	0.267000	0.21916	0.557000	0.71058	AAG	.		0.498	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
EPPK1	83481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144944289	144944289	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr8:144944289C>T	ENST00000525985.1	-	2	3204	c.3133G>A	c.(3133-3135)Gcc>Acc	p.A1045T				P58107	EPIPL_HUMAN	epiplakin 1	1045						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTCCTGTGGCCACTTGAGCC	0.597																																					p.A1045T		.											.	EPPK1	25	0			c.G3133A						.						30.0	34.0	33.0					8																	144944289		2098	4233	6331	SO:0001583	missense	83481	exon1			CTGTGGCCACTTG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.3133G>A	8.37:g.144944289C>T	ENSP00000436337:p.Ala1045Thr	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	52.0	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	17.90	3.501754	0.64298	.	.	ENSG00000227184	ENST00000525985	T	0.79454	-1.27	4.54	3.61	0.41365	.	.	.	.	.	T	0.81044	0.4741	L	0.50919	1.6	0.37637	D	0.921882	D	0.69078	0.997	D	0.64506	0.926	T	0.79115	-0.1936	9	0.23891	T	0.37	.	10.5803	0.45252	0.2398:0.7602:0.0:0.0	.	1045	E9PPU0	.	T	1045	ENSP00000436337:A1045T	ENSP00000436337:A1045T	A	-	1	0	EPPK1	145016277	1.000000	0.71417	1.000000	0.80357	0.336000	0.28762	3.864000	0.56024	1.005000	0.39183	0.563000	0.77884	GCC	.		0.597	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
FLOT1	10211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30707949	30707949	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:30707949C>A	ENST00000376389.3	-	8	929	c.709G>T	c.(709-711)Gcc>Tcc	p.A237S	FLOT1_ENST00000470643.1_5'UTR|XXbac-BPG252P9.10_ENST00000607333.1_RNA|FLOT1_ENST00000456573.2_Missense_Mutation_p.A189S	NM_005803.2	NP_005794.1	P41440	S19A1_HUMAN	flotillin 1	0					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|prostate(1)	13					Methotrexate(DB00563)|Pralatrexate(DB06813)	AGCTGATAGGCCAGGTCAGCC	0.562																																					p.A237S		.											.	FLOT1	90	0			c.G709T						.						94.0	71.0	79.0					6																	30707949		1511	2709	4220	SO:0001583	missense	10211	exon8			GATAGGCCAGGTC	AF089750	CCDS4688.1	6p21.3	2010-02-17			ENSG00000137312	ENSG00000137312			3757	protein-coding gene	gene with protein product		606998					Standard	XM_005248780		Approved		uc003nrm.3	O75955	OTTHUMG00000031151	ENST00000376389.3:c.709G>T	6.37:g.30707949C>A	ENSP00000365569:p.Ala237Ser	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	24.0	NM_005803	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	ENST00000376389.3	37	CCDS4688.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249218	0.59103	.	.	ENSG00000137312	ENST00000376389;ENST00000456573;ENST00000413165;ENST00000438162;ENST00000418160	D;T;D	0.96992	-3.79;1.3;-4.2	4.74	3.87	0.44632	.	0.058090	0.64402	D	0.000002	D	0.92586	0.7645	M	0.67625	2.065	0.51767	D	0.999934	B;B	0.32324	0.364;0.104	B;B	0.34489	0.184;0.117	D	0.92269	0.5823	10	0.56958	D	0.05	-16.5585	10.9434	0.47287	0.0:0.8114:0.1886:0.0	.	189;237	B4DVY7;O75955	.;FLOT1_HUMAN	S	237;189;174;237;142	ENSP00000365569:A237S;ENSP00000394375:A189S;ENSP00000400615:A237S	ENSP00000365569:A237S	A	-	1	0	FLOT1	30815928	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.160000	0.77495	1.212000	0.43366	0.609000	0.83330	GCC	.		0.562	FLOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076276.2		
FBXL4	26235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	99374410	99374410	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:99374410A>C	ENST00000369244.2	-	4	883	c.455T>G	c.(454-456)aTt>aGt	p.I152S	FBXL4_ENST00000229971.1_Missense_Mutation_p.I152S	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	152					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		GAGAATTCTAATGACTGCTCC	0.393																																					p.I152S		.											.	FBXL4	227	0			c.T455G						.						93.0	88.0	90.0					6																	99374410		2203	4300	6503	SO:0001583	missense	26235	exon3			ATTCTAATGACTG	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.455T>G	6.37:g.99374410A>C	ENSP00000358247:p.Ile152Ser	Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	45.0	NM_012160	B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	ENST00000369244.2	37	CCDS5041.1	.	.	.	.	.	.	.	.	.	.	A	16.13	3.035112	0.54896	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.14893	2.47;2.47	5.52	5.52	0.82312	.	0.050504	0.85682	D	0.000000	T	0.10423	0.0255	L	0.48642	1.525	0.53005	D	0.999967	B	0.32245	0.361	B	0.31686	0.134	T	0.02766	-1.1113	10	0.87932	D	0	.	15.9507	0.79835	1.0:0.0:0.0:0.0	.	152	Q9UKA2	FBXL4_HUMAN	S	152	ENSP00000358247:I152S;ENSP00000229971:I152S	ENSP00000229971:I152S	I	-	2	0	FBXL4	99481131	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	8.910000	0.92685	2.232000	0.73038	0.528000	0.53228	ATT	.		0.393	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2		
FMNL2	114793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	153435453	153435453	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:153435453C>G	ENST00000288670.9	+	8	1124	c.757C>G	c.(757-759)Cta>Gta	p.L253V		NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	253	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						TGAGATTGCACTAAGCCTGAA	0.388																																					p.L253V		.											.	FMNL2	516	0			c.C757G						.						81.0	79.0	79.0					2																	153435453		1929	4166	6095	SO:0001583	missense	114793	exon8			ATTGCACTAAGCC	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.757C>G	2.37:g.153435453C>G	ENSP00000288670:p.Leu253Val	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	19.0	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000288670.9	37	CCDS46429.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.813000	0.70912	.	.	ENSG00000157827	ENST00000288670	D	0.89552	-2.53	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.95162	0.8432	M	0.87180	2.865	0.80722	D	1	D	0.67145	0.996	D	0.75484	0.986	D	0.93768	0.7072	10	0.33141	T	0.24	.	19.4836	0.95020	0.0:1.0:0.0:0.0	.	253	Q96PY5-3	.	V	253	ENSP00000288670:L253V	ENSP00000288670:L253V	L	+	1	2	FMNL2	153143699	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.847000	0.62867	2.700000	0.92200	0.563000	0.77884	CTA	.		0.388	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905	
FMNL2	114793	hgsc.bcm.edu;bcgsc.ca	37	2	153486415	153486415	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:153486415A>G	ENST00000475377.2	+	7	871	c.671A>G	c.(670-672)gAt>gGt	p.D224G	FMNL2_ENST00000288670.9_Missense_Mutation_p.D849G			Q96PY5	FMNL2_HUMAN	formin-like 2	849	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CAGAGTTTAGATCTGGTGAGT	0.388																																					p.D849G		.											.	FMNL2	516	0			c.A2546G						.						94.0	86.0	89.0					2																	153486415		1883	4100	5983	SO:0001583	missense	114793	exon20			GTTTAGATCTGGT	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000475377.2:c.671A>G	2.37:g.153486415A>G	ENSP00000418959:p.Asp224Gly	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000475377.2	37		.	.	.	.	.	.	.	.	.	.	A	20.2	3.942041	0.73557	.	.	ENSG00000157827	ENST00000288670;ENST00000421344;ENST00000475377	T;T	0.63417	-0.04;-0.04	5.61	5.61	0.85477	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	D	0.83769	0.5326	M	0.93763	3.455	0.80722	D	1	D;P;D	0.69078	0.997;0.949;0.991	D;P;D	0.79108	0.992;0.869;0.968	D	0.86461	0.1779	10	0.42905	T	0.14	.	15.759	0.78063	1.0:0.0:0.0:0.0	.	849;330;849	Q96PY5;Q6ZN96;Q96PY5-3	FMNL2_HUMAN;.;.	G	849;330;224	ENSP00000288670:D849G;ENSP00000418959:D224G	ENSP00000288670:D849G	D	+	2	0	FMNL2	153194661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.231000	0.95317	2.269000	0.75478	0.533000	0.62120	GAT	.		0.388	FMNL2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333583.3	NM_052905	
GPM6B	2824	hgsc.bcm.edu;bcgsc.ca	37	X	13803853	13803853	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chrX:13803853A>G	ENST00000356942.5	-	2	577	c.136T>C	c.(136-138)Tcc>Ccc	p.S46P	GPM6B_ENST00000454189.2_Missense_Mutation_p.S27P|GPM6B_ENST00000355135.2_Missense_Mutation_p.S86P|GPM6B_ENST00000398361.3_5'UTR|GPM6B_ENST00000493677.1_Missense_Mutation_p.S60P|GPM6B_ENST00000316715.4_Missense_Mutation_p.S86P	NM_005278.3	NP_005269.1	Q13491	GPM6B_HUMAN	glycoprotein M6B	46					cell differentiation (GO:0030154)|extracellular matrix assembly (GO:0085029)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of serotonin uptake (GO:0051612)|nervous system development (GO:0007399)|ossification (GO:0001503)|positive regulation of bone mineralization (GO:0030501)|protein transport (GO:0015031)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of focal adhesion assembly (GO:0051893)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|pancreas(1)	6						GCCACCCCGGAGAAGCAGAGG	0.572																																					p.S86P		.											.	GPM6B	130	0			c.T256C						.						56.0	51.0	53.0					X																	13803853		2203	4300	6503	SO:0001583	missense	2824	exon3			CCCCGGAGAAGCA		CCDS14158.1, CCDS35206.1, CCDS35207.1, CCDS48084.1	Xp22.2	2010-08-03			ENSG00000046653	ENSG00000046653			4461	protein-coding gene	gene with protein product		300051				8661015	Standard	NM_001001995		Approved	M6B, MGC17150, MGC54284	uc004cvw.3	Q13491	OTTHUMG00000021162	ENST00000356942.5:c.136T>C	X.37:g.13803853A>G	ENSP00000349420:p.Ser46Pro	Somatic	352.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	5.0	NM_001001995	O76077|Q86X43|Q8N956	Missense_Mutation	SNP	ENST00000356942.5	37	CCDS14158.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.882895	0.91740	.	.	ENSG00000046653	ENST00000316715;ENST00000454189;ENST00000493677;ENST00000355135;ENST00000356942;ENST00000475307	D;D;D;D;D;D	0.99252	-5.63;-5.63;-5.63;-5.63;-5.63;-5.63	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.99214	0.9727	M	0.71581	2.175	0.80722	D	1	D;D;D;D;D;D	0.69078	0.993;0.983;0.993;0.994;0.976;0.997	P;P;P;P;P;D	0.68483	0.828;0.736;0.876;0.878;0.828;0.958	D	0.99474	1.0946	10	0.46703	T	0.11	-1.6883	14.9261	0.70878	1.0:0.0:0.0:0.0	.	60;27;46;86;38;86	B7Z613;Q13491-2;Q13491;Q13491-3;Q59FD5;Q8N956	.;.;GPM6B_HUMAN;.;.;.	P	86;27;60;86;46;46	ENSP00000316861:S86P;ENSP00000389915:S27P;ENSP00000419904:S60P;ENSP00000347258:S86P;ENSP00000349420:S46P;ENSP00000418594:S46P	ENSP00000316861:S86P	S	-	1	0	GPM6B	13713774	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	7.007000	0.76335	1.907000	0.55213	0.486000	0.48141	TCC	.		0.572	GPM6B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055822.1	NM_001001995	
GPR124	25960	hgsc.bcm.edu;bcgsc.ca	37	8	37699046	37699046	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr8:37699046T>C	ENST00000412232.2	+	19	3203	c.3190T>C	c.(3190-3192)Ttc>Ctc	p.F1064L	GPR124_ENST00000315215.7_Missense_Mutation_p.F847L	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	1064					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CCTGGGCCTCTTCGTCTTCAC	0.741																																					p.F1064L		.											.	GPR124	157	0			c.T3190C						.						20.0	23.0	22.0					8																	37699046		2202	4297	6499	SO:0001583	missense	25960	exon19			GGCCTCTTCGTCT	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.3190T>C	8.37:g.37699046T>C	ENSP00000406367:p.Phe1064Leu	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	4.0	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.03|19.03	3.747715|3.747715	0.69533|0.69533	.|.	.|.	ENSG00000020181|ENSG00000020181	ENST00000315215;ENST00000412232|ENST00000416514	T;T|.	0.60040|.	0.22;0.22|.	5.01|5.01	5.01|5.01	0.66863|0.66863	GPCR, family 2, secretin-like, conserved site (1);|.	0.114571|.	0.64402|.	D|.	0.000012|.	T|T	0.75148|0.75148	0.3810|0.3810	M|M	0.73598|0.73598	2.24|2.24	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.69078|.	0.997;0.997|.	P;D|.	0.75020|.	0.879;0.985|.	T|T	0.79065|0.79065	-0.1956|-0.1956	10|6	0.87932|0.87932	D|D	0|0	-30.5409|-30.5409	14.7311|14.7311	0.69383|0.69383	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	847;1064|.	Q96PE1-2;Q96PE1|.	.;GP124_HUMAN|.	L|P	847;1064|1056	ENSP00000323508:F847L;ENSP00000406367:F1064L|.	ENSP00000323508:F847L|ENSP00000405145:L1056P	F|L	+|+	1|2	0|0	GPR124|GPR124	37818204|37818204	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.025000|0.025000	0.11179|0.11179	7.764000|7.764000	0.85297|0.85297	1.882000|1.882000	0.54519|0.54519	0.528000|0.528000	0.53228|0.53228	TTC|CTT	.		0.741	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
GPR84	53831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54757190	54757190	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:54757190A>G	ENST00000551809.1	-	1	1081	c.446T>C	c.(445-447)gTg>gCg	p.V149A	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|GPR84_ENST00000267015.3_Missense_Mutation_p.V149A			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						AAAGCTGGCCACGCCCACAAC	0.577																																					p.V149A		.											.	GPR84	523	0			c.T446C						.						54.0	46.0	49.0					12																	54757190		2203	4300	6503	SO:0001583	missense	53831	exon2			CTGGCCACGCCCA	AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.446T>C	12.37:g.54757190A>G	ENSP00000450310:p.Val149Ala	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	24.0	NM_020370	B6V9G7	Missense_Mutation	SNP	ENST00000551809.1	37	CCDS8878.1	.	.	.	.	.	.	.	.	.	.	A	11.06	1.526378	0.27299	.	.	ENSG00000139572	ENST00000267015;ENST00000551809	T;T	0.37584	1.19;1.19	5.02	5.02	0.67125	GPCR, rhodopsin-like superfamily (1);	0.608353	0.13667	N	0.371156	T	0.26231	0.0640	N	0.25060	0.705	0.38787	D	0.954905	B	0.22541	0.071	B	0.25614	0.062	T	0.09357	-1.0678	10	0.16420	T	0.52	-2.519	12.9907	0.58616	1.0:0.0:0.0:0.0	.	149	Q9NQS5	GPR84_HUMAN	A	149	ENSP00000267015:V149A;ENSP00000450310:V149A	ENSP00000267015:V149A	V	-	2	0	GPR84	53043457	0.994000	0.37717	0.775000	0.31657	0.498000	0.33706	6.753000	0.74904	2.020000	0.59435	0.454000	0.30748	GTG	.		0.577	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
GPX8	493869	hgsc.bcm.edu;bcgsc.ca	37	5	54459895	54459895	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr5:54459895A>G	ENST00000503787.1	+	3	554	c.479A>G	c.(478-480)aAg>aGg	p.K160R	GPX8_ENST00000515370.1_Missense_Mutation_p.K109R|CDC20B_ENST00000331730.3_Intron|GPX8_ENST00000506123.1_3'UTR|GPX8_ENST00000296734.6_Missense_Mutation_p.R73G|CDC20B_ENST00000296733.1_Intron|CDC20B_ENST00000381375.2_Intron|CDC20B_ENST00000334206.5_Intron|CDC20B_ENST00000322374.6_Intron	NM_001008397.2	NP_001008398.2	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8 (putative)	160					response to oxidative stress (GO:0006979)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	glutathione peroxidase activity (GO:0004602)|peroxidase activity (GO:0004601)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)	11					Glutathione(DB00143)	TCTTCAAAGAAGGAACCAAGG	0.368																																					p.K160R		.											.	GPX8	68	0			c.A479G						.						58.0	62.0	61.0					5																	54459895		2203	4300	6503	SO:0001583	missense	493869	exon3			CAAAGAAGGAACC	BC029424	CCDS34156.1	5q11.2	2008-09-29				ENSG00000164294			33100	protein-coding gene	gene with protein product							Standard	NM_001008397		Approved	UNQ847, EPLA847	uc003jpq.2	Q8TED1		ENST00000503787.1:c.479A>G	5.37:g.54459895A>G	ENSP00000423822:p.Lys160Arg	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	4.0	NM_001008397		Missense_Mutation	SNP	ENST00000503787.1	37	CCDS34156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.58|15.58	2.875565|2.875565	0.51695|0.51695	.|.	.|.	ENSG00000164294|ENSG00000164294	ENST00000503787;ENST00000515370|ENST00000296734	T;T|.	0.03831|.	3.79;3.79|.	5.92|5.92	3.52|3.52	0.40303|0.40303	Thioredoxin-like fold (2);|.	0.126441|.	0.64402|.	N|.	0.000001|.	T|T	0.60457|0.60457	0.2270|0.2270	L|L	0.58583|0.58583	1.82|1.82	0.43172|0.43172	D|D	0.994973|0.994973	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.58493|0.58493	-0.7627|-0.7627	10|6	0.66056|0.54805	D|T	0.02|0.06	.|.	7.4915|7.4915	0.27464|0.27464	0.6612:0.2708:0.068:0.0|0.6612:0.2708:0.068:0.0	.|.	109;160|.	E7ETY7;Q8TED1|.	.;GPX8_HUMAN|.	R|G	160;109|73	ENSP00000423822:K160R;ENSP00000427466:K109R|.	ENSP00000423822:K160R|ENSP00000296734:R73G	K|R	+|+	2|1	0|2	GPX8|GPX8	54495652|54495652	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	4.537000|4.537000	0.60643|0.60643	0.476000|0.476000	0.27440|0.27440	0.528000|0.528000	0.53228|0.53228	AAG|AGG	.		0.368	GPX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369717.1	NM_001008397	
GRIN2D	2906	hgsc.bcm.edu;broad.mit.edu	37	19	48908506	48908506	+	Silent	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:48908506G>A	ENST00000263269.3	+	3	1069	c.981G>A	c.(979-981)gtG>gtA	p.V327V		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	327					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGGCCGTAGTGGCCAGAGGTG	0.701																																					p.V327V		.											.	GRIN2D	156	0			c.G981A						.						15.0	18.0	17.0					19																	48908506		2184	4252	6436	SO:0001819	synonymous_variant	2906	exon3			CGTAGTGGCCAGA	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.981G>A	19.37:g.48908506G>A		Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	4.0	NM_000836		Silent	SNP	ENST00000263269.3	37	CCDS12719.1																																																																																			.		0.701	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
GSR	2936	hgsc.bcm.edu;bcgsc.ca	37	8	30537135	30537135	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr8:30537135A>G	ENST00000221130.5	-	13	1561	c.1471T>C	c.(1471-1473)Ttt>Ctt	p.F491L	GSR_ENST00000541648.1_Missense_Mutation_p.F438L|GSR_ENST00000414019.1_Missense_Mutation_p.F448L|GSR_ENST00000546342.1_Missense_Mutation_p.F462L|GSR_ENST00000537535.1_Missense_Mutation_p.F409L	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase	491					cell redox homeostasis (GO:0045454)|glutathione metabolic process (GO:0006749)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|glutathione-disulfide reductase activity (GO:0004362)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Flavin adenine dinucleotide(DB03147)|Glutathione(DB00143)	GCAACAGCAAAACCCTGCAGC	0.443																																					p.F491L		.											.	GSR	94	0			c.T1471C						.						169.0	139.0	149.0					8																	30537135		2203	4300	6503	SO:0001583	missense	2936	exon13			CAGCAAAACCCTG		CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687	1.8.1.7		4623	protein-coding gene	gene with protein product		138300					Standard	NM_000637		Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.1471T>C	8.37:g.30537135A>G	ENSP00000221130:p.Phe491Leu	Somatic	319.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_000637	C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	Missense_Mutation	SNP	ENST00000221130.5	37	CCDS34877.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.995070	0.93167	.	.	ENSG00000104687	ENST00000221130;ENST00000414019;ENST00000546342;ENST00000541648;ENST00000537535	D;D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86;-2.86	5.34	5.34	0.76211	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (2);	0.000000	0.85682	D	0.000000	D	0.94411	0.8202	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94458	0.7673	10	0.54805	T	0.06	-6.5594	13.5686	0.61832	1.0:0.0:0.0:0.0	.	491	P00390	GSHR_HUMAN	L	491;448;462;438;409	ENSP00000221130:F491L;ENSP00000390065:F448L;ENSP00000445516:F462L;ENSP00000444559:F438L;ENSP00000438845:F409L	ENSP00000221130:F491L	F	-	1	0	GSR	30656677	1.000000	0.71417	0.992000	0.48379	0.815000	0.46073	8.577000	0.90773	2.160000	0.67779	0.454000	0.30748	TTT	.		0.443	GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376519.1		
GTF3C3	9330	hgsc.bcm.edu;broad.mit.edu	37	2	197654717	197654717	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:197654717A>G	ENST00000263956.3	-	5	702	c.613T>C	c.(613-615)Ttt>Ctt	p.F205L	GTF3C3_ENST00000409364.3_Missense_Mutation_p.F205L|GTF3C3_ENST00000470386.1_5'UTR	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	205					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						ATCAACTCAAACTGCAATGAT	0.378																																					p.F205L		.											.	GTF3C3	97	0			c.T613C						.						117.0	111.0	113.0					2																	197654717		2203	4300	6503	SO:0001583	missense	9330	exon5			ACTCAAACTGCAA	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.613T>C	2.37:g.197654717A>G	ENSP00000263956:p.Phe205Leu	Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_001206774	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	A	33	5.277666	0.95459	.	.	ENSG00000119041	ENST00000263956;ENST00000409364	T;T	0.36157	1.27;1.27	5.66	5.66	0.87406	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.057710	0.64402	N	0.000001	T	0.47655	0.1457	L	0.42008	1.315	0.80722	D	1	P;D	0.67145	0.532;0.996	B;D	0.63192	0.348;0.912	T	0.27872	-1.0061	10	0.15066	T	0.55	-26.7547	15.8985	0.79353	1.0:0.0:0.0:0.0	.	205;205	Q9Y5Q9-2;Q9Y5Q9	.;TF3C3_HUMAN	L	205	ENSP00000263956:F205L;ENSP00000386465:F205L	ENSP00000263956:F205L	F	-	1	0	GTF3C3	197362962	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.202000	0.95026	2.169000	0.68431	0.374000	0.22700	TTT	.		0.378	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
HDLBP	3069	hgsc.bcm.edu;bcgsc.ca	37	2	242194881	242194881	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:242194881C>T	ENST00000391975.1	-	8	1215	c.988G>A	c.(988-990)Gag>Aag	p.E330K	HDLBP_ENST00000391976.2_Missense_Mutation_p.E330K|HDLBP_ENST00000310931.4_Missense_Mutation_p.E330K|HDLBP_ENST00000427183.2_Intron	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	330	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		GGTGGGATCTCAACGGAAACT	0.478																																					p.E330K		.											.	HDLBP	290	0			c.G988A						.						155.0	142.0	147.0					2																	242194881		2203	4300	6503	SO:0001583	missense	3069	exon8			GGATCTCAACGGA		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.988G>A	2.37:g.242194881C>T	ENSP00000375836:p.Glu330Lys	Somatic	265.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_005336	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	37	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.650954	0.87958	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931	T;T;T	0.27720	1.65;1.65;1.65	6.17	6.17	0.99709	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.63674	0.2531	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.62895	-0.6757	10	0.51188	T	0.08	-36.6558	20.8794	0.99867	0.0:1.0:0.0:0.0	.	330;330	B2R5V9;Q00341	.;VIGLN_HUMAN	K	330	ENSP00000375836:E330K;ENSP00000375837:E330K;ENSP00000312042:E330K	ENSP00000312042:E330K	E	-	1	0	HDLBP	241843554	1.000000	0.71417	0.980000	0.43619	0.031000	0.12232	7.755000	0.85180	2.941000	0.99782	0.655000	0.94253	GAG	.		0.478	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
HYOU1	10525	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	118925746	118925746	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:118925746A>G	ENST00000404233.3	-	6	570	c.446T>C	c.(445-447)gTg>gCg	p.V149A	HYOU1_ENST00000525859.1_Missense_Mutation_p.V149A|HYOU1_ENST00000543287.1_Missense_Mutation_p.V62A|HYOU1_ENST00000529972.1_Missense_Mutation_p.V149A	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	149					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CATGCCCAACACTTCCTCAGG	0.532																																					p.V149A		.											.	HYOU1	90	0			c.T446C						.						119.0	99.0	106.0					11																	118925746		2200	4295	6495	SO:0001583	missense	10525	exon6			CCCAACACTTCCT	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.446T>C	11.37:g.118925746A>G	ENSP00000384144:p.Val149Ala	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	4.0	NM_006389	A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	ENST00000404233.3	37	CCDS8408.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.611289	0.87258	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.01287	5.05;5.05;5.05;5.05;5.05	4.96	4.96	0.65561	.	0.122225	0.56097	D	0.000033	T	0.04048	0.0113	M	0.66378	2.025	0.44432	D	0.997352	P;P;P;P	0.43938	0.822;0.729;0.722;0.722	B;P;B;B	0.47603	0.42;0.551;0.42;0.42	T	0.33033	-0.9884	10	0.87932	D	0	-22.4032	13.3595	0.60648	1.0:0.0:0.0:0.0	.	140;193;149;149	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	A	149;140;149;149;149;192;62;149	ENSP00000384144:V149A;ENSP00000437313:V149A;ENSP00000433397:V149A;ENSP00000442727:V62A;ENSP00000431874:V149A	ENSP00000278752:V140A	V	-	2	0	HYOU1	118430956	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.467000	0.73547	2.074000	0.62210	0.459000	0.35465	GTG	.		0.532	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	
ICAM3	3385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10449552	10449552	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:10449552A>G	ENST00000160262.5	-	2	357	c.149T>C	c.(148-150)tTt>tCt	p.F50S	ICAM3_ENST00000589261.1_5'UTR	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3	50	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			GCAGTTCACAAACAGGGACCC	0.572																																					p.F50S		.											.	ICAM3	131	0			c.T149C						.						76.0	74.0	75.0					19																	10449552		2203	4300	6503	SO:0001583	missense	3385	exon2			TTCACAAACAGGG		CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.149T>C	19.37:g.10449552A>G	ENSP00000160262:p.Phe50Ser	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	6.0	NM_002162	Q6PD68	Missense_Mutation	SNP	ENST00000160262.5	37	CCDS12235.1	.	.	.	.	.	.	.	.	.	.	A	8.188	0.795300	0.16327	.	.	ENSG00000076662	ENST00000160262	T	0.21191	2.02	5.66	2.47	0.30058	Intercellular adhesion molecule/vascular cell adhesion molecule, N-terminal (1);Intercellular adhesion molecule, N-terminal (1);Immunoglobulin-like fold (1);	1.072550	0.07277	N	0.870167	T	0.09949	0.0244	N	0.04959	-0.14	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.40961	-0.9535	10	0.15499	T	0.54	-0.1736	6.7699	0.23589	0.7189:0.0:0.2811:0.0	.	50	P32942	ICAM3_HUMAN	S	50	ENSP00000160262:F50S	ENSP00000160262:F50S	F	-	2	0	ICAM3	10310552	0.000000	0.05858	0.001000	0.08648	0.069000	0.16628	0.508000	0.22692	0.121000	0.18284	0.482000	0.46254	TTT	.		0.572	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451234.1		
KCNAB1	7881	hgsc.bcm.edu;bcgsc.ca	37	3	155838405	155838405	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:155838405T>C	ENST00000490337.1	+	1	69	c.5T>C	c.(4-6)cTg>cCg	p.L2P	KCNAB1_ENST00000389636.5_Missense_Mutation_p.L2P	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	2					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TCCACGATGCTGGCAGCCCGG	0.517																																					p.L2P		.											.	KCNAB1	94	0			c.T5C						.						112.0	128.0	123.0					3																	155838405		2203	4300	6503	SO:0001583	missense	7881	exon1			CGATGCTGGCAGC	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.5T>C	3.37:g.155838405T>C	ENSP00000419952:p.Leu2Pro	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_172160	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	37	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.007534	0.75046	.	.	ENSG00000169282	ENST00000490337;ENST00000389636	T;T	0.15139	2.91;2.45	5.33	5.33	0.75918	.	.	.	.	.	T	0.18882	0.0453	N	0.08118	0	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.56343	0.796;0.796	T	0.17776	-1.0358	9	0.87932	D	0	-17.1642	15.3008	0.73949	0.0:0.0:0.0:1.0	.	2;2	B7Z8E5;Q14722	.;KCAB1_HUMAN	P	2	ENSP00000419952:L2P;ENSP00000374287:L2P	ENSP00000374287:L2P	L	+	2	0	KCNAB1	157321099	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.273000	0.65564	2.000000	0.58554	0.455000	0.32223	CTG	.		0.517	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	
KCNMB2	10242	hgsc.bcm.edu;bcgsc.ca	37	3	178560484	178560484	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:178560484T>C	ENST00000432997.1	+	5	819	c.467T>C	c.(466-468)aTg>aCg	p.M156T	RP11-385J1.2_ENST00000425330.1_RNA|RP11-385J1.2_ENST00000451742.1_RNA|RP11-385J1.2_ENST00000437488.1_RNA|KCNMB2_ENST00000420517.2_Missense_Mutation_p.M156T|KCNMB2_ENST00000358316.3_Missense_Mutation_p.M156T|RP11-385J1.2_ENST00000432385.1_RNA|KCNMB2_ENST00000452583.1_Missense_Mutation_p.M156T	NM_001278911.1	NP_001265840.1	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 2	166					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(2)|endometrium(4)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)		Miconazole(DB01110)|Procaine(DB00721)	GAAGAATCCATGTCCCTGGTG	0.373																																					p.M156T		.											.	KCNMB2	91	0			c.T467C						.						91.0	91.0	91.0					3																	178560484		2203	4300	6503	SO:0001583	missense	10242	exon6			AATCCATGTCCCT	AF099137	CCDS3223.1	3q26.32	2005-10-13			ENSG00000197584	ENSG00000197584		"""Potassium channels"""	6286	protein-coding gene	gene with protein product		605214				10097176	Standard	NM_181361		Approved		uc003fjd.3	Q9Y691	OTTHUMG00000157264	ENST00000432997.1:c.467T>C	3.37:g.178560484T>C	ENSP00000407592:p.Met156Thr	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_005832	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	ENST00000432997.1	37	CCDS3223.1	.	.	.	.	.	.	.	.	.	.	T	4.923	0.171559	0.09391	.	.	ENSG00000197584	ENST00000420517;ENST00000452583;ENST00000432997;ENST00000358316;ENST00000457763	T;T;T;T	0.08984	3.03;3.03;3.03;3.03	6.06	6.06	0.98353	.	0.186148	0.64402	D	0.000013	T	0.05364	0.0142	N	0.08118	0	0.41506	D	0.988319	B	0.06786	0.001	B	0.15484	0.013	T	0.45454	-0.9260	10	0.13108	T	0.6	-24.2237	16.6093	0.84858	0.0:0.0:0.0:1.0	.	156	Q9Y691	KCMB2_HUMAN	T	156;156;156;156;137	ENSP00000408252:M156T;ENSP00000397483:M156T;ENSP00000407592:M156T;ENSP00000351068:M156T	ENSP00000351068:M156T	M	+	2	0	KCNMB2	180043178	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.638000	0.46562	2.324000	0.78689	0.533000	0.62120	ATG	.		0.373	KCNMB2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348251.1	NM_181361	
KIAA1217	56243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	24834953	24834953	+	Silent	SNP	A	A	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr10:24834953A>T	ENST00000376454.3	+	21	5562	c.5532A>T	c.(5530-5532)acA>acT	p.T1844T	KIAA1217_ENST00000396445.1_3'UTR|KIAA1217_ENST00000376462.1_Silent_p.T1165T|KIAA1217_ENST00000376451.2_3'UTR|KIAA1217_ENST00000376452.3_Silent_p.T1275T|KIAA1217_ENST00000458595.1_Silent_p.T1250T	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1844	Ser-rich. {ECO:0000255}.				embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GCCCCCAAACAGGACCACCTG	0.493																																					p.T1844T		.											.	KIAA1217	98	0			c.A5532T						.						192.0	199.0	197.0					10																	24834953		2203	4300	6503	SO:0001819	synonymous_variant	56243	exon21			CCAAACAGGACCA	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.5532A>T	10.37:g.24834953A>T		Somatic	346.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	73.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	ENST00000376454.3	37	CCDS31165.1																																																																																			.		0.493	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
KLB	152831	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	39447995	39447995	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr4:39447995T>C	ENST00000257408.4	+	4	1746	c.1649T>C	c.(1648-1650)cTg>cCg	p.L550P		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	550	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						GATCCTCATCTGTACGTGTGG	0.522																																					p.L550P		.											.	KLB	69	0			c.T1649C						.						79.0	73.0	75.0					4																	39447995		2203	4300	6503	SO:0001583	missense	152831	exon4			CTCATCTGTACGT	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1649T>C	4.37:g.39447995T>C	ENSP00000257408:p.Leu550Pro	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	4.0	NM_175737	Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	37	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.920731	0.73213	.	.	ENSG00000134962	ENST00000257408	T	0.29917	1.55	5.77	5.77	0.91146	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.072978	0.56097	D	0.000033	T	0.42359	0.1199	N	0.21142	0.635	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71870	0.975;0.975	T	0.40136	-0.9579	10	0.62326	D	0.03	-14.1461	16.0874	0.81068	0.0:0.0:0.0:1.0	.	541;550	B7ZL50;Q86Z14	.;KLOTB_HUMAN	P	550	ENSP00000257408:L550P	ENSP00000257408:L550P	L	+	2	0	KLB	39124390	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	7.855000	0.86950	2.203000	0.70933	0.397000	0.26171	CTG	.		0.522	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
KNDC1	85442	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	135012267	135012267	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr10:135012267G>A	ENST00000304613.3	+	14	2276	c.2255G>A	c.(2254-2256)cGt>cAt	p.R752H	KNDC1_ENST00000368572.2_Missense_Mutation_p.R752H|KNDC1_ENST00000368571.2_Missense_Mutation_p.R687H			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	752	Pro-rich.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TCAGTGCAGCGTGACTCAGCC	0.746																																					p.R752H		.											.	KNDC1	229	0			c.G2255A						.						6.0	9.0	8.0					10																	135012267		2118	4187	6305	SO:0001583	missense	85442	exon14			TGCAGCGTGACTC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2255G>A	10.37:g.135012267G>A	ENSP00000304437:p.Arg752His	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	13.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207072	0.39003	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.19532	2.66;2.66;2.14	3.11	-2.94	0.05581	.	15.918900	0.00639	U	0.000517	T	0.12689	0.0308	L	0.27053	0.805	0.09310	N	1	B;B;B	0.13145	0.007;0.006;0.003	B;B;B	0.06405	0.002;0.001;0.001	T	0.13845	-1.0494	10	0.14656	T	0.56	0.1441	4.1452	0.10212	0.3653:0.3857:0.2491:0.0	.	752;687;752	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	H	752;752;687	ENSP00000304437:R752H;ENSP00000357561:R752H;ENSP00000357560:R687H	ENSP00000304437:R752H	R	+	2	0	KNDC1	134862257	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.305000	0.08188	-0.654000	0.05394	0.306000	0.20318	CGT	.		0.746	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KNTC1	9735	bcgsc.ca;mdanderson.org	37	12	123022962	123022962	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:123022962T>C	ENST00000333479.7	+	4	504	c.327T>C	c.(325-327)caT>caC	p.H109H	KNTC1_ENST00000450485.2_Silent_p.H109H	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	109					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GCAACCTACATCTTATTCATG	0.308																																					p.H109H		.											.	KNTC1	543	0			c.T327C						.						99.0	90.0	93.0					12																	123022962		1839	4103	5942	SO:0001819	synonymous_variant	9735	exon4			CCTACATCTTATT		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.327T>C	12.37:g.123022962T>C		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_1	20.0	3.0	NM_014708	A7E2C4|B3KSG2	Silent	SNP	ENST00000333479.7	37	CCDS45002.1																																																																																			.		0.308	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
KRTAP4-6	81871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39296198	39296198	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr17:39296198T>A	ENST00000345847.4	-	1	541	c.542A>T	c.(541-543)cAc>cTc	p.H181L		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	181						keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						GCAAGTGGTGTGGCAGGAGAC	0.632																																					p.H181L		.											.	.	.	0			c.A542T						.																																			SO:0001583	missense	81871	exon1			GTGGTGTGGCAGG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.542A>T	17.37:g.39296198T>A	ENSP00000328270:p.His181Leu	Somatic	316.0	0.0		WXS	Illumina HiSeq	Phase_I	181.0	65.0	NM_030976	Q9BYR1	Missense_Mutation	SNP	ENST00000345847.4	37	CCDS54125.1	.	.	.	.	.	.	.	.	.	.	.	5.877	0.345916	0.11126	.	.	ENSG00000198090	ENST00000345847	T	0.00584	6.4	3.66	2.58	0.30949	.	0.749098	0.10888	U	0.623037	T	0.01254	0.0041	M	0.79123	2.44	0.23459	N	0.997632	.	.	.	.	.	.	T	0.43925	-0.9361	8	0.59425	D	0.04	.	3.1069	0.06345	0.2092:0.1136:0.0:0.6772	.	.	.	.	L	181	ENSP00000328270:H181L	ENSP00000328270:H181L	H	-	2	0	KRTAP4-6	36549724	0.001000	0.12720	0.831000	0.32960	0.033000	0.12548	-0.235000	0.09016	0.783000	0.33636	0.456000	0.33151	CAC	.		0.632	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
LBP	3929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36974925	36974925	+	Silent	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr20:36974925G>A	ENST00000217407.2	+	1	167	c.6G>A	c.(4-6)ggG>ggA	p.G2G		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	2					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				CTAGGATGGGGGCCTTGGCCA	0.642																																					p.G2G		.											.	LBP	91	0			c.G6A						.						71.0	70.0	70.0					20																	36974925		2203	4300	6503	SO:0001819	synonymous_variant	3929	exon1			GATGGGGGCCTTG		CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.6G>A	20.37:g.36974925G>A		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	25.0	NM_004139	B2R938|O43438|Q92672|Q9H403|Q9UD66	Silent	SNP	ENST00000217407.2	37	CCDS13304.1																																																																																			.		0.642	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139	
LDB3	11155	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	88478582	88478582	+	Silent	SNP	C	C	T	rs139213290	byFrequency	TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr10:88478582C>T	ENST00000361373.4	+	11	1977	c.1956C>T	c.(1954-1956)gaC>gaT	p.D652D	LDB3_ENST00000458213.2_Silent_p.D542D|LDB3_ENST00000429277.2_Silent_p.D657D|LDB3_ENST00000263066.6_Silent_p.D542D|LDB3_ENST00000352360.5_Silent_p.D395D	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						ACATGGAAGACGGGGAGCCCT	0.577													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		19334	0.0		0.0	False		,,,				2504	0.0				p.D657D		.											.	LDB3	92	0			c.C1971T						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	68.0	60.0	63.0		1626,1971,1956	-6.2	0.7	10	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	LDB3	NM_001080114.1,NM_001171610.1,NM_007078.2	,,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,,	542/618,657/733,652/728	88478582	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	11155	exon12			GGAAGACGGGGAG	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1956C>T	10.37:g.88478582C>T		Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	9.0	NM_001171610		Silent	SNP	ENST00000361373.4	37	CCDS7377.1																																																																																			C|1.000;T|0.000		0.577	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2		
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	170103365	170103365	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:170103365C>T	ENST00000263816.3	-	21	3325	c.3040G>A	c.(3040-3042)Gag>Aag	p.E1014K	LRP2_ENST00000443831.1_Missense_Mutation_p.E877K	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1014	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGGTCCCCCTCGCATGTCAAG	0.517																																					p.E1014K		.											.	LRP2	175	0			c.G3040A						.						116.0	105.0	109.0					2																	170103365		2203	4300	6503	SO:0001583	missense	4036	exon21			CCCCCTCGCATGT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3040G>A	2.37:g.170103365C>T	ENSP00000263816:p.Glu1014Lys	Somatic	259.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	51.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	4.510	0.094617	0.08681	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	T;T	0.44881	0.91;0.91	6.03	4.22	0.49857	Epidermal growth factor-like (1);	0.250775	0.39615	N	0.001301	T	0.23886	0.0578	L	0.29908	0.895	0.26234	N	0.978977	B;P	0.36412	0.452;0.552	B;B	0.29785	0.107;0.042	T	0.19451	-1.0305	10	0.05721	T	0.95	.	11.8159	0.52211	0.1263:0.6124:0.2613:0.0	.	877;1014	E9PC35;P98164	.;LRP2_HUMAN	K	1014;877	ENSP00000263816:E1014K;ENSP00000409813:E877K	ENSP00000263816:E1014K	E	-	1	0	LRP2	169811611	0.076000	0.21285	0.004000	0.12327	0.081000	0.17604	0.568000	0.23623	0.852000	0.35287	0.655000	0.94253	GAG	.		0.517	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LTK	4058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41799394	41799394	+	Silent	SNP	G	G	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:41799394G>C	ENST00000263800.6	-	11	1536	c.1440C>G	c.(1438-1440)gcC>gcG	p.A480A	LTK_ENST00000355166.5_Silent_p.A419A|LTK_ENST00000561619.1_Silent_p.A178A|LTK_ENST00000453182.2_Intron	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	480					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		AGGGATTGGGGGCTGTCCTGA	0.612										TSP Lung(18;0.14)																											p.A480A		.											.	LTK	1377	0			c.C1440G						.						55.0	57.0	56.0					15																	41799394		2203	4300	6503	SO:0001819	synonymous_variant	4058	exon11			ATTGGGGGCTGTC	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1440C>G	15.37:g.41799394G>C		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	35.0	NM_002344	A6NNJ8|B4DL89|E9PFX4	Silent	SNP	ENST00000263800.6	37	CCDS10077.1																																																																																			.		0.612	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		
MAP3K5	4217	ucsc.edu;bcgsc.ca	37	6	136932527	136932527	+	Splice_Site	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:136932527T>C	ENST00000359015.4	-	18	2776		c.e18-2		MAP3K5_ENST00000355845.4_Splice_Site	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		ATTGTCACCCTAGAGAACAGA	0.378																																					.		.											.	MAP3K5	982	0			c.2416-2A>G						.						123.0	116.0	119.0					6																	136932527		2203	4300	6503	SO:0001630	splice_region_variant	4217	exon19			TCACCCTAGAGAA	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.2416-2A>G	6.37:g.136932527T>C		Somatic	106.0	1.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_005923	A6NIA0|B4DGB2|Q5THN3|Q99461	Splice_Site	SNP	ENST00000359015.4	37	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.268660	0.80469	.	.	ENSG00000197442	ENST00000359015;ENST00000355845;ENST00000367768	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0223	0.71640	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAP3K5	136974220	1.000000	0.71417	0.983000	0.44433	0.983000	0.72400	7.654000	0.83653	2.001000	0.58596	0.454000	0.30748	.	.		0.378	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		Intron
MAP9	79884	hgsc.bcm.edu;bcgsc.ca	37	4	156294381	156294381	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr4:156294381A>G	ENST00000311277.4	-	4	651	c.388T>C	c.(388-390)Tct>Cct	p.S130P	AC097467.2_ENST00000596165.1_RNA|MAP9_ENST00000515654.1_Missense_Mutation_p.S130P|MAP9_ENST00000379248.2_Missense_Mutation_p.S58P	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	130					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		TGAGATTCAGAGAAAGATTTT	0.338																																					p.S130P		.											.	MAP9	91	0			c.T388C						.						87.0	88.0	87.0					4																	156294381		2203	4300	6503	SO:0001583	missense	79884	exon4			ATTCAGAGAAAGA	AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.388T>C	4.37:g.156294381A>G	ENSP00000310593:p.Ser130Pro	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	4.0	NM_001039580	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Missense_Mutation	SNP	ENST00000311277.4	37	CCDS35493.1	.	.	.	.	.	.	.	.	.	.	A	10.15	1.271255	0.23221	.	.	ENSG00000164114	ENST00000311277;ENST00000515654;ENST00000433024;ENST00000393836;ENST00000379248	T;T;T;T	0.34667	2.1;2.08;1.35;1.36	5.84	-1.31	0.09230	.	0.727289	0.12968	N	0.424371	T	0.17619	0.0423	N	0.17674	0.51	0.09310	N	1	B;B;B;B	0.27559	0.002;0.181;0.004;0.004	B;B;B;B	0.26864	0.004;0.074;0.009;0.009	T	0.20505	-1.0273	10	0.23891	T	0.37	-0.8377	4.5813	0.12260	0.3867:0.0:0.4409:0.1724	.	130;58;130;130	B4DVG9;A8MSM7;B9EJB6;Q49MG5	.;.;.;MAP9_HUMAN	P	130;130;130;130;58	ENSP00000310593:S130P;ENSP00000427402:S130P;ENSP00000394048:S130P;ENSP00000368550:S58P	ENSP00000310593:S130P	S	-	1	0	MAP9	156513831	0.000000	0.05858	0.005000	0.12908	0.069000	0.16628	0.059000	0.14322	0.152000	0.19188	0.455000	0.32223	TCT	.		0.338	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257771.3	NM_001039580	
MARCH7	64844	hgsc.bcm.edu;bcgsc.ca	37	2	160615791	160615791	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:160615791T>C	ENST00000259050.4	+	7	1960	c.1838T>C	c.(1837-1839)cTt>cCt	p.L613P	MARCH7_ENST00000409591.1_Missense_Mutation_p.L575P|MARCH7_ENST00000539065.1_Missense_Mutation_p.L557P|MARCH7_ENST00000409175.1_Missense_Mutation_p.L613P	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	613					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						AAGTTGGAGCTTAACCTGGAG	0.318																																					p.L613P		.											.	MARCH7	68	0			c.T1838C						.						132.0	134.0	133.0					2																	160615791		2203	4298	6501	SO:0001583	missense	64844	exon7			TGGAGCTTAACCT	AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.1838T>C	2.37:g.160615791T>C	ENSP00000259050:p.Leu613Pro	Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_022826	A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	ENST00000259050.4	37	CCDS2210.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.006535	0.74932	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000409591;ENST00000420397	T;T;T;T;T	0.50277	2.36;2.39;2.36;2.37;0.75	5.49	5.49	0.81192	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-CH-type (1);	0.000000	0.85682	D	0.000000	T	0.60327	0.2260	L	0.38531	1.155	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.996;0.997;0.997	T	0.63453	-0.6634	10	0.72032	D	0.01	-14.4281	15.876	0.79162	0.0:0.0:0.0:1.0	.	557;575;613	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	P	613;557;613;575;46	ENSP00000386830:L613P;ENSP00000442992:L557P;ENSP00000259050:L613P;ENSP00000387238:L575P;ENSP00000391493:L46P	ENSP00000259050:L613P	L	+	2	0	MARCH7	160324037	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.852000	0.86927	2.200000	0.70718	0.454000	0.30748	CTT	.		0.318	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255040.3	NM_022826	
MARCH4	57574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	217124210	217124210	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:217124210C>T	ENST00000273067.4	-	4	2824	c.1058G>A	c.(1057-1059)gGc>gAc	p.G353D	AC012513.6_ENST00000417481.1_RNA	NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	353						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GGCAGGGGTGCCTGCGGTCTC	0.632																																					p.G353D		.											.	MARCH4	69	0			c.G1058A						.						52.0	53.0	53.0					2																	217124210		2202	4300	6502	SO:0001583	missense	57574	exon4			GGGGTGCCTGCGG	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.1058G>A	2.37:g.217124210C>T	ENSP00000273067:p.Gly353Asp	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	34.0	NM_020814	Q4KMN7|Q86WR8	Missense_Mutation	SNP	ENST00000273067.4	37	CCDS33376.1	.	.	.	.	.	.	.	.	.	.	C	6.190	0.403292	0.11754	.	.	ENSG00000144583	ENST00000273067	T	0.14893	2.47	5.62	2.81	0.32909	.	0.656708	0.14823	N	0.296336	T	0.11452	0.0279	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32903	-0.9889	10	0.25751	T	0.34	.	7.58	0.27959	0.0:0.5806:0.2718:0.1476	.	353	Q9P2E8	MARH4_HUMAN	D	353	ENSP00000273067:G353D	ENSP00000273067:G353D	G	-	2	0	MARCH4	216832455	0.989000	0.36119	0.024000	0.17045	0.091000	0.18340	1.148000	0.31614	0.305000	0.22832	0.561000	0.74099	GGC	.		0.632	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814	
MASP1	5648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	186938875	186938875	+	Silent	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:186938875G>A	ENST00000337774.5	-	15	2246	c.1857C>T	c.(1855-1857)gcC>gcT	p.A619A		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	619	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TCTTCAGCGGGGCATAAGCCT	0.542																																					p.A619A		.											.	MASP1	94	0			c.C1857T						.						147.0	112.0	124.0					3																	186938875		2203	4300	6503	SO:0001819	synonymous_variant	5648	exon15			CAGCGGGGCATAA	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1857C>T	3.37:g.186938875G>A		Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	62.0	NM_001879	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	ENST00000337774.5	37	CCDS33907.1																																																																																			.		0.542	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
MDC1	9656	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	30680046	30680046	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:30680046delC	ENST00000376406.3	-	5	2320	c.1673delG	c.(1672-1674)ggafs	p.G558fs	MDC1_ENST00000376405.2_Frame_Shift_Del_p.G558fs|MDC1_ENST00000494654.1_5'Flank|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	558	Required for nuclear localization (NLS1).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CTTTGCTGGTCCCCCAACTGC	0.522								Other conserved DNA damage response genes																													p.G558fs		.											.	MDC1	273	0			c.1673delG						.						73.0	69.0	71.0					6																	30680046		1509	2709	4218	SO:0001589	frameshift_variant	9656	exon5			GCTGGTCCCCCAA	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.1673delG	6.37:g.30680046delC	ENSP00000365588:p.Gly558fs	Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	217.0	41.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Frame_Shift_Del	DEL	ENST00000376406.3	37	CCDS34384.1																																																																																			.		0.522	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
METTL22	79091	hgsc.bcm.edu;bcgsc.ca	37	16	8735035	8735035	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr16:8735035T>C	ENST00000381920.3	+	7	1078	c.820T>C	c.(820-822)Tgc>Cgc	p.C274R	METTL22_ENST00000561758.1_Missense_Mutation_p.C218R|METTL22_ENST00000568967.1_3'UTR	NM_024109.2	NP_077014.2	Q9BUU2	MET22_HUMAN	methyltransferase like 22	274						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			large_intestine(5)|lung(4)	9						GGACGACCTCTGCACAGGTGT	0.453																																					p.C274R		.											.	METTL22	90	0			c.T820C						.						162.0	162.0	162.0					16																	8735035		1950	4142	6092	SO:0001583	missense	79091	exon7			GACCTCTGCACAG	AK022495	CCDS10533.2	16p13.2	2014-07-15	2011-03-03	2011-03-03	ENSG00000067365	ENSG00000067365			28368	protein-coding gene	gene with protein product		615261	"""chromosome 16 open reading frame 68"""	C16orf68		24140279	Standard	XM_005255570		Approved	FLJ12433,MGC2654	uc002cyz.3	Q9BUU2	OTTHUMG00000129694	ENST00000381920.3:c.820T>C	16.37:g.8735035T>C	ENSP00000371345:p.Cys274Arg	Somatic	238.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_024109	B2RD29|D3DUF2|Q6XYB4|Q9HA03	Missense_Mutation	SNP	ENST00000381920.3	37	CCDS10533.2	.	.	.	.	.	.	.	.	.	.	T	11.45	1.641694	0.29157	.	.	ENSG00000067365	ENST00000381920	T	0.39592	1.07	4.98	4.98	0.66077	.	0.122272	0.56097	D	0.000025	T	0.36413	0.0966	L	0.56124	1.755	0.80722	D	1	B;P	0.39551	0.267;0.678	B;B	0.38500	0.062;0.275	T	0.12656	-1.0539	10	0.13108	T	0.6	-16.8399	12.0339	0.53415	0.0:0.0:0.0:1.0	.	49;274	Q9BUU2-3;Q9BUU2	.;MET22_HUMAN	R	274	ENSP00000371345:C274R	ENSP00000371345:C274R	C	+	1	0	METTL22	8642536	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	3.670000	0.54569	1.880000	0.54463	0.459000	0.35465	TGC	.		0.453	METTL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251901.1	NM_024109	
MORC3	23515	hgsc.bcm.edu;bcgsc.ca	37	21	37747486	37747486	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr21:37747486T>C	ENST00000400485.1	+	17	2788	c.2712T>C	c.(2710-2712)gcT>gcC	p.A904A	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	904					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						AACTGCTGGCTATGATTGTGC	0.363																																					p.A904A		.											.	MORC3	92	0			c.T2712C						.						168.0	154.0	158.0					21																	37747486		1942	4143	6085	SO:0001819	synonymous_variant	23515	exon17			GCTGGCTATGATT	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.2712T>C	21.37:g.37747486T>C		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_015358	A8KA92|Q9UEZ2	Silent	SNP	ENST00000400485.1	37	CCDS42924.1																																																																																			.		0.363	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
MRPL37	51253	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	54681856	54681856	+	Missense_Mutation	SNP	G	G	A	rs369065705		TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:54681856G>A	ENST00000360840.5	+	6	1110	c.1033G>A	c.(1033-1035)Gtg>Atg	p.V345M	MRPL37_ENST00000605337.1_Missense_Mutation_p.V345M|MRPL37_ENST00000336230.6_Missense_Mutation_p.V214M	NM_016491.3	NP_057575.2	Q9BZE1	RM37_HUMAN	mitochondrial ribosomal protein L37	345					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.V345M(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(4)|skin(2)	19						GGTGCAGAGCGTGGGCACGGA	0.517																																					p.V345M		.											.	MRPL37	90	1	Substitution - Missense(1)	large_intestine(1)	c.G1033A						.	G	MET/VAL	0,4406		0,0,2203	176.0	155.0	162.0		1033	3.3	1.0	1		162	1,8599	1.2+/-3.3	0,1,4299	no	missense	MRPL37	NM_016491.3	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	345/424	54681856	1,13005	2203	4300	6503	SO:0001583	missense	51253	exon6			CAGAGCGTGGGCA	AB051344	CCDS589.1	1p32.1	2012-09-13			ENSG00000116221	ENSG00000116221		"""Mitochondrial ribosomal proteins / large subunits"""	14034	protein-coding gene	gene with protein product		611843				10600119	Standard	NM_016491		Approved	RPML2, MRP-L2	uc001cxa.4	Q9BZE1	OTTHUMG00000008118	ENST00000360840.5:c.1033G>A	1.37:g.54681856G>A	ENSP00000354086:p.Val345Met	Somatic	361.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	7.0	NM_016491	Q96Q67|Q9BWR1|Q9P0P3	Missense_Mutation	SNP	ENST00000360840.5	37	CCDS589.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.514810	0.27123	0.0	1.16E-4	ENSG00000116221	ENST00000360840;ENST00000329505;ENST00000336230	T;T	0.32753	1.44;1.44	5.23	3.33	0.38152	.	0.118458	0.64402	D	0.000020	T	0.49047	0.1534	M	0.77820	2.39	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.991	P;P;P	0.60886	0.88;0.854;0.771	T	0.53034	-0.8495	10	0.87932	D	0	-14.5998	9.371	0.38254	0.2227:0.0:0.7773:0.0	.	214;282;345	A6NHR2;E9PB99;Q9BZE1	.;.;RM37_HUMAN	M	345;282;214	ENSP00000354086:V345M;ENSP00000338526:V214M	ENSP00000328799:V282M	V	+	1	0	MRPL37	54454444	0.989000	0.36119	0.963000	0.40424	0.057000	0.15508	2.009000	0.40903	1.204000	0.43247	-0.391000	0.06502	GTG	.		0.517	MRPL37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022224.1	NM_016491	
MRPL48	51642	hgsc.bcm.edu;bcgsc.ca	37	11	73536778	73536778	+	Silent	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:73536778G>A	ENST00000310614.7	+	4	794	c.138G>A	c.(136-138)cgG>cgA	p.R46R	MRPL48_ENST00000542303.1_Silent_p.R46R|MRPL48_ENST00000411840.2_5'UTR|MRPL48_ENST00000398483.3_5'UTR|MRPL48_ENST00000535529.1_Silent_p.R28R	NM_016055.5	NP_057139.1	Q96GC5	RM48_HUMAN	mitochondrial ribosomal protein L48	46						mitochondrial ribosome (GO:0005761)				kidney(1)	1						GTATCAGTCGGCCCTACAAGA	0.403																																					p.R46R		.											.	.	.	0			c.G138A						.						43.0	43.0	43.0					11																	73536778		1848	4077	5925	SO:0001819	synonymous_variant	51642	exon4			CAGTCGGCCCTAC	AF151876	CCDS44676.1	11q13.4	2012-09-13			ENSG00000175581	ENSG00000175581		"""Mitochondrial ribosomal proteins / large subunits"""	16653	protein-coding gene	gene with protein product		611853				10810093	Standard	NM_016055		Approved	CGI-118	uc001ouh.4	Q96GC5	OTTHUMG00000168048	ENST00000310614.7:c.138G>A	11.37:g.73536778G>A		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_016055	B4DN34|Q49AK7|Q4U2Q4|Q9P091|Q9Y5J0	Silent	SNP	ENST00000310614.7	37	CCDS44676.1																																																																																			.		0.403	MRPL48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397733.1	NM_016055	
MRPS10	55173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42185570	42185570	+	Silent	SNP	C	C	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:42185570C>A	ENST00000053468.3	-	1	33	c.18G>T	c.(16-18)gcG>gcT	p.A6A		NM_018141.3	NP_060611.2	P82664	RT10_HUMAN	mitochondrial ribosomal protein S10	6						mitochondrion (GO:0005739)|ribosome (GO:0005840)				endometrium(1)|lung(1)	2	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00528)			CAGCACCGAACGCTGTCCGCG	0.597																																					p.A6A		.											.	MRPS10	90	0			c.G18T						.						24.0	28.0	26.0					6																	42185570		2203	4300	6503	SO:0001819	synonymous_variant	55173	exon1			ACCGAACGCTGTC		CCDS4866.1	6p21.1	2012-09-13			ENSG00000048544	ENSG00000048544		"""Mitochondrial ribosomal proteins / small subunits"""	14502	protein-coding gene	gene with protein product		611976				11279123	Standard	NM_018141		Approved	FLJ10567	uc003osa.4	P82664	OTTHUMG00000014694	ENST00000053468.3:c.18G>T	6.37:g.42185570C>A		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	16.0	NM_018141	B2RE89|Q9H3E5|Q9NVR3	Silent	SNP	ENST00000053468.3	37	CCDS4866.1																																																																																			.		0.597	MRPS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040547.1		
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9087298	9087298	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:9087298G>A	ENST00000397910.4	-	1	4720	c.4517C>T	c.(4516-4518)aCc>aTc	p.T1506I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1506	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AATGGCACTGGTATCTGCCTC	0.433																																					p.T1506I		.											.	MUC16	566	0			c.C4517T						.						247.0	231.0	236.0					19																	9087298		1947	4130	6077	SO:0001583	missense	94025	exon1			GCACTGGTATCTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4517C>T	19.37:g.9087298G>A	ENSP00000381008:p.Thr1506Ile	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	28.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	8.063	0.768474	0.15983	.	.	ENSG00000181143	ENST00000397910	T	0.02472	4.28	1.01	1.01	0.19927	.	.	.	.	.	T	0.04003	0.0112	N	0.08118	0	.	.	.	D	0.69078	0.997	D	0.68483	0.958	T	0.43605	-0.9381	8	0.87932	D	0	.	5.3673	0.16121	0.0:0.0:1.0:0.0	.	1506	B5ME49	.	I	1506	ENSP00000381008:T1506I	ENSP00000381008:T1506I	T	-	2	0	MUC16	8948298	0.003000	0.15002	0.036000	0.18154	0.792000	0.44763	-0.342000	0.07801	0.850000	0.35239	0.313000	0.20887	ACC	.		0.433	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1256342	1256342	+	Silent	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:1256342C>T	ENST00000529681.1	+	22	2716	c.2658C>T	c.(2656-2658)tgC>tgT	p.C886C	MUC5B_ENST00000447027.1_Silent_p.C889C	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	886	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGTGGGAGTGCAGCCACCGGC	0.652																																					p.C886C		.											.	.	.	0			c.C2658T						.						41.0	49.0	47.0					11																	1256342		2099	4219	6318	SO:0001819	synonymous_variant	727897	exon22			GGAGTGCAGCCAC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2658C>T	11.37:g.1256342C>T		Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	48.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
NAA35	60560	hgsc.bcm.edu;bcgsc.ca	37	9	88611410	88611410	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr9:88611410T>C	ENST00000361671.5	+	12	1107	c.974T>C	c.(973-975)aTg>aCg	p.M325T		NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit	325					negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						AGGGAAGAAATGGTGAACTAT	0.343																																					p.M325T		.											.	NAA35	92	0			c.T974C						.						62.0	66.0	65.0					9																	88611410		2203	4297	6500	SO:0001583	missense	60560	exon12			AAGAAATGGTGAA	AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.974T>C	9.37:g.88611410T>C	ENSP00000354972:p.Met325Thr	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	4.0	NM_024635	Q5VZE6|Q9H631|Q9H703	Missense_Mutation	SNP	ENST00000361671.5	37	CCDS6673.1	.	.	.	.	.	.	.	.	.	.	T	9.477	1.097232	0.20552	.	.	ENSG00000135040	ENST00000361671	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.38612	0.1047	N	0.08118	0	0.80722	D	1	B	0.12630	0.006	B	0.04013	0.001	T	0.18871	-1.0323	9	0.33141	T	0.24	-14.6319	15.5547	0.76184	0.0:0.0:0.0:1.0	.	325	Q5VZE5	NAA35_HUMAN	T	325	.	ENSP00000354972:M325T	M	+	2	0	NAA35	87801230	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	7.816000	0.86201	2.144000	0.66660	0.460000	0.39030	ATG	.		0.343	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052906.1	NM_024635	
NCOA3	8202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	46275954	46275954	+	Silent	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr20:46275954A>G	ENST00000371998.3	+	18	3581	c.3390A>G	c.(3388-3390)ggA>ggG	p.G1130G	NCOA3_ENST00000372004.3_Silent_p.G1130G|NCOA3_ENST00000341724.6_Silent_p.G1060G|NCOA3_ENST00000371997.3_Silent_p.G1125G			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1130	Acetyltransferase.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						ATCTTCAGGGACAATCACCAT	0.483																																					p.G1130G		.											.	NCOA3	229	0			c.A3390G						.						109.0	95.0	100.0					20																	46275954		2203	4300	6503	SO:0001819	synonymous_variant	8202	exon18			TCAGGGACAATCA	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3390A>G	20.37:g.46275954A>G		Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	52.0	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			.		0.483	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
NDUFAF7	55471	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37464985	37464985	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:37464985G>A	ENST00000002125.4	+	4	423	c.383G>A	c.(382-384)gGa>gAa	p.G128E	NDUFAF7_ENST00000336237.6_Missense_Mutation_p.G101E|NDUFAF7_ENST00000483999.1_Intron	NM_144736.4	NP_653337.1	Q7L592	NDUF7_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 7	128					methylation (GO:0032259)|mitochondrial respiratory chain complex I assembly (GO:0032981)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|methyltransferase activity (GO:0008168)										CCAGGTAGGGGAACCCTCGTG	0.428																																					p.G128E		.											.	.	.	0			c.G383A						.						53.0	63.0	60.0					2																	37464985		2203	4300	6503	SO:0001583	missense	55471	exon4			GTAGGGGAACCCT		CCDS1788.1, CCDS42673.1	2p22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000003509	ENSG00000003509		"""Mitochondrial respiratory chain complex assembly factors"""	28816	protein-coding gene	gene with protein product	"""mitochondrial dysfunction protein A homolog"""	615898	"""chromosome 2 open reading frame 56"""	C2orf56			Standard	NM_144736		Approved	PRO1853, MidA	uc002rqa.4	Q7L592	OTTHUMG00000128468	ENST00000002125.4:c.383G>A	2.37:g.37464985G>A	ENSP00000002125:p.Gly128Glu	Somatic	66.0	1.0		WXS	Illumina HiSeq	Phase_I	38.0	19.0	NM_144736	Q7Z399|Q9P1G3	Missense_Mutation	SNP	ENST00000002125.4	37	CCDS1788.1	.	.	.	.	.	.	.	.	.	.	G	31	5.061212	0.93846	.	.	ENSG00000003509	ENST00000002125;ENST00000336237;ENST00000431821;ENST00000416653;ENST00000439218;ENST00000432075	D;D;D;D;D;D	0.97303	-4.33;-4.33;-4.33;-4.33;-4.33;-4.33	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.99202	0.9723	H	0.98178	4.165	0.41151	D	0.986021	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99019	1.0817	9	.	.	.	-23.1187	20.1346	0.98019	0.0:0.0:1.0:0.0	.	101;128;101;128	E7EUC2;B4DQY3;Q7L592-2;Q7L592	.;.;.;MIDA_HUMAN	E	128;101;49;86;86;86	ENSP00000002125:G128E;ENSP00000337431:G101E;ENSP00000399207:G49E;ENSP00000410181:G86E;ENSP00000394436:G86E;ENSP00000402959:G86E	.	G	+	2	0	C2orf56	37318489	1.000000	0.71417	0.985000	0.45067	0.993000	0.82548	8.566000	0.90734	2.765000	0.95021	0.655000	0.94253	GGA	.		0.428	NDUFAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250267.1	NM_144736	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152534626	152534626	+	Silent	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:152534626G>A	ENST00000172853.10	-	33	3478	c.3331C>T	c.(3331-3333)Ctg>Ttg	p.L1111L	NEB_ENST00000397345.3_Silent_p.L1111L|NEB_ENST00000603639.1_Silent_p.L1111L|NEB_ENST00000409198.1_Silent_p.L1111L|NEB_ENST00000604864.1_Silent_p.L1111L|NEB_ENST00000427231.2_Silent_p.L1111L			P20929	NEBU_HUMAN	nebulin	1111					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TAATGAACCAGTTTAGGGTCA	0.378																																					p.L1111L		.											.	NEB	145	0			c.C3331T						.						77.0	71.0	73.0					2																	152534626		1837	4087	5924	SO:0001819	synonymous_variant	4703	exon33			GAACCAGTTTAGG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.3331C>T	2.37:g.152534626G>A		Somatic	382.0	1.0		WXS	Illumina HiSeq	Phase_I	227.0	94.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.		0.378	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NEBL	10529	hgsc.bcm.edu;bcgsc.ca	37	10	21134258	21134258	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr10:21134258T>C	ENST00000377122.4	-	12	1552	c.1156A>G	c.(1156-1158)Agg>Ggg	p.R386G	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	386					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						AGTGATGACCTTCCTTTAATC	0.323																																					p.R386G		.											.	NEBL	92	0			c.A1156G						.						127.0	125.0	126.0					10																	21134258		2203	4300	6503	SO:0001583	missense	10529	exon12			ATGACCTTCCTTT	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.1156A>G	10.37:g.21134258T>C	ENSP00000366326:p.Arg386Gly	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	6.0	NM_006393	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000377122.4	37	CCDS7134.1	.	.	.	.	.	.	.	.	.	.	T	15.65	2.897608	0.52121	.	.	ENSG00000078114	ENST00000377122	T	0.04970	3.52	5.99	4.83	0.62350	.	0.341407	0.33772	N	0.004580	T	0.10035	0.0246	M	0.64997	1.995	0.80722	D	1	B	0.26081	0.141	B	0.33121	0.158	T	0.08310	-1.0728	10	0.27785	T	0.31	.	11.0863	0.48089	0.0:0.0:0.1552:0.8448	.	386	O76041	NEBL_HUMAN	G	386	ENSP00000366326:R386G	ENSP00000366326:R386G	R	-	1	2	NEBL	21174264	1.000000	0.71417	0.985000	0.45067	0.983000	0.72400	2.757000	0.47557	1.053000	0.40415	0.533000	0.62120	AGG	.		0.323	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393	
NLGN1	22871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	173997373	173997373	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:173997373T>G	ENST00000457714.1	+	6	2011	c.1582T>G	c.(1582-1584)Ttc>Gtc	p.F528V	NLGN1_ENST00000545397.1_Missense_Mutation_p.F528V|NLGN1_ENST00000401917.3_Missense_Mutation_p.F568V|NLGN1_ENST00000361589.4_Missense_Mutation_p.F528V	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	545					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TCCTTGCAATTTCTCCAAAAA	0.423																																					p.F528V		.											.	NLGN1	231	0			c.T1582G						.						55.0	53.0	54.0					3																	173997373		2203	4299	6502	SO:0001583	missense	22871	exon6			TGCAATTTCTCCA	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1582T>G	3.37:g.173997373T>G	ENSP00000392500:p.Phe528Val	Somatic	323.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	93.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.413882	0.83449	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.74566	0.3733	L	0.61036	1.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.76063	-0.3096	10	0.66056	D	0.02	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	568;528	D2X2H5;Q8N2Q7-2	.;.	V	528;528;528;568	ENSP00000392500:F528V;ENSP00000354541:F528V;ENSP00000441108:F528V;ENSP00000385750:F568V	ENSP00000354541:F528V	F	+	1	0	NLGN1	175480067	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	TTC	.		0.423	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
NLRC4	58484	hgsc.bcm.edu;bcgsc.ca	37	2	32449645	32449645	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:32449645A>G	ENST00000404025.2	-	10	3460	c.2972T>C	c.(2971-2973)tTa>tCa	p.L991S	NLRC4_ENST00000402280.1_Missense_Mutation_p.L991S|NLRC4_ENST00000342905.6_Missense_Mutation_p.L326S|NLRC4_ENST00000360906.5_Missense_Mutation_p.L991S			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	991					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TAACTTGGATAACACTTGGCT	0.353																																					p.L991S		.											.	NLRC4	276	0			c.T2972C						.						113.0	114.0	114.0					2																	32449645		2203	4300	6503	SO:0001583	missense	58484	exon9			TTGGATAACACTT	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.2972T>C	2.37:g.32449645A>G	ENSP00000385090:p.Leu991Ser	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_001199138	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	37	CCDS33174.1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.921008	0.52653	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000342905;ENST00000404025	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	4.57	1.97	0.26223	.	0.000000	0.29466	N	0.012077	T	0.32585	0.0834	L	0.27053	0.805	0.33133	D	0.543303	P;P	0.48911	0.911;0.917	B;B	0.43728	0.429;0.348	T	0.45234	-0.9275	9	0.72032	D	0.01	-2.3967	6.0271	0.19660	0.6697:0.1686:0.0:0.1618	.	326;991	Q9NPP4-2;Q9NPP4	.;NLRC4_HUMAN	S	991;991;326;991	ENSP00000354159:L991S;ENSP00000385428:L991S;ENSP00000339666:L326S;ENSP00000385090:L991S	ENSP00000339666:L326S	L	-	2	0	NLRC4	32303149	0.226000	0.23696	0.124000	0.21820	0.891000	0.51852	2.179000	0.42528	0.775000	0.33450	0.528000	0.53228	TTA	.		0.353	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209	
NUP62	23636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50412103	50412103	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:50412103C>T	ENST00000596217.1	-	2	2849	c.962G>A	c.(961-963)gGg>gAg	p.G321E	NUP62_ENST00000597723.1_Intron|NUP62_ENST00000352066.3_Missense_Mutation_p.G321E|NUP62_ENST00000600583.1_5'Flank|IL4I1_ENST00000341114.3_Intron|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000422090.2_Missense_Mutation_p.G321E|NUP62_ENST00000413454.1_Missense_Mutation_p.G321E|NUP62_ENST00000597029.1_Missense_Mutation_p.G321E			P37198	NUP62_HUMAN	nucleoporin 62kDa	321	Ala-rich.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GGCAGCCGCCCCTGCAGCTGC	0.637																																					p.G321E		.											.	NUP62	615	0			c.G962A						.						32.0	38.0	36.0					19																	50412103		2181	4270	6451	SO:0001583	missense	23636	exon3			GCCGCCCCTGCAG	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.962G>A	19.37:g.50412103C>T	ENSP00000471191:p.Gly321Glu	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	13.0	NM_153719	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Missense_Mutation	SNP	ENST00000596217.1	37	CCDS12788.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278653	0.40294	.	.	ENSG00000213024	ENST00000352066;ENST00000422090;ENST00000413454	T;T;T	0.37752	1.18;1.18;1.18	5.73	2.24	0.28232	Nucleoporin, NSP1-like, C-terminal (1);	0.373725	0.23930	U	0.043150	T	0.22003	0.0530	L	0.36672	1.1	0.09310	N	1	P	0.34934	0.476	B	0.33121	0.158	T	0.07790	-1.0754	9	.	.	.	-14.9936	4.2073	0.10495	0.1637:0.5934:0.1581:0.0848	.	321	P37198	NUP62_HUMAN	E	321	ENSP00000305503:G321E;ENSP00000407331:G321E;ENSP00000387991:G321E	.	G	-	2	0	NUP62	55103915	0.004000	0.15560	0.009000	0.14445	0.011000	0.07611	0.091000	0.15046	0.887000	0.36136	0.655000	0.94253	GGG	.		0.637	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
OSCP1	127700	hgsc.bcm.edu;bcgsc.ca	37	1	36889022	36889022	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:36889022A>G	ENST00000356637.5	-	6	655	c.592T>C	c.(592-594)Ttt>Ctt	p.F198L	OSCP1_ENST00000315643.9_Missense_Mutation_p.F198L|OSCP1_ENST00000433045.2_Missense_Mutation_p.F143L|OSCP1_ENST00000495222.1_5'UTR|OSCP1_ENST00000235532.5_Missense_Mutation_p.F188L			Q8WVF1	OSCP1_HUMAN	organic solute carrier partner 1	198					transport (GO:0006810)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	22						GGCAACACAAAGCGACCGTTA	0.408																																					p.F188L		.											.	OSCP1	4	0			c.T562C						.						91.0	94.0	93.0					1																	36889022		2203	4300	6503	SO:0001583	missense	127700	exon5			ACACAAAGCGACC		CCDS409.1, CCDS410.1, CCDS409.2	1p34.3	2009-07-06	2009-07-06	2009-07-06	ENSG00000116885	ENSG00000116885			29971	protein-coding gene	gene with protein product	"""oxidored nitro domain containing protein"""	608854	"""chromosome 1 open reading frame 102"""	C1orf102		12477932	Standard	NM_145047		Approved	NOR1	uc001caq.3	Q8WVF1	OTTHUMG00000008139	ENST00000356637.5:c.592T>C	1.37:g.36889022A>G	ENSP00000349052:p.Phe198Leu	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	5.0	NM_145047	A6NHM5|A6NHS9|A6NIN9|Q4AEJ0|Q8N7G2|Q8TDF1	Missense_Mutation	SNP	ENST00000356637.5	37		.	.	.	.	.	.	.	.	.	.	a	16.12	3.034298	0.54896	.	.	ENSG00000116885	ENST00000235532;ENST00000356637;ENST00000433045;ENST00000445843;ENST00000315643	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.50735	0.1633	L	0.46157	1.445	0.80722	D	1	B;P	0.52061	0.448;0.95	P;P	0.55303	0.55;0.773	T	0.48043	-0.9069	10	0.42905	T	0.14	.	14.4998	0.67714	1.0:0.0:0.0:0.0	.	188;198	Q8WVF1-3;Q8WVF1	.;OSCP1_HUMAN	L	188;198;143;158;198	ENSP00000235532:F188L;ENSP00000349052:F198L;ENSP00000390820:F143L;ENSP00000396417:F158L;ENSP00000314541:F198L	ENSP00000235532:F188L	F	-	1	0	OSCP1	36661609	1.000000	0.71417	1.000000	0.80357	0.308000	0.27856	8.667000	0.91153	2.032000	0.59987	0.528000	0.53228	TTT	.		0.408	OSCP1-010	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000389759.1	NM_145047	
PAK1IP1	55003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	10702604	10702604	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:10702604A>G	ENST00000379568.3	+	3	541	c.250A>G	c.(250-252)Aca>Gca	p.T84A		NM_017906.2	NP_060376.2	Q9NWT1	PK1IP_HUMAN	PAK1 interacting protein 1	84					cell proliferation (GO:0008283)|negative regulation of signal transduction (GO:0009968)|palate development (GO:0060021)	nucleus (GO:0005634)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)				TTCCATAGGTACAATAACTTG	0.358																																					p.T84A		.											.	PAK1IP1	68	0			c.A250G						.						58.0	57.0	57.0					6																	10702604		2203	4300	6503	SO:0001583	missense	55003	exon3			ATAGGTACAATAA	AF283303	CCDS34339.1	6p24.1	2013-05-21			ENSG00000111845	ENSG00000111845		"""WD repeat domain containing"""	20882	protein-coding gene	gene with protein product		607811				11371639	Standard	XM_005249204		Approved	FLJ20624, hPIP1, PIP1, bA421M1.5, MAK11, WDR84	uc003mzg.3	Q9NWT1	OTTHUMG00000014245	ENST00000379568.3:c.250A>G	6.37:g.10702604A>G	ENSP00000368887:p.Thr84Ala	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	17.0	NM_017906	Q5T4J2|Q96QJ8|Q96T87	Missense_Mutation	SNP	ENST00000379568.3	37	CCDS34339.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.246275	0.80024	.	.	ENSG00000111845	ENST00000379568	T	0.40756	1.02	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.044405	0.85682	D	0.000000	T	0.23330	0.0564	L	0.31120	0.905	0.58432	D	0.999999	B	0.33171	0.4	B	0.41946	0.371	T	0.11867	-1.0570	10	0.22706	T	0.39	-0.2316	12.7401	0.57246	1.0:0.0:0.0:0.0	.	84	Q9NWT1	PK1IP_HUMAN	A	84	ENSP00000368887:T84A	ENSP00000368887:T84A	T	+	1	0	PAK1IP1	10810590	1.000000	0.71417	1.000000	0.80357	0.598000	0.36846	9.072000	0.93986	2.254000	0.74563	0.533000	0.62120	ACA	.		0.358	PAK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039835.1	NM_017906	
PARP14	54625	hgsc.bcm.edu;bcgsc.ca	37	3	122419251	122419251	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:122419251T>C	ENST00000474629.2	+	6	2116	c.1850T>C	c.(1849-1851)cTc>cCc	p.L617P		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	617					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		TGGAAAGGGCTCACTCACAAT	0.393																																					p.L617P		.											.	PARP14	525	0			c.T1850C						.						37.0	36.0	36.0					3																	122419251		1860	4100	5960	SO:0001583	missense	54625	exon6			AAGGGCTCACTCA	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1850T>C	3.37:g.122419251T>C	ENSP00000418194:p.Leu617Pro	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	4.0	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	37	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.811876	0.50527	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.12255	2.7	5.35	1.11	0.20524	.	0.541730	0.17633	N	0.167331	T	0.21347	0.0514	M	0.66939	2.045	0.23168	N	0.998187	P;P	0.50617	0.937;0.8	P;B	0.52267	0.694;0.347	T	0.07028	-1.0794	10	0.72032	D	0.01	.	6.3179	0.21200	0.3792:0.0:0.1224:0.4985	.	617;617	Q460N5-4;Q460N5	.;PAR14_HUMAN	P	617;536	ENSP00000418194:L617P	ENSP00000381228:L536P	L	+	2	0	PARP14	123901941	0.038000	0.19896	0.000000	0.03702	0.006000	0.05464	2.488000	0.45276	0.014000	0.14944	0.533000	0.62120	CTC	.		0.393	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
PATL1	219988	hgsc.bcm.edu;bcgsc.ca	37	11	59423450	59423450	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:59423450T>C	ENST00000300146.9	-	7	876	c.792A>G	c.(790-792)gcA>gcG	p.A264A		NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	264	Involved in RNA-binding.|Involved in nuclear foci localization.|Pro-rich.|Region N; interaction with decapping machinery.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						CAAGAAGCTGTGCTCTCTGGA	0.428																																					p.A264A		.											.	PATL1	1	0			c.A792G						.						13.0	14.0	14.0					11																	59423450		1835	4072	5907	SO:0001819	synonymous_variant	219988	exon7			AAGCTGTGCTCTC	AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.792A>G	11.37:g.59423450T>C		Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	5.0	NM_152716	B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Silent	SNP	ENST00000300146.9	37	CCDS44613.1																																																																																			.		0.428	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394559.1	NM_152716	
PCDHGB6	56100	hgsc.bcm.edu;broad.mit.edu	37	5	140790042	140790042	+	Missense_Mutation	SNP	A	A	G	rs185995562		TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr5:140790042A>G	ENST00000520790.1	+	1	2273	c.2273A>G	c.(2272-2274)cAt>cGt	p.H758R	PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA10_ENST00000398610.2_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	758					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCATTGCACATACGGGTACA	0.453																																					p.H758R		.											.	.	.	0			c.A2273G						.						120.0	118.0	118.0					5																	140790042		1926	4147	6073	SO:0001583	missense	56100	exon1			TTGCACATACGGG	AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.2273A>G	5.37:g.140790042A>G	ENSP00000428603:p.His758Arg	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	5.0	NM_032100	Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	37	CCDS54929.1	.	.	.	.	.	.	.	.	.	.	a	0.244	-1.011492	0.02095	.	.	ENSG00000253305	ENST00000520790	T	0.45276	0.9	5.39	5.39	0.77823	.	.	.	.	.	T	0.30634	0.0771	L	0.28274	0.84	0.09310	N	0.999999	B;B	0.11235	0.002;0.004	B;B	0.10450	0.002;0.005	T	0.13629	-1.0502	9	0.11485	T	0.65	.	14.3903	0.66973	1.0:0.0:0.0:0.0	.	758;758	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	R	758	ENSP00000428603:H758R	ENSP00000428603:H758R	H	+	2	0	PCDHGB6	140770226	0.010000	0.17322	0.028000	0.17463	0.016000	0.09150	1.872000	0.39549	2.038000	0.60285	0.460000	0.39030	CAT	A|0.999;T|0.000		0.453	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926	
PEAK1	79834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	77473962	77473962	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:77473962C>G	ENST00000560626.2	-	4	782	c.307G>C	c.(307-309)Ggg>Cgg	p.G103R	PEAK1_ENST00000312493.4_Missense_Mutation_p.G103R|PEAK1_ENST00000558305.1_Missense_Mutation_p.G103R			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	103					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CGGTTCCACCCTATGATGACA	0.423																																					p.G103R		.											.	.	.	0			c.G307C						.						203.0	195.0	197.0					15																	77473962		1947	4138	6085	SO:0001583	missense	0	exon5			TCCACCCTATGAT		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.307G>C	15.37:g.77473962C>G	ENSP00000452796:p.Gly103Arg	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	44.0	NM_024776	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	ENST00000560626.2	37	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959287	0.34565	.	.	ENSG00000173517	ENST00000312493	T	0.68903	-0.36	5.76	4.66	0.58398	.	0.238594	0.17033	U	0.189628	T	0.49474	0.1559	N	0.19112	0.55	0.27427	N	0.954138	P	0.34780	0.468	B	0.27500	0.08	T	0.51718	-0.8670	10	0.49607	T	0.09	-8.351	13.9485	0.64101	0.0:0.9176:0.0:0.0824	.	103	Q9H792	PEAK1_HUMAN	R	103	ENSP00000309230:G103R	ENSP00000309230:G103R	G	-	1	0	AC087465.1	75261017	0.959000	0.32827	0.986000	0.45419	0.995000	0.86356	4.507000	0.60434	2.724000	0.93272	0.650000	0.86243	GGG	.		0.423	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		
PEG3	5178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57326944	57326944	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:57326944G>T	ENST00000326441.9	-	10	3229	c.2866C>A	c.(2866-2868)Cct>Act	p.P956T	ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.P956T|PEG3_ENST00000593695.1_Missense_Mutation_p.P830T|PEG3_ENST00000598410.1_Missense_Mutation_p.P832T|ZIM2_ENST00000599935.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	956					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCACCAAAAGGCAGAGAGTGA	0.473																																					p.P956T		.											.	PEG3	164	0			c.C2866A						.						142.0	135.0	137.0					19																	57326944		2203	4300	6503	SO:0001583	missense	5178	exon9			CAAAAGGCAGAGA	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2866C>A	19.37:g.57326944G>T	ENSP00000326581:p.Pro956Thr	Somatic	283.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	43.0	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	G	0.175	-1.067845	0.01934	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02837	4.14;4.14	3.83	1.66	0.24008	.	1.031830	0.07707	N	0.941361	T	0.03783	0.0107	L	0.59436	1.845	.	.	.	B;B;B	0.31910	0.063;0.179;0.346	B;B;B	0.30943	0.026;0.052;0.122	T	0.40232	-0.9574	9	0.19147	T	0.46	-1.1974	6.4047	0.21658	0.1015:0.0:0.7156:0.1828	.	832;956;891	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	T	956	ENSP00000326581:P956T;ENSP00000403051:P956T	ENSP00000326581:P956T	P	-	1	0	ZIM2	62018756	0.000000	0.05858	0.001000	0.08648	0.108000	0.19459	0.044000	0.13992	0.591000	0.29711	0.655000	0.94253	CCT	.		0.473	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
PGGT1B	5229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	114548112	114548112	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr5:114548112T>C	ENST00000419445.1	-	9	1141	c.1121A>G	c.(1120-1122)cAt>cGt	p.H374R	PGGT1B_ENST00000379615.3_Missense_Mutation_p.H297R	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit	374					negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		TGTGGAGATATGTACATTCTC	0.423																																					p.H374R		.											.	PGGT1B	90	0			c.A1121G						.						140.0	128.0	132.0					5																	114548112		2202	4300	6502	SO:0001583	missense	5229	exon9			GAGATATGTACAT		CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.1121A>G	5.37:g.114548112T>C	ENSP00000404676:p.His374Arg	Somatic	296.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	52.0	NM_005023	Q5MJP9	Missense_Mutation	SNP	ENST00000419445.1	37	CCDS4116.1	.	.	.	.	.	.	.	.	.	.	T	10.59	1.392167	0.25118	.	.	ENSG00000164219	ENST00000419445;ENST00000379615	T;T	0.42513	1.03;0.97	5.53	3.09	0.35607	.	0.341401	0.27117	N	0.020845	T	0.30324	0.0761	N	0.22421	0.69	0.09310	N	1	B;B	0.26258	0.145;0.02	B;B	0.28465	0.09;0.005	T	0.16928	-1.0386	10	0.41790	T	0.15	-3.1303	12.9202	0.58228	0.0:0.0:0.4221:0.5779	.	297;374	P53609-2;P53609	.;PGTB1_HUMAN	R	374;297	ENSP00000404676:H374R;ENSP00000368935:H297R	ENSP00000368935:H297R	H	-	2	0	PGGT1B	114576011	0.426000	0.25506	0.005000	0.12908	0.946000	0.59487	0.486000	0.22340	0.374000	0.24650	0.477000	0.44152	CAT	.		0.423	PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250855.2	NM_005023	
PHIP	55023	hgsc.bcm.edu;bcgsc.ca	37	6	79692705	79692705	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:79692705T>C	ENST00000275034.4	-	23	2834	c.2667A>G	c.(2665-2667)aaA>aaG	p.K889K	PHIP_ENST00000479165.1_5'Flank	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	889	Lys-rich.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		tttgcttctgtttttcagatt	0.333																																					p.K889K		.											.	PHIP	579	0			c.A2667G						.																																			SO:0001819	synonymous_variant	55023	exon23			CTTCTGTTTTTCA	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2667A>G	6.37:g.79692705T>C		Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	4.0	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Silent	SNP	ENST00000275034.4	37	CCDS4987.1																																																																																			.		0.333	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
PNPT1	87178	hgsc.bcm.edu;bcgsc.ca	37	2	55906857	55906857	+	Silent	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:55906857A>G	ENST00000447944.2	-	8	725	c.639T>C	c.(637-639)acT>acC	p.T213T		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	213					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CTAAATTTAAAGTACTAGAAG	0.328																																					p.T213T		.											.	PNPT1	90	0			c.T639C						.						105.0	107.0	106.0					2																	55906857		2201	4299	6500	SO:0001819	synonymous_variant	87178	exon8			ATTTAAAGTACTA	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.639T>C	2.37:g.55906857A>G		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_033109	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Silent	SNP	ENST00000447944.2	37	CCDS1856.1																																																																																			.		0.328	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
POLG	5428	hgsc.bcm.edu;bcgsc.ca	37	15	89864157	89864157	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:89864157T>C	ENST00000268124.5	-	18	3154	c.2821A>G	c.(2821-2823)Atc>Gtc	p.I941V	POLG_ENST00000442287.2_Missense_Mutation_p.I941V	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	941					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			TCACGGCTGATGCCCACAGTA	0.552								DNA polymerases (catalytic subunits)																													p.I941V	Colon(73;648 1203 11348 18386 27782)	.											.	POLG	228	0			c.A2821G						.						115.0	92.0	100.0					15																	89864157		2200	4299	6499	SO:0001583	missense	5428	exon18			GGCTGATGCCCAC	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.2821A>G	15.37:g.89864157T>C	ENSP00000268124:p.Ile941Val	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	4.0	NM_002693	Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359111	0.82353	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.96587	-4.06;-4.06	5.15	5.15	0.70609	DNA-directed DNA polymerase, family A, palm domain (2);	0.000000	0.85682	D	0.000000	D	0.97860	0.9297	M	0.79475	2.455	0.80722	D	1	D	0.63880	0.993	D	0.76071	0.987	D	0.98708	1.0703	10	0.72032	D	0.01	-21.6569	14.9635	0.71174	0.0:0.0:0.0:1.0	.	941	P54098	DPOG1_HUMAN	V	941	ENSP00000268124:I941V;ENSP00000399851:I941V	ENSP00000268124:I941V	I	-	1	0	POLG	87665161	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.698000	0.84413	1.944000	0.56390	0.482000	0.46254	ATC	.		0.552	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
PPM1B	5495	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	44436409	44436409	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:44436409G>A	ENST00000282412.4	+	3	1319	c.907G>A	c.(907-909)Gat>Aat	p.D303N	PPM1B_ENST00000409895.4_Missense_Mutation_p.D303N|PPM1B_ENST00000378540.4_3'UTR|PPM1B_ENST00000378551.2_Missense_Mutation_p.D303N|PPM1B_ENST00000409432.3_Missense_Mutation_p.D303N|PPM1B_ENST00000345249.4_Missense_Mutation_p.D16N	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	303					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CAAGGTCTCAGATGAAGCGGT	0.363																																					p.D303N		.											.	PPM1B	227	0			c.G907A						.						90.0	89.0	89.0					2																	44436409		2203	4300	6503	SO:0001583	missense	5495	exon3			GTCTCAGATGAAG	AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.907G>A	2.37:g.44436409G>A	ENSP00000282412:p.Asp303Asn	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	4.0	NM_001033556	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Missense_Mutation	SNP	ENST00000282412.4	37	CCDS1817.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176650	0.78564	.	.	ENSG00000138032	ENST00000419807;ENST00000409895;ENST00000409432;ENST00000282412;ENST00000378551;ENST00000345249;ENST00000409473	T;T;T;T;T;T	0.22539	1.98;1.98;1.98;1.95;1.97;3.0	5.24	5.24	0.73138	Protein serine/threonine phosphatase 2C, C-terminal (3);	0.284278	0.40728	N	0.001024	T	0.21387	0.0515	L	0.27053	0.805	0.46981	D	0.999277	B;B;B;B;B	0.20459	0.045;0.004;0.022;0.018;0.009	B;B;B;B;B	0.32022	0.139;0.038;0.063;0.088;0.063	T	0.05131	-1.0904	10	0.34782	T	0.22	-6.4833	19.1692	0.93570	0.0:0.0:1.0:0.0	.	303;303;303;303;303	Q4J6C0;O75688-2;Q4J6C1;O75688;Q4J6C2	.;.;.;PPM1B_HUMAN;.	N	303;303;303;303;303;16;228	ENSP00000390087:D303N;ENSP00000387341:D303N;ENSP00000387287:D303N;ENSP00000282412:D303N;ENSP00000367813:D303N;ENSP00000386982:D228N	ENSP00000282412:D303N	D	+	1	0	PPM1B	44289913	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.854000	0.86942	2.590000	0.87494	0.655000	0.94253	GAT	.		0.363	PPM1B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250672.1	NM_002706	
PRG4	10216	hgsc.bcm.edu;bcgsc.ca	37	1	186275693	186275693	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:186275693A>G	ENST00000445192.2	+	7	887	c.842A>G	c.(841-843)gAg>gGg	p.E281G	PRG4_ENST00000367484.3_Missense_Mutation_p.E240G|PRG4_ENST00000367485.4_Missense_Mutation_p.E188G|PRG4_ENST00000367486.3_Missense_Mutation_p.E238G|PRG4_ENST00000367483.4_Missense_Mutation_p.E240G	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	281					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						GTGAATAAAGAGACAACAGTT	0.373																																					p.E281G		.											.	PRG4	91	0			c.A842G						.						175.0	189.0	184.0					1																	186275693		2203	4300	6503	SO:0001583	missense	10216	exon7			ATAAAGAGACAAC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.842A>G	1.37:g.186275693A>G	ENSP00000399679:p.Glu281Gly	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	5.0	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	A	4.390	0.072021	0.08436	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T	0.09911	2.93;3.33;3.25;3.09;3.33	3.81	3.81	0.43845	.	0.000000	0.42682	U	0.000665	T	0.27278	0.0669	M	0.67397	2.05	0.22666	N	0.99887	D;D;D;D	0.71674	0.998;0.998;0.997;0.998	D;D;D;D	0.68943	0.961;0.961;0.915;0.961	T	0.02365	-1.1170	9	.	.	.	-11.4708	11.4546	0.50173	1.0:0.0:0.0:0.0	.	147;188;281;240	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	G	238;240;147;240;188;281	ENSP00000356456:E238G;ENSP00000356454:E240G;ENSP00000356453:E240G;ENSP00000356455:E188G;ENSP00000399679:E281G	.	E	+	2	0	PRG4	184542316	0.003000	0.15002	0.935000	0.37517	0.138000	0.21146	1.257000	0.32932	1.512000	0.48834	0.378000	0.23410	GAG	.		0.373	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PRMT9	90826	hgsc.bcm.edu;bcgsc.ca	37	4	148559822	148559822	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr4:148559822A>G	ENST00000322396.6	-	12	2641	c.2399T>C	c.(2398-2400)tTg>tCg	p.L800S	TMEM184C_ENST00000508208.1_Intron|PRMT10_ENST00000541232.1_Missense_Mutation_p.L687S	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		800	SAM-dependent MTase PRMT-type 2. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						TGAAGTATCCAACCTAATCTC	0.383																																					p.L800S		.											.	PRMT10	91	0			c.T2399C						.						99.0	89.0	93.0					4																	148559822		2203	4300	6503	SO:0001583	missense	90826	exon12			GTATCCAACCTAA																												ENST00000322396.6:c.2399T>C	4.37:g.148559822A>G	ENSP00000314396:p.Leu800Ser	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	4.0	NM_138364	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Missense_Mutation	SNP	ENST00000322396.6	37	CCDS3771.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.534579	0.85812	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	T;T	0.29655	1.56;1.56	5.67	5.67	0.87782	.	0.143577	0.47852	D	0.000216	T	0.52306	0.1726	M	0.64997	1.995	0.49483	D	0.999791	D	0.69078	0.997	D	0.65773	0.938	T	0.55108	-0.8192	10	0.87932	D	0	-21.4202	15.9054	0.79423	1.0:0.0:0.0:0.0	.	800	Q6P2P2	ANM10_HUMAN	S	800;687	ENSP00000314396:L800S;ENSP00000439508:L687S	ENSP00000314396:L800S	L	-	2	0	PRMT10	148779272	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.639000	0.91023	2.157000	0.67596	0.533000	0.62120	TTG	.		0.383	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		
PSG7	5676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43430131	43430131	+	RNA	SNP	G	G	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:43430131G>T	ENST00000406070.2	-	0	1133				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				GTTTTGTCCTGAATGGTAATA	0.463																																					p.S224X		.											.	.	.	0			c.C671A						.						147.0	157.0	154.0					19																	43430131		2201	4299	6500			5676	exon4			TGTCCTGAATGGT			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43430131G>T		Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	43.0	NM_001206650	Q15232	Nonsense_Mutation	SNP	ENST00000406070.2	37																																																																																				.		0.463	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650	
PSMD5	5711	hgsc.bcm.edu;bcgsc.ca	37	9	123589185	123589185	+	Splice_Site	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr9:123589185T>C	ENST00000210313.3	-	6	746	c.672A>G	c.(670-672)agA>agG	p.R224R	PSMD5_ENST00000373904.5_Splice_Site_p.R181R|PSMD5-AS1_ENST00000589026.1_RNA	NM_001270427.1|NM_005047.3	NP_001257356.1|NP_005038.1	Q16401	PSMD5_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 5	224					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein folding (GO:0006457)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)				endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)	10						TACAGGTGGCTCTAAAATGTC	0.338																																					p.R224R		.											.	PSMD5	90	0			c.A672G						.						84.0	84.0	84.0					9																	123589185		2203	4300	6503	SO:0001630	splice_region_variant	5711	exon6			GGTGGCTCTAAAA	AK001065	CCDS6824.1, CCDS59143.1	9q34.11	2008-02-05			ENSG00000095261	ENSG00000095261		"""Proteasome (prosome, macropain) subunits"""	9563	protein-coding gene	gene with protein product		604452				7559544	Standard	NM_005047		Approved	S5B, KIAA0072	uc004bko.4	Q16401	OTTHUMG00000020573	ENST00000210313.3:c.672-1A>G	9.37:g.123589185T>C		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_005047	B4DZM8|Q15045|Q4VXG8	Silent	SNP	ENST00000210313.3	37	CCDS6824.1																																																																																			.		0.338	PSMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053825.2	NM_005047	Silent
PTPRQ	374462	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	80887157	80887157	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:80887157C>T	ENST00000266688.5	+	15	1451	c.1451C>T	c.(1450-1452)gCt>gTt	p.A484V				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	530	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CACTCACTTGCTACATTTATA	0.398																																					p.A316V		.											.	.	.	0			c.C947T						.						108.0	96.0	100.0					12																	80887157		692	1591	2283	SO:0001583	missense	374462	exon7			CACTTGCTACATT	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.1451C>T	12.37:g.80887157C>T	ENSP00000266688:p.Ala484Val	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	17.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	37		.	.	.	.	.	.	.	.	.	.	C	14.26	2.481302	0.44147	.	.	ENSG00000139304	ENST00000266688	T	0.36699	1.24	5.73	5.73	0.89815	Fibronectin, type III (3);	.	.	.	.	T	0.23410	0.0566	.	.	.	0.40029	D	0.975506	P	0.39665	0.682	B	0.30029	0.11	T	0.07770	-1.0755	8	0.11794	T	0.64	.	19.8961	0.96958	0.0:1.0:0.0:0.0	.	530	Q9UMZ3	PTPRQ_HUMAN	V	484	ENSP00000266688:A484V	ENSP00000266688:A484V	A	+	2	0	PTPRQ	79411288	1.000000	0.71417	0.961000	0.40146	0.202000	0.24057	5.262000	0.65501	2.699000	0.92147	0.655000	0.94253	GCT	.		0.398	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
PUS10	150962	hgsc.bcm.edu;broad.mit.edu	37	2	61175205	61175205	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:61175205C>T	ENST00000316752.6	-	16	1685	c.1424G>A	c.(1423-1425)cGc>cAc	p.R475H	PUS10_ENST00000407787.1_Missense_Mutation_p.R475H	NM_144709.2	NP_653310.2	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	475					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)	22			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			CAAGTGGAGGCGGAAGTGGTG	0.542																																					p.R475H		.											.	PUS10	291	0			c.G1424A						.						159.0	160.0	160.0					2																	61175205		2203	4300	6503	SO:0001583	missense	150962	exon16			TGGAGGCGGAAGT	AK056874	CCDS1865.1	2p16.1	2008-02-05	2008-01-09	2008-01-09	ENSG00000162927	ENSG00000162927			26505	protein-coding gene	gene with protein product		612787	"""coiled-coil domain containing 139"""	CCDC139		17900615	Standard	NM_144709		Approved	FLJ32312	uc002sao.3	Q3MIT2	OTTHUMG00000129423	ENST00000316752.6:c.1424G>A	2.37:g.61175205C>T	ENSP00000326003:p.Arg475His	Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	5.0	NM_144709	Q5JPJ5|Q96MI8	Missense_Mutation	SNP	ENST00000316752.6	37	CCDS1865.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.514692	0.27123	.	.	ENSG00000162927	ENST00000316752;ENST00000407787	D;D	0.88431	-2.38;-2.38	5.86	4.96	0.65561	Pseudouridine synthase, catalytic domain (1);	0.220456	0.49916	N	0.000133	D	0.83982	0.5372	L	0.55834	1.745	0.80722	D	1	P;P	0.34684	0.463;0.463	B;B	0.27076	0.076;0.076	T	0.81165	-0.1057	10	0.15952	T	0.53	8.0589	14.4899	0.67645	0.0:0.9271:0.0:0.0729	.	475;475	A8K6R4;Q3MIT2	.;PUS10_HUMAN	H	475	ENSP00000326003:R475H;ENSP00000386074:R475H	ENSP00000326003:R475H	R	-	2	0	PUS10	61028709	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	2.736000	0.47385	1.557000	0.49525	0.650000	0.86243	CGC	.		0.542	PUS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251582.2	NM_144709	
PUS7L	83448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	44148626	44148626	+	Silent	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:44148626G>A	ENST00000416848.2	-	2	911	c.423C>T	c.(421-423)gcC>gcT	p.A141A	PUS7L_ENST00000553166.1_Silent_p.A141A|PUS7L_ENST00000344862.5_Silent_p.A141A|PUS7L_ENST00000551923.1_Silent_p.A141A|PUS7L_ENST00000431332.3_Intron	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	141					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.A141A(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TTACATCACAGGCAAAATTAT	0.368																																					p.A141A		.											.	PUS7L	91	1	Substitution - coding silent(1)	lung(1)	c.C423T						.						97.0	96.0	96.0					12																	44148626		2203	4299	6502	SO:0001819	synonymous_variant	83448	exon2			ATCACAGGCAAAA	BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.423C>T	12.37:g.44148626G>A		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	25.0	NM_001098614	B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Silent	SNP	ENST00000416848.2	37	CCDS8743.1																																																																																			.		0.368	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292	
RAPGEF4	11069	hgsc.bcm.edu;bcgsc.ca	37	2	173852991	173852991	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:173852991T>C	ENST00000397081.3	+	13	1361	c.1218T>C	c.(1216-1218)atT>atC	p.I406I	RAPGEF4_ENST00000473043.1_3'UTR|RAPGEF4_ENST00000409036.1_Silent_p.I406I|RAPGEF4_ENST00000538974.1_Silent_p.I235I|RAPGEF4_ENST00000397087.3_Silent_p.I262I|RAPGEF4_ENST00000540783.1_Silent_p.I253I|RAPGEF4_ENST00000264111.6_Silent_p.I405I|RAPGEF4_ENST00000539331.1_Silent_p.I253I|RAPGEF4_ENST00000535187.1_Silent_p.I186I	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	406					blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			ATGTAGTCATTTACGGCAAGG	0.338																																					p.I406I		.											.	RAPGEF4	274	0			c.T1218C						.						124.0	113.0	116.0					2																	173852991		1814	4087	5901	SO:0001819	synonymous_variant	11069	exon13			AGTCATTTACGGC	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.1218T>C	2.37:g.173852991T>C		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_007023	B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Silent	SNP	ENST00000397081.3	37	CCDS42775.1																																																																																			.		0.338	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257864.2	NM_007023	
RCOR1	23186	hgsc.bcm.edu;bcgsc.ca	37	14	103148307	103148307	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr14:103148307A>G	ENST00000570597.1	+	3	428	c.428A>G	c.(427-429)gAa>gGa	p.E143G	RCOR1_ENST00000262241.6_Missense_Mutation_p.E146G			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	143	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interaction with HDAC1.				blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						AATCTGTCAGAAGCAAAGTGT	0.373																																					p.E146G		.											.	RCOR1	91	0			c.A437G						.						105.0	94.0	98.0					14																	103148307		2203	4300	6503	SO:0001583	missense	23186	exon3			TGTCAGAAGCAAA	AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.428A>G	14.37:g.103148307A>G	ENSP00000459789:p.Glu143Gly	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_015156	Q15044|Q6P2I9|Q86VG5	Missense_Mutation	SNP	ENST00000570597.1	37		.	.	.	.	.	.	.	.	.	.	A	22.2	4.261680	0.80358	.	.	ENSG00000089902	ENST00000262241	.	.	.	5.25	5.25	0.73442	ELM2 domain (2);	0.058965	0.64402	D	0.000004	T	0.70465	0.3227	L	0.50333	1.59	0.58432	D	0.999991	D	0.62365	0.991	D	0.76575	0.988	T	0.73594	-0.3933	9	0.87932	D	0	-23.7068	14.1505	0.65381	1.0:0.0:0.0:0.0	.	143	Q9UKL0	RCOR1_HUMAN	G	143	.	ENSP00000262241:E143G	E	+	2	0	RCOR1	102218060	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.041000	0.70988	1.985000	0.57927	0.533000	0.62120	GAA	.		0.373	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015156	
REXO1	57455	hgsc.bcm.edu;bcgsc.ca	37	19	1827477	1827477	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:1827477T>C	ENST00000170168.4	-	2	1405	c.1311A>G	c.(1309-1311)ccA>ccG	p.P437P	REXO1_ENST00000587524.1_5'Flank|CTB-31O20.4_ENST00000587741.1_RNA|CTB-31O20.4_ENST00000593201.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	437						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCCGAAGATGGCTTCTTCT	0.731																																					p.P437P		.											.	REXO1	90	0			c.A1311G						.						15.0	16.0	16.0					19																	1827477		2150	4202	6352	SO:0001819	synonymous_variant	57455	exon2			CGAAGATGGCTTC	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1311A>G	19.37:g.1827477T>C		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	4.0	NM_020695	Q9ULT2	Silent	SNP	ENST00000170168.4	37	CCDS32866.1																																																																																			.		0.731	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1	NM_020695	
RGS4	5999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	163042190	163042190	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:163042190A>G	ENST00000367909.6	+	2	390	c.50A>G	c.(49-51)aAa>aGa	p.K17R	RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000531057.1_Missense_Mutation_p.K17R|RGS4_ENST00000367908.4_Missense_Mutation_p.K17R|RGS4_ENST00000421743.2_Missense_Mutation_p.K114R|RGS4_ENST00000367906.3_5'UTR|RGS4_ENST00000527809.1_5'UTR	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	17					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						TGCAGTGCAAAAGATATGAAA	0.368																																					p.K114R	Ovarian(76;1257 1738 3039 6086)	.											.	RGS4	652	0			c.A341G						.						56.0	55.0	56.0					1																	163042190		2203	4300	6503	SO:0001583	missense	5999	exon3			GTGCAAAAGATAT	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.50A>G	1.37:g.163042190A>G	ENSP00000356885:p.Lys17Arg	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	20.0	NM_001102445	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	ENST00000367909.6	37	CCDS1243.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.424432	0.83667	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000531057;ENST00000367908	T;T;D	0.88201	0.28;0.35;-2.35	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	D	0.93324	0.7872	M	0.86953	2.85	0.42174	D	0.991651	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.80764	0.99;0.991;0.994	D	0.94358	0.7585	9	0.62326	D	0.03	.	11.8394	0.52344	1.0:0.0:0.0:0.0	.	17;17;114	B1APZ3;P49798;A7XA59	.;RGS4_HUMAN;.	R	114;17;17;17	ENSP00000397181:K114R;ENSP00000356885:K17R;ENSP00000436106:K17R	ENSP00000356884:K17R	K	+	2	0	RGS4	161308814	1.000000	0.71417	0.964000	0.40570	0.997000	0.91878	6.310000	0.72830	1.890000	0.54733	0.533000	0.62120	AAA	.		0.368	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613	
RFWD2	64326	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175958553	175958553	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:175958553G>A	ENST00000367669.3	-	16	2306	c.1792C>T	c.(1792-1794)Cac>Tac	p.H598Y	RFWD2_ENST00000308769.8_Missense_Mutation_p.H574Y	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	598					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						GCTTTACGGTGTCCTTTGAAT	0.383																																					p.H598Y	Ovarian(134;1413 1765 5706 35534 51541)	.											.	RFWD2	659	0			c.C1792T						.						142.0	124.0	130.0					1																	175958553		2203	4300	6503	SO:0001583	missense	64326	exon16			TACGGTGTCCTTT	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.1792C>T	1.37:g.175958553G>A	ENSP00000356641:p.His598Tyr	Somatic	225.0	1.0		WXS	Illumina HiSeq	Phase_I	201.0	45.0	NM_022457	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	ENST00000367669.3	37	CCDS30944.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903400	0.92035	.	.	ENSG00000143207	ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769	T;T;T	0.81415	-1.49;-1.49;-1.49	5.79	5.79	0.91817	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.94391	0.8196	H	0.98646	4.29	0.80722	D	1	D;P;D;P;P	0.89917	1.0;0.705;1.0;0.925;0.925	D;P;D;D;D	0.97110	1.0;0.784;0.998;0.954;0.932	D	0.96079	0.9052	10	0.87932	D	0	-12.4248	19.6032	0.95572	0.0:0.0:1.0:0.0	.	373;358;574;598;598	Q8NHY2-3;B1AMD2;Q8NHY2-2;Q8NHY2;Q504W6	.;.;.;RFWD2_HUMAN;.	Y	373;598;433;574	ENSP00000356641:H598Y;ENSP00000356638:H433Y;ENSP00000310943:H574Y	ENSP00000310943:H574Y	H	-	1	0	RFWD2	174225176	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.627000	0.98412	2.738000	0.93877	0.655000	0.94253	CAC	.		0.383	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2	NM_022457	
RHOH	399	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	40245536	40245536	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr4:40245536G>A	ENST00000381799.5	+	3	1254	c.530G>A	c.(529-531)cGa>cAa	p.R177Q	RHOH_ENST00000505618.1_Missense_Mutation_p.R177Q	NM_001278363.1|NM_001278365.1|NM_001278366.1|NM_001278367.1|NM_001278369.1|NM_004310.4	NP_001265292.1|NP_001265294.1|NP_001265295.1|NP_001265296.1|NP_001265298.1|NP_004301.1	Q15669	RHOH_HUMAN	ras homolog family member H	177					mast cell activation (GO:0045576)|negative regulation of catalytic activity (GO:0043086)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of phosphorylation (GO:0042326)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase inhibitor activity (GO:0005095)|kinase inhibitor activity (GO:0019210)|Rho GTPase binding (GO:0017048)	p.R177Q(1)		kidney(1)|large_intestine(3)|lung(7)|ovary(1)	12						GCCAGGAGACGAAACAGAAGG	0.527																																					p.R177Q		.											.	RHOH	660	1	Substitution - Missense(1)	large_intestine(1)	c.G530A						.						32.0	33.0	33.0					4																	40245536		2203	4300	6503	SO:0001583	missense	399	exon3			GGAGACGAAACAG	Z35227	CCDS3458.1	4p13	2014-09-17	2012-02-27	2004-03-24	ENSG00000168421	ENSG00000168421			686	protein-coding gene	gene with protein product		602037	"""ras homolog gene family, member H"""	ARHH		7784061	Standard	NM_001278359		Approved	RhoH, TTF	uc003guz.2	Q15669	OTTHUMG00000099373	ENST00000381799.5:c.530G>A	4.37:g.40245536G>A	ENSP00000371219:p.Arg177Gln	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	10.0	NM_004310		Missense_Mutation	SNP	ENST00000381799.5	37	CCDS3458.1	.	.	.	.	.	.	.	.	.	.	g	6.416	0.444863	0.12164	.	.	ENSG00000168421	ENST00000505618;ENST00000381799	T;T	0.63580	-0.05;-0.05	6.03	4.3	0.51218	.	0.184661	0.35936	U	0.002886	T	0.41994	0.1183	N	0.12887	0.27	0.37252	D	0.906626	B	0.13145	0.007	B	0.01281	0.0	T	0.42344	-0.9457	10	0.41790	T	0.15	.	10.4219	0.44354	0.2106:0.0:0.7894:0.0	.	177	Q15669	RHOH_HUMAN	Q	177	ENSP00000425010:R177Q;ENSP00000371219:R177Q	ENSP00000371219:R177Q	R	+	2	0	RHOH	39921931	1.000000	0.71417	0.988000	0.46212	0.098000	0.18820	2.358000	0.44134	1.558000	0.49541	0.655000	0.94253	CGA	.		0.527	RHOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216820.3	NM_004310	
RLF	6018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	40705106	40705106	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:40705106A>G	ENST00000372771.4	+	8	4759	c.4732A>G	c.(4732-4734)Agt>Ggt	p.S1578G		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1578					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TCAGATGAGTAGTGCCTATTT	0.448																																					p.S1578G		.											.	RLF	93	0			c.A4732G						.						80.0	78.0	78.0					1																	40705106		2203	4300	6503	SO:0001583	missense	6018	exon8			ATGAGTAGTGCCT		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.4732A>G	1.37:g.40705106A>G	ENSP00000361857:p.Ser1578Gly	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	13.0	NM_012421	Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	37	CCDS448.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.327471	0.24080	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.14266	2.52	6.15	4.97	0.65823	.	0.273633	0.47455	D	0.000240	T	0.10423	0.0255	L	0.36672	1.1	0.31147	N	0.705943	P;P	0.38370	0.628;0.495	B;B	0.31869	0.137;0.065	T	0.07558	-1.0766	10	0.56958	D	0.05	-15.8971	10.5126	0.44870	0.7507:0.0:0.0:0.2493	.	1271;1578	F5H2M5;Q13129	.;RLF_HUMAN	G	1578;1271	ENSP00000361857:S1578G	ENSP00000361857:S1578G	S	+	1	0	RLF	40477693	0.961000	0.32948	1.000000	0.80357	0.999000	0.98932	2.645000	0.46621	2.363000	0.80096	0.523000	0.50628	AGT	.		0.448	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421	
RNGTT	8732	hgsc.bcm.edu;bcgsc.ca	37	6	89322527	89322527	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:89322527A>G	ENST00000369485.4	-	16	1891	c.1705T>C	c.(1705-1707)Tct>Cct	p.S569P	RNGTT_ENST00000265607.6_Missense_Mutation_p.S546P|RNGTT_ENST00000538899.1_Missense_Mutation_p.S486P	NM_003800.3	NP_003791.3	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase	569	GTase.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA processing (GO:0006396)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|mRNA guanylyltransferase activity (GO:0004484)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA guanylyltransferase activity (GO:0008192)|triphosphatase activity (GO:0050355)			endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	21		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		TGTCCTTGAGAAGCTGCAGTA	0.512																																					p.S569P		.											.	RNGTT	91	0			c.T1705C						.						231.0	176.0	194.0					6																	89322527		2203	4300	6503	SO:0001583	missense	8732	exon16			CTTGAGAAGCTGC	AF025654	CCDS5017.1	6q16	2011-06-09			ENSG00000111880	ENSG00000111880	2.7.7.50	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	10073	protein-coding gene	gene with protein product		603512				9828141, 9512541	Standard	NM_001286428		Approved	HCE, HCE1, hCAP	uc003pmr.2	O60942	OTTHUMG00000015190	ENST00000369485.4:c.1705T>C	6.37:g.89322527A>G	ENSP00000358497:p.Ser569Pro	Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_003800	E1P513|E1P514|O43483|O60257|O60351|Q5TCW8|Q8WUM8	Missense_Mutation	SNP	ENST00000369485.4	37	CCDS5017.1	.	.	.	.	.	.	.	.	.	.	A	2.769	-0.256124	0.05829	.	.	ENSG00000111880	ENST00000369485;ENST00000265607;ENST00000538899;ENST00000536746	T;T;T	0.22945	1.93;1.93;1.93	5.84	3.35	0.38373	Nucleic acid-binding, OB-fold-like (1);	0.730694	0.14759	N	0.300081	T	0.04634	0.0126	N	0.19112	0.55	0.21652	N	0.9996	B;P;B	0.34977	0.0;0.478;0.347	B;B;B	0.31686	0.001;0.134;0.047	T	0.35101	-0.9802	10	0.25106	T	0.35	-2.9691	6.8469	0.23992	0.5041:0.1335:0.0:0.3624	.	486;546;569	B4DSJ8;O60942-2;O60942	.;.;MCE1_HUMAN	P	569;546;486;540	ENSP00000358497:S569P;ENSP00000265607:S546P;ENSP00000442609:S486P	ENSP00000265607:S546P	S	-	1	0	RNGTT	89379246	0.852000	0.29690	0.207000	0.23584	0.474000	0.32979	1.290000	0.33319	0.504000	0.28082	0.529000	0.55759	TCT	.		0.512	RNGTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041469.1		
RP1L1	94137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	10464506	10464506	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr8:10464506C>T	ENST00000382483.3	-	4	7325	c.7102G>A	c.(7102-7104)Gaa>Aaa	p.E2368K		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2448					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCATAACCTTCACTGGCCCCC	0.557																																					p.E2368K		.											.	RP1L1	139	0			c.G7102A						.						96.0	101.0	99.0					8																	10464506		1912	4113	6025	SO:0001583	missense	94137	exon4			AACCTTCACTGGC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.7102G>A	8.37:g.10464506C>T	ENSP00000371923:p.Glu2368Lys	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	25.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	9.958	1.221954	0.22457	.	.	ENSG00000183638	ENST00000382483	T	0.12879	2.64	4.29	-0.977	0.10282	.	.	.	.	.	T	0.04907	0.0132	N	0.04508	-0.205	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.44772	-0.9306	9	0.17369	T	0.5	-0.015	5.0356	0.14432	0.1339:0.5556:0.0:0.3105	.	2368	A6NKC6	.	K	2368	ENSP00000371923:E2368K	ENSP00000371923:E2368K	E	-	1	0	RP1L1	10501916	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.058000	0.11750	-0.316000	0.08690	-1.093000	0.02169	GAA	.		0.557	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
RP1	6101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	55542668	55542668	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr8:55542668T>A	ENST00000220676.1	+	4	6374	c.6226T>A	c.(6226-6228)Ttc>Atc	p.F2076I		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	2076					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAATAACAGATTCCAGGGCTC	0.358																																					p.F2076I	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.T6226A						.						44.0	45.0	45.0					8																	55542668		2202	4297	6499	SO:0001583	missense	6101	exon4			AACAGATTCCAGG	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.6226T>A	8.37:g.55542668T>A	ENSP00000220676:p.Phe2076Ile	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	24.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	T	13.47	2.245740	0.39697	.	.	ENSG00000104237	ENST00000220676	T	0.24151	1.87	5.76	5.76	0.90799	.	0.236869	0.29668	N	0.011509	T	0.29491	0.0735	M	0.62723	1.935	0.09310	N	0.999999	P	0.35077	0.483	B	0.33392	0.163	T	0.32534	-0.9903	10	0.72032	D	0.01	.	14.6387	0.68708	0.0:0.0:0.0:1.0	.	2076	P56715	RP1_HUMAN	I	2076	ENSP00000220676:F2076I	ENSP00000220676:F2076I	F	+	1	0	RP1	55705221	0.574000	0.26684	0.362000	0.25862	0.126000	0.20510	2.402000	0.44521	2.201000	0.70794	0.533000	0.62120	TTC	.		0.358	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
RRM1	6240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4142990	4142990	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:4142990A>T	ENST00000300738.5	+	10	1237	c.1033A>T	c.(1033-1035)Aat>Tat	p.N345Y	RRM1_ENST00000534285.1_Missense_Mutation_p.N123Y|RRM1_ENST00000528470.1_3'UTR|RRM1_ENST00000537197.1_Missense_Mutation_p.N7Y|RRM1_ENST00000423050.2_Missense_Mutation_p.N248Y	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	345					cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	AGTGGAGACTAATCAGGTGAG	0.408																																					p.N345Y	NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)	.											.	RRM1	227	0			c.A1033T						.						95.0	101.0	99.0					11																	4142990		2201	4298	6499	SO:0001583	missense	6240	exon10			GAGACTAATCAGG	X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.1033A>T	11.37:g.4142990A>T	ENSP00000300738:p.Asn345Tyr	Somatic	209.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	42.0	NM_001033	Q9UNN2	Missense_Mutation	SNP	ENST00000300738.5	37	CCDS7750.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.631683	0.87660	.	.	ENSG00000167325	ENST00000300738;ENST00000423050;ENST00000536894;ENST00000534285;ENST00000543838;ENST00000537197	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.4	5.4	0.78164	Ribonucleoside-diphosphate reductase, alpha subunit (1);Ribonucleotide reductase large subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.74321	0.3701	H	0.97131	3.945	0.80722	D	1	D	0.69078	0.997	P	0.55545	0.778	D	0.84232	0.0467	10	0.87932	D	0	-21.6001	14.6003	0.68435	1.0:0.0:0.0:0.0	.	345	P23921	RIR1_HUMAN	Y	345;248;258;123;123;7	ENSP00000300738:N345Y;ENSP00000390539:N248Y;ENSP00000431464:N123Y;ENSP00000442148:N7Y	ENSP00000300738:N345Y	N	+	1	0	RRM1	4099566	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.962000	0.93254	2.030000	0.59900	0.528000	0.53228	AAT	.		0.408	RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257197.1	NM_001033	
SBNO1	55206	hgsc.bcm.edu;bcgsc.ca	37	12	123793921	123793921	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:123793921T>C	ENST00000602398.1	-	28	3693	c.3566A>G	c.(3565-3567)gAg>gGg	p.E1189G	SBNO1_ENST00000420886.2_Missense_Mutation_p.E1189G|SBNO1_ENST00000267176.4_Missense_Mutation_p.E1188G|SBNO1_ENST00000602750.1_Missense_Mutation_p.E1188G			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1189					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		GGTAGCTTCCTCCCATGACAT	0.388																																					p.E1189G		.											.	SBNO1	292	0			c.A3566G						.						115.0	113.0	113.0					12																	123793921		2203	4300	6503	SO:0001583	missense	55206	exon27			GCTTCCTCCCATG	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.3566A>G	12.37:g.123793921T>C	ENSP00000473665:p.Glu1189Gly	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	5.0	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.426805	0.62733	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	D;D	0.83673	-1.75;-1.75	5.2	4.06	0.47325	.	0.200475	0.42294	N	0.000721	T	0.81235	0.4780	M	0.82056	2.57	0.51012	D	0.999906	B;B;P	0.43431	0.039;0.066;0.807	B;B;B	0.37692	0.014;0.033;0.256	T	0.79052	-0.1961	10	0.39692	T	0.17	-11.4839	10.6188	0.45467	0.0:0.0756:0.0:0.9244	.	1189;1188;300	A3KN83;A3KN83-2;B3KUC1	SBNO1_HUMAN;.;.	G	1189;1188	ENSP00000387361:E1189G;ENSP00000267176:E1188G	ENSP00000267176:E1188G	E	-	2	0	SBNO1	122359874	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	8.013000	0.88655	0.825000	0.34637	0.383000	0.25322	GAG	.		0.388	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
SCN3A	6328	hgsc.bcm.edu;bcgsc.ca	37	2	166019086	166019086	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:166019086T>C	ENST00000360093.3	-	8	1438	c.947A>G	c.(946-948)aAg>aGg	p.K316R	SCN3A_ENST00000283254.7_Missense_Mutation_p.K316R|SCN3A_ENST00000409101.3_Missense_Mutation_p.K316R	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	316					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AATGTAATCCTTCCAGTTAAA	0.348																																					p.K316R		.											.	SCN3A	141	0			c.A947G						.						120.0	122.0	121.0					2																	166019086		2203	4300	6503	SO:0001583	missense	6328	exon8			TAATCCTTCCAGT	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.947A>G	2.37:g.166019086T>C	ENSP00000353206:p.Lys316Arg	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_001081676	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		.	.	.	.	.	.	.	.	.	.	T	11.48	1.650437	0.29336	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.96041	-3.89;-3.88;-3.84;-3.71	5.82	5.82	0.92795	Ion transport (1);	0.234157	0.29980	N	0.010706	D	0.92136	0.7507	L	0.33189	0.99	0.80722	D	1	B;B;B;B;B	0.31485	0.077;0.325;0.001;0.001;0.145	B;B;B;B;B	0.28849	0.042;0.095;0.019;0.019;0.036	D	0.90956	0.4809	10	0.49607	T	0.09	.	16.1839	0.81934	0.0:0.0:0.0:1.0	.	316;316;316;316;316	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	R	316	ENSP00000353206:K316R;ENSP00000283254:K316R;ENSP00000386726:K316R;ENSP00000403348:K316R	ENSP00000283254:K316R	K	-	2	0	SCN3A	165727332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.590000	0.46154	2.222000	0.72286	0.533000	0.62120	AAG	.		0.348	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
SCRIB	23513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	144890960	144890960	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr8:144890960C>T	ENST00000320476.3	-	15	1940	c.1934G>A	c.(1933-1935)tGg>tAg	p.W645*	SCRIB_ENST00000356994.2_Nonsense_Mutation_p.W645*|SCRIB_ENST00000377533.3_Nonsense_Mutation_p.W564*	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	645	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GCCATTGTGCCAGCCCCCGGG	0.667																																					p.W645X	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB	228	0			c.G1934A						.						50.0	57.0	55.0					8																	144890960		2203	4300	6503	SO:0001587	stop_gained	23513	exon15			TTGTGCCAGCCCC	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1934G>A	8.37:g.144890960C>T	ENSP00000322938:p.Trp645*	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	11.0	NM_015356	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Nonsense_Mutation	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	c	39	7.545454	0.98348	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533;ENST00000377539	.	.	.	4.68	4.68	0.58851	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	9.9332	0.41534	0.0:0.9046:0.0:0.0954	.	.	.	.	X	645;645;564;14	.	ENSP00000322938:W645X	W	-	2	0	SCRIB	144962948	1.000000	0.71417	0.999000	0.59377	0.420000	0.31355	2.760000	0.47581	2.153000	0.67306	0.401000	0.26515	TGG	.		0.667	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4091349	4091349	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr7:4091349G>A	ENST00000404826.2	+	19	2937	c.2798G>A	c.(2797-2799)gGa>gAa	p.G933E	SDK1_ENST00000389531.3_Missense_Mutation_p.G933E	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	933	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GTCCACCATGGACACATAACG	0.577																																					p.G933E		.											.	SDK1	138	0			c.G2798A						.						152.0	135.0	141.0					7																	4091349		2203	4300	6503	SO:0001583	missense	221935	exon19			ACCATGGACACAT	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2798G>A	7.37:g.4091349G>A	ENSP00000385899:p.Gly933Glu	Somatic	200.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	75.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667580	0.47677	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.56941	0.43;0.43	5.62	5.62	0.85841	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.70876	0.3274	M	0.71296	2.17	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	T	0.71434	-0.4594	10	0.51188	T	0.08	.	14.519	0.67838	0.0:0.0:0.8536:0.1464	.	933;933	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	E	933	ENSP00000385899:G933E;ENSP00000374182:G933E	ENSP00000374182:G933E	G	+	2	0	SDK1	4057875	1.000000	0.71417	0.144000	0.22314	0.018000	0.09664	5.487000	0.66863	2.648000	0.89879	0.650000	0.86243	GGA	.		0.577	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SETD2	29072	hgsc.bcm.edu;bcgsc.ca	37	3	47155420	47155420	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:47155420A>G	ENST00000409792.3	-	5	4703	c.4661T>C	c.(4660-4662)gTc>gCc	p.V1554A		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1554	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.V1051G(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGTGAGTATGACTTCCACATC	0.403			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.V1554A		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	SETD2,NS,carcinoma,0	SETD2	1273	1	Substitution - Missense(1)	kidney(1)	c.T4661C						.						139.0	140.0	139.0					3																	47155420		2203	4300	6503	SO:0001583	missense	29072	exon5			AGTATGACTTCCA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4661T>C	3.37:g.47155420A>G	ENSP00000386759:p.Val1554Ala	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	5.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	A	14.92	2.678586	0.47886	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.83837	-1.77	5.06	5.06	0.68205	SET domain (2);	0.000000	0.49916	D	0.000136	T	0.81922	0.4925	M	0.80847	2.515	0.80722	D	1	B;B	0.24675	0.109;0.109	B;B	0.21546	0.035;0.035	T	0.79867	-0.1622	10	0.45353	T	0.12	.	9.6237	0.39737	0.9207:0.0:0.0793:0.0	.	1554;1554	F2Z317;Q9BYW2	.;SETD2_HUMAN	A	1554	ENSP00000386759:V1554A	ENSP00000386759:V1554A	V	-	2	0	SETD2	47130424	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.142000	0.77339	2.036000	0.60181	0.477000	0.44152	GTC	.		0.403	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SHC4	399694	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	49176517	49176517	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:49176517C>A	ENST00000332408.4	-	4	1196	c.768G>T	c.(766-768)caG>caT	p.Q256H		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	256	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		TTCCTGAAAACTGAAGATTAC	0.323																																					p.Q256H		.											.	SHC4	95	0			c.G768T						.						111.0	109.0	110.0					15																	49176517		2196	4295	6491	SO:0001583	missense	399694	exon4			TGAAAACTGAAGA	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.768G>T	15.37:g.49176517C>A	ENSP00000329668:p.Gln256His	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	6.0	NM_203349	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.583076	0.65992	.	.	ENSG00000185634	ENST00000332408	T	0.20200	2.09	5.14	3.22	0.36961	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000002	T	0.29850	0.0746	M	0.68317	2.08	0.80722	D	1	P	0.38167	0.621	P	0.44897	0.463	T	0.12967	-1.0527	10	0.59425	D	0.04	-19.8923	11.744	0.51809	0.0:0.8525:0.0:0.1475	.	256	Q6S5L8	SHC4_HUMAN	H	256	ENSP00000329668:Q256H	ENSP00000329668:Q256H	Q	-	3	2	SHC4	46963809	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.202000	0.51067	1.394000	0.46624	0.655000	0.94253	CAG	.		0.323	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
SH2D7	646892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	78393469	78393469	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:78393469C>T	ENST00000328828.5	+	5	874	c.874C>T	c.(874-876)Cct>Tct	p.P292S	SH2D7_ENST00000409568.2_Missense_Mutation_p.P156S	NM_001101404.1	NP_001094874.1	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7	292										endometrium(2)|kidney(2)|lung(3)	7						ACAGAACAGGCCTGATGGCCT	0.637																																					p.P292S		.											.	.	.	0			c.C874T						.						22.0	25.0	24.0					15																	78393469		1891	4117	6008	SO:0001583	missense	646892	exon5			AACAGGCCTGATG		CCDS45315.1	15q25.1	2013-02-14			ENSG00000183476	ENSG00000183476		"""SH2 domain containing"""	34549	protein-coding gene	gene with protein product							Standard	NM_001101404		Approved	LOC646892	uc010blb.1	A6NKC9	OTTHUMG00000154271	ENST00000328828.5:c.874C>T	15.37:g.78393469C>T	ENSP00000327846:p.Pro292Ser	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	43.0	NM_001101404		Missense_Mutation	SNP	ENST00000328828.5	37	CCDS45315.1	.	.	.	.	.	.	.	.	.	.	C	8.777	0.927343	0.18056	.	.	ENSG00000183476	ENST00000409568;ENST00000328828	T;T	0.61742	0.08;0.24	3.75	-0.448	0.12230	.	0.716340	0.12608	N	0.454087	T	0.34861	0.0912	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.17198	-1.0377	10	0.46703	T	0.11	-1.4708	3.3582	0.07177	0.0:0.4337:0.2047:0.3615	.	292	A6NKC9	SH2D7_HUMAN	S	156;292	ENSP00000386676:P156S;ENSP00000327846:P292S	ENSP00000327846:P292S	P	+	1	0	SH2D7	76180524	0.011000	0.17503	0.006000	0.13384	0.014000	0.08584	0.724000	0.25954	0.028000	0.15324	-0.254000	0.11334	CCT	.		0.637	SH2D7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000334660.2	NM_001101404	
SLAMF7	57823	hgsc.bcm.edu;bcgsc.ca	37	1	160719673	160719673	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:160719673A>G	ENST00000368043.3	+	3	476	c.439A>G	c.(439-441)Acc>Gcc	p.T147A	SLAMF7_ENST00000458602.2_Missense_Mutation_p.T40A|SLAMF7_ENST00000441662.2_Intron|SLAMF7_ENST00000368042.3_Missense_Mutation_p.T40A|SLAMF7_ENST00000359331.4_Missense_Mutation_p.T147A|SLAMF7_ENST00000458104.2_Missense_Mutation_p.T40A|SLAMF7_ENST00000444090.2_Intron	NM_001282595.1|NM_021181.3	NP_001269524.1|NP_067004.3	Q9NQ25	SLAF7_HUMAN	SLAM family member 7	147	Ig-like C2-type.				cell adhesion (GO:0007155)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of natural killer cell activation (GO:0032814)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(4)	24	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CACCTGTGTGACCAATCTGAC	0.512																																					p.T147A		.											.	SLAMF7	93	0			c.A439G						.						120.0	120.0	120.0					1																	160719673		2203	4300	6503	SO:0001583	missense	57823	exon3			TGTGTGACCAATC	AB027233	CCDS1209.1, CCDS60321.1, CCDS60322.1, CCDS60323.1, CCDS60324.1, CCDS60325.1, CCDS72956.1, CCDS72957.1	1q23.1-q24.1	2013-01-11			ENSG00000026751	ENSG00000026751		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	21394	protein-coding gene	gene with protein product		606625				11802771, 11220635	Standard	XM_005245386		Approved	CRACC, 19A, CS1, CD319	uc001fwq.3	Q9NQ25	OTTHUMG00000024008	ENST00000368043.3:c.439A>G	1.37:g.160719673A>G	ENSP00000357022:p.Thr147Ala	Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	4.0	NM_021181	A8K3U1|B4DPU4|B4DPY3|B4DWA3|Q8N6Y8|Q8ND32|Q9NY08|Q9NY23	Missense_Mutation	SNP	ENST00000368043.3	37	CCDS1209.1	.	.	.	.	.	.	.	.	.	.	A	11.05	1.524450	0.27299	.	.	ENSG00000026751	ENST00000368043;ENST00000368042;ENST00000458602;ENST00000458104;ENST00000359331	T;T;T;T;T	0.41065	4.13;1.01;1.01;1.01;4.13	5.16	0.103	0.14526	Immunoglobulin-like (1);	0.926254	0.09304	N	0.820567	T	0.30603	0.0770	L	0.39898	1.24	0.09310	N	1	P;D;D;D;D;D	0.76494	0.952;0.993;0.998;0.997;0.992;0.999	P;P;D;D;P;D	0.72625	0.647;0.84;0.947;0.921;0.87;0.978	T	0.07214	-1.0784	10	0.41790	T	0.15	-5.746	3.6683	0.08264	0.5756:0.0:0.2679:0.1565	.	40;40;40;40;147;147	B4DVL7;B4DWA3;B4DW98;Q9NQ25-2;A8K3U1;Q9NQ25	.;.;.;.;.;SLAF7_HUMAN	A	147;40;40;40;147	ENSP00000357022:T147A;ENSP00000357021:T40A;ENSP00000409965:T40A;ENSP00000403294:T40A;ENSP00000352281:T147A	ENSP00000352281:T147A	T	+	1	0	SLAMF7	158986297	0.001000	0.12720	0.006000	0.13384	0.118000	0.20060	0.052000	0.14163	0.097000	0.17492	0.528000	0.53228	ACC	.		0.512	SLAMF7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060464.1	NM_021181	
SLC30A3	7781	hgsc.bcm.edu;bcgsc.ca	37	2	27481800	27481800	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:27481800A>G	ENST00000233535.4	-	2	450	c.98T>C	c.(97-99)cTc>cCc	p.L33P	SLC30A3_ENST00000447008.2_Missense_Mutation_p.L28P	NM_003459.4	NP_003450.2	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter), member 3	33					positive regulation of transport (GO:0051050)|regulation of sequestering of zinc ion (GO:0061088)|transmembrane transport (GO:0055085)|transport (GO:0006810)|zinc ion transmembrane transport (GO:0071577)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	zinc transporting ATPase activity (GO:0015633)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|pancreas(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCTGTGAAGAGACTGAGGCA	0.632																																					p.L33P		.											.	SLC30A3	90	0			c.T98C						.						35.0	41.0	39.0					2																	27481800		2203	4300	6503	SO:0001583	missense	7781	exon2			GTGAAGAGACTGA	U76010	CCDS1743.1	2p23.3	2013-05-22			ENSG00000115194	ENSG00000115194		"""Solute carriers"""	11014	protein-coding gene	gene with protein product		602878		ZNT3		8962159	Standard	NM_003459		Approved		uc002rjj.3	Q99726	OTTHUMG00000128409	ENST00000233535.4:c.98T>C	2.37:g.27481800A>G	ENSP00000233535:p.Leu33Pro	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	4.0	NM_003459	Q8TC03	Missense_Mutation	SNP	ENST00000233535.4	37	CCDS1743.1	.	.	.	.	.	.	.	.	.	.	A	17.88	3.496416	0.64186	.	.	ENSG00000115194	ENST00000233535;ENST00000447008;ENST00000426924;ENST00000424577	T;T;T;T	0.81163	-0.32;-0.4;-1.18;-1.46	5.02	5.02	0.67125	.	0.000000	0.49305	D	0.000159	T	0.67069	0.2854	N	0.19112	0.55	0.53688	D	0.999975	B;B	0.20550	0.046;0.027	B;B	0.20184	0.028;0.012	T	0.62728	-0.6793	10	0.28530	T	0.3	-25.7601	11.4202	0.49976	1.0:0.0:0.0:0.0	.	28;33	F5H3B7;Q99726	.;ZNT3_HUMAN	P	33;28;20;11	ENSP00000233535:L33P;ENSP00000415226:L28P;ENSP00000393545:L20P;ENSP00000403959:L11P	ENSP00000233535:L33P	L	-	2	0	SLC30A3	27335304	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.470000	0.53100	2.008000	0.58898	0.459000	0.35465	CTC	.		0.632	SLC30A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250189.2		
SMNDC1	10285	hgsc.bcm.edu;bcgsc.ca	37	10	112063340	112063340	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr10:112063340T>C	ENST00000369603.5	-	2	209	c.6A>G	c.(4-6)tcA>tcG	p.S2S	SMNDC1_ENST00000471297.1_5'UTR|SMNDC1_ENST00000369592.1_Silent_p.S2S	NM_005871.3	NP_005862.1	O75940	SPF30_HUMAN	survival motor neuron domain containing 1	2					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	4		Breast(234;0.174)		Epithelial(162;6.86e-05)|all cancers(201;0.00149)|BRCA - Breast invasive adenocarcinoma(275;0.119)		CTAAATCCTCTGACATCTAGG	0.383																																					p.S2S		.											.	SMNDC1	91	0			c.A6G						.						63.0	64.0	64.0					10																	112063340		2203	4300	6503	SO:0001819	synonymous_variant	10285	exon2			ATCCTCTGACATC	AF083385	CCDS7565.1	10q23	2013-01-23			ENSG00000119953	ENSG00000119953		"""Tudor domain containing"""	16900	protein-coding gene	gene with protein product	"""splicing factor 30, survival of motor neuron-related"", ""tudor domain containing 16C"""	603519				9731529, 9817934	Standard	NM_005871		Approved	SPF30, SMNR, TDRD16C	uc001kzc.4	O75940	OTTHUMG00000019036	ENST00000369603.5:c.6A>G	10.37:g.112063340T>C		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_005871	B2RA27|D3DRB1|Q5T3K6	Silent	SNP	ENST00000369603.5	37	CCDS7565.1																																																																																			.		0.383	SMNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050325.2	NM_005871	
SNX13	23161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	17933019	17933019	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr7:17933019G>A	ENST00000409389.1	-	3	336	c.164C>T	c.(163-165)tCa>tTa	p.S55L	SNX13_ENST00000409604.1_Missense_Mutation_p.S55L|SNX13_ENST00000428135.3_Missense_Mutation_p.S55L			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	55					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					GTACTTCTCTGAGTTTGTTTT	0.338																																					p.S55L		.											.	SNX13	650	0			c.C164T						.						44.0	40.0	41.0					7																	17933019		1814	4067	5881	SO:0001583	missense	23161	exon3			TTCTCTGAGTTTG	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.164C>T	7.37:g.17933019G>A	ENSP00000386705:p.Ser55Leu	Somatic	229.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	41.0	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	ENST00000409389.1	37		.	.	.	.	.	.	.	.	.	.	G	28.8	4.949072	0.92660	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044;ENST00000409604	T;T	0.18810	2.19;2.46	5.71	5.71	0.89125	.	0.125660	0.56097	D	0.000026	T	0.36853	0.0982	L	0.34521	1.04	0.80722	D	1	D;P;P	0.63880	0.993;0.553;0.862	D;B;P	0.72338	0.977;0.142;0.607	T	0.01596	-1.1316	10	0.27785	T	0.31	-9.9993	19.4828	0.95017	0.0:0.0:1.0:0.0	.	55;55;55	Q9NSH0;B8ZZT9;Q9Y5W8-2	.;.;.	L	55;55;103;55	ENSP00000386705:S55L;ENSP00000398789:S55L	ENSP00000242044:S103L	S	-	2	0	SNX13	17899544	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.988000	0.93501	2.699000	0.92147	0.557000	0.71058	TCA	.		0.338	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	
SP4	6671	hgsc.bcm.edu;bcgsc.ca	37	7	21469063	21469063	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr7:21469063A>G	ENST00000222584.3	+	3	498	c.280A>G	c.(280-282)Aca>Gca	p.T94A		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	94					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						AGAACTGGTAACAACGCAACT	0.428																																					p.T94A		.											.	SP4	95	0			c.A280G						.						103.0	89.0	94.0					7																	21469063		2203	4300	6503	SO:0001583	missense	6671	exon3			CTGGTAACAACGC		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.280A>G	7.37:g.21469063A>G	ENSP00000222584:p.Thr94Ala	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	5.0	NM_003112	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	A	7.458	0.644180	0.14451	.	.	ENSG00000105866	ENST00000222584	T	0.08370	3.1	4.46	4.46	0.54185	.	0.051668	0.85682	D	0.000000	T	0.05502	0.0145	N	0.16166	0.38	0.43179	D	0.994991	P	0.38504	0.634	B	0.35607	0.206	T	0.52328	-0.8590	10	0.25106	T	0.35	.	13.9273	0.63970	1.0:0.0:0.0:0.0	.	94	Q02446	SP4_HUMAN	A	94	ENSP00000222584:T94A	ENSP00000222584:T94A	T	+	1	0	SP4	21435588	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	6.380000	0.73158	1.873000	0.54277	0.533000	0.62120	ACA	.		0.428	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
SPATS2L	26010	hgsc.bcm.edu;bcgsc.ca	37	2	201334662	201334662	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:201334662A>G	ENST00000358677.5	+	11	1230	c.983A>G	c.(982-984)gAc>gGc	p.D328G	SPATS2L_ENST00000460095.1_3'UTR|SPATS2L_ENST00000409755.3_Missense_Mutation_p.D358G|SPATS2L_ENST00000451764.2_Missense_Mutation_p.D328G|SPATS2L_ENST00000409988.3_Missense_Mutation_p.D328G|SPATS2L_ENST00000409718.1_Missense_Mutation_p.D328G|SPATS2L_ENST00000360760.5_Missense_Mutation_p.D259G|SPATS2L_ENST00000409385.1_Missense_Mutation_p.D268G|SPATS2L_ENST00000409140.3_Missense_Mutation_p.D328G|SPATS2L_ENST00000409151.1_Missense_Mutation_p.D336G	NM_001282735.1|NM_001282743.1|NM_001282744.1|NM_015535.2	NP_001269664.1|NP_001269672.1|NP_001269673.1|NP_056350.2	Q9NUQ6	SPS2L_HUMAN	spermatogenesis associated, serine-rich 2-like	328						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	10						CGTAAATATGACGAGGAGCTC	0.498																																					p.D328G		.											.	SPATS2L	48	0			c.A983G						.						59.0	57.0	58.0					2																	201334662		1892	4125	6017	SO:0001583	missense	26010	exon11			AATATGACGAGGA	AF193059	CCDS46483.1, CCDS46484.1, CCDS74621.1, CCDS74622.1	2q33.1	2009-06-12			ENSG00000196141	ENSG00000196141			24574	protein-coding gene	gene with protein product	"""DNA polymerase transactivated protein 6"""	613817				11230166	Standard	NM_001100422		Approved	DNAPTP6	uc002uvr.4	Q9NUQ6	OTTHUMG00000154589	ENST00000358677.5:c.983A>G	2.37:g.201334662A>G	ENSP00000351503:p.Asp328Gly	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	6.0	NM_001100423	A8K381|B4DRE6|B4DT67|B7WNZ7|Q53T22|Q8WV53|Q8WYG1|Q9NTW4	Missense_Mutation	SNP	ENST00000358677.5	37	CCDS46483.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138924	0.77775	.	.	ENSG00000196141	ENST00000409718;ENST00000358677;ENST00000409988;ENST00000409385;ENST00000451764;ENST00000360760;ENST00000409140;ENST00000409397;ENST00000409755;ENST00000409151	.	.	.	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000003	T	0.75852	0.3906	M	0.64170	1.965	0.48040	D	0.999577	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.997;0.998;0.997	T	0.78583	-0.2148	9	0.87932	D	0	-24.1067	13.6569	0.62344	1.0:0.0:0.0:0.0	.	358;259;328	B4DT67;Q9NUQ6-2;Q9NUQ6	.;.;SPS2L_HUMAN	G	328;328;328;268;328;259;328;259;358;336	.	ENSP00000351503:D328G	D	+	2	0	SPATS2L	201042907	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.160000	0.77495	2.218000	0.71995	0.533000	0.62120	GAC	.		0.498	SPATS2L-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336208.3	NM_015535	
STAU1	6780	hgsc.bcm.edu;bcgsc.ca	37	20	47740949	47740949	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr20:47740949T>C	ENST00000371856.2	-	7	1195	c.785A>G	c.(784-786)aAg>aGg	p.K262R	STAU1_ENST00000347458.5_Missense_Mutation_p.K181R|STAU1_ENST00000371828.3_Missense_Mutation_p.K187R|STAU1_ENST00000340954.7_Missense_Mutation_p.K181R|STAU1_ENST00000371792.1_Missense_Mutation_p.K181R|STAU1_ENST00000360426.4_Missense_Mutation_p.K181R|STAU1_ENST00000371802.1_Missense_Mutation_p.K187R	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	262					intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			GATTCTAGGCTTTACTCGTTC	0.423																																					p.K262R		.											.	STAU1	230	0			c.A785G						.						211.0	235.0	227.0					20																	47740949		2203	4300	6503	SO:0001583	missense	6780	exon7			CTAGGCTTTACTC		CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.785A>G	20.37:g.47740949T>C	ENSP00000360922:p.Lys262Arg	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	4.0	NM_017453	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Missense_Mutation	SNP	ENST00000371856.2	37	CCDS13414.1	.	.	.	.	.	.	.	.	.	.	T	11.44	1.639398	0.29157	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792;ENST00000437404	T;T;T;T;T;T;T;T	0.47528	1.37;1.38;1.38;1.38;1.38;1.37;1.4;0.84	5.33	4.22	0.49857	.	0.332870	0.35555	N	0.003134	T	0.38772	0.1053	L	0.49350	1.555	0.40451	D	0.980147	B;B	0.14012	0.009;0.0	B;B	0.15052	0.012;0.001	T	0.17471	-1.0368	10	0.18710	T	0.47	-8.297	9.9143	0.41425	0.0:0.0847:0.0:0.9153	.	262;187	O95793;Q5JW29	STAU1_HUMAN;.	R	187;181;262;181;181;181;187;181;187	ENSP00000360893:K187R;ENSP00000345425:K181R;ENSP00000360922:K262R;ENSP00000353604:K181R;ENSP00000323443:K181R;ENSP00000360867:K187R;ENSP00000360857:K181R;ENSP00000416779:K187R	ENSP00000345425:K181R	K	-	2	0	STAU1	47174356	1.000000	0.71417	0.994000	0.49952	0.814000	0.46013	2.733000	0.47360	0.854000	0.35336	0.528000	0.53228	AAG	.		0.423	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079633.1	NM_017453	
SUPT16H	11198	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	21829290	21829311	+	Frame_Shift_Del	DEL	TAATAATTCGGAAAGCATTCTG	TAATAATTCGGAAAGCATTCTG	-			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	TAATAATTCGGAAAGCATTCTG	TAATAATTCGGAAAGCATTCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr14:21829290_21829311delTAATAATTCGGAAAGCATTCTG	ENST00000216297.2	-	16	2193_2214	c.1855_1876delCAGAATGCTTTCCGAATTATTA	c.(1855-1878)cagaatgctttccgaattattaaafs	p.QNAFRIIK619fs		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	619					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TGTACTTCTTTAATAATTCGGAAAGCATTCTGAAGGTTCAAG	0.396																																					p.619_626del		.											.	SUPT16H	90	0			c.1855_1876del						.																																			SO:0001589	frameshift_variant	11198	exon16			CTTCTTTAATAAT	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.1855_1876delCAGAATGCTTTCCGAATTATTA	14.37:g.21829290_21829311delTAATAATTCGGAAAGCATTCTG	ENSP00000216297:p.Gln619fs	Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	9.0	NM_007192	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Frame_Shift_Del	DEL	ENST00000216297.2	37	CCDS9569.1																																																																																			.		0.396	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074025.2		
SYT4	6860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	18	40853607	40853607	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr18:40853607C>A	ENST00000255224.3	-	2	1155	c.787G>T	c.(787-789)Gga>Tga	p.G263*	SYT4_ENST00000590752.1_Nonsense_Mutation_p.G245*|SYT4_ENST00000586678.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	263	Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						AATTCAATTCCCGAGAGAGGA	0.328																																					p.G263X	NSCLC(85;81 1419 2855 22820 35912)	.											.	SYT4	132	0			c.G787T						.						42.0	45.0	44.0					18																	40853607		2195	4293	6488	SO:0001587	stop_gained	6860	exon2			CAATTCCCGAGAG	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.787G>T	18.37:g.40853607C>A	ENSP00000255224:p.Gly263*	Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	57.0	NM_020783	B4DEU3|Q9P2K4	Nonsense_Mutation	SNP	ENST00000255224.3	37	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	C	40	8.128881	0.98667	.	.	ENSG00000132872	ENST00000255224;ENST00000442661	.	.	.	5.72	5.72	0.89469	.	0.049066	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	.	.	.	X	263;68	.	ENSP00000255224:G263X	G	-	1	0	SYT4	39107605	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.729000	0.84864	2.865000	0.98341	0.655000	0.94253	GGA	.		0.328	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
TBC1D14	57533	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	7006574	7006574	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr4:7006574T>C	ENST00000409757.4	+	8	1398	c.1274T>C	c.(1273-1275)cTc>cCc	p.L425P	TBC1D14_ENST00000451522.2_Missense_Mutation_p.L145P|TBC1D14_ENST00000448507.1_Missense_Mutation_p.L425P|TBC1D14_ENST00000446947.2_Missense_Mutation_p.L38P|TBC1D14_ENST00000410031.1_Missense_Mutation_p.L197P	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	425	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						CTTCCAGAGCTCTTTGACATC	0.463																																					p.L425P		.											.	TBC1D14	92	0			c.T1274C						.						105.0	104.0	104.0					4																	7006574		2203	4300	6503	SO:0001583	missense	57533	exon8			CAGAGCTCTTTGA	AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1274T>C	4.37:g.7006574T>C	ENSP00000386921:p.Leu425Pro	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	4.0	NM_001113361	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	ENST00000409757.4	37	CCDS3394.2	.	.	.	.	.	.	.	.	.	.	T	24.7	4.563694	0.86335	.	.	ENSG00000132405	ENST00000448507;ENST00000409757;ENST00000410031;ENST00000451522;ENST00000439515;ENST00000446947	T;T;T;T;T;T	0.04317	3.65;3.65;3.65;3.65;3.65;3.65	5.27	5.27	0.74061	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.30230	0.0758	M	0.93507	3.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.987;0.992	T	0.33929	-0.9849	10	0.72032	D	0.01	-25.3524	14.5294	0.67915	0.0:0.0:0.0:1.0	.	38;145;425	F5GXK4;Q9P2M4-2;Q9P2M4	.;.;TBC14_HUMAN	P	425;425;197;145;44;38	ENSP00000404041:L425P;ENSP00000386921:L425P;ENSP00000386343:L197P;ENSP00000388886:L145P;ENSP00000389082:L44P;ENSP00000405875:L38P	ENSP00000386921:L425P	L	+	2	0	TBC1D14	7057475	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.393000	0.79851	2.198000	0.70561	0.533000	0.62120	CTC	.		0.463	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206981.3	NM_020773	
TBCK	93627	hgsc.bcm.edu;bcgsc.ca	37	4	107154200	107154200	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr4:107154200A>G	ENST00000273980.5	-	18	1981	c.1534T>C	c.(1534-1536)Tgt>Cgt	p.C512R	TBCK_ENST00000394708.2_Missense_Mutation_p.C512R|TBCK_ENST00000394706.3_Missense_Mutation_p.C473R|TBCK_ENST00000361687.4_Missense_Mutation_p.C449R|TBCK_ENST00000432496.2_Missense_Mutation_p.C512R					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						TACTGATGACAGCGAGGAATA	0.353																																					p.C512R		.											.	TBCK	336	0			c.T1534C						.						119.0	114.0	116.0					4																	107154200		2203	4300	6503	SO:0001583	missense	93627	exon17			GATGACAGCGAGG		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1534T>C	4.37:g.107154200A>G	ENSP00000273980:p.Cys512Arg	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_001163436		Missense_Mutation	SNP	ENST00000273980.5	37	CCDS54788.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.499858	0.85176	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708;ENST00000503516	T;T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81;3.67	5.55	5.55	0.83447	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.42765	0.1217	M	0.91920	3.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.54616	-0.8267	10	0.87932	D	0	.	15.7093	0.77612	1.0:0.0:0.0:0.0	.	512;473;449	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	R	512;512;449;473;512;42	ENSP00000273980:C512R;ENSP00000405847:C512R;ENSP00000355338:C449R;ENSP00000378196:C473R;ENSP00000378198:C512R;ENSP00000423834:C42R	ENSP00000273980:C512R	C	-	1	0	TBCK	107373649	1.000000	0.71417	0.994000	0.49952	0.956000	0.61745	9.141000	0.94612	2.111000	0.64477	0.533000	0.62120	TGT	.		0.353	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
TENM1	10178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	123654550	123654550	+	Silent	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chrX:123654550G>A	ENST00000371130.3	-	18	3181	c.3118C>T	c.(3118-3120)Cta>Tta	p.L1040L	TENM1_ENST00000422452.2_Silent_p.L1040L	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1040					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AGGATCCGTAGCAGGGTTTTA	0.483																																					p.L1040L		.											.	.	.	0			c.C3118T						.						86.0	78.0	81.0					X																	123654550		2203	4300	6503	SO:0001819	synonymous_variant	10178	exon18			TCCGTAGCAGGGT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3118C>T	X.37:g.123654550G>A		Somatic	325.0	1.0		WXS	Illumina HiSeq	Phase_I	79.0	56.0	NM_001163278	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																			.		0.483	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
TLR2	7097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	154625449	154625449	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr4:154625449G>A	ENST00000260010.6	+	1	2798	c.1390G>A	c.(1390-1392)Gtt>Att	p.V464I		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	464					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	AATTTTAGATGTTAGCAACAA	0.368																																					p.V464I		.											.	TLR2	523	0			c.G1390A						.						96.0	98.0	97.0					4																	154625449		2203	4300	6503	SO:0001583	missense	7097	exon3			TTAGATGTTAGCA	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.1390G>A	4.37:g.154625449G>A	ENSP00000260010:p.Val464Ile	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	44.0	NM_003264	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	ENST00000260010.6	37	CCDS3784.1	.	.	.	.	.	.	.	.	.	.	G	0.969	-0.700825	0.03279	.	.	ENSG00000137462	ENST00000260010	T	0.00816	5.66	5.42	-5.31	0.02730	.	0.347798	0.26927	N	0.021789	T	0.00784	0.0026	N	0.17838	0.53	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.40327	-0.9569	10	0.30078	T	0.28	.	16.5669	0.84601	0.1076:0.0701:0.8223:0.0	.	464	O60603	TLR2_HUMAN	I	464	ENSP00000260010:V464I	ENSP00000260010:V464I	V	+	1	0	TLR2	154844899	0.952000	0.32445	0.004000	0.12327	0.074000	0.17049	0.152000	0.16302	-1.581000	0.01642	-2.010000	0.00438	GTT	.		0.368	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365205.1		
TMEM126A	84233	hgsc.bcm.edu;bcgsc.ca	37	11	85367380	85367380	+	Silent	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:85367380A>G	ENST00000304511.2	+	5	532	c.423A>G	c.(421-423)aaA>aaG	p.K141K	TMEM126A_ENST00000532180.1_Silent_p.K71K|TMEM126A_ENST00000528105.1_Silent_p.K71K	NM_032273.3	NP_115649.1	Q9H061	T126A_HUMAN	transmembrane protein 126A	141					optic nerve development (GO:0021554)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(2)|stomach(1)	7		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				TACCACACAAAGGGAACATCT	0.358																																					p.K141K		.											.	TMEM126A	92	0			c.A423G						.						95.0	86.0	89.0					11																	85367380		2203	4298	6501	SO:0001819	synonymous_variant	84233	exon5			ACACAAAGGGAAC		CCDS8268.1, CCDS58165.1	11q14.1	2011-03-25			ENSG00000171202	ENSG00000171202			25382	protein-coding gene	gene with protein product		612988				11230166	Standard	NM_032273		Approved	DKFZp586C1924, OPA7	uc001par.3	Q9H061	OTTHUMG00000166975	ENST00000304511.2:c.423A>G	11.37:g.85367380A>G		Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_032273	B2R570|E9PI16	Silent	SNP	ENST00000304511.2	37	CCDS8268.1																																																																																			.		0.358	TMEM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392177.1	NM_032273	
TMEM132C	92293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	128899651	128899651	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr12:128899651A>G	ENST00000435159.2	+	2	460	c.460A>G	c.(460-462)Atg>Gtg	p.M154V		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	154						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						TTTCCACATCATGGGCAGAGA	0.552																																					p.M154V		.											.	TMEM132C	68	0			c.A460G						.						18.0	19.0	19.0					12																	128899651		692	1591	2283	SO:0001583	missense	92293	exon2			CACATCATGGGCA	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.460A>G	12.37:g.128899651A>G	ENSP00000410852:p.Met154Val	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	6.0	NM_001136103	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	37		.	.	.	.	.	.	.	.	.	.	G	0.005	-2.208375	0.00292	.	.	ENSG00000181234	ENST00000435159	T	0.09538	2.97	4.96	-0.417	0.12347	.	.	.	.	.	T	0.02342	0.0072	N	0.00642	-1.3	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45293	-0.9271	9	0.11182	T	0.66	.	4.7255	0.12939	0.1275:0.3468:0.4141:0.1117	.	154	Q8N3T6	T132C_HUMAN	V	154	ENSP00000410852:M154V	ENSP00000410852:M154V	M	+	1	0	TMEM132C	127465604	0.948000	0.32251	0.002000	0.10522	0.023000	0.10783	2.014000	0.40951	-0.595000	0.05828	-0.775000	0.03384	ATG	.		0.552	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
TMEM8B	51754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	35853674	35853674	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr9:35853674G>T	ENST00000377991.4	+	14	2271	c.1256G>T	c.(1255-1257)gGc>gTc	p.G419V	TMEM8B_ENST00000377988.2_Missense_Mutation_p.G419V	NM_001042589.2	NP_001036054.1	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B	419					cell-matrix adhesion (GO:0007160)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle (GO:0007346)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	7						CTCATTGCGGGCAGTGTGGGC	0.587																																					p.G419V		.											.	TMEM8B	91	0			c.G1256T						.						92.0	93.0	92.0					9																	35853674		1975	4142	6117	SO:0001583	missense	51754	exon13			TTGCGGGCAGTGT	BC043384	CCDS6595.1, CCDS43800.1	9p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000137103	ENSG00000137103			21427	protein-coding gene	gene with protein product	"""nasopharyngeal carcinoma expressed 6"""		"""chromosome 9 open reading frame 127"""	C9orf127		12918109, 8619474	Standard	NM_016446		Approved	NAG-5, NGX6	uc003zym.4	A6NDV4	OTTHUMG00000019885	ENST00000377991.4:c.1256G>T	9.37:g.35853674G>T	ENSP00000367230:p.Gly419Val	Somatic	289.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	65.0	NM_001042590	B3KQF3|O75539|Q49AB1|Q4KMX5|Q5TCW5|Q9HBY2|Q9P0U7	Missense_Mutation	SNP	ENST00000377991.4	37	CCDS43800.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200632	0.79015	.	.	ENSG00000137103	ENST00000377991;ENST00000377988	T;T	0.41400	1.0;1.0	5.49	5.49	0.81192	.	.	.	.	.	T	0.59770	0.2218	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.51196	-0.8736	9	0.15066	T	0.55	.	17.9596	0.89081	0.0:0.0:1.0:0.0	.	419	A6NDV4	TMM8B_HUMAN	V	419	ENSP00000367230:G419V;ENSP00000367227:G419V	ENSP00000367227:G419V	G	+	2	0	TMEM8B	35843674	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	6.635000	0.74295	2.583000	0.87209	0.555000	0.69702	GGC	.		0.587	TMEM8B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052388.2	NM_016446	
TRAPPC9	83696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	141381200	141381200	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr8:141381200G>A	ENST00000438773.2	-	8	1347	c.1214C>T	c.(1213-1215)gCg>gTg	p.A405V	TRAPPC9_ENST00000389328.4_Missense_Mutation_p.A503V|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.A396V	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	405					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CTTGAAGAACGCAGACTTGCG	0.582																																					p.A503V		.											.	TRAPPC9	228	0			c.C1508T						.						59.0	58.0	58.0					8																	141381200		2203	4300	6503	SO:0001583	missense	83696	exon8			AAGAACGCAGACT	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.1214C>T	8.37:g.141381200G>A	ENSP00000405060:p.Ala405Val	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	21.0	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	37	CCDS55278.1	.	.	.	.	.	.	.	.	.	.	G	36	5.641101	0.96693	.	.	ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773	.	.	.	5.65	5.65	0.86999	.	0.100710	0.64402	D	0.000002	T	0.78181	0.4243	M	0.73217	2.22	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;P;D	0.67103	0.941;0.903;0.949	T	0.79322	-0.1851	9	0.62326	D	0.03	.	17.9129	0.88939	0.0:0.0:1.0:0.0	.	405;396;503	Q96Q05;Q96Q05-3;Q96Q05-2	TPPC9_HUMAN;.;.	V	503;396;405	.	ENSP00000373978:A396V	A	-	2	0	TRAPPC9	141450382	1.000000	0.71417	0.892000	0.35008	0.903000	0.53119	9.330000	0.96422	2.663000	0.90544	0.455000	0.32223	GCG	.		0.582	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
TRIP11	9321	hgsc.bcm.edu;bcgsc.ca	37	14	92474090	92474090	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr14:92474090A>G	ENST00000267622.4	-	10	1794	c.1421T>C	c.(1420-1422)cTt>cCt	p.L474P		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	474					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CTCCAAATTAAGTCTTAAGTC	0.328			T	PDGFRB	AML																																p.L474P	Ovarian(84;609 1888 9852 42686)	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	TRIP11	1400	0			c.T1421C						.						147.0	138.0	141.0					14																	92474090		2202	4300	6502	SO:0001583	missense	9321	exon10			AAATTAAGTCTTA	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1421T>C	14.37:g.92474090A>G	ENSP00000267622:p.Leu474Pro	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	4.0	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	A	11.43	1.637705	0.29157	.	.	ENSG00000100815	ENST00000267622;ENST00000542257	T	0.61040	0.14	6.04	-3.19	0.05171	.	1.823300	0.02222	N	0.064106	T	0.45438	0.1342	L	0.50333	1.59	0.09310	N	0.999999	P;P	0.41569	0.755;0.718	B;B	0.37888	0.26;0.251	T	0.39143	-0.9628	10	0.30854	T	0.27	.	2.5457	0.04736	0.2409:0.1922:0.07:0.4969	.	210;474	F5H1Z0;Q15643	.;TRIPB_HUMAN	P	474;210	ENSP00000267622:L474P	ENSP00000267622:L474P	L	-	2	0	TRIP11	91543843	0.037000	0.19845	0.861000	0.33841	0.982000	0.71751	0.476000	0.22180	-0.130000	0.11599	0.459000	0.35465	CTT	.		0.328	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
TSC2	7249	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	2107122	2107122	+	Missense_Mutation	SNP	T	T	G	rs45517131|rs397515102		TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr16:2107122T>G	ENST00000219476.3	+	9	1421	c.791T>G	c.(790-792)cTt>cGt	p.L264R	TSC2_ENST00000350773.4_Missense_Mutation_p.L264R|TSC2_ENST00000401874.2_Missense_Mutation_p.L264R|TSC2_ENST00000439673.2_Missense_Mutation_p.L227R|TSC2_ENST00000353929.4_Missense_Mutation_p.L264R|TSC2_ENST00000568454.1_Missense_Mutation_p.L275R|TSC2_ENST00000382538.6_Missense_Mutation_p.L215R	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	264	Required for interaction with TSC1.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CGGAACCTCCTTGGCACCCAC	0.672			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.L264R		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	1908	0			c.T791G	GRCh37	CM090985	TSC2	M	rs45517131	.						40.0	28.0	32.0					16																	2107122		2080	4005	6085	SO:0001583	missense	7249	exon9	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	ACCTCCTTGGCAC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.791T>G	16.37:g.2107122T>G	ENSP00000219476:p.Leu264Arg	Somatic	251.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	5.0	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	.	22.1	4.243093	0.79912	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84;-1.84	4.65	4.65	0.58169	Armadillo-type fold (1);Tuberin, N-terminal (1);	0.000000	0.64402	D	0.000002	D	0.92090	0.7493	M	0.81497	2.545	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;0.999;0.999	D;D;D;D;D;D	0.97110	1.0;0.996;0.999;0.999;1.0;0.998	D	0.93167	0.6563	10	0.72032	D	0.01	-13.3355	14.3569	0.66742	0.0:0.0:0.0:1.0	.	215;227;264;264;264;264	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	R	264;264;264;227;215;264	ENSP00000219476:L264R;ENSP00000384468:L264R;ENSP00000248099:L264R;ENSP00000399232:L227R;ENSP00000371978:L215R;ENSP00000344383:L264R	ENSP00000219476:L264R	L	+	2	0	TSC2	2047123	1.000000	0.71417	0.994000	0.49952	0.931000	0.56810	7.730000	0.84881	1.857000	0.53885	0.459000	0.35465	CTT	.		0.672	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
TTLL2	83887	ucsc.edu;bcgsc.ca	37	6	167738685	167738685	+	Silent	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:167738685C>T	ENST00000239587.5	+	1	112	c.24C>T	c.(22-24)tcC>tcT	p.S8S		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	8					cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		ACCTGTGTTCCTCCACACAAA	0.652																																					p.S8S		.											.	TTLL2	92	0			c.C24T						.						55.0	50.0	51.0					6																	167738685		2184	4271	6455	SO:0001819	synonymous_variant	83887	exon1			GTGTTCCTCCACA	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.24C>T	6.37:g.167738685C>T		Somatic	94.0	1.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_031949	B2RB11|B3KS77|Q7Z6R8|Q86X22	Silent	SNP	ENST00000239587.5	37	CCDS5301.1																																																																																			.		0.652	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
UBQLN3	50613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5528949	5528949	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:5528949C>G	ENST00000311659.4	-	2	1987	c.1840G>C	c.(1840-1842)Gct>Cct	p.A614P	HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_5'Flank|HBE1_ENST00000380237.1_5'Flank	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	614	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.									NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGAAAGTGAGCCTCAGGCTGC	0.562																																					p.A614P	Ovarian(72;684 1260 12332 41642 52180)	.											.	UBQLN3	93	0			c.G1840C						.						59.0	64.0	62.0					11																	5528949		2201	4297	6498	SO:0001583	missense	50613	exon2			AGTGAGCCTCAGG	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1840G>C	11.37:g.5528949C>G	ENSP00000347997:p.Ala614Pro	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	29.0	NM_017481	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	CCDS7758.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964841	0.53507	.	.	ENSG00000175520	ENST00000311659	T	0.40476	1.03	5.14	-0.928	0.10448	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (1);UBA-like (1);	0.274307	0.25845	N	0.027932	T	0.31231	0.0790	L	0.50333	1.59	0.28172	N	0.928542	P	0.46395	0.877	B	0.38562	0.276	T	0.31223	-0.9951	10	0.72032	D	0.01	-1.2028	9.3221	0.37971	0.0:0.5256:0.0:0.4744	.	614	Q9H347	UBQL3_HUMAN	P	614	ENSP00000347997:A614P	ENSP00000347997:A614P	A	-	1	0	UBQLN3	5485525	0.990000	0.36364	0.683000	0.30040	0.969000	0.65631	1.652000	0.37313	-0.193000	0.10415	-0.136000	0.14681	GCT	.		0.562	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481	
UHRF1BP1	54887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	34831811	34831811	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr6:34831811C>T	ENST00000192788.5	+	15	3419	c.3248C>T	c.(3247-3249)gCa>gTa	p.A1083V	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.A1083V	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	1083							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						GAGGGGGTGGCAGCCCCAGTG	0.473																																					p.A1083V		.											.	UHRF1BP1	93	0			c.C3248T						.						73.0	80.0	78.0					6																	34831811		1977	4130	6107	SO:0001583	missense	54887	exon15			GGGTGGCAGCCCC	AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.3248C>T	6.37:g.34831811C>T	ENSP00000192788:p.Ala1083Val	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	17.0	NM_017754	Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	CCDS43455.1	.	.	.	.	.	.	.	.	.	.	C	9.151	1.016206	0.19355	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.17528	2.27;2.27	6.04	0.942	0.19525	.	1.000120	0.08080	N	1.000000	T	0.01730	0.0055	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48019	-0.9071	10	0.14252	T	0.57	-1.4049	6.3567	0.21404	0.0:0.507:0.1343:0.3586	.	1083	Q6BDS2	URFB1_HUMAN	V	1083	ENSP00000192788:A1083V;ENSP00000400628:A1083V	ENSP00000192788:A1083V	A	+	2	0	UHRF1BP1	34939789	0.000000	0.05858	0.066000	0.19879	0.615000	0.37417	0.611000	0.24268	0.439000	0.26476	0.561000	0.74099	GCA	.		0.473	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
UNC13C	440279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	54825124	54825124	+	Silent	SNP	T	T	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr15:54825124T>A	ENST00000260323.11	+	25	5556	c.5556T>A	c.(5554-5556)gtT>gtA	p.V1852V	UNC13C_ENST00000537900.1_Silent_p.V1850V|UNC13C_ENST00000545554.1_Silent_p.V1852V	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1852					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GTTTCCAGGTTATAATTGAAG	0.323																																					p.V1852V		.											.	UNC13C	51	0			c.T5556A						.						36.0	34.0	35.0					15																	54825124		1783	4049	5832	SO:0001819	synonymous_variant	440279	exon24			CCAGGTTATAATT	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5556T>A	15.37:g.54825124T>A		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	18.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	37	CCDS45264.1																																																																																			.		0.323	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
UNC45B	146862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33495162	33495162	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr17:33495162C>G	ENST00000268876.5	+	10	1331	c.1234C>G	c.(1234-1236)Ctg>Gtg	p.L412V	UNC45B_ENST00000433649.1_Missense_Mutation_p.L412V|UNC45B_ENST00000394570.2_Missense_Mutation_p.L412V|UNC45B_ENST00000591048.1_Missense_Mutation_p.L412V|RP11-799D4.3_ENST00000585646.1_RNA|UNC45B_ENST00000378449.1_Missense_Mutation_p.L412V	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	412					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				CCCCTTTGACCTGGGCAACCA	0.577																																					p.L412V		.											.	UNC45B	157	0			c.C1234G						.						99.0	81.0	87.0					17																	33495162		2203	4300	6503	SO:0001583	missense	146862	exon10			TTTGACCTGGGCA	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1234C>G	17.37:g.33495162C>G	ENSP00000268876:p.Leu412Val	Somatic	241.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	53.0	NM_001267052	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	C	1.551	-0.539168	0.04053	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.02	4.06	0.47325	Armadillo-like helical (1);Armadillo-type fold (1);	0.068819	0.64402	D	0.000019	T	0.18045	0.0433	N	0.05078	-0.115	0.27112	N	0.962358	B;B;B	0.23128	0.08;0.002;0.001	B;B;B	0.25140	0.058;0.01;0.012	T	0.25467	-1.0131	10	0.02654	T	1	-15.046	9.4724	0.38851	0.0:0.8216:0.0:0.1784	.	412;412;412	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	V	412	ENSP00000378071:L412V;ENSP00000268876:L412V;ENSP00000412840:L412V;ENSP00000367710:L412V	ENSP00000268876:L412V	L	+	1	2	UNC45B	30519275	0.987000	0.35691	1.000000	0.80357	0.994000	0.84299	0.642000	0.24735	1.484000	0.48361	-0.137000	0.14449	CTG	.		0.577	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
UNC80	285175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	210837964	210837964	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:210837964G>A	ENST00000439458.1	+	55	8439	c.8359G>A	c.(8359-8361)Gct>Act	p.A2787T	UNC80_ENST00000272845.6_Missense_Mutation_p.A2782T|UNC80_ENST00000539183.1_Missense_Mutation_p.A233T	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2787					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GGAAGGGCTGGCTGAGTCCAC	0.507																																					p.A2787T		.											.	UNC80	90	0			c.G8359A						.						61.0	69.0	67.0					2																	210837964		692	1591	2283	SO:0001583	missense	285175	exon55			GGGCTGGCTGAGT	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.8359G>A	2.37:g.210837964G>A	ENSP00000391088:p.Ala2787Thr	Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	42.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	33	5.242648	0.95272	.	.	ENSG00000144406	ENST00000439458;ENST00000272845;ENST00000333907;ENST00000539183	T;T	0.32515	1.45;1.46	5.0	5.0	0.66597	.	.	.	.	.	T	0.42854	0.1221	N	0.22421	0.69	0.52099	D	0.999942	D;D	0.67145	0.996;0.996	D;D	0.79784	0.993;0.987	T	0.22034	-1.0228	9	0.36615	T	0.2	.	18.8532	0.92241	0.0:0.0:1.0:0.0	.	2782;2787	C9J1U3;Q8N2C7	.;UNC80_HUMAN	T	2787;2782;313;233	ENSP00000391088:A2787T;ENSP00000272845:A2782T	ENSP00000272845:A2782T	A	+	1	0	UNC80	210546209	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.564000	0.98151	2.769000	0.95229	0.655000	0.94253	GCT	.		0.507	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
USP31	57478	hgsc.bcm.edu;bcgsc.ca	37	16	23093795	23093795	+	Silent	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr16:23093795A>G	ENST00000219689.7	-	12	1913	c.1914T>C	c.(1912-1914)ccT>ccC	p.P638P		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	289	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		TAAGCACATCAGGCAGAGTCC	0.478																																					p.P638P		.											.	USP31	663	0			c.T1914C						.						104.0	92.0	96.0					16																	23093795		2197	4300	6497	SO:0001819	synonymous_variant	57478	exon12			CACATCAGGCAGA	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.1914T>C	16.37:g.23093795A>G		Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000219689.7	37	CCDS10607.1																																																																																			.		0.478	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
VCL	7414	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	75871688	75871688	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr10:75871688G>A	ENST00000211998.4	+	19	2861	c.2767G>A	c.(2767-2769)Gtg>Atg	p.V923M	VCL_ENST00000417648.2_Intron|VCL_ENST00000372755.3_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	923	C-terminal tail.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					AGCCGCTGAGGTGGGTATAGG	0.542																																					p.V923M		.											.	VCL	93	0			c.G2767A						.						67.0	57.0	60.0					10																	75871688		2203	4300	6503	SO:0001583	missense	7414	exon19			GCTGAGGTGGGTA	M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.2767G>A	10.37:g.75871688G>A	ENSP00000211998:p.Val923Met	Somatic	155.0	1.0		WXS	Illumina HiSeq	Phase_I	103.0	26.0	NM_014000	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	37	CCDS7341.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828209	0.50845	.	.	ENSG00000035403	ENST00000211998;ENST00000415462;ENST00000436396	T;T	0.58210	0.77;0.35	6.04	4.97	0.65823	.	0.279620	0.25180	N	0.032534	T	0.38904	0.1058	N	0.08118	0	0.80722	D	1	B	0.23540	0.087	B	0.33042	0.157	T	0.32079	-0.9920	10	0.46703	T	0.11	.	16.2231	0.82269	0.0732:0.0:0.9268:0.0	.	923	P18206	VINC_HUMAN	M	923;830;595	ENSP00000211998:V923M;ENSP00000415489:V595M	ENSP00000211998:V923M	V	+	1	0	VCL	75541694	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.090000	0.71397	2.873000	0.98535	0.563000	0.77884	GTG	.		0.542	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000	
WDR33	55339	hgsc.bcm.edu;bcgsc.ca	37	2	128480841	128480841	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:128480841T>C	ENST00000322313.4	-	12	1435	c.1277A>G	c.(1276-1278)gAt>gGt	p.D426G		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	426					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TTCTACTCCATCTTCAGACAT	0.353																																					p.D426G		.											.	WDR33	90	0			c.A1277G						.						151.0	163.0	158.0					2																	128480841		2203	4300	6503	SO:0001583	missense	55339	exon12			ACTCCATCTTCAG		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.1277A>G	2.37:g.128480841T>C	ENSP00000325377:p.Asp426Gly	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	4.0	NM_018383	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	37	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	T	17.67	3.447507	0.63178	.	.	ENSG00000136709	ENST00000322313	D	0.90069	-2.61	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.92011	0.7469	L	0.47716	1.5	0.80722	D	1	D	0.63880	0.993	D	0.74674	0.984	D	0.91720	0.5388	10	0.42905	T	0.14	-14.7764	15.4363	0.75149	0.0:0.0:0.0:1.0	.	426	Q9C0J8	WDR33_HUMAN	G	426	ENSP00000325377:D426G	ENSP00000325377:D426G	D	-	2	0	WDR33	128197311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.259000	0.78381	2.091000	0.63221	0.533000	0.62120	GAT	.		0.353	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
XIRP2	129446	hgsc.bcm.edu;bcgsc.ca	37	2	168099632	168099632	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:168099632T>C	ENST00000409195.1	+	9	1819	c.1730T>C	c.(1729-1731)aTt>aCt	p.I577T	XIRP2_ENST00000409273.1_Missense_Mutation_p.I355T|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.I577T|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	402					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTGCAGTCCATTAGATGGATC	0.388																																					p.I577T		.											.	XIRP2	104	0			c.T1730C						.						68.0	67.0	68.0					2																	168099632		1909	4115	6024	SO:0001583	missense	129446	exon9			AGTCCATTAGATG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.1730T>C	2.37:g.168099632T>C	ENSP00000386840:p.Ile577Thr	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	5.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	T	14.90	2.673191	0.47781	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.22743	1.94;1.94;1.94	5.54	4.38	0.52667	.	0.338576	0.34986	N	0.003532	T	0.14960	0.0361	N	0.22421	0.69	0.38926	D	0.957832	P;B;B	0.35226	0.491;0.435;0.01	B;B;B	0.34536	0.185;0.116;0.005	T	0.07385	-1.0775	10	0.66056	D	0.02	-2.2586	11.1645	0.48535	0.0:0.0731:0.0:0.9269	.	402;402;355	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	T	577;577;355	ENSP00000386840:I577T;ENSP00000295237:I577T;ENSP00000387255:I355T	ENSP00000295237:I577T	I	+	2	0	XIRP2	167807878	1.000000	0.71417	0.900000	0.35374	0.979000	0.70002	4.141000	0.58038	0.936000	0.37367	0.533000	0.62120	ATT	.		0.388	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
ZDHHC21	340481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	14639974	14639974	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr9:14639974T>C	ENST00000380916.4	-	8	1007	c.541A>G	c.(541-543)Aga>Gga	p.R181G		NM_178566.4	NP_848661.1	Q8IVQ6	ZDH21_HUMAN	zinc finger, DHHC-type containing 21	181					hair follicle development (GO:0001942)|nitric oxide metabolic process (GO:0046209)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)|regulation of nitric-oxide synthase activity (GO:0050999)|sebaceous gland development (GO:0048733)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9				GBM - Glioblastoma multiforme(50;4.31e-06)		GCTGCTAGTCTCATTATGGCC	0.333																																					p.R181G		.											.	ZDHHC21	226	0			c.A541G						.						92.0	96.0	94.0					9																	14639974		2203	4297	6500	SO:0001583	missense	340481	exon8			CTAGTCTCATTAT	AF161360	CCDS6475.1	9p22.3	2010-02-09			ENSG00000175893	ENSG00000175893		"""Zinc fingers, DHHC-type"""	20750	protein-coding gene	gene with protein product		614605				19956733	Standard	NM_178566		Approved	HSPC097, DNZ1	uc003zlg.2	Q8IVQ6	OTTHUMG00000019573	ENST00000380916.4:c.541A>G	9.37:g.14639974T>C	ENSP00000370303:p.Arg181Gly	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	7.0	NM_178566	A8KA95|D3DRI7|Q5VWG1	Missense_Mutation	SNP	ENST00000380916.4	37	CCDS6475.1	.	.	.	.	.	.	.	.	.	.	T	18.10	3.549267	0.65311	.	.	ENSG00000175893	ENST00000380916	T	0.23754	1.89	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.37128	0.0992	L	0.44542	1.39	0.54753	D	0.99998	D	0.53462	0.96	P	0.61328	0.887	T	0.05599	-1.0875	10	0.36615	T	0.2	-6.1186	11.0856	0.48084	0.0:0.0:0.155:0.845	.	181	Q8IVQ6	ZDH21_HUMAN	G	181	ENSP00000370303:R181G	ENSP00000370303:R181G	R	-	1	2	ZDHHC21	14629974	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.047000	0.41269	1.852000	0.53769	0.477000	0.44152	AGA	.		0.333	ZDHHC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051748.2	NM_178566	
ZFP69	339559	hgsc.bcm.edu;bcgsc.ca	37	1	40961639	40961639	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr1:40961639T>C	ENST00000372706.1	+	6	2495	c.1489T>C	c.(1489-1491)Tgt>Cgt	p.C497R	RP11-656D10.3_ENST00000450713.1_RNA|ZFP69_ENST00000372705.3_Missense_Mutation_p.C497R			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ACCTTACGAATGTAACGAATG	0.393																																					p.C497R		.											.	.	.	0			c.T1489C						.						62.0	63.0	63.0					1																	40961639		2203	4300	6503	SO:0001583	missense	339559	exon6			TACGAATGTAACG	AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.1489T>C	1.37:g.40961639T>C	ENSP00000361791:p.Cys497Arg	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	7.0	NM_198494	Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	ENST00000372706.1	37	CCDS30686.1	.	.	.	.	.	.	.	.	.	.	T	18.60	3.658079	0.67586	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	D;D	0.85258	-1.96;-1.96	4.51	4.51	0.55191	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45361	D	0.000380	D	0.95778	0.8626	H	0.99619	4.66	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96792	0.9583	10	0.87932	D	0	-8.8513	12.4448	0.55645	0.0:0.0:0.0:1.0	.	497	Q49AA0	ZN642_HUMAN	R	497	ENSP00000361791:C497R;ENSP00000361790:C497R	ENSP00000361790:C497R	C	+	1	0	ZNF642	40734226	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.104000	0.71498	2.248000	0.74166	0.459000	0.35465	TGT	.		0.393	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019082.1	NM_198494	
ZNF143	7702	hgsc.bcm.edu;bcgsc.ca	37	11	9546829	9546829	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr11:9546829T>C	ENST00000396602.2	+	15	1848	c.1729T>C	c.(1729-1731)Tca>Cca	p.S577P	ZNF143_ENST00000299606.2_Missense_Mutation_p.S549P|ZNF143_ENST00000396597.3_Missense_Mutation_p.S546P|ZNF143_ENST00000530463.1_Missense_Mutation_p.S576P|ZNF143_ENST00000396604.1_Missense_Mutation_p.S576P	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	577					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		CCATACTGCCTCATCAGAAAT	0.428																																					p.S577P		.											.	ZNF143	90	0			c.T1729C						.						189.0	157.0	168.0					11																	9546829		2201	4294	6495	SO:0001583	missense	7702	exon15			ACTGCCTCATCAG	U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.1729T>C	11.37:g.9546829T>C	ENSP00000379847:p.Ser577Pro	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	5.0	NM_003442	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Missense_Mutation	SNP	ENST00000396602.2	37	CCDS7799.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.46|18.46	3.627818|3.627818	0.66901|0.66901	.|.	.|.	ENSG00000166478|ENSG00000166478	ENST00000447186|ENST00000396604;ENST00000396602;ENST00000530463;ENST00000396597;ENST00000299606	.|T;T;T;T;T	.|0.10573	.|2.86;2.87;2.86;2.88;2.89	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	.|0.095556	.|0.46442	.|D	.|0.000298	T|T	0.07863|0.07863	0.0197|0.0197	N|N	0.08118|0.08118	0|0	0.42671|0.42671	D|D	0.993519|0.993519	.|P;P;P	.|0.40476	.|0.718;0.596;0.596	.|B;B;B	.|0.43658	.|0.426;0.245;0.245	T|T	0.45644|0.45644	-0.9247|-0.9247	5|10	.|0.33940	.|T	.|0.23	.|.	11.8455|11.8455	0.52381|0.52381	0.0:0.0:0.146:0.854|0.0:0.0:0.146:0.854	.|.	.|546;576;577	.|P52747-2;E7ER34;P52747	.|.;.;ZN143_HUMAN	P|P	102|576;577;576;546;549	.|ENSP00000379849:S576P;ENSP00000379847:S577P;ENSP00000432154:S576P;ENSP00000379843:S546P;ENSP00000299606:S549P	.|ENSP00000299606:S549P	L|S	+|+	2|1	0|0	ZNF143|ZNF143	9503405|9503405	0.991000|0.991000	0.36638|0.36638	0.990000|0.990000	0.47175|0.47175	0.999000|0.999000	0.98932|0.98932	2.461000|2.461000	0.45040|0.45040	2.161000|2.161000	0.67846|0.67846	0.533000|0.533000	0.62120|0.62120	CTC|TCA	.		0.428	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
ZNF343	79175	hgsc.bcm.edu;bcgsc.ca	37	20	2465247	2465247	+	Silent	SNP	A	A	G			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr20:2465247A>G	ENST00000278772.4	-	6	847	c.360T>C	c.(358-360)tgT>tgC	p.C120C	RP4-734P14.4_ENST00000461548.1_Intron	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	120	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						GGAACTGCTGACAGGAGAAGG	0.468																																					p.C120C		.											.	ZNF343	92	0			c.T360C						.						90.0	93.0	92.0					20																	2465247		2203	4300	6503	SO:0001819	synonymous_variant	79175	exon6			CTGCTGACAGGAG	AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.360T>C	20.37:g.2465247A>G		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_024325	Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Silent	SNP	ENST00000278772.4	37	CCDS13028.1																																																																																			.		0.468	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077617.1	NM_024325	
ZNF385D	79750	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	21606170	21606170	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr3:21606170G>A	ENST00000281523.2	-	3	690	c.172C>T	c.(172-174)Ccg>Tcg	p.P58S	ZNF385D_ENST00000494118.1_5'UTR|ZNF385D-AS1_ENST00000412369.1_RNA	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	58						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P58T(1)		NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						TTCTGAATCGGGTCCATCTGT	0.358																																					p.P58S		.											.	ZNF385D	156	1	Substitution - Missense(1)	lung(1)	c.C172T						.						109.0	107.0	108.0					3																	21606170		2203	4300	6503	SO:0001583	missense	79750	exon3			GAATCGGGTCCAT	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.172C>T	3.37:g.21606170G>A	ENSP00000281523:p.Pro58Ser	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	4.0	NM_024697		Missense_Mutation	SNP	ENST00000281523.2	37	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977372	0.92982	.	.	ENSG00000151789	ENST00000281523	T	0.41400	1.0	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.64951	0.2645	M	0.61703	1.905	0.52099	D	0.99994	D	0.89917	1.0	D	0.80764	0.994	T	0.63157	-0.6700	10	0.59425	D	0.04	-3.427	20.3632	0.98871	0.0:0.0:1.0:0.0	.	58	Q9H6B1	Z385D_HUMAN	S	58	ENSP00000281523:P58S	ENSP00000281523:P58S	P	-	1	0	ZNF385D	21581174	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.866000	0.99616	2.826000	0.97356	0.561000	0.74099	CCG	.		0.358	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697	
ZNF479	90827	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	57188564	57188564	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr7:57188564T>A	ENST00000331162.4	-	5	828	c.558A>T	c.(556-558)aaA>aaT	p.K186N		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			ATTTGTTACATTTGAAATGTT	0.294																																					p.K186N		.											.	ZNF479	72	0			c.A558T						.						65.0	61.0	62.0					7																	57188564		1946	4161	6107	SO:0001583	missense	90827	exon5			GTTACATTTGAAA	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.558A>T	7.37:g.57188564T>A	ENSP00000333776:p.Lys186Asn	Somatic	339.0	0.0		WXS	Illumina HiSeq	Phase_I	335.0	89.0	NM_033273		Missense_Mutation	SNP	ENST00000331162.4	37	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	t	7.103	0.574544	0.13623	.	.	ENSG00000185177	ENST00000331162	T	0.58060	0.36	0.946	0.946	0.19549	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57844	0.2081	M	0.89904	3.07	0.09310	N	1	D	0.52996	0.957	P	0.45428	0.48	T	0.54820	-0.8236	9	0.66056	D	0.02	.	3.7264	0.08476	0.0:0.0:0.4015:0.5985	.	186	Q96JC4	ZN479_HUMAN	N	186	ENSP00000333776:K186N	ENSP00000333776:K186N	K	-	3	2	ZNF479	57192506	0.002000	0.14202	0.003000	0.11579	0.003000	0.03518	-1.201000	0.03026	0.339000	0.23719	0.329000	0.21502	AAA	.		0.294	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
ZNF638	27332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71592804	71592804	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr2:71592804G>T	ENST00000409544.1	+	6	2593	c.1963G>T	c.(1963-1965)Gtg>Ttg	p.V655L	ZNF638_ENST00000377802.2_Missense_Mutation_p.V655L|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000264447.4_Missense_Mutation_p.V655L|ZNF638_ENST00000355812.3_Missense_Mutation_p.V655L	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	655					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						ATGTAAACAGGTGTCTGATAA	0.363																																					p.V655L		.											.	ZNF638	94	0			c.G1963T						.						48.0	47.0	47.0					2																	71592804		2203	4300	6503	SO:0001583	missense	27332	exon6			AAACAGGTGTCTG	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1963G>T	2.37:g.71592804G>T	ENSP00000386433:p.Val655Leu	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	47.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	9.344	1.063785	0.20067	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000394137;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.72505	-0.07;-0.66;0.51;-0.06;1.51;1.51	5.69	-1.65	0.08291	.	1.967430	0.01694	N	0.026819	T	0.55305	0.1912	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B;B	0.23806	0.03;0.091;0.029;0.017;0.022;0.029	B;B;B;B;B;B	0.23574	0.005;0.047;0.012;0.025;0.017;0.011	T	0.36212	-0.9757	10	0.29301	T	0.29	2.5262	5.8202	0.18524	0.4791:0.1386:0.3823:0.0	.	655;761;655;655;655;655	A8K583;F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;.;ZN638_HUMAN;.	L	655;761;234;655;655;655;655	ENSP00000386669:V655L;ENSP00000438189:V761L;ENSP00000348066:V655L;ENSP00000367033:V655L;ENSP00000264447:V655L;ENSP00000386433:V655L	ENSP00000264447:V655L	V	+	1	0	ZNF638	71446312	0.002000	0.14202	0.014000	0.15608	0.821000	0.46438	-0.248000	0.08854	-0.135000	0.11495	0.563000	0.77884	GTG	.		0.363	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
ZNF81	347344	hgsc.bcm.edu;bcgsc.ca	37	X	47775710	47775710	+	Silent	SNP	T	T	C			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chrX:47775710T>C	ENST00000376954.1	+	6	2033	c.1665T>C	c.(1663-1665)gtT>gtC	p.V555V	ZNF81_ENST00000338637.7_Silent_p.V555V			P51508	ZNF81_HUMAN	zinc finger protein 81	555					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				AACCCTATGTTTGTGCTGATT	0.423																																					p.V555V		.											.	ZNF81	130	0			c.T1665C						.						55.0	54.0	54.0					X																	47775710		2148	4268	6416	SO:0001819	synonymous_variant	347344	exon5			CTATGTTTGTGCT	AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.1665T>C	X.37:g.47775710T>C		Somatic	211.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	4.0	NM_007137	Q6RX22|Q96QH6	Silent	SNP	ENST00000376954.1	37	CCDS43933.1																																																																																			.		0.423	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056455.2	NM_007137	
ZNF835	90485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57175497	57175497	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr19:57175497G>T	ENST00000537055.2	-	2	1301	c.1070C>A	c.(1069-1071)aCc>aAc	p.T357N		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CCGCTCTCCGGTGTGCGTGCG	0.697																																					p.T357N		.											.	ZNF835	72	0			c.C1070A						.						21.0	21.0	21.0					19																	57175497		2202	4293	6495	SO:0001583	missense	90485	exon2			TCTCCGGTGTGCG	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1070C>A	19.37:g.57175497G>T	ENSP00000444747:p.Thr357Asn	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	44.0	NM_001005850	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	37	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158278	0.78114	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.26067	1.76	2.15	1.04	0.20106	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29423	0.0733	L	0.49126	1.545	0.22001	N	0.999428	B	0.32188	0.359	B	0.41236	0.351	T	0.35475	-0.9787	9	0.62326	D	0.03	.	9.8689	0.41162	0.0:0.2131:0.7869:0.0	.	379	Q9Y2P0	ZN835_HUMAN	N	379;357	ENSP00000444747:T357N	ENSP00000341756:T379N	T	-	2	0	ZNF835	61867309	0.902000	0.30710	0.011000	0.14972	0.924000	0.55760	1.556000	0.36288	0.430000	0.26230	0.561000	0.74099	ACC	.		0.697	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
BRD7	29117	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	50367608	50367609	+	Splice_Site	DNP	CC	CC	AT			TCGA-DD-A39Z-01A-11D-A20W-10	TCGA-DD-A39Z-11A-21D-A20W-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b5d662f8-35c9-4f38-9e23-10cd6e522078	7dbbd52e-3044-4bd2-8839-4471df1bd1dc	g.chr16:50367608_50367609CC>AT	ENST00000394688.3	-	8	1047	c.888_888GG>AT	c.(886-888)aaGG>aaATg	p.K296K	BRD7_ENST00000394689.2_Splice_Site_p.K296K			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	296					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				CTTTGTCTTTCCTGAAAATATA	0.312																																					.		.											.	.	.	0			.						.																																			SO:0001630	splice_region_variant	29117	.			GTCTTTCCTGAAA	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.888_888delinsAT	16.37:g.50367608_50367609delinsAT		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	35.0	.	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Splice_Site	DNP	ENST00000394688.3	37	CCDS10742.1																																																																																			.		0.312	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	Silent
