#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCC10	89845	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	43413441	43413441	+	Silent	SNP	C	C	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:43413441C>A	ENST00000372530.4	+	15	3350	c.3135C>A	c.(3133-3135)atC>atA	p.I1045I	ABCC10_ENST00000244533.3_Silent_p.I1017I	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	1045	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	TCCTCAACATCCTCCTGGCCA	0.627																																					p.I1045I		.											.	ABCC10	96	0			c.C3135A						.						64.0	56.0	58.0					6																	43413441		2203	4300	6503	SO:0001819	synonymous_variant	89845	exon15			CAACATCCTCCTG	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.3135C>A	6.37:g.43413441C>A		Somatic	258.0	0.0		WXS	Illumina HiSeq	Phase_I	253.0	102.0	NM_001198934	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	ENST00000372530.4	37	CCDS56430.1																																																																																			.		0.627	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
ADAM11	4185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42854589	42854589	+	Silent	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr17:42854589G>C	ENST00000200557.6	+	21	1906	c.1737G>C	c.(1735-1737)ggG>ggC	p.G579G	ADAM11_ENST00000535346.1_Silent_p.G379G	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	579	Cys-rich.				integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				CGGAGCGTGGGAGCTGTGGGC	0.627																																					p.G579G		.											.	ADAM11	227	0			c.G1737C						.						54.0	54.0	54.0					17																	42854589		2203	4300	6503	SO:0001819	synonymous_variant	4185	exon21			GCGTGGGAGCTGT	D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.1737G>C	17.37:g.42854589G>C		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	19.0	NM_002390	Q14808|Q14809|Q14810	Silent	SNP	ENST00000200557.6	37	CCDS11486.1																																																																																			.		0.627	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
ADAMTS9	56999	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	64536638	64536638	+	Missense_Mutation	SNP	C	C	T	rs140575639		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:64536638C>T	ENST00000498707.1	-	31	5141	c.4799G>A	c.(4798-4800)cGg>cAg	p.R1600Q	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.R1572Q	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1600	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GTCCACCGGCCGCTTGCTCAC	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		13054	0.0		0.001	False		,,,				2504	0.0				p.R1600Q		.											.	ADAMTS9	230	0			c.G4799A						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	201.0	162.0	175.0		4799	5.7	1.0	3	dbSNP_134	175	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ADAMTS9	NM_182920.1	43	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	1600/1936	64536638	2,13004	2203	4300	6503	SO:0001583	missense	56999	exon31			ACCGGCCGCTTGC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4799G>A	3.37:g.64536638C>T	ENSP00000418735:p.Arg1600Gln	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	225.0	72.0	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	C|C	19.40|19.40	3.820190|3.820190	0.71028|0.71028	2.27E-4|2.27E-4	1.16E-4|1.16E-4	ENSG00000163638|ENSG00000163638	ENST00000481060|ENST00000295903;ENST00000498707	.|T;T	.|0.49720	.|0.77;0.77	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.59998|0.59998	0.2235|0.2235	M|M	0.69358|0.69358	2.11|2.11	0.80722|0.80722	D|D	1|1	.|P;D;P	.|0.69078	.|0.766;0.997;0.875	.|B;P;B	.|0.56514	.|0.354;0.8;0.354	T|T	0.60777|0.60777	-0.7196|-0.7196	5|10	.|0.49607	.|T	.|0.09	.|.	13.0587|13.0587	0.58996|0.58996	0.0:0.9265:0.0:0.0735|0.0:0.9265:0.0:0.0735	.|.	.|1572;1600;1600	.|B7ZVX9;Q9P2N4-1;Q9P2N4	.|.;.;ATS9_HUMAN	S|Q	656|1572;1600	.|ENSP00000295903:R1572Q;ENSP00000418735:R1600Q	.|ENSP00000295903:R1572Q	G|R	-|-	1|2	0|0	ADAMTS9|ADAMTS9	64511678|64511678	0.068000|0.068000	0.21057|0.21057	0.957000|0.957000	0.39632|0.39632	0.082000|0.082000	0.17680|0.17680	3.225000|3.225000	0.51246|0.51246	2.666000|2.666000	0.90696|0.90696	0.585000|0.585000	0.79938|0.79938	GGC|CGG	C|1.000;T|0.000		0.567	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
ADAMTSL3	57188	hgsc.bcm.edu;bcgsc.ca	37	15	84539614	84539614	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr15:84539614T>C	ENST00000286744.5	+	9	1087	c.863T>C	c.(862-864)gTc>gCc	p.V288A	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.V288A	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	288						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGCCCCGGCGTCTTTCTCGTA	0.378																																					p.V288A		.											.	ADAMTSL3	1153	0			c.T863C						.						61.0	67.0	65.0					15																	84539614		2203	4300	6503	SO:0001583	missense	57188	exon9			CCGGCGTCTTTCT	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.863T>C	15.37:g.84539614T>C	ENSP00000286744:p.Val288Ala	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	4.0	NM_207517	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	T	5.437	0.265673	0.10294	.	.	ENSG00000156218	ENST00000286744	T	0.62498	0.02	4.69	2.32	0.28847	.	1.314130	0.05205	N	0.505614	T	0.49115	0.1538	L	0.28458	0.855	0.09310	N	1	B;B	0.24483	0.032;0.104	B;B	0.28991	0.097;0.058	T	0.31223	-0.9951	10	0.09590	T	0.72	.	7.0714	0.25181	0.0:0.2726:0.0:0.7274	.	288;288	P82987-2;P82987	.;ATL3_HUMAN	A	288	ENSP00000286744:V288A	ENSP00000286744:V288A	V	+	2	0	ADAMTSL3	82330618	0.712000	0.27916	0.007000	0.13788	0.039000	0.13416	0.777000	0.26718	0.171000	0.19730	0.379000	0.24179	GTC	.		0.378	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
ADGB	79747	hgsc.bcm.edu;bcgsc.ca	37	6	147049711	147049711	+	Splice_Site	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:147049711A>G	ENST00000397944.3	+	20	2430	c.2354A>G	c.(2353-2355)gAg>gGg	p.E785G	ADGB_ENST00000367493.3_Splice_Site_p.E204G	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	785					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						TCTTCACAGGAGAGCTGCCGA	0.368																																					p.E785G		.											.	.	.	0			c.A2354G						.						194.0	174.0	180.0					6																	147049711		692	1591	2283	SO:0001630	splice_region_variant	79747	exon20			CACAGGAGAGCTG	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.2353-1A>G	6.37:g.147049711A>G		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	5.0	NM_024694	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	ENST00000397944.3	37		.	.	.	.	.	.	.	.	.	.	A	16.87	3.243186	0.58995	.	.	ENSG00000118492	ENST00000397944;ENST00000367493	T	0.70399	-0.48	5.59	5.59	0.84812	Globin, structural domain (1);	.	.	.	.	T	0.78059	0.4224	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.81378	-0.0960	9	0.72032	D	0.01	.	13.2875	0.60251	1.0:0.0:0.0:0.0	.	785	Q8N7X0	CAN7L_HUMAN	G	785;204	ENSP00000381036:E785G	ENSP00000356463:E204G	E	+	2	0	C6orf103	147091404	1.000000	0.71417	1.000000	0.80357	0.195000	0.23768	5.841000	0.69409	2.145000	0.66743	0.482000	0.46254	GAG	.		0.368	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	Missense_Mutation
AHNAK2	113146	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	14	105418939	105418939	+	Missense_Mutation	SNP	G	G	A	rs137934113	byFrequency	TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr14:105418939G>A	ENST00000333244.5	-	7	2968	c.2849C>T	c.(2848-2850)gCg>gTg	p.A950V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	950						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.A950V(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGTCACTTCCGCCTTGGGGCC	0.617													.|||	4	0.000798722	0.003	0.0	5008	,	,		17546	0.0		0.0	False		,,,				2504	0.0				p.A950V		.											.	AHNAK2	47	1	Substitution - Missense(1)	large_intestine(1)	c.C2849T						.						138.0	161.0	154.0					14																	105418939		1915	4109	6024	SO:0001583	missense	113146	exon7			ACTTCCGCCTTGG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2849C>T	14.37:g.105418939G>A	ENSP00000353114:p.Ala950Val	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	301.0	104.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	g	1.747	-0.490242	0.04322	.	.	ENSG00000185567	ENST00000333244	T	0.00902	5.56	2.43	-4.87	0.03123	.	.	.	.	.	T	0.00412	0.0013	N	0.05574	-0.02	0.09310	N	1	B	0.27068	0.167	B	0.33392	0.163	T	0.45542	-0.9254	9	0.10111	T	0.7	-1.06	5.6826	0.17784	0.4409:0.2058:0.3532:0.0	.	950	Q8IVF2	AHNK2_HUMAN	V	950	ENSP00000353114:A950V	ENSP00000353114:A950V	A	-	2	0	AHNAK2	104489984	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.938000	0.00684	-0.896000	0.03915	-1.797000	0.00622	GCG	G|0.998;A|0.002		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AIFM3	150209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	21328152	21328152	+	Silent	SNP	G	G	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr22:21328152G>T	ENST00000399167.2	+	4	591	c.351G>T	c.(349-351)gtG>gtT	p.V117V	AIFM3_ENST00000335375.5_Intron|AIFM3_ENST00000399163.2_Silent_p.V117V|AIFM3_ENST00000440238.2_Silent_p.V117V|AIFM3_ENST00000405089.1_Silent_p.V123V|AIFM3_ENST00000333607.6_Silent_p.V117V	NM_144704.2	NP_653305.1	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 3	117	Rieske. {ECO:0000255|PROSITE- ProRule:PRU00628}.				cell redox homeostasis (GO:0045454)|execution phase of apoptosis (GO:0097194)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	21	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CACCCCTGGTGAAAGGTGAGC	0.617																																					p.V123V		.											.	AIFM3	280	0			c.G369T						.						35.0	30.0	32.0					22																	21328152		2187	4291	6478	SO:0001819	synonymous_variant	150209	exon4			CCTGGTGAAAGGT	AK094844	CCDS13786.1, CCDS33605.1, CCDS54503.1	22q11.21	2007-05-03			ENSG00000183773	ENSG00000183773			26398	protein-coding gene	gene with protein product						15764604	Standard	NM_144704		Approved	AIFL, FLJ30473		Q96NN9	OTTHUMG00000150804	ENST00000399167.2:c.351G>T	22.37:g.21328152G>T		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	34.0	NM_001146288	B7WP37|D3DX37|D3DX38|Q6ZT44|Q8N1V3|Q8N5E0	Silent	SNP	ENST00000399167.2	37	CCDS13786.1																																																																																			.		0.617	AIFM3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320150.1	NM_144704	
ANKS1B	56899	hgsc.bcm.edu;bcgsc.ca	37	12	99129364	99129364	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:99129364T>C	ENST00000547776.2	-	26	3720	c.3721A>G	c.(3721-3723)Act>Gct	p.T1241A	ANKS1B_ENST00000549558.2_Missense_Mutation_p.T407A|ANKS1B_ENST00000547010.1_Missense_Mutation_p.T757A|ANKS1B_ENST00000329257.7_Missense_Mutation_p.T1241A|ANKS1B_ENST00000341752.7_Missense_Mutation_p.T247A	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	1241						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GCCTCCTCAGTGTGTCTCTCT	0.353																																					p.T1241A		.											.	.	.	0			c.A3721G						.						117.0	112.0	113.0					12																	99129364		1841	4094	5935	SO:0001583	missense	56899	exon26			CCTCAGTGTGTCT	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.3721A>G	12.37:g.99129364T>C	ENSP00000449629:p.Thr1241Ala	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	4.0	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.994346	0.35226	.	.	ENSG00000185046	ENST00000341752;ENST00000549558;ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702	T;T;T;T;T	0.64260	-0.09;-0.08;1.1;0.28;1.1	2.95	2.95	0.34219	.	1.415530	0.05657	U	0.586107	T	0.60560	0.2278	N	0.08118	0	0.22213	N	0.999284	P;P;P	0.52842	0.874;0.956;0.917	P;D;P	0.65010	0.641;0.931;0.878	T	0.56878	-0.7906	10	0.66056	D	0.02	0.4115	7.7143	0.28696	0.0:0.0:0.0:1.0	.	757;1241;407	Q7Z6G8-6;Q7Z6G8;Q7Z6G8-7	.;ANS1B_HUMAN;.	A	247;407;1241;757;1241;756	ENSP00000345510:T247A;ENSP00000448993:T407A;ENSP00000449629:T1241A;ENSP00000448512:T757A;ENSP00000331381:T1241A	ENSP00000331381:T1241A	T	-	1	0	ANKS1B	97653495	0.001000	0.12720	0.004000	0.12327	0.908000	0.53690	0.330000	0.19715	1.587000	0.49959	0.379000	0.24179	ACT	.		0.353	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
ANLN	54443	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	36445866	36445866	+	Silent	SNP	T	T	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr7:36445866T>G	ENST00000265748.2	+	4	785	c.564T>G	c.(562-564)ctT>ctG	p.L188L	ANLN_ENST00000396068.2_Silent_p.L188L	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	188	Nuclear localization.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						GACCTCTGCTTTCAAATGCCT	0.473																																					p.L188L		.											.	ANLN	517	0			c.T564G						.						75.0	76.0	76.0					7																	36445866		2203	4300	6503	SO:0001819	synonymous_variant	54443	exon4			TCTGCTTTCAAAT	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.564T>G	7.37:g.36445866T>G		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	44.0	NM_018685	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Silent	SNP	ENST00000265748.2	37	CCDS5447.1																																																																																			.		0.473	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685	
ARVCF	421	hgsc.bcm.edu;bcgsc.ca	37	22	19959474	19959474	+	Silent	SNP	G	G	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr22:19959474G>T	ENST00000263207.3	-	18	3007	c.2716C>A	c.(2716-2718)Cgg>Agg	p.R906R	ARVCF_ENST00000406522.1_Silent_p.R837R|ARVCF_ENST00000406259.1_Silent_p.R900R|ARVCF_ENST00000344269.3_Silent_p.R843R|ARVCF_ENST00000401994.1_Silent_p.R843R	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	906			R -> Q (in dbSNP:rs165815). {ECO:0000269|PubMed:19690332}.		calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					CGCTCCCTCCGGTCCACCGTG	0.637																																					p.R906R		.											.	ARVCF	91	0			c.C2716A						.						65.0	63.0	64.0					22																	19959474		2203	4300	6503	SO:0001819	synonymous_variant	421	exon18			CCCTCCGGTCCAC		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.2716C>A	22.37:g.19959474G>T		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	6.0	NM_001670	B7WNV2	Silent	SNP	ENST00000263207.3	37	CCDS13771.1																																																																																			.		0.637	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670	
ATP2A3	489	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	3854948	3854948	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr17:3854948G>C	ENST00000352011.3	-	4	305	c.251C>G	c.(250-252)aCc>aGc	p.T84S	ATP2A3_ENST00000309890.7_Missense_Mutation_p.T84S|ATP2A3_ENST00000359983.3_Missense_Mutation_p.T84S|ATP2A3_ENST00000397041.3_Missense_Mutation_p.T84S|ATP2A3_ENST00000397043.3_Missense_Mutation_p.T84S|ATP2A3_ENST00000397039.1_5'UTR|ATP2A3_ENST00000397035.3_Missense_Mutation_p.T84S			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	84					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		GGCGGTCGTGGTCTCCTCGCC	0.662																																					p.T84S	GBM(32;29 774 15719 37967)	.											.	ATP2A3	156	0			c.C251G						.						40.0	28.0	32.0					17																	3854948		2202	4300	6502	SO:0001583	missense	489	exon4			GTCGTGGTCTCCT		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.251C>G	17.37:g.3854948G>C	ENSP00000301387:p.Thr84Ser	Somatic	222.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	103.0	NM_174956	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	ENST00000352011.3	37	CCDS11041.1	.	.	.	.	.	.	.	.	.	.	G	8.608	0.888349	0.17540	.	.	ENSG00000074370	ENST00000397043;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	D;D;D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31;-2.31;-2.31	3.83	3.83	0.44106	ATPase, P-type,  transmembrane domain (1);	0.181563	0.32819	N	0.005615	T	0.77130	0.4085	N	0.19112	0.55	0.44523	D	0.997474	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001;0.001	T	0.72020	-0.4416	10	0.28530	T	0.3	.	12.8645	0.57932	0.0:0.1647:0.8353:0.0	.	84;84;84;84;84;84	Q93084-4;Q93084-2;Q93084;Q93084-6;G3XAE1;Q93084-3	.;.;AT2A3_HUMAN;.;.;.	S	84	ENSP00000380236:T84S;ENSP00000301387:T84S;ENSP00000353072:T84S;ENSP00000380234:T84S;ENSP00000312577:T84S;ENSP00000380229:T84S	ENSP00000312577:T84S	T	-	2	0	ATP2A3	3801697	1.000000	0.71417	0.992000	0.48379	0.977000	0.68977	5.506000	0.66993	2.125000	0.65367	0.514000	0.50259	ACC	.		0.662	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
B4GALNT4	338707	hgsc.bcm.edu;bcgsc.ca	37	11	376081	376081	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:376081T>C	ENST00000329962.6	+	12	1103	c.1103T>C	c.(1102-1104)cTg>cCg	p.L368P		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	368					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGGTGTACCTGTCCTTCGTT	0.672																																					p.L368P		.											.	B4GALNT4	91	0			c.T1103C						.						27.0	28.0	27.0					11																	376081		2197	4290	6487	SO:0001583	missense	338707	exon12			TGTACCTGTCCTT	AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.1103T>C	11.37:g.376081T>C	ENSP00000328277:p.Leu368Pro	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_178537	Q96LV2	Missense_Mutation	SNP	ENST00000329962.6	37	CCDS7694.1	.	.	.	.	.	.	.	.	.	.	t	17.34	3.363741	0.61513	.	.	ENSG00000182272	ENST00000329962	T	0.73152	-0.72	2.83	2.83	0.33086	.	0.286546	0.27636	N	0.018484	T	0.80166	0.4573	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.82078	-0.0635	10	0.87932	D	0	-10.2847	11.839	0.52342	0.0:0.0:0.0:1.0	.	368	Q76KP1	B4GN4_HUMAN	P	368	ENSP00000328277:L368P	ENSP00000328277:L368P	L	+	2	0	B4GALNT4	366081	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	5.765000	0.68834	1.533000	0.49186	0.358000	0.22013	CTG	.		0.672	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239289.2	NM_178537	
BAI2	576	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32207725	32207725	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:32207725G>A	ENST00000373658.3	-	8	1687	c.1346C>T	c.(1345-1347)gCg>gTg	p.A449V	BAI2_ENST00000527361.1_Missense_Mutation_p.A449V|BAI2_ENST00000398547.1_Missense_Mutation_p.A382V|BAI2_ENST00000398538.1_Missense_Mutation_p.A437V|BAI2_ENST00000257070.4_Missense_Mutation_p.A449V|BAI2_ENST00000440175.2_Missense_Mutation_p.A91V|BAI2_ENST00000398556.3_Missense_Mutation_p.A397V|BAI2_ENST00000398542.1_Missense_Mutation_p.A382V|BAI2_ENST00000373655.2_Missense_Mutation_p.A449V	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	449	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A449V(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGCTGGGCCCGCCACGCTGCA	0.657																																					p.A449V		.											.	BAI2	526	1	Substitution - Missense(1)	lung(1)	c.C1346T						.						30.0	35.0	33.0					1																	32207725		2201	4296	6497	SO:0001583	missense	576	exon8			GGGCCCGCCACGC	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.1346C>T	1.37:g.32207725G>A	ENSP00000362762:p.Ala449Val	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	60.0	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271041	0.59540	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62	4.1	3.17	0.36434	.	0.200067	0.24996	N	0.033949	T	0.38214	0.1032	N	0.17345	0.48	0.29032	N	0.885631	P;P;P;P;P;D;P	0.54964	0.89;0.936;0.936;0.709;0.89;0.969;0.89	P;B;B;B;B;P;P	0.48270	0.523;0.388;0.388;0.426;0.322;0.572;0.523	T	0.33369	-0.9871	10	0.54805	T	0.06	.	12.9627	0.58468	0.0:0.1647:0.8352:0.0	.	382;449;437;91;382;449;449	A2A3C3;O60241-4;O60241-3;B4DKC3;A2A3C1;O60241-2;O60241	.;.;.;.;.;.;BAI2_HUMAN	V	397;382;449;449;382;449;449;91;437;387;428	ENSP00000381564:A397V;ENSP00000381555:A382V;ENSP00000362762:A449V;ENSP00000362759:A449V;ENSP00000381550:A382V;ENSP00000257070:A449V;ENSP00000435397:A449V;ENSP00000391071:A91V;ENSP00000381548:A437V;ENSP00000410921:A387V;ENSP00000437219:A428V	ENSP00000257070:A449V	A	-	2	0	BAI2	31980312	1.000000	0.71417	0.918000	0.36340	0.806000	0.45545	9.594000	0.98254	1.049000	0.40321	0.561000	0.74099	GCG	.		0.657	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
C10orf40	283025	ucsc.edu;bcgsc.ca;mdanderson.org	37	10	61719043	61719043	+	5'UTR	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr10:61719043C>T	ENST00000521074.1	-	0	473				C10orf40_ENST00000444900.1_5'UTR|C10orf40_ENST00000430888.1_5'Flank					chromosome 10 open reading frame 40																		tctgtttctccagagctctgt	0.403																																					.		.											.	.	.	0			.						.																																			SO:0001623	5_prime_UTR_variant	283025	.			TTTCTCCAGAGCT	BC038741		10q21.3	2013-01-15			ENSG00000235931	ENSG00000235931			23524	other	unknown						12477932	Standard	NR_024340		Approved	AC023904.2	uc021prf.1	A4QN01	OTTHUMG00000018285	ENST00000521074.1:c.-614G>A	10.37:g.61719043C>T		Somatic	176.0	0.0		WXS	Illumina HiSeq	.	146.0	56.0	.		RNA	SNP	ENST00000521074.1	37																																																																																				.		0.403	C10orf40-002	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379562.1	NR_024340	
RTCB	51493	hgsc.bcm.edu;bcgsc.ca	37	22	32789991	32789991	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr22:32789991T>C	ENST00000216038.5	-	10	1278		c.e10-2		RTCB_ENST00000451746.2_Intron	NM_014306.4	NP_055121.1			RNA 2',3'-cyclic phosphate and 5'-OH ligase																		TCCAGTGAGCTGAGGATGCAC	0.403																																					.		.											.	C22orf28	90	0			c.1180-2A>G						.						111.0	98.0	102.0					22																	32789991		2203	4300	6503	SO:0001630	splice_region_variant	51493	exon11			GTGAGCTGAGGAT	BC016707	CCDS13905.1	22q12.3	2013-05-22	2013-05-22	2013-05-22	ENSG00000100220	ENSG00000100220	6.5.1.3		26935	protein-coding gene	gene with protein product	"""focal adhesion-associated protein"""	613901	"""chromosome 22 open reading frame 28"""	C22orf28		11042152, 21209330, 21311021	Standard	NM_014306		Approved	HSPC117, FAAP		Q9Y3I0	OTTHUMG00000030300	ENST00000216038.5:c.1180-2A>G	22.37:g.32789991T>C		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_014306		Splice_Site	SNP	ENST00000216038.5	37	CCDS13905.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.082258	0.76528	.	.	ENSG00000100220	ENST00000216038	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6325	0.68666	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	C22orf28	31119991	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	7.885000	0.87282	1.851000	0.53745	0.482000	0.46254	.	.		0.403	RTCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075188.3	NM_014306	Intron
C2orf42	54980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	70402864	70402864	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr2:70402864C>T	ENST00000264434.2	-	5	1359	c.980G>A	c.(979-981)aGt>aAt	p.S327N	C2orf42_ENST00000420306.1_Missense_Mutation_p.S327N	NM_017880.1	NP_060350.1	Q9NWW7	CB042_HUMAN	chromosome 2 open reading frame 42	327										endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	12						CCTTAGATTACTGCTCACTGC	0.408																																					p.S327N		.											.	C2orf42	90	0			c.G980A						.						215.0	212.0	213.0					2																	70402864		2203	4300	6503	SO:0001583	missense	54980	exon5			AGATTACTGCTCA	AK000565	CCDS1899.1	2p14	2011-03-08			ENSG00000115998	ENSG00000115998			26056	protein-coding gene	gene with protein product						12477932	Standard	XM_005264389		Approved	FLJ20558	uc002sgh.3	Q9NWW7	OTTHUMG00000129642	ENST00000264434.2:c.980G>A	2.37:g.70402864C>T	ENSP00000264434:p.Ser327Asn	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	42.0	NM_017880	D6W5G3|Q9H629	Missense_Mutation	SNP	ENST00000264434.2	37	CCDS1899.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.444671	0.43429	.	.	ENSG00000115998	ENST00000264434;ENST00000420306	D;D	0.93247	-3.19;-3.19	4.86	4.86	0.63082	.	0.448742	0.25596	N	0.029598	D	0.86793	0.6018	N	0.22421	0.69	0.26026	N	0.981805	B	0.33238	0.403	B	0.30029	0.11	T	0.78585	-0.2147	10	0.29301	T	0.29	-18.4621	13.335	0.60512	0.0:1.0:0.0:0.0	.	327	Q9NWW7	CB042_HUMAN	N	327	ENSP00000264434:S327N;ENSP00000404515:S327N	ENSP00000264434:S327N	S	-	2	0	C2orf42	70256368	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.937000	0.40193	2.516000	0.84829	0.491000	0.48974	AGT	.		0.408	C2orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251840.1	NM_017880	
C2orf47	79568	hgsc.bcm.edu;bcgsc.ca	37	2	200824539	200824539	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr2:200824539T>C	ENST00000392290.1	+	3	781	c.585T>C	c.(583-585)gcT>gcC	p.A195A	C2orf47_ENST00000295079.2_Silent_p.A195A|C2orf47_ENST00000469156.1_3'UTR			Q8WWC4	CB047_HUMAN	chromosome 2 open reading frame 47	195						mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|large_intestine(1)|lung(5)	9						ATGCCCTTGCTGCTAACATAG	0.358																																					p.A195A		.											.	C2orf47	90	0			c.T585C						.						115.0	105.0	108.0					2																	200824539		2203	4298	6501	SO:0001819	synonymous_variant	79568	exon4			CCTTGCTGCTAAC	BC017959	CCDS2329.1	2q33.1	2011-03-08			ENSG00000162972	ENSG00000162972			26198	protein-coding gene	gene with protein product						12477932	Standard	NM_024520		Approved	DKFZp666A212, FLJ22555	uc002uvm.3	Q8WWC4	OTTHUMG00000132771	ENST00000392290.1:c.585T>C	2.37:g.200824539T>C		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	4.0	NM_024520	Q658V9|Q9H671	Silent	SNP	ENST00000392290.1	37	CCDS2329.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.327125	0.24080	.	.	ENSG00000162972	ENST00000435773	.	.	.	5.97	4.83	0.62350	.	.	.	.	.	T	0.54515	0.1863	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53781	-0.8390	4	.	.	.	-12.2038	5.6195	0.17450	0.2446:0.0741:0.0:0.6813	.	.	.	.	P	188	.	.	L	+	2	0	C2orf47	200532784	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.608000	0.36847	2.277000	0.76020	0.482000	0.46254	CTG	.		0.358	C2orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256146.1	NM_024520	
C7orf66	154907	hgsc.bcm.edu;bcgsc.ca	37	7	108524086	108524086	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr7:108524086A>G	ENST00000379007.2	-	2	380	c.326T>C	c.(325-327)tTt>tCt	p.F109S		NM_001024607.1	NP_001019778.1	A4D0T2	CG066_HUMAN	chromosome 7 open reading frame 66	109						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	15						TTCCTTTGGAAAAGATTTTGC	0.323																																					p.F109S		.											.	C7orf66	92	0			c.T326C						.						115.0	108.0	110.0					7																	108524086		2203	4300	6503	SO:0001583	missense	154907	exon2			TTTGGAAAAGATT	AF103078	CCDS34735.1	7q31.1	2009-03-06			ENSG00000205174	ENSG00000205174			33712	protein-coding gene	gene with protein product							Standard	NM_001024607		Approved		uc003vfo.3	A4D0T2	OTTHUMG00000154867	ENST00000379007.2:c.326T>C	7.37:g.108524086A>G	ENSP00000368292:p.Phe109Ser	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_001024607		Missense_Mutation	SNP	ENST00000379007.2	37	CCDS34735.1	.	.	.	.	.	.	.	.	.	.	a	8.917	0.960139	0.18507	.	.	ENSG00000205174	ENST00000379007	.	.	.	3.62	-0.0197	0.13958	.	.	.	.	.	T	0.14442	0.0349	N	0.08118	0	0.09310	N	1	B	0.24963	0.115	B	0.21546	0.035	T	0.26467	-1.0102	7	.	.	.	.	3.2723	0.06886	0.5156:0.2404:0.244:0.0	.	109	A4D0T2	CG066_HUMAN	S	109	.	.	F	-	2	0	C7orf66	108311322	0.099000	0.21834	0.000000	0.03702	0.030000	0.12068	0.899000	0.28417	-0.009000	0.14296	0.451000	0.29950	TTT	.		0.323	C7orf66-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337420.1	NM_001024607	
CACNA1A	773	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	13394203	13394203	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:13394203G>A	ENST00000360228.5	-	22	3699	c.3700C>T	c.(3700-3702)Cgc>Tgc	p.R1234C	CACNA1A_ENST00000573710.2_Missense_Mutation_p.R1235C	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1235					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGCACAGGCGGCGAAGGCTG	0.547																																					p.R1235C		.											.	CACNA1A	67	0			c.C3703T						.						77.0	84.0	81.0					19																	13394203		2165	4263	6428	SO:0001583	missense	773	exon22			ACAGGCGGCGAAG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3700C>T	19.37:g.13394203G>A	ENSP00000353362:p.Arg1234Cys	Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	75.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816993	0.50633	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	T	0.42513	0.97	4.92	3.83	0.44106	.	0.063724	0.56097	D	0.000035	T	0.45296	0.1335	L	0.46670	1.46	0.53688	D	0.999979	D;D;D	0.76494	0.959;0.988;0.999	B;P;P	0.50490	0.241;0.576;0.642	T	0.51108	-0.8747	10	0.87932	D	0	.	13.4591	0.61217	0.0:0.0:0.8427:0.1573	.	1235;1238;1234	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	C	1234;1238;1235;1235	ENSP00000353362:R1234C	ENSP00000317661:R1235C	R	-	1	0	CACNA1A	13255203	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.503000	0.53340	2.301000	0.77427	0.561000	0.74099	CGC	.		0.547	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CASD1	64921	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	94166946	94166946	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr7:94166946A>G	ENST00000297273.4	+	9	1293	c.1006A>G	c.(1006-1008)Aat>Gat	p.N336D		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	336						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			AATTCATCGTAATGCTCATCG	0.343																																					p.N336D		.											.	CASD1	70	0			c.A1006G						.						99.0	106.0	104.0					7																	94166946		2203	4300	6503	SO:0001583	missense	64921	exon9			CATCGTAATGCTC	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1006A>G	7.37:g.94166946A>G	ENSP00000297273:p.Asn336Asp	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	230.0	45.0	NM_022900	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	ENST00000297273.4	37	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	A	11.12	1.544602	0.27563	.	.	ENSG00000127995	ENST00000297273	T	0.41400	1.0	5.27	4.08	0.47627	.	0.135452	0.64402	D	0.000003	T	0.25901	0.0631	N	0.08118	0	0.38203	D	0.940245	P;P	0.38711	0.643;0.643	B;B	0.40506	0.331;0.331	T	0.21965	-1.0230	10	0.35671	T	0.21	.	12.8372	0.57780	0.8208:0.1792:0.0:0.0	.	336;336	Q8WZ77;Q96PB1	.;CASD1_HUMAN	D	336	ENSP00000297273:N336D	ENSP00000297273:N336D	N	+	1	0	CASD1	94004882	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.296000	0.65698	2.124000	0.65301	0.482000	0.46254	AAT	.		0.343	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1	NM_022900	
CDC42BPG	55561	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	64598997	64598997	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:64598997G>A	ENST00000342711.5	-	28	3283	c.3284C>T	c.(3283-3285)aCg>aTg	p.T1095M	CDC42BPG_ENST00000491280.1_5'UTR	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						AGCGCAGAGCGTGTGAGGCAG	0.657											OREG0004016	type=REGULATORY REGION|Gene=CDC42BPG|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T1095M		.											.	CDC42BPG	528	0			c.C3284T						.						50.0	48.0	49.0					11																	64598997		2195	4290	6485	SO:0001583	missense	55561	exon28			CAGAGCGTGTGAG	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.3284C>T	11.37:g.64598997G>A	ENSP00000345133:p.Thr1095Met	Somatic	180.0	0.0	1077	WXS	Illumina HiSeq	Phase_I	241.0	29.0	NM_017525		Missense_Mutation	SNP	ENST00000342711.5	37	CCDS31601.1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991419	0.35131	.	.	ENSG00000171219	ENST00000342711	T	0.68765	-0.35	4.33	4.33	0.51752	Citron-like (1);	0.500739	0.16910	N	0.194528	T	0.60907	0.2305	L	0.39147	1.195	0.28328	N	0.921926	D	0.59767	0.986	B	0.43809	0.432	T	0.62201	-0.6904	10	0.66056	D	0.02	.	14.7225	0.69317	0.0:0.0:1.0:0.0	.	1095	Q6DT37	MRCKG_HUMAN	M	1095	ENSP00000345133:T1095M	ENSP00000345133:T1095M	T	-	2	0	CDC42BPG	64355573	0.898000	0.30612	0.439000	0.26833	0.277000	0.26821	5.264000	0.65513	2.416000	0.81992	0.467000	0.42956	ACG	.		0.657	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
CDH22	64405	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	20	44839091	44839091	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr20:44839091C>T	ENST00000372262.3	-	6	1541	c.1141G>A	c.(1141-1143)Gtg>Atg	p.V381M	CDH22_ENST00000537909.1_Missense_Mutation_p.V381M|CDH22_ENST00000474438.1_5'UTR	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	381	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GCCACGCGCACGATCGCCTGG	0.711																																					p.V381M		.											.	CDH22	95	0			c.G1141A						.						20.0	19.0	19.0					20																	44839091		2198	4294	6492	SO:0001583	missense	64405	exon7			CGCGCACGATCGC	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1141G>A	20.37:g.44839091C>T	ENSP00000361336:p.Val381Met	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	58.0	NM_021248	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721056	0.89205	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.55588	0.51;0.51	4.17	4.17	0.49024	Cadherin (3);Cadherin-like (1);	0.072247	0.56097	D	0.000034	T	0.75788	0.3897	H	0.96142	3.775	0.58432	D	0.999992	D	0.76494	0.999	P	0.60415	0.874	T	0.81920	-0.0712	10	0.87932	D	0	.	9.4414	0.38670	0.0:0.9025:0.0:0.0975	.	381	Q9UJ99	CAD22_HUMAN	M	381	ENSP00000361336:V381M;ENSP00000437790:V381M	ENSP00000361336:V381M	V	-	1	0	CDH22	44272498	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.776000	0.62354	2.171000	0.68590	0.555000	0.69702	GTG	.		0.711	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
CETP	1071	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	57005938	57005938	+	Silent	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr16:57005938C>T	ENST00000566128.1	+	8	765	c.498C>T	c.(496-498)gaC>gaT	p.D166D	CETP_ENST00000200676.3_Silent_p.D231D|CETP_ENST00000379780.2_Silent_p.D231D|CETP_ENST00000569082.1_3'UTR					cholesteryl ester transfer protein, plasma											NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(4)|skin(3)	23						TTGGGGTGGACATTTCCCTGA	0.597																																					p.D231D		.											.	CETP	91	0			c.C693T						.						113.0	92.0	99.0					16																	57005938		2198	4300	6498	SO:0001819	synonymous_variant	1071	exon8			GGTGGACATTTCC	M30185	CCDS10772.1, CCDS67032.1	16q13	2012-10-02			ENSG00000087237	ENSG00000087237		"""BPI fold containing"""	1869	protein-coding gene	gene with protein product	"""BPI fold containing family F"""	118470				3600759, 2334701	Standard	NM_000078		Approved	BPIFF	uc002eki.2	P11597	OTTHUMG00000133279	ENST00000566128.1:c.498C>T	16.37:g.57005938C>T		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	36.0	NM_000078		Silent	SNP	ENST00000566128.1	37																																																																																				.		0.597	CETP-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000432305.1	NM_000078	
CHD3	1107	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	7809999	7809999	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr17:7809999C>A	ENST00000330494.7	+	29	4637	c.4487C>A	c.(4486-4488)tCt>tAt	p.S1496Y	CHD3_ENST00000380358.4_Missense_Mutation_p.S1555Y|CHD3_ENST00000358181.4_Missense_Mutation_p.S1496Y|SCARNA21_ENST00000517026.1_RNA	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1496					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GGAGTCATGTCTCTCGTCAAA	0.557																																					p.S1555Y		.											.	CHD3	228	0			c.C4664A						.						99.0	95.0	96.0					17																	7809999		2203	4300	6503	SO:0001583	missense	1107	exon29			TCATGTCTCTCGT	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4487C>A	17.37:g.7809999C>A	ENSP00000332628:p.Ser1496Tyr	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	49.0	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041720	0.55003	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.91631	-2.88;-2.82;-2.81	4.69	4.69	0.59074	Domain of unknown function DUF1086 (1);	0.000000	0.44688	D	0.000435	D	0.95971	0.8688	M	0.78637	2.42	0.80722	D	1	D;D;D;D	0.76494	0.998;0.997;0.997;0.999	D;D;D;D	0.87578	0.998;0.994;0.996;0.998	D	0.96542	0.9401	10	0.87932	D	0	-14.2861	17.8077	0.88606	0.0:1.0:0.0:0.0	.	72;1496;1496;1555	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	Y	1555;1496;1496	ENSP00000369716:S1555Y;ENSP00000350907:S1496Y;ENSP00000332628:S1496Y	ENSP00000332628:S1496Y	S	+	2	0	CHD3	7750724	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.452000	0.66638	2.429000	0.82318	0.313000	0.20887	TCT	.		0.557	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
CNTN5	53942	hgsc.bcm.edu;bcgsc.ca	37	11	99715962	99715962	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:99715962T>C	ENST00000524871.1	+	6	835	c.545T>C	c.(544-546)aTt>aCt	p.I182T	CNTN5_ENST00000527185.1_Missense_Mutation_p.I182T|CNTN5_ENST00000279463.3_Missense_Mutation_p.I182T|CNTN5_ENST00000418526.2_Missense_Mutation_p.I108T|CNTN5_ENST00000528682.1_Missense_Mutation_p.I182T	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	182	Ig-like C2-type 1.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GTGGGGAGTATTCTTAGTAGA	0.343																																					p.I182T		.											.	CNTN5	366	0			c.T545C						.						141.0	132.0	135.0					11																	99715962		1828	4097	5925	SO:0001583	missense	53942	exon5			GGAGTATTCTTAG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.545T>C	11.37:g.99715962T>C	ENSP00000435637:p.Ile182Thr	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	4.0	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	T	16.99	3.273069	0.59649	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	5.8	5.8	0.92144	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.232270	0.43260	D	0.000584	T	0.68063	0.2960	L	0.46819	1.47	0.58432	D	0.999993	P;P;P	0.49447	0.924;0.697;0.924	P;B;P	0.53185	0.72;0.42;0.635	T	0.70791	-0.4776	10	0.66056	D	0.02	.	15.3151	0.74069	0.0:0.0:0.0:1.0	.	182;108;182	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	T	182;182;182;108;182	ENSP00000433575:I182T;ENSP00000436185:I182T;ENSP00000435637:I182T;ENSP00000393229:I108T;ENSP00000279463:I182T	ENSP00000279463:I182T	I	+	2	0	CNTN5	99221172	1.000000	0.71417	1.000000	0.80357	0.447000	0.32167	5.896000	0.69822	2.216000	0.71823	0.528000	0.53228	ATT	.		0.343	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
COL5A1	1289	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	137726974	137726974	+	Missense_Mutation	SNP	G	G	A	rs150608071		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr9:137726974G>A	ENST00000371817.3	+	65	5708	c.5294G>A	c.(5293-5295)cGc>cAc	p.R1765H		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1765	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AAGGCCCTCCGCTTCCTGGGC	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		16790	0.0		0.001	False		,,,				2504	0.0				p.R1765H		.											.	COL5A1	524	0			c.G5294A						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	89.0	70.0	76.0		5294	5.0	1.0	9	dbSNP_134	76	0,8600		0,0,4300	no	missense	COL5A1	NM_000093.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1765/1839	137726974	1,13005	2203	4300	6503	SO:0001583	missense	1289	exon65			CCCTCCGCTTCCT	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.5294G>A	9.37:g.137726974G>A	ENSP00000360882:p.Arg1765His	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	52.0	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612809	0.87258	2.27E-4	0.0	ENSG00000130635	ENST00000371817;ENST00000355306	T	0.74632	-0.86	5.03	5.03	0.67393	Fibrillar collagen, C-terminal (4);	0.000000	0.64402	U	0.000002	T	0.82263	0.4999	L	0.41961	1.31	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82165	-0.0592	10	0.44086	T	0.13	.	18.3643	0.90385	0.0:0.0:1.0:0.0	.	1765	P20908	CO5A1_HUMAN	H	1765;302	ENSP00000360882:R1765H	ENSP00000347458:R302H	R	+	2	0	COL5A1	136866795	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.659000	0.98597	2.340000	0.79590	0.561000	0.74099	CGC	G|1.000;A|0.000		0.657	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
BMI1	648	hgsc.bcm.edu;bcgsc.ca	37	10	22618212	22618212	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr10:22618212A>G	ENST00000376663.3	+	10	1227	c.722A>G	c.(721-723)gAt>gGt	p.D241G	COMMD3-BMI1_ENST00000602390.1_Missense_Mutation_p.D384G	NM_005180.8	NP_005171.4	P35226	BMI1_HUMAN	BMI1 proto-oncogene, polycomb ring finger	241					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|regulation of gene expression (GO:0010468)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|ubiquitin ligase complex (GO:0000151)	RING-like zinc finger domain binding (GO:0071535)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|urinary_tract(1)	12						CACCAGAGAGATGGACTGACA	0.438																																					p.D384G		.											.	.	.	0			c.A1151G						.						64.0	61.0	62.0					10																	22618212		2203	4300	6503	SO:0001583	missense	0	exon14			AGAGAGATGGACT	BC011652	CCDS7138.1	10p13	2014-06-26	2014-06-26	2006-04-26	ENSG00000168283	ENSG00000168283		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	1066	protein-coding gene	gene with protein product		164831	"""polycomb group ring finger 4"", ""B lymphoma Mo-MLV insertion region 1 homolog (mouse)"""	PCGF4		8268912	Standard	NM_005180		Approved	RNF51		P35226	OTTHUMG00000017807	ENST00000376663.3:c.722A>G	10.37:g.22618212A>G	ENSP00000365851:p.Asp241Gly	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	4.0	NM_001204062	Q16030|Q5T8Z3|Q96F37	Missense_Mutation	SNP	ENST00000376663.3	37	CCDS7138.1	.	.	.	.	.	.	.	.	.	.	A	13.30	2.195977	0.38806	.	.	ENSG00000168283	ENST00000376691;ENST00000376663;ENST00000443519	T;T	0.47869	1.44;0.83	5.68	5.68	0.88126	.	0.211158	0.52532	D	0.000079	T	0.24160	0.0585	N	0.02011	-0.69	0.52099	D	0.999949	B;B	0.22080	0.003;0.064	B;B	0.20767	0.004;0.031	T	0.12372	-1.0550	10	0.30854	T	0.27	-16.8412	14.7675	0.69651	1.0:0.0:0.0:0.0	.	241;241	Q5U0M5;P35226	.;BMI1_HUMAN	G	153;241;146	ENSP00000365851:D241G;ENSP00000390768:D146G	ENSP00000365851:D241G	D	+	2	0	BMI1	22658218	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.908000	0.75730	2.169000	0.68431	0.528000	0.53228	GAT	.		0.438	BMI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047176.1	NM_005180	
CRHR2	1395	ucsc.edu;bcgsc.ca	37	7	30705231	30705231	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr7:30705231G>T	ENST00000471646.1	-	4	757	c.340C>A	c.(340-342)Cgc>Agc	p.R114S	CRHR2_ENST00000506074.2_Missense_Mutation_p.R114S|CRHR2_ENST00000341843.4_Missense_Mutation_p.R100S|CRHR2_ENST00000348438.4_Missense_Mutation_p.R141S	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	114					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGGGCGATGCGGTAGTGCAGG	0.637																																					p.R141S		.											.	CRHR2	524	0			c.C421A						.						115.0	75.0	89.0					7																	30705231		2200	4286	6486	SO:0001583	missense	1395	exon5			CGATGCGGTAGTG		CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.340C>A	7.37:g.30705231G>T	ENSP00000418722:p.Arg114Ser	Somatic	401.0	1.0		WXS	Illumina HiSeq	.	598.0	92.0	NM_001202475	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	ENST00000471646.1	37	CCDS5429.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.325660	0.24080	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.02	3.05	0.35203	.	0.222920	0.44483	D	0.000459	T	0.14270	0.0345	N	0.08118	0	0.34175	D	0.670218	B;B;P;B;B	0.37158	0.021;0.036;0.585;0.298;0.021	B;B;B;B;B	0.36608	0.078;0.078;0.229;0.168;0.078	T	0.17077	-1.0381	10	0.09084	T	0.74	.	5.6412	0.17565	0.0953:0.0:0.6161:0.2886	.	113;114;141;100;114	B3SXT0;B3SXS6;Q13324-2;Q13324-3;Q13324	.;.;.;.;CRFR2_HUMAN	S	114;141;100;114	ENSP00000418722:R114S;ENSP00000340943:R141S;ENSP00000344304:R100S;ENSP00000426498:R114S	ENSP00000344304:R100S	R	-	1	0	CRHR2	30671756	0.890000	0.30428	0.917000	0.36280	0.202000	0.24057	1.119000	0.31258	1.422000	0.47177	0.655000	0.94253	CGC	.		0.637	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250448.3		
CSMD1	64478	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	2820095	2820095	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr8:2820095T>A	ENST00000520002.1	-	62	10079	c.9524A>T	c.(9523-9525)aAg>aTg	p.K3175M	CSMD1_ENST00000542608.1_Missense_Mutation_p.K2997M|CSMD1_ENST00000602723.1_Missense_Mutation_p.K2998M|CSMD1_ENST00000400186.3_Missense_Mutation_p.K2998M|CSMD1_ENST00000537824.1_Missense_Mutation_p.K3174M|CSMD1_ENST00000602557.1_Missense_Mutation_p.K3175M			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3175	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GACTTCGGACTTATAGGTGAA	0.522																																					p.K3174M		.											.	CSMD1	86	0			c.A9521T						.						57.0	56.0	56.0					8																	2820095		1897	4120	6017	SO:0001583	missense	64478	exon61			TCGGACTTATAGG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9524A>T	8.37:g.2820095T>A	ENSP00000430733:p.Lys3175Met	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	42.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.95|11.95	1.791085|1.791085	0.31685|0.31685	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.66280|.	-0.2;-0.2;-0.2;-0.2|.	5.6|5.6	0.158|0.158	0.14942|0.14942	Complement control module (2);Sushi/SCR/CCP (3);|.	0.208600|.	0.38436|.	N|.	0.001684|.	T|.	0.52581|.	0.1743|.	M|M	0.73217|0.73217	2.22|2.22	0.09310|0.09310	N|N	1|1	P;P;P|.	0.50617|.	0.912;0.779;0.937|.	P;P;P|.	0.57371|.	0.65;0.608;0.819|.	T|.	0.48210|.	-0.9055|.	10|.	0.54805|.	T|.	0.06|.	.|.	9.5169|9.5169	0.39111|0.39111	0.0:0.4619:0.0:0.5381|0.0:0.4619:0.0:0.5381	.|.	3175;3175;2997|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	M|Y	2998;3175;3036;3174;2997|2591	ENSP00000383047:K2998M;ENSP00000430733:K3175M;ENSP00000441462:K3174M;ENSP00000446243:K2997M|.	ENSP00000320445:K3036M|.	K|X	-|-	2|3	0|2	CSMD1|CSMD1	2807502|2807502	0.005000|0.005000	0.15991|0.15991	0.006000|0.006000	0.13384|0.13384	0.123000|0.123000	0.20343|0.20343	0.317000|0.317000	0.19487|0.19487	0.101000|0.101000	0.17610|0.17610	0.533000|0.533000	0.62120|0.62120	AAG|TAA	.		0.522	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSMD2	114784	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	34011768	34011768	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:34011768C>T	ENST00000373381.4	-	57	9145	c.8969G>A	c.(8968-8970)cGt>cAt	p.R2990H		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2963	Sushi 22. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2846H(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTCCCCCAAACGGATGCCATG	0.567																																					p.R2846H		.											.	CSMD2	103	1	Substitution - Missense(1)	prostate(1)	c.G8537A						.						59.0	53.0	55.0					1																	34011768		2203	4300	6503	SO:0001583	missense	114784	exon56			CCCAAACGGATGC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8969G>A	1.37:g.34011768C>T	ENSP00000362479:p.Arg2990His	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	45.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	C	20.8	4.056281	0.76074	.	.	ENSG00000121904	ENST00000373381	T	0.64803	-0.12	4.97	4.97	0.65823	Complement control module (2);Sushi/SCR/CCP (3);	0.061352	0.64402	D	0.000003	T	0.67664	0.2917	M	0.69523	2.12	0.80722	D	1	P;B	0.46457	0.878;0.139	P;B	0.46339	0.513;0.072	T	0.68685	-0.5343	10	0.36615	T	0.2	.	17.4042	0.87469	0.0:1.0:0.0:0.0	.	2846;2990	Q7Z408;E7EUA6	CSMD2_HUMAN;.	H	2990	ENSP00000362479:R2990H	ENSP00000241312:R2846H	R	-	2	0	CSMD2	33784355	1.000000	0.71417	0.951000	0.38953	0.596000	0.36781	7.629000	0.83207	2.591000	0.87537	0.650000	0.86243	CGT	.		0.567	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
CWH43	80157	hgsc.bcm.edu;bcgsc.ca	37	4	49063874	49063874	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:49063874T>A	ENST00000226432.4	+	16	2250	c.2067T>A	c.(2065-2067)caT>caA	p.H689Q	CWH43_ENST00000513409.1_Missense_Mutation_p.H662Q	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	689			H -> N (in dbSNP:rs1051447). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						ACAACCATCATTTTCATATGA	0.249																																					p.H689Q		.											.	CWH43	93	0			c.T2067A						.						28.0	26.0	27.0					4																	49063874		2183	4238	6421	SO:0001583	missense	80157	exon16			CCATCATTTTCAT		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.2067T>A	4.37:g.49063874T>A	ENSP00000226432:p.His689Gln	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	7.0	NM_025087	B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	37	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.112985	0.37242	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.41758	1.58;0.99	4.59	2.18	0.27775	.	0.209202	0.34025	N	0.004323	T	0.40909	0.1136	L	0.43152	1.355	0.36487	D	0.868185	D	0.56746	0.977	P	0.53593	0.73	T	0.41610	-0.9499	9	.	.	.	.	6.0925	0.20003	0.0:0.2:0.0:0.8	.	689	Q9H720	PG2IP_HUMAN	Q	689;662	ENSP00000226432:H689Q;ENSP00000422802:H662Q	.	H	+	3	2	CWH43	48758631	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.024000	0.30077	0.520000	0.28426	-0.379000	0.06801	CAT	.		0.249	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	
DDX43	55510	hgsc.bcm.edu;bcgsc.ca	37	6	74125911	74125911	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:74125911A>G	ENST00000370336.4	+	16	2067	c.1909A>G	c.(1909-1911)Atg>Gtg	p.M637V	MB21D1_ENST00000370318.1_Intron	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	637					ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						GGAAAGAAAAATGGAAAGACC	0.378																																					p.M637V		.											.	DDX43	229	0			c.A1909G						.						112.0	111.0	112.0					6																	74125911		2203	4300	6503	SO:0001583	missense	55510	exon16			AGAAAAATGGAAA		CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.1909A>G	6.37:g.74125911A>G	ENSP00000359361:p.Met637Val	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_018665	B4E0C8|Q6NXR1	Missense_Mutation	SNP	ENST00000370336.4	37	CCDS4977.1	.	.	.	.	.	.	.	.	.	.	A	6.548	0.469322	0.12461	.	.	ENSG00000080007	ENST00000370336	T	0.14266	2.52	5.26	-0.547	0.11836	.	0.548016	0.18229	N	0.147631	T	0.02119	0.0066	L	0.36672	1.1	0.23581	N	0.997368	B	0.15719	0.014	B	0.12837	0.008	T	0.45175	-0.9279	10	0.16896	T	0.51	-8.7957	2.6132	0.04897	0.3832:0.0897:0.0848:0.4424	.	637	Q9NXZ2	DDX43_HUMAN	V	637	ENSP00000359361:M637V	ENSP00000359361:M637V	M	+	1	0	DDX43	74182632	0.000000	0.05858	0.995000	0.50966	0.973000	0.67179	-0.607000	0.05648	0.085000	0.17107	0.482000	0.46254	ATG	.		0.378	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041219.3	NM_018665	
DIO2	1734	ucsc.edu;bcgsc.ca;mdanderson.org	37	14	80669460	80669460	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr14:80669460T>A	ENST00000557010.1	-	4	779	c.394A>T	c.(394-396)Act>Tct	p.T132S	DIO2_ENST00000422005.3_Missense_Mutation_p.T132S|DIO2_ENST00000555750.1_Missense_Mutation_p.T168S|DIO2_ENST00000557125.1_Intron|DIO2_ENST00000438257.4_Missense_Mutation_p.T132S	NM_000793.5|NM_001242502.1|NM_001242503.1	NP_000784.2|NP_001229431.1|NP_001229432.1	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	132					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		GGAGGTCAAGTGGCTGAGCCA	0.557											OREG0022848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	DIO2	22	0			.						.						52.0	56.0	55.0					14																	80669460		2067	4222	6289	SO:0001583	missense	1734	.			GTCAAGTGGCTGA	AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557010.1:c.394A>T	14.37:g.80669460T>A	ENSP00000451419:p.Thr132Ser	Somatic	99.0	0.0	1200	WXS	Illumina HiSeq	.	116.0	44.0	.	B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Missense_Mutation	SNP	ENST00000557010.1	37	CCDS45146.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.019487	0.75275	.	.	ENSG00000211448	ENST00000438257;ENST00000557010;ENST00000422005;ENST00000555750	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.63	5.63	0.86233	Thioredoxin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.61553	0.2356	M	0.62209	1.925	0.42717	D	0.993664	P;D;P	0.76494	0.884;0.999;0.884	B;D;P	0.79108	0.41;0.992;0.54	T	0.60510	-0.7249	10	0.37606	T	0.19	.	15.8957	0.79333	0.0:0.0:0.0:1.0	.	168;132;168	Q92813-2;Q92813;G3V315	.;IOD2_HUMAN;.	S	132;132;132;168	ENSP00000405854:T132S;ENSP00000451419:T132S;ENSP00000411438:T132S;ENSP00000450980:T168S	ENSP00000411438:T132S	T	-	1	0	DIO2	79739213	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	7.803000	0.85983	2.159000	0.67721	0.473000	0.43528	ACT	.		0.557	DIO2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000413428.2		
DMXL1	1657	hgsc.bcm.edu;bcgsc.ca	37	5	118569090	118569090	+	Silent	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:118569090A>G	ENST00000311085.8	+	38	8411	c.8331A>G	c.(8329-8331)caA>caG	p.Q2777Q	DMXL1_ENST00000505312.1_3'UTR|DMXL1_ENST00000539542.1_Silent_p.Q2798Q	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2777										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GCCATTCTCAACAAATAACCT	0.343																																					p.Q2777Q		.											.	DMXL1	92	0			c.A8331G						.						116.0	110.0	112.0					5																	118569090		2202	4300	6502	SO:0001819	synonymous_variant	1657	exon38			TTCTCAACAAATA	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8331A>G	5.37:g.118569090A>G		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	6.0	NM_005509		Silent	SNP	ENST00000311085.8	37	CCDS4125.1																																																																																			.		0.343	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
DNAH10	196385	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124323027	124323027	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:124323027C>A	ENST00000409039.3	+	28	4598	c.4573C>A	c.(4573-4575)Ccc>Acc	p.P1525T		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1525	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTTAAAAGACCCCGTGATCAA	0.552																																					p.P1525T		.											.	DNAH10	95	0			c.C4573A						.						41.0	43.0	42.0					12																	124323027		2010	4167	6177	SO:0001583	missense	196385	exon28			AAAGACCCCGTGA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.4573C>A	12.37:g.124323027C>A	ENSP00000386770:p.Pro1525Thr	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	19.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662236	0.47572	.	.	ENSG00000197653	ENST00000409039	T	0.62498	0.02	5.57	5.57	0.84162	Dynein heavy chain, domain-2 (1);	0.248516	0.33272	U	0.005089	T	0.66674	0.2813	L	0.60067	1.865	0.80722	D	1	P	0.42456	0.78	P	0.45232	0.474	T	0.65117	-0.6246	10	0.37606	T	0.19	.	19.554	0.95333	0.0:1.0:0.0:0.0	.	1525	Q8IVF4	DYH10_HUMAN	T	1525	ENSP00000386770:P1525T	ENSP00000386770:P1525T	P	+	1	0	DNAH10	122888980	1.000000	0.71417	0.997000	0.53966	0.240000	0.25518	7.584000	0.82572	2.632000	0.89209	0.650000	0.86243	CCC	.		0.552	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH10	196385	hgsc.bcm.edu;bcgsc.ca	37	12	124354958	124354958	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:124354958A>G	ENST00000409039.3	+	43	7236	c.7211A>G	c.(7210-7212)aAt>aGt	p.N2404S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2404					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AACAAACGGAATCAATGGGTC	0.398																																					p.N2404S		.											.	DNAH10	95	0			c.A7211G						.						98.0	93.0	95.0					12																	124354958		1875	4113	5988	SO:0001583	missense	196385	exon43			AACGGAATCAATG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7211A>G	12.37:g.124354958A>G	ENSP00000386770:p.Asn2404Ser	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	4.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	A	7.640	0.680644	0.14907	.	.	ENSG00000197653	ENST00000409039	T	0.21031	2.03	5.21	1.52	0.23074	.	0.665037	0.13286	N	0.399382	T	0.16981	0.0408	L	0.47716	1.5	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.31308	-0.9948	10	0.20519	T	0.43	.	9.1845	0.37163	0.7913:0.0:0.2087:0.0	.	2404	Q8IVF4	DYH10_HUMAN	S	2404	ENSP00000386770:N2404S	ENSP00000386770:N2404S	N	+	2	0	DNAH10	122920911	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	5.213000	0.65230	0.018000	0.15052	-0.290000	0.09829	AAT	.		0.398	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH7	56171	ucsc.edu;bcgsc.ca;mdanderson.org	37	2	196912185	196912185	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr2:196912185G>A	ENST00000312428.6	-	5	389	c.289C>T	c.(289-291)Ccc>Tcc	p.P97S	DNAH7_ENST00000410072.1_Missense_Mutation_p.P97S	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	97	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ACTTGGTGGGGTAATTTGCCC	0.323																																					p.P97S		.											.	DNAH7	102	0			c.C289T						.						177.0	173.0	174.0					2																	196912185		1820	4077	5897	SO:0001583	missense	56171	exon5			GGTGGGGTAATTT	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.289C>T	2.37:g.196912185G>A	ENSP00000311273:p.Pro97Ser	Somatic	150.0	1.0		WXS	Illumina HiSeq	.	193.0	71.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	2.422	-0.332874	0.05314	.	.	ENSG00000118997	ENST00000312428;ENST00000410072;ENST00000312446;ENST00000427816	T;T	0.19669	2.13;3.06	4.66	1.92	0.25849	.	1.808710	0.03014	N	0.149771	T	0.10508	0.0257	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26573	-1.0099	10	0.07175	T	0.84	.	6.2915	0.21063	0.3064:0.0:0.6936:0.0	.	97	Q8WXX0	DYH7_HUMAN	S	97;97;97;72	ENSP00000311273:P97S;ENSP00000386260:P97S	ENSP00000311273:P97S	P	-	1	0	DNAH7	196620430	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.188000	0.17018	0.217000	0.20800	-0.229000	0.12294	CCC	.		0.323	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
DNAJA1	3301	hgsc.bcm.edu;bcgsc.ca	37	9	33037024	33037024	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr9:33037024A>G	ENST00000330899.4	+	8	1069	c.886A>G	c.(886-888)Aag>Gag	p.K296E	DNAJA1_ENST00000544625.1_Missense_Mutation_p.K139E|DNAJA1_ENST00000495015.1_3'UTR	NM_001539.2	NP_001530.1	P31689	DNJA1_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 1	296					androgen receptor signaling pathway (GO:0030521)|DNA damage response, detection of DNA damage (GO:0042769)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of apoptotic process (GO:0043065)|protein folding (GO:0006457)|protein localization to mitochondrion (GO:0070585)|regulation of protein transport (GO:0051223)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasmic side of endoplasmic reticulum membrane (GO:0098554)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|G-protein coupled receptor binding (GO:0001664)|Hsp70 protein binding (GO:0030544)|low-density lipoprotein particle receptor binding (GO:0050750)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			large_intestine(2)|ovary(1)|skin(3)	6			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.102)		TCAGATTGTCAAGCATGGAGA	0.383																																					p.K296E		.											.	DNAJA1	226	0			c.A886G						.						136.0	122.0	127.0					9																	33037024		2203	4300	6503	SO:0001583	missense	3301	exon8			ATTGTCAAGCATG	L08069	CCDS6533.1	9p13.3	2011-09-02			ENSG00000086061	ENSG00000086061		"""Heat shock proteins / DNAJ (HSP40)"""	5229	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 7"""	602837		HSJ2		8334160, 11147971	Standard	NM_001539		Approved	HSPF4, hdj-2, dj-2, NEDD7	uc003zsd.1	P31689	OTTHUMG00000019760	ENST00000330899.4:c.886A>G	9.37:g.33037024A>G	ENSP00000369127:p.Lys296Glu	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_001539	Q5T7Q0|Q86TL9	Missense_Mutation	SNP	ENST00000330899.4	37	CCDS6533.1	.	.	.	.	.	.	.	.	.	.	A	17.15	3.316808	0.60524	.	.	ENSG00000086061	ENST00000330899;ENST00000539152;ENST00000544625	T;T	0.48522	0.81;0.81	5.33	5.33	0.75918	Chaperone DnaJ, C-terminal (1);HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	M	0.74389	2.26	0.80722	D	1	B;B	0.29481	0.118;0.245	B;B	0.37346	0.108;0.247	T	0.54774	-0.8243	10	0.40728	T	0.16	-19.7625	13.5499	0.61726	1.0:0.0:0.0:0.0	.	296;296	Q86TL9;P31689	.;DNJA1_HUMAN	E	296;139;139	ENSP00000369127:K296E;ENSP00000439010:K139E	ENSP00000369127:K296E	K	+	1	0	DNAJA1	33027024	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.465000	0.80898	2.157000	0.67596	0.482000	0.46254	AAG	.		0.383	DNAJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052031.1		
DSC3	1825	hgsc.bcm.edu;bcgsc.ca	37	18	28604328	28604328	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr18:28604328T>C	ENST00000360428.4	-	6	842	c.762A>G	c.(760-762)gaA>gaG	p.E254E	DSC3_ENST00000434452.1_Silent_p.E254E	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	254	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			GTCTACTACTTTCCAAAACTT	0.358																																					p.E254E		.											.	DSC3	94	0			c.A762G						.						61.0	66.0	64.0					18																	28604328		2203	4299	6502	SO:0001819	synonymous_variant	1825	exon6			ACTACTTTCCAAA	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.762A>G	18.37:g.28604328T>C		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	5.0	NM_024423	A6NN35|Q14200|Q9HAZ9	Silent	SNP	ENST00000360428.4	37	CCDS32810.1																																																																																			.		0.358	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423	
DTL	51514	hgsc.bcm.edu;bcgsc.ca	37	1	212238257	212238257	+	Splice_Site	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:212238257A>G	ENST00000366991.4	+	7	840		c.e7-1		DTL_ENST00000542077.1_Splice_Site|DTL_ENST00000475419.1_Splice_Site	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)						cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		AATATCTTTCAGATGGGTTTT	0.343																																					.		.											.	DTL	22	0			c.527-2A>G						.						93.0	95.0	95.0					1																	212238257		2203	4300	6503	SO:0001630	splice_region_variant	51514	exon7			TCTTTCAGATGGG	AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.527-1A>G	1.37:g.212238257A>G		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_016448	A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Splice_Site	SNP	ENST00000366991.4	37	CCDS1502.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.302938	0.81136	.	.	ENSG00000143476	ENST00000366991;ENST00000542077	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8947	0.70636	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DTL	210304880	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.921000	0.87530	2.216000	0.71823	0.533000	0.62120	.	.		0.343	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090182.1	NM_016448	Intron
DYRK4	8798	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	4700393	4700393	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:4700393G>C	ENST00000540757.2	+	3	207	c.47G>C	c.(46-48)aGc>aCc	p.S16T	DYRK4_ENST00000010132.5_Missense_Mutation_p.S16T|DYRK4_ENST00000543431.1_Missense_Mutation_p.S16T	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	16						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			TTCCACCCTAGCATTAAAACC	0.498																																					p.S16T		.											.	DYRK4	360	0			c.G47C						.						89.0	80.0	83.0					12																	4700393		2203	4300	6503	SO:0001583	missense	8798	exon3			ACCCTAGCATTAA	Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.47G>C	12.37:g.4700393G>C	ENSP00000441755:p.Ser16Thr	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	66.0	NM_003845	A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	ENST00000540757.2	37	CCDS8530.1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.288611	0.23478	.	.	ENSG00000010219	ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431	T;T;T;T	0.64438	-0.1;-0.03;-0.03;-0.03	4.34	0.201	0.15186	.	1.896970	0.02033	N	0.048652	T	0.52629	0.1746	L	0.44542	1.39	0.09310	N	1	B;B;B	0.28636	0.218;0.11;0.139	B;B;B	0.25291	0.059;0.059;0.027	T	0.24584	-1.0156	10	0.35671	T	0.21	.	5.3065	0.15807	0.2707:0.16:0.5693:0.0	.	131;16;16	F5H6L9;Q9NR20-2;Q9NR20	.;.;DYRK4_HUMAN	T	131;16;16;16	ENSP00000437534:S131T;ENSP00000441755:S16T;ENSP00000010132:S16T;ENSP00000439697:S16T	ENSP00000010132:S16T	S	+	2	0	DYRK4	4570654	0.003000	0.15002	0.000000	0.03702	0.293000	0.27360	0.383000	0.20651	-0.074000	0.12820	-0.430000	0.05897	AGC	.		0.498	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398780.2		
ECT2L	345930	hgsc.bcm.edu;bcgsc.ca	37	6	139197610	139197610	+	Splice_Site	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:139197610A>G	ENST00000423192.1	+	13	1741	c.1580A>G	c.(1579-1581)gAa>gGa	p.E527G	ECT2L_ENST00000541398.1_Splice_Site_p.E458G|ECT2L_ENST00000367682.2_Splice_Site_p.E527G|RP3-509I19.6_ENST00000572284.1_RNA			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	527			E -> K (in dbSNP:rs1529151).				Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						AATCTTCAGGAAAGAAATGTT	0.413			"""N, Splice, Mis"""		ETP ALL																																p.E527G		.		Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	ECT2L	22	0			c.A1580G						.						64.0	61.0	62.0					6																	139197610		1859	4099	5958	SO:0001630	splice_region_variant	345930	exon13			TTCAGGAAAGAAA		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.1579-1A>G	6.37:g.139197610A>G		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_001195037	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	37	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	A	11.84	1.758092	0.31137	.	.	ENSG00000203734	ENST00000423192;ENST00000367682;ENST00000541398	T;T;T	0.77098	0.06;0.06;-1.07	5.25	-0.205	0.13196	Dbl homology (DH) domain (1);	0.000000	0.41712	U	0.000821	T	0.48857	0.1523	L	0.60455	1.87	0.25093	N	0.990847	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.46048	-0.9219	10	0.44086	T	0.13	22.768	4.6103	0.12399	0.5108:0.3155:0.1737:0.0	.	458;527	F5H7S9;Q008S8	.;ECT2L_HUMAN	G	527;527;458	ENSP00000387388:E527G;ENSP00000356655:E527G;ENSP00000442307:E458G	ENSP00000356655:E527G	E	+	2	0	ECT2L	139239303	0.997000	0.39634	0.063000	0.19743	0.092000	0.18411	1.273000	0.33121	0.022000	0.15160	0.528000	0.53228	GAA	.		0.413	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706	Missense_Mutation
EDARADD	128178	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	236577581	236577581	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:236577581G>A	ENST00000334232.4	+	3	309	c.142G>A	c.(142-144)Gat>Aat	p.D48N	EDARADD_ENST00000359362.5_Missense_Mutation_p.D38N	NM_145861.2	NP_665860.2	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain	48					cell differentiation (GO:0030154)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|stomach(1)	12	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TCCCATTCAAGATACGGAACT	0.318																																					p.D48N		.											.	EDARADD	90	0			c.G142A						.						100.0	103.0	102.0					1																	236577581		2203	4299	6502	SO:0001583	missense	128178	exon3			ATTCAAGATACGG	AY028914	CCDS1610.1, CCDS31065.1	1q42.3	2013-05-22			ENSG00000186197	ENSG00000186197			14341	protein-coding gene	gene with protein product		606603				11780064	Standard	NM_145861		Approved		uc001hxu.1	Q8WWZ3	OTTHUMG00000039954	ENST00000334232.4:c.142G>A	1.37:g.236577581G>A	ENSP00000335076:p.Asp48Asn	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	55.0	NM_145861	A2VCK5|A8K7B5|B1AL54|B9ZVW5|Q5VYJ7	Missense_Mutation	SNP	ENST00000334232.4	37	CCDS1610.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057813	0.76074	.	.	ENSG00000186197	ENST00000439430;ENST00000334232;ENST00000359362	T;T;D	0.83163	-0.04;-1.13;-1.69	4.72	4.72	0.59763	.	0.148151	0.28952	U	0.013607	D	0.89556	0.6749	M	0.71581	2.175	0.36604	D	0.874813	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.92304	0.5852	10	0.87932	D	0	.	13.0389	0.58887	0.0:0.0:1.0:0.0	.	38;48	A8K7B5;Q8WWZ3	.;EDAD_HUMAN	N	26;48;38	ENSP00000405815:D26N;ENSP00000335076:D48N;ENSP00000352320:D38N	ENSP00000335076:D48N	D	+	1	0	EDARADD	234644204	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	4.693000	0.61753	2.465000	0.83290	0.563000	0.77884	GAT	.		0.318	EDARADD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096368.1	NM_145861	
EIF3A	8661	hgsc.bcm.edu;bcgsc.ca	37	10	120828985	120828985	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr10:120828985T>C	ENST00000369144.3	-	6	1050	c.923A>G	c.(922-924)aAg>aGg	p.K308R	EIF3A_ENST00000541549.1_Missense_Mutation_p.K274R	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		TGTGAGATTCTTTCTCATTTC	0.318																																					p.K308R		.											.	EIF3A	226	0			c.A923G						.						98.0	90.0	93.0					10																	120828985		2203	4300	6503	SO:0001583	missense	8661	exon6			AGATTCTTTCTCA	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.923A>G	10.37:g.120828985T>C	ENSP00000358140:p.Lys308Arg	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_003750	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	37	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.000719	0.74818	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.46063	0.88;0.88	5.87	5.87	0.94306	.	0.000000	0.41097	D	0.000944	T	0.61274	0.2334	L	0.60904	1.88	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.60063	-0.7336	10	0.46703	T	0.11	-34.5111	16.5764	0.84681	0.0:0.0:0.0:1.0	.	308	Q14152	EIF3A_HUMAN	R	308;274	ENSP00000358140:K308R;ENSP00000438178:K274R	ENSP00000358140:K308R	K	-	2	0	EIF3A	120818975	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.965000	0.87945	2.371000	0.80710	0.533000	0.62120	AAG	.		0.318	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750	
ENPEP	2028	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	111409837	111409837	+	Splice_Site	SNP	C	C	T	rs373049379		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:111409837C>T	ENST00000265162.5	+	2	1127	c.785C>T	c.(784-786)gCg>gTg	p.A262V		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	262					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		ATGCCAGTGGCGGTAAGTATT	0.358																																					p.A262V		.											.	ENPEP	157	0			c.C785T						.	C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	93.0	92.0	92.0		785	-1.1	1.0	4		92	0,8600		0,0,4300	no	missense-near-splice	ENPEP	NM_001977.3	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	262/958	111409837	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	2028	exon2			CAGTGGCGGTAAG	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.786+1C>T	4.37:g.111409837C>T		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	18.0	NM_001977	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.588973	0.46110	2.27E-4	0.0	ENSG00000138792	ENST00000265162	T	0.02579	4.24	4.61	-1.13	0.09775	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.425182	0.24999	N	0.033928	T	0.01454	0.0047	N	0.05574	-0.02	0.31035	N	0.716968	P	0.47350	0.894	B	0.40165	0.321	T	0.52102	-0.8620	10	0.28530	T	0.3	.	8.6135	0.33817	0.463:0.4203:0.0:0.1166	.	262	Q07075	AMPE_HUMAN	V	262	ENSP00000265162:A262V	ENSP00000265162:A262V	A	+	2	0	ENPEP	111629286	0.616000	0.27035	0.991000	0.47740	0.798000	0.45092	1.105000	0.31086	-0.498000	0.06632	-0.251000	0.11542	GCG	.		0.358	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		Missense_Mutation
ERI1	90459	hgsc.bcm.edu;bcgsc.ca	37	8	8875834	8875834	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr8:8875834C>T	ENST00000523898.1	+	6	1289	c.610C>T	c.(610-612)Cct>Tct	p.P204S	ERI1_ENST00000250263.7_Missense_Mutation_p.P204S|ERI1_ENST00000519292.1_Missense_Mutation_p.P204S|ERI1_ENST00000520332.1_3'UTR			Q8IV48	ERI1_HUMAN	exoribonuclease 1	204	Exonuclease.				gene silencing by RNA (GO:0031047)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|rRNA 3'-end processing (GO:0031125)	cytoplasm (GO:0005737)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|histone pre-mRNA stem-loop binding (GO:0071207)|metal ion binding (GO:0046872)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11						TGATACCTTCCCTCAGGTACT	0.358																																					p.P204S		.											.	ERI1	68	0			c.C610T						.						58.0	59.0	59.0					8																	8875834		2203	4300	6503	SO:0001583	missense	90459	exon5			ACCTTCCCTCAGG	BC035279	CCDS5972.1	8p23.1	2008-12-16	2008-12-16	2008-12-16	ENSG00000104626	ENSG00000104626		"""Enhanced RNAi three prime mRNA exonucleases"""	23994	protein-coding gene	gene with protein product	"""exoribonuclease 1"", ""enhanced RNAi three prime mRNA exonuclease homolog 1 (C.elegans)"""	608739	"""three prime histone mRNA exonuclease 1"""	THEX1		14536070	Standard	NM_153332		Approved	3'HEXO	uc003wsk.2	Q8IV48	OTTHUMG00000129328	ENST00000523898.1:c.610C>T	8.37:g.8875834C>T	ENSP00000429615:p.Pro204Ser	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	4.0	NM_153332	A8K4U7|Q9NSX3	Missense_Mutation	SNP	ENST00000523898.1	37	CCDS5972.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.907533	0.92107	.	.	ENSG00000104626	ENST00000523898;ENST00000250263;ENST00000519292	T;T;T	0.21543	2.0;2.0;2.0	5.97	5.97	0.96955	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.046969	0.85682	D	0.000000	T	0.33381	0.0861	M	0.63428	1.95	0.80722	D	1	P	0.39883	0.693	P	0.44623	0.455	T	0.00783	-1.1568	10	0.38643	T	0.18	-15.1539	19.4222	0.94726	0.0:1.0:0.0:0.0	.	204	Q8IV48	ERI1_HUMAN	S	204	ENSP00000429615:P204S;ENSP00000250263:P204S;ENSP00000430190:P204S	ENSP00000250263:P204S	P	+	1	0	ERI1	8913244	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.361000	0.66092	2.838000	0.97847	0.561000	0.74099	CCT	.		0.358	ERI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251471.2	NM_153332	
ESCO2	157570	hgsc.bcm.edu;bcgsc.ca	37	8	27634369	27634369	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr8:27634369T>C	ENST00000305188.8	+	3	782	c.544T>C	c.(544-546)Tgt>Cgt	p.C182R	ESCO2_ENST00000397418.2_5'UTR|ESCO2_ENST00000523910.1_3'UTR	NM_001017420.2	NP_001017420.1	Q56NI9	ESCO2_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 2	182					chromosome segregation (GO:0007059)|double-strand break repair (GO:0006302)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|protein localization to chromatin (GO:0071168)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromocenter (GO:0010369)|Golgi apparatus (GO:0005794)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|XY body (GO:0001741)	lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)		GGAAAATAATTGTCATTCAGC	0.373									SC Phocomelia syndrome																												p.C182R		.											.	ESCO2	90	0			c.T544C						.						55.0	58.0	57.0					8																	27634369		2203	4300	6503	SO:0001583	missense	157570	exon3	Familial Cancer Database	SC-Pseudothalidomide s., incl.: Roberts s.	AATAATTGTCATT	AF306679	CCDS34872.1	8p21.1	2013-05-02	2013-05-02		ENSG00000171320	ENSG00000171320			27230	protein-coding gene	gene with protein product		609353	"""Roberts syndrome"", ""establishment of cohesion 1 homolog 2 (S. cerevisiae)"""	RBS		15958495, 16775838, 15821733, 16380922	Standard	XR_247122		Approved	EFO2	uc003xgg.3	Q56NI9	OTTHUMG00000163901	ENST00000305188.8:c.544T>C	8.37:g.27634369T>C	ENSP00000306999:p.Cys182Arg	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_001017420	B3KW59|Q49AP4	Missense_Mutation	SNP	ENST00000305188.8	37	CCDS34872.1	.	.	.	.	.	.	.	.	.	.	T	1.802	-0.476850	0.04414	.	.	ENSG00000171320	ENST00000523566;ENST00000305188	T;T	0.64085	0.83;-0.08	5.93	1.81	0.25067	.	1.026470	0.07659	N	0.933369	T	0.63402	0.2508	L	0.56769	1.78	0.09310	N	0.999996	D;P	0.53151	0.958;0.744	P;B	0.51866	0.682;0.154	T	0.48917	-0.8992	10	0.25751	T	0.34	-0.2848	5.0166	0.14339	0.3938:0.0:0.1481:0.4581	.	182;182	E5RFE4;Q56NI9	.;ESCO2_HUMAN	R	182	ENSP00000428435:C182R;ENSP00000306999:C182R	ENSP00000306999:C182R	C	+	1	0	ESCO2	27690288	0.000000	0.05858	0.084000	0.20598	0.068000	0.16541	0.417000	0.21214	0.435000	0.26365	0.482000	0.46254	TGT	.		0.373	ESCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376276.1	NM_001017420	
EXOC2	55770	hgsc.bcm.edu;bcgsc.ca	37	6	556010	556010	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:556010A>G	ENST00000230449.4	-	19	2071	c.1936T>C	c.(1936-1938)Ttc>Ctc	p.F646L	EXOC2_ENST00000448181.3_Missense_Mutation_p.F241L	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	646					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		GGTTGTTGGAAGACCTGTAAG	0.348																																					p.F646L		.											.	EXOC2	662	0			c.T1936C						.						130.0	123.0	125.0					6																	556010		2203	4300	6503	SO:0001583	missense	55770	exon19			GTTGGAAGACCTG	AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.1936T>C	6.37:g.556010A>G	ENSP00000230449:p.Phe646Leu	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	5.0	NM_018303	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	ENST00000230449.4	37	CCDS34327.1	.	.	.	.	.	.	.	.	.	.	A	13.20	2.165846	0.38217	.	.	ENSG00000112685	ENST00000230449;ENST00000448181	T;T	0.21191	2.02;2.02	5.6	5.6	0.85130	.	0.194343	0.51477	D	0.000084	T	0.09291	0.0229	L	0.47190	1.495	0.58432	D	0.999995	B	0.15141	0.012	B	0.12156	0.007	T	0.09574	-1.0668	10	0.14656	T	0.56	-0.0157	14.6565	0.68835	1.0:0.0:0.0:0.0	.	646	Q96KP1	EXOC2_HUMAN	L	646;241	ENSP00000230449:F646L;ENSP00000398113:F241L	ENSP00000230449:F646L	F	-	1	0	EXOC2	501010	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	5.571000	0.67404	2.248000	0.74166	0.460000	0.39030	TTC	.		0.348	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303	
FOXK1	221937	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	4798978	4798978	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr7:4798978T>C	ENST00000328914.4	+	7	1448	c.1448T>C	c.(1447-1449)gTg>gCg	p.V483A	FOXK1_ENST00000446823.1_Missense_Mutation_p.V320A	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		ATCATGGCCGTGCCTCCCCGA	0.736																																					p.V483A		.											.	FOXK1	516	0			c.T1448C						.						19.0	20.0	20.0					7																	4798978		2194	4295	6489	SO:0001583	missense	221937	exon7			TGGCCGTGCCTCC	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1448T>C	7.37:g.4798978T>C	ENSP00000328720:p.Val483Ala	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	4.0	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.461008	0.43736	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.96011	-3.45;-3.88	5.34	5.34	0.76211	.	0.126422	0.53938	D	0.000044	D	0.92397	0.7587	L	0.42245	1.32	0.47659	D	0.999486	B;B	0.27625	0.057;0.183	B;B	0.26416	0.01;0.069	D	0.90058	0.4154	10	0.25751	T	0.34	.	14.7896	0.69830	0.0:0.0:0.0:1.0	.	483;320	P85037;P85037-2	FOXK1_HUMAN;.	A	320;239;483;366	ENSP00000394442:V320A;ENSP00000328720:V483A	ENSP00000328720:V483A	V	+	2	0	FOXK1	4765504	1.000000	0.71417	0.948000	0.38648	0.442000	0.32017	5.699000	0.68310	2.153000	0.67306	0.482000	0.46254	GTG	.		0.736	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
GBP5	115362	hgsc.bcm.edu;bcgsc.ca	37	1	89729600	89729600	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:89729600C>A	ENST00000370459.3	-	8	1308	c.1181G>T	c.(1180-1182)tGt>tTt	p.C394F	RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000471171.1_5'Flank|GBP5_ENST00000343435.5_Missense_Mutation_p.C394F			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	394						cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		GTTCCGTTTACAAATGTCATT	0.368																																					p.C394F		.											.	GBP5	91	0			c.G1181T						.						136.0	141.0	139.0					1																	89729600		2203	4300	6503	SO:0001583	missense	115362	exon9			CGTTTACAAATGT	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.1181G>T	1.37:g.89729600C>A	ENSP00000359488:p.Cys394Phe	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	9.0	NM_052942	B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	37	CCDS722.1	.	.	.	.	.	.	.	.	.	.	C	8.934	0.964062	0.18583	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.54675	0.56;0.56;0.56	5.12	-1.2	0.09554	Guanylate-binding protein, C-terminal (3);	0.566743	0.20220	N	0.096703	T	0.18509	0.0444	L	0.46741	1.465	0.09310	N	1	B	0.18310	0.027	B	0.28385	0.089	T	0.24440	-1.0160	10	0.39692	T	0.17	0.5771	1.786	0.03041	0.1275:0.3928:0.1245:0.3552	.	394	Q96PP8	GBP5_HUMAN	F	394	ENSP00000340396:C394F;ENSP00000359488:C394F;ENSP00000403010:C394F	ENSP00000340396:C394F	C	-	2	0	GBP5	89502188	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.404000	0.07205	-0.262000	0.09392	-0.335000	0.08231	TGT	.		0.368	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942	
GBP6	163351	hgsc.bcm.edu;bcgsc.ca	37	1	89847413	89847413	+	Silent	SNP	C	C	T	rs373830740		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:89847413C>T	ENST00000370456.4	+	7	1125	c.1032C>T	c.(1030-1032)ctC>ctT	p.L344L	GBP6_ENST00000535065.1_Silent_p.L214L	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	344			L -> F (in dbSNP:rs4658360). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.		cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		GAGTGAAGCTCCCCACAGACA	0.572																																					p.L344L		.											.	GBP6	92	0			c.C1032T						.						81.0	74.0	76.0					1																	89847413		2203	4300	6503	SO:0001819	synonymous_variant	163351	exon7			GAAGCTCCCCACA	BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.1032C>T	1.37:g.89847413C>T		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	221.0	9.0	NM_198460	A2RRM3|Q6ZN86|Q7Z3F0	Silent	SNP	ENST00000370456.4	37	CCDS723.1																																																																																			.		0.572	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028001.1	NM_198460	
GCSAM	257144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	111842506	111842506	+	Silent	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:111842506G>A	ENST00000308910.4	-	6	517	c.333C>T	c.(331-333)ccC>ccT	p.P111P	GCSAM_ENST00000484193.1_Silent_p.P113P|C3orf52_ENST00000467942.2_Intron	NM_001190259.1|NM_001190260.1|NM_152785.4	NP_001177188.1|NP_001177189.1|NP_689998.1	Q8N6F7	GCSAM_HUMAN	germinal center-associated, signaling and motility	111					negative regulation of lymphocyte migration (GO:2000402)|regulation of B cell receptor signaling pathway (GO:0050855)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|myosin II binding (GO:0045159)|protein kinase binding (GO:0019901)										CAGCTTTGCAGGGAACATTCT	0.507																																					p.P113P		.											.	.	.	0			c.C339T						.						117.0	110.0	112.0					3																	111842506		2203	4300	6503	SO:0001819	synonymous_variant	257144	exon6			TTTGCAGGGAACA	BC030506	CCDS2964.1, CCDS54621.1, CCDS54622.1	3q13.13	2012-09-03	2012-08-23	2012-08-23	ENSG00000174500	ENSG00000174500			20253	protein-coding gene	gene with protein product	"""human germinal center-associated lymphoma"""	607792	"""germinal center expressed transcript 2"""	GCET2			Standard	NM_152785		Approved	MGC40441, HGAL	uc021xcl.1	Q8N6F7	OTTHUMG00000159231	ENST00000308910.4:c.333C>T	3.37:g.111842506G>A		Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	272.0	90.0	NM_001190259	C9JD17|C9JUG6	Silent	SNP	ENST00000308910.4	37	CCDS2964.1																																																																																			.		0.507	GCSAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353967.2	NM_152785	
GLI1	2735	hgsc.bcm.edu;bcgsc.ca	37	12	57857530	57857530	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:57857530T>C	ENST00000228682.2	+	2	147	c.56T>C	c.(55-57)cTc>cCc	p.L19P	GLI1_ENST00000546141.1_Missense_Mutation_p.L19P|GLI1_ENST00000543426.1_Intron	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	19	SNAG domain. {ECO:0000250}.				cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CCCTGCTGTCTCCGGCCCCTC	0.592																																					p.L19P	Pancreas(157;841 1936 10503 41495 50368)	.											.	GLI1	722	0			c.T56C						.						78.0	70.0	73.0					12																	57857530		2203	4300	6503	SO:0001583	missense	2735	exon2			GCTGTCTCCGGCC		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.56T>C	12.37:g.57857530T>C	ENSP00000228682:p.Leu19Pro	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	4.0	NM_005269	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	37	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	T	18.76	3.693279	0.68386	.	.	ENSG00000111087	ENST00000228682;ENST00000546141;ENST00000528432;ENST00000528467	T;T;T	0.18016	2.24;2.33;2.33	4.42	4.42	0.53409	.	0.470469	0.17701	N	0.164920	T	0.21347	0.0514	N	0.17082	0.46	0.80722	D	1	D	0.63880	0.993	P	0.59595	0.86	T	0.02844	-1.1103	10	0.56958	D	0.05	.	11.572	0.50839	0.0:0.0:0.0:1.0	.	19	P08151	GLI1_HUMAN	P	19	ENSP00000228682:L19P;ENSP00000441006:L19P;ENSP00000434408:L19P	ENSP00000228682:L19P	L	+	2	0	GLI1	56143797	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.974000	0.56852	1.983000	0.57843	0.528000	0.53228	CTC	.		0.592	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269	
GLI3	2737	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	42012094	42012094	+	Silent	SNP	G	G	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr7:42012094G>T	ENST00000395925.3	-	13	2029	c.1945C>A	c.(1945-1947)Cgg>Agg	p.R649R	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	649					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GGTGGCGGCCGAGGATGGATG	0.612									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.R649R		.											.	GLI3	1149	0			c.C1945A						.						86.0	88.0	88.0					7																	42012094		2203	4300	6503	SO:0001819	synonymous_variant	2737	exon13	Familial Cancer Database	;	GCGGCCGAGGATG		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1945C>A	7.37:g.42012094G>T		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	190.0	79.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	37	CCDS5465.1																																																																																			.		0.612	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
GYS2	2998	hgsc.bcm.edu;bcgsc.ca	37	12	21692268	21692268	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:21692268T>C	ENST00000261195.2	-	15	2068	c.1814A>G	c.(1813-1815)tAc>tGc	p.Y605C		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	605					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GGCATGCTGGTAATACTATTG	0.333																																					p.Y605C	Colon(149;9 1820 3690 10544 50424)	.											.	GYS2	523	0			c.A1814G						.						146.0	153.0	151.0					12																	21692268		2203	4300	6503	SO:0001583	missense	2998	exon15			TGCTGGTAATACT		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1814A>G	12.37:g.21692268T>C	ENSP00000261195:p.Tyr605Cys	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_021957	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	37	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.990812	0.74589	.	.	ENSG00000111713	ENST00000261195	T	0.73575	-0.76	5.3	5.3	0.74995	.	0.064498	0.64402	D	0.000004	D	0.86318	0.5904	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88259	0.2922	10	0.87932	D	0	-16.451	14.569	0.68200	0.0:0.0:0.0:1.0	.	605	P54840	GYS2_HUMAN	C	605	ENSP00000261195:Y605C	ENSP00000261195:Y605C	Y	-	2	0	GYS2	21583535	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.002000	0.76304	2.218000	0.71995	0.528000	0.53228	TAC	.		0.333	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
HEYL	26508	hgsc.bcm.edu;bcgsc.ca	37	1	40105230	40105230	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:40105230T>C	ENST00000372852.3	-	1	387	c.68A>G	c.(67-69)gAg>gGg	p.E23G		NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	23					atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CAGCTGGCCCTCTTGGCCCAC	0.751																																					p.E23G		.											.	HEYL	91	0			c.A68G						.						11.0	11.0	11.0					1																	40105230		2186	4285	6471	SO:0001583	missense	26508	exon1			TGGCCCTCTTGGC	BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.68A>G	1.37:g.40105230T>C	ENSP00000361943:p.Glu23Gly	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_014571	Q5TG99	Missense_Mutation	SNP	ENST00000372852.3	37	CCDS439.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.388348	0.42308	.	.	ENSG00000163909	ENST00000372852	T	0.63580	-0.05	3.68	3.68	0.42216	.	0.553967	0.19177	N	0.120783	T	0.57242	0.2040	L	0.57536	1.79	0.80722	D	1	B	0.20368	0.044	B	0.24848	0.056	T	0.61481	-0.7054	10	0.87932	D	0	-15.647	8.9953	0.36048	0.0:0.0:0.0:1.0	.	23	Q9NQ87	HEYL_HUMAN	G	23	ENSP00000361943:E23G	ENSP00000361943:E23G	E	-	2	0	HEYL	39877817	0.994000	0.37717	0.951000	0.38953	0.108000	0.19459	2.862000	0.48388	1.884000	0.54569	0.533000	0.62120	GAG	.		0.751	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001179.2	NM_014571	
HEATR1	55127	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	236750749	236750749	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:236750749A>T	ENST00000366582.3	-	14	1782	c.1668T>A	c.(1666-1668)aaT>aaA	p.N556K	HEATR1_ENST00000366581.2_Missense_Mutation_p.N556K	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	556					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GATTCAGAAGATTTGAAATCG	0.323																																					p.N556K		.											.	HEATR1	93	0			c.T1668A						.						46.0	44.0	45.0					1																	236750749		2197	4289	6486	SO:0001583	missense	55127	exon14			CAGAAGATTTGAA	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1668T>A	1.37:g.236750749A>T	ENSP00000355541:p.Asn556Lys	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	266.0	135.0	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.319392	0.23994	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.65732	-0.17;0.92	5.58	0.587	0.17439	Armadillo-like helical (1);Armadillo-type fold (1);	0.580156	0.19042	N	0.124248	T	0.47581	0.1453	L	0.47716	1.5	0.09310	N	0.999997	B	0.25169	0.119	B	0.28465	0.09	T	0.28202	-1.0051	10	0.19590	T	0.45	.	5.3855	0.16216	0.5651:0.1416:0.2933:0.0	.	556	Q9H583	HEAT1_HUMAN	K	556	ENSP00000355541:N556K;ENSP00000355540:N556K	ENSP00000355540:N556K	N	-	3	2	HEATR1	234817372	0.754000	0.28360	0.015000	0.15790	0.181000	0.23173	1.292000	0.33342	0.062000	0.16340	-0.313000	0.08912	AAT	.		0.323	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
HMMR	3161	hgsc.bcm.edu;bcgsc.ca	37	5	162891750	162891750	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:162891750T>C	ENST00000358715.3	+	3	203	c.167T>C	c.(166-168)gTt>gCt	p.V56A	HMMR_ENST00000393915.4_Missense_Mutation_p.V56A|HMMR_ENST00000353866.3_Missense_Mutation_p.V56A|HMMR_ENST00000432118.2_Intron			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	56					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	AATCTTAATGTTGACAAAGAT	0.343																																					p.V56A		.											.	HMMR	90	0			c.T167C						.						122.0	121.0	121.0					5																	162891750		2203	4300	6503	SO:0001583	missense	3161	exon3			TTAATGTTGACAA	U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.167T>C	5.37:g.162891750T>C	ENSP00000351554:p.Val56Ala	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_012485	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	ENST00000358715.3	37	CCDS4362.1	.	.	.	.	.	.	.	.	.	.	T	1.522	-0.546775	0.04024	.	.	ENSG00000072571	ENST00000353866;ENST00000434157;ENST00000393915;ENST00000426586;ENST00000358715	T;T;T	0.08282	3.11;3.19;3.19	4.85	0.829	0.18847	.	1.167870	0.05896	N	0.629184	T	0.03695	0.0105	N	0.08118	0	0.09310	N	1	B;B;B	0.23249	0.018;0.082;0.082	B;B;B	0.25140	0.031;0.058;0.058	T	0.38134	-0.9675	10	0.02654	T	1	-1.1384	5.0531	0.14518	0.177:0.0:0.3658:0.4572	.	56;56;56	O75330-3;O75330-2;O75330	.;.;HMMR_HUMAN	A	56	ENSP00000185942:V56A;ENSP00000377492:V56A;ENSP00000351554:V56A	ENSP00000185942:V56A	V	+	2	0	HMMR	162824328	0.367000	0.25023	0.427000	0.26684	0.038000	0.13279	0.419000	0.21247	0.771000	0.33359	0.460000	0.39030	GTT	.		0.343	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252752.1	NM_012484	
HRG	3273	hgsc.bcm.edu;bcgsc.ca	37	3	186390578	186390578	+	Silent	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:186390578A>G	ENST00000232003.4	+	5	641	c.561A>G	c.(559-561)agA>agG	p.R187R		NM_000412.2	NP_000403.1	P04196	HRG_HUMAN	histidine-rich glycoprotein	187	Cystatin 2.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|defense response to fungus (GO:0050832)|fibrinolysis (GO:0042730)|heme export (GO:0097037)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel remodeling (GO:2000504)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of immune response to tumor cell (GO:0002839)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet activation (GO:0010543)|regulation of protein complex assembly (GO:0043254)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|response to organic cyclic compound (GO:0014070)	blood microparticle (GO:0072562)|endolysosome (GO:0036019)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|phagolysosome membrane (GO:0061474)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heme binding (GO:0020037)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|immunoglobulin binding (GO:0019865)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(12)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		TGTTCTAGAGAGGAGGGGAAG	0.413																																					p.R187R		.											.	HRG	91	0			c.A561G						.						92.0	89.0	90.0					3																	186390578		2203	4300	6503	SO:0001819	synonymous_variant	3273	exon5			CTAGAGAGGAGGG		CCDS3280.1	3q27	2008-07-18			ENSG00000113905	ENSG00000113905			5181	protein-coding gene	gene with protein product	"""histidine-proline rich glycoprotein"", ""thrombophilia due to elevated HRG"""	142640				1678514	Standard	NM_000412		Approved	HRGP, HPRG	uc003fqq.3	P04196	OTTHUMG00000156578	ENST00000232003.4:c.561A>G	3.37:g.186390578A>G		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	5.0	NM_000412	B9EK35|D3DNU7	Silent	SNP	ENST00000232003.4	37	CCDS3280.1																																																																																			.		0.413	HRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344655.1	NM_000412	
IFI44	10561	hgsc.bcm.edu;bcgsc.ca	37	1	79115893	79115893	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:79115893A>G	ENST00000370747.4	+	2	98	c.13A>G	c.(13-15)Act>Gct	p.T5A	IFI44_ENST00000495254.1_Intron|IFI44_ENST00000545124.1_Intron	NM_006417.4	NP_006408.3	Q8TCB0	IFI44_HUMAN	interferon-induced protein 44	5					response to virus (GO:0009615)	cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21						GGCAGTGACAACTCGTTTGAC	0.358																																					p.T5A		.											.	IFI44	91	0			c.A13G						.						91.0	85.0	87.0					1																	79115893		2203	4300	6503	SO:0001583	missense	10561	exon2			GTGACAACTCGTT	D28915	CCDS688.1	1p31.1	2013-03-14			ENSG00000137965	ENSG00000137965			16938	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 5"""	610468				7925411	Standard	NM_006417		Approved	MTAP44, p44, TLDC5	uc001dip.4	Q8TCB0	OTTHUMG00000009723	ENST00000370747.4:c.13A>G	1.37:g.79115893A>G	ENSP00000359783:p.Thr5Ala	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	6.0	NM_006417	B7ZAG3|D3DQ80|Q14496	Missense_Mutation	SNP	ENST00000370747.4	37	CCDS688.1	.	.	.	.	.	.	.	.	.	.	A	8.520	0.868638	0.17322	.	.	ENSG00000137965	ENST00000370747	T	0.08896	3.04	3.3	2.17	0.27698	.	0.075957	0.53938	D	0.000047	T	0.09555	0.0235	M	0.64404	1.975	0.21105	N	0.999787	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.981	T	0.08351	-1.0726	10	0.46703	T	0.11	-10.591	5.2677	0.15607	0.8668:0.0:0.1332:0.0	.	5;5	B7ZB11;Q8TCB0	.;IFI44_HUMAN	A	5	ENSP00000359783:T5A	ENSP00000359783:T5A	T	+	1	0	IFI44	78888481	0.601000	0.26907	0.207000	0.23584	0.023000	0.10783	0.704000	0.25661	0.656000	0.30886	-0.467000	0.05162	ACT	.		0.358	IFI44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026825.1	NM_006417	
IFNA2	3440	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	21385289	21385289	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr9:21385289G>A	ENST00000380206.2	-	1	107	c.40C>T	c.(40-42)Ctc>Ttc	p.L14F		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	14					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		TTGCAGCTGAGCACCAGGAGG	0.537																																					p.L14F		.											.	IFNA2	153	0			c.C40T						.						109.0	96.0	100.0					9																	21385289		2203	4300	6503	SO:0001583	missense	3440	exon1			AGCTGAGCACCAG		CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.40C>T	9.37:g.21385289G>A	ENSP00000369554:p.Leu14Phe	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	67.0	NM_000605	H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Missense_Mutation	SNP	ENST00000380206.2	37	CCDS6506.1	.	.	.	.	.	.	.	.	.	.	G	7.915	0.737272	0.15574	.	.	ENSG00000188379	ENST00000380206	T	0.03689	3.84	3.24	1.17	0.20885	.	0.094776	0.44688	D	0.000430	T	0.09423	0.0232	M	0.86097	2.795	0.09310	N	1	D	0.54047	0.964	P	0.50314	0.637	T	0.11036	-1.0604	10	0.52906	T	0.07	.	5.3592	0.16077	0.0:0.1916:0.3847:0.4236	.	14	Q6DJX8	.	F	14	ENSP00000369554:L14F	ENSP00000369554:L14F	L	-	1	0	IFNA2	21375289	0.004000	0.15560	0.002000	0.10522	0.013000	0.08279	0.405000	0.21015	0.052000	0.16007	0.484000	0.47621	CTC	.		0.537	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051903.1	NM_000605	
IGDCC4	57722	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	65676554	65676554	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr15:65676554C>A	ENST00000352385.2	-	20	3755	c.3546G>T	c.(3544-3546)agG>agT	p.R1182S	IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	1182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						CTCCCAACTCCCTGTCCAGCC	0.657																																					p.R1182S		.											.	IGDCC4	93	0			c.G3546T						.						23.0	27.0	25.0					15																	65676554		2201	4299	6500	SO:0001583	missense	57722	exon20			CAACTCCCTGTCC		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.3546G>T	15.37:g.65676554C>A	ENSP00000319623:p.Arg1182Ser	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	62.0	NM_020962	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	C	7.389	0.630391	0.14322	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.60672	0.17	5.02	1.62	0.23740	.	0.845108	0.10220	N	0.700982	T	0.42899	0.1223	L	0.29908	0.895	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.31696	-0.9934	10	0.40728	T	0.16	-3.6858	7.4997	0.27511	0.0:0.6794:0.0:0.3206	.	1182	Q8TDY8	IGDC4_HUMAN	S	1182;911	ENSP00000319623:R1182S	ENSP00000319623:R1182S	R	-	3	2	IGDCC4	63463607	0.012000	0.17670	0.637000	0.29366	0.105000	0.19272	0.430000	0.21428	0.545000	0.28902	0.555000	0.69702	AGG	.		0.657	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
IGSF10	285313	hgsc.bcm.edu;bcgsc.ca	37	3	151176327	151176327	+	Silent	SNP	G	G	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:151176327G>T	ENST00000282466.3	-	1	170	c.171C>A	c.(169-171)ccC>ccA	p.P57P		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	57					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTTCCACATTGGGCGGGATGC	0.532																																					p.P57P		.											.	IGSF10	102	0			c.C171A						.						120.0	98.0	106.0					3																	151176327		2203	4300	6503	SO:0001819	synonymous_variant	285313	exon1			CACATTGGGCGGG	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.171C>A	3.37:g.151176327G>T		Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	244.0	17.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	37	CCDS3160.1																																																																																			.		0.532	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
INSR	3643	hgsc.bcm.edu;bcgsc.ca	37	19	7152932	7152932	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:7152932T>C	ENST00000302850.5	-	10	2178	c.2036A>G	c.(2035-2037)aAg>aGg	p.K679R	INSR_ENST00000341500.5_Missense_Mutation_p.K679R	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	679	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CGAGGGCAGCTTCAGCCCTGG	0.542																																					p.K679R		.											.	INSR	1381	0			c.A2036G						.						63.0	58.0	60.0					19																	7152932		2203	4300	6503	SO:0001583	missense	3643	exon10			GGCAGCTTCAGCC	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2036A>G	19.37:g.7152932T>C	ENSP00000303830:p.Lys679Arg	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	CCDS12176.1	.	.	.	.	.	.	.	.	.	.	t	13.44	2.237562	0.39598	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.75367	-0.93;-0.93	5.55	5.55	0.83447	Fibronectin, type III (3);	0.000000	0.47852	U	0.000209	T	0.67970	0.2950	L	0.46947	1.48	0.58432	D	0.999995	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.63571	-0.6607	10	0.36615	T	0.2	.	13.6724	0.62434	0.0:0.0:0.0:1.0	.	670;679;679	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	R	679	ENSP00000303830:K679R;ENSP00000342838:K679R	ENSP00000303830:K679R	K	-	2	0	INSR	7103932	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	7.477000	0.81069	2.121000	0.65114	0.487000	0.48397	AAG	.		0.542	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
INTU	27152	hgsc.bcm.edu;bcgsc.ca	37	4	128635178	128635178	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:128635178T>C	ENST00000335251.6	+	15	2750	c.2647T>C	c.(2647-2649)Ttt>Ctt	p.F883L		NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	883					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						TGGTGTGTTGTTTGAATGTTC	0.363																																					p.F883L		.											.	INTU	91	0			c.T2647C						.						142.0	142.0	142.0					4																	128635178		2203	4300	6503	SO:0001583	missense	27152	exon15			GTGTTGTTTGAAT	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.2647T>C	4.37:g.128635178T>C	ENSP00000334003:p.Phe883Leu	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	4.0	NM_015693	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	37	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.832049	0.91036	.	.	ENSG00000164066	ENST00000335251	.	.	.	4.2	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.76912	0.4054	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80241	-0.1464	9	0.87932	D	0	-19.9757	13.455	0.61193	0.0:0.0:0.0:1.0	.	883	Q9ULD6	PDZD6_HUMAN	L	883	.	ENSP00000334003:F883L	F	+	1	0	INTU	128854628	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.142000	0.77339	1.751000	0.51876	0.528000	0.53228	TTT	.		0.363	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
ITGB5	3693	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	124578237	124578237	+	Silent	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:124578237G>A	ENST00000296181.4	-	3	509	c.213C>T	c.(211-213)gtC>gtT	p.V71V		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	71	PSI.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		AGCCATTTTTGACAAGGTTTG	0.592																																					p.V71V		.											.	ITGB5	227	0			c.C213T						.						81.0	75.0	77.0					3																	124578237		2203	4300	6503	SO:0001819	synonymous_variant	3693	exon3			ATTTTTGACAAGG	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.213C>T	3.37:g.124578237G>A		Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	226.0	82.0	NM_002213	B0LPF8|B2RD70	Silent	SNP	ENST00000296181.4	37	CCDS3030.1																																																																																			.		0.592	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
ITPKB	3707	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	226923526	226923526	+	Missense_Mutation	SNP	G	G	A	rs149543375		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:226923526G>A	ENST00000272117.3	-	1	1633	c.1634C>T	c.(1633-1635)cCg>cTg	p.P545L	ITPKB_ENST00000366784.1_Missense_Mutation_p.P545L|ITPKB_ENST00000429204.1_Missense_Mutation_p.P545L			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	545					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TAGCAGCTCCGGACTTGGGAG	0.597																																					p.P545L	Colon(84;110 1851 5306 33547)	.											.	ITPKB	230	0			c.C1634T						.	G	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	41.0	39.0	40.0		1634	-3.2	0.0	1	dbSNP_134	40	0,8600		0,0,4300	no	missense	ITPKB	NM_002221.3	98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	545/947	226923526	1,13005	2203	4300	6503	SO:0001583	missense	3707	exon2			AGCTCCGGACTTG	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1634C>T	1.37:g.226923526G>A	ENSP00000272117:p.Pro545Leu	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	46.0	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	G	5.501	0.277439	0.10403	2.27E-4	0.0	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.21932	1.98;1.98;1.98	5.43	-3.18	0.05186	.	1.426790	0.04261	N	0.340381	T	0.11836	0.0288	N	0.19112	0.55	0.09310	N	1	B	0.15719	0.014	B	0.08055	0.003	T	0.33904	-0.9850	10	0.52906	T	0.07	1.5012	2.8086	0.05434	0.2829:0.2641:0.3599:0.0931	.	545	P27987	IP3KB_HUMAN	L	545	ENSP00000272117:P545L;ENSP00000411152:P545L;ENSP00000355748:P545L	ENSP00000272117:P545L	P	-	2	0	ITPKB	224990149	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.825000	0.04433	-0.164000	0.10927	-0.339000	0.08088	CCG	G|1.000;A|0.000		0.597	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
KANSL1	284058	hgsc.bcm.edu;bcgsc.ca	37	17	44109416	44109416	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr17:44109416T>C	ENST00000262419.6	-	14	3557	c.3087A>G	c.(3085-3087)gaA>gaG	p.E1029E	KANSL1_ENST00000572904.1_Silent_p.E1029E|KANSL1_ENST00000432791.1_Silent_p.E1029E|KANSL1_ENST00000393476.3_Silent_p.E323E|KANSL1_ENST00000574590.1_Silent_p.E1029E|KANSL1_ENST00000575318.1_Silent_p.E965E	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	1029	Sufficient for interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CCCTTACCTGTTCATCCAGCC	0.617																																					p.E1029E		.											.	.	.	0			c.A3087G						.						56.0	49.0	52.0					17																	44109416		2203	4300	6503	SO:0001819	synonymous_variant	284058	exon14			TACCTGTTCATCC	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.3087A>G	17.37:g.44109416T>C		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_001193466	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Silent	SNP	ENST00000262419.6	37	CCDS11503.1																																																																																			.		0.617	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
KIAA0196	9897	hgsc.bcm.edu;bcgsc.ca	37	8	126052109	126052109	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr8:126052109A>G	ENST00000318410.7	-	24	3231	c.2882T>C	c.(2881-2883)aTt>aCt	p.I961T	KIAA0196-AS1_ENST00000519140.1_RNA|KIAA0196_ENST00000517845.1_Missense_Mutation_p.I813T	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	961					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TTCATTGGCAATCTGTTGTCT	0.428																																					p.I961T		.											.	KIAA0196	92	0			c.T2882C						.						76.0	70.0	72.0					8																	126052109		2203	4300	6503	SO:0001583	missense	9897	exon24			TTGGCAATCTGTT		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.2882T>C	8.37:g.126052109A>G	ENSP00000318016:p.Ile961Thr	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	ENST00000318410.7	37	CCDS6355.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.497961	0.85069	.	.	ENSG00000164961	ENST00000318410;ENST00000517845	D;D	0.91351	-2.83;-2.83	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.95834	0.8644	M	0.86651	2.83	0.80722	D	1	D;P	0.89917	1.0;0.901	D;P	0.83275	0.996;0.559	D	0.96516	0.9382	10	0.87932	D	0	-21.0437	15.7714	0.78173	1.0:0.0:0.0:0.0	.	813;961	E7EQI7;Q12768	.;STRUM_HUMAN	T	961;813	ENSP00000318016:I961T;ENSP00000429676:I813T	ENSP00000318016:I961T	I	-	2	0	KIAA0196	126121291	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.299000	0.96137	2.127000	0.65507	0.459000	0.35465	ATT	.		0.428	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
KIF19	124602	hgsc.bcm.edu;bcgsc.ca	37	17	72350520	72350520	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr17:72350520A>G	ENST00000389916.4	+	18	2666	c.2528A>G	c.(2527-2529)gAg>gGg	p.E843G	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	843					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GCTGCCAGTGAGGACAACCTG	0.697																																					p.E843G		.											.	KIF19	90	0			c.A2528G						.						11.0	14.0	13.0					17																	72350520		1946	4108	6054	SO:0001583	missense	124602	exon18			CCAGTGAGGACAA	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2528A>G	17.37:g.72350520A>G	ENSP00000374566:p.Glu843Gly	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	A	19.92	3.915684	0.73098	.	.	ENSG00000196169	ENST00000389916	T	0.74632	-0.86	5.06	5.06	0.68205	.	.	.	.	.	T	0.67239	0.2872	L	0.54323	1.7	0.37026	D	0.896437	P	0.39665	0.682	B	0.32980	0.156	T	0.72239	-0.4351	9	0.32370	T	0.25	.	14.5258	0.67887	1.0:0.0:0.0:0.0	.	843	Q2TAC6	KIF19_HUMAN	G	843	ENSP00000374566:E843G	ENSP00000374566:E843G	E	+	2	0	KIF19	69862115	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.488000	0.66869	1.915000	0.55452	0.454000	0.30748	GAG	.		0.697	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
KIR2DL3	3804	hgsc.bcm.edu;bcgsc.ca	37	19	55263169	55263169	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:55263169T>C	ENST00000342376.3	+	6	815	c.784T>C	c.(784-786)Ttc>Ctc	p.F262L	CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL3_ENST00000434419.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR3DL1_ENST00000538269.1_Intron	NM_015868.2	NP_056952.2	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3	262					immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		cctcctcctcttctttctcct	0.512																																					p.F262L		.											.	KIR2DL3	92	0			c.T784C						.						137.0	112.0	121.0					19																	55263169		1408	2560	3968	SO:0001583	missense	3804	exon6			CTCCTCTTCTTTC	L41268	CCDS33107.1	19q13.4	2013-01-29				ENSG00000243772		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6331	protein-coding gene	gene with protein product		604938				7749980, 8662091	Standard	XM_006725426		Approved	cl-6, nkat2, nkat2a, nkat2b, p58, CD158B2		P43628	OTTHUMG00000065887	ENST00000342376.3:c.784T>C	19.37:g.55263169T>C	ENSP00000342215:p.Phe262Leu	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	5.0	NM_015868	O43472|P78402|Q14944|Q14945|Q9UM51|Q9UQ70	Missense_Mutation	SNP	ENST00000342376.3	37	CCDS33107.1	.	.	.	.	.	.	.	.	.	.	T	8.827	0.939009	0.18281	.	.	ENSG00000243772	ENST00000342376	T	0.00455	7.31	0.635	0.635	0.17723	.	.	.	.	.	T	0.00384	0.0012	N	0.25094	0.71	0.09310	N	0.999999	B;P;B;B	0.46395	0.0;0.877;0.001;0.001	B;P;B;B	0.51866	0.001;0.682;0.005;0.005	T	0.57248	-0.7844	8	0.62326	D	0.03	.	.	.	.	.	262;164;262;262	E3NZD7;P43628-2;P43628;E3NZD8	.;.;KI2L3_HUMAN;.	L	262	ENSP00000342215:F262L	ENSP00000342215:F262L	F	+	1	0	KIR2DL3	59954981	0.007000	0.16637	0.061000	0.19648	0.079000	0.17450	-0.023000	0.12456	0.516000	0.28340	0.248000	0.18094	TTC	.		0.512	KIR2DL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000141150.1		
LATS1	9113	hgsc.bcm.edu;bcgsc.ca	37	6	149997708	149997708	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:149997708T>C	ENST00000543571.1	-	6	3306	c.2759A>G	c.(2758-2760)gAa>gGa	p.E920G	LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Missense_Mutation_p.E920G	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TAGCAACACTTCAGGTGCAAT	0.448																																					p.E920G		.											.	LATS1	992	0			c.A2759G						.						65.0	65.0	65.0					6																	149997708		2203	4300	6503	SO:0001583	missense	9113	exon6			AACACTTCAGGTG	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.2759A>G	6.37:g.149997708T>C	ENSP00000437550:p.Glu920Gly	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_004690		Missense_Mutation	SNP	ENST00000543571.1	37	CCDS34551.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.799498	0.90538	.	.	ENSG00000131023	ENST00000543571;ENST00000253339	T;T	0.38887	1.11;1.11	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.70011	0.3175	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80058	-0.1541	9	.	.	.	.	16.1708	0.81812	0.0:0.0:0.0:1.0	.	920	O95835	LATS1_HUMAN	G	920	ENSP00000437550:E920G;ENSP00000253339:E920G	.	E	-	2	0	LATS1	150039401	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.698000	0.84413	2.225000	0.72522	0.533000	0.62120	GAA	.		0.448	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
LCT	3938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	136594658	136594658	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr2:136594658A>G	ENST00000264162.2	-	1	92	c.82T>C	c.(82-84)Ttc>Ctc	p.F28L		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	28					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GTGGAAATGAAATTTCTATCA	0.468																																					p.F28L		.											.	LCT	101	0			c.T82C						.						51.0	52.0	52.0					2																	136594658		2203	4300	6503	SO:0001583	missense	3938	exon1			AAATGAAATTTCT	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.82T>C	2.37:g.136594658A>G	ENSP00000264162:p.Phe28Leu	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	42.0	NM_002299	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	a	13.41	2.230199	0.39399	.	.	ENSG00000115850	ENST00000264162	T	0.31769	1.48	5.16	3.98	0.46160	Glycoside hydrolase, superfamily (1);	0.130956	0.51477	D	0.000090	T	0.20455	0.0492	L	0.36672	1.1	0.38355	D	0.944447	P	0.49090	0.919	B	0.37550	0.253	T	0.07214	-1.0784	10	0.18710	T	0.47	-21.1719	12.0775	0.53652	0.8559:0.1441:0.0:0.0	.	28	P09848	LPH_HUMAN	L	28	ENSP00000264162:F28L	ENSP00000264162:F28L	F	-	1	0	LCT	136311128	0.995000	0.38212	0.875000	0.34327	0.149000	0.21700	3.430000	0.52807	0.944000	0.37579	0.529000	0.55759	TTC	.		0.468	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
LEPR	3953	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	66067119	66067119	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:66067119A>C	ENST00000349533.6	+	9	1224	c.1039A>C	c.(1039-1041)Aat>Cat	p.N347H	LEPR_ENST00000371059.3_Missense_Mutation_p.N347H|LEPR_ENST00000371060.3_Missense_Mutation_p.N347H|LEPR_ENST00000344610.8_Missense_Mutation_p.N347H|LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371058.1_Missense_Mutation_p.N347H	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TGTTGGGTCTAATGTTTCTTT	0.343																																					p.N347H		.											.	LEPR	91	0			c.A1039C						.						123.0	118.0	120.0					1																	66067119		2203	4300	6503	SO:0001583	missense	3953	exon9			GGGTCTAATGTTT	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.1039A>C	1.37:g.66067119A>C	ENSP00000330393:p.Asn347His	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	29.0	NM_001003680	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	A	16.20	3.056426	0.55325	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37	4.98	4.98	0.66077	Immunoglobulin-like (1);Immunoglobulin C2-set-like, ligand-binding (1);Immunoglobulin-like fold (1);	0.277175	0.45606	D	0.000356	D	0.86916	0.6048	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.991	D	0.88639	0.3174	10	0.66056	D	0.02	-24.6842	14.8343	0.70172	1.0:0.0:0.0:0.0	.	347;347;347	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	H	347	ENSP00000340884:N347H;ENSP00000330393:N347H;ENSP00000360099:N347H;ENSP00000360098:N347H;ENSP00000360097:N347H	ENSP00000340884:N347H	N	+	1	0	LEPR	65839707	1.000000	0.71417	0.436000	0.26797	0.618000	0.37518	6.549000	0.73900	2.087000	0.62958	0.533000	0.62120	AAT	.		0.343	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
LIG1	3978	hgsc.bcm.edu;bcgsc.ca	37	19	48665558	48665558	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:48665558T>C	ENST00000263274.7	-	3	487	c.68A>G	c.(67-69)gAg>gGg	p.E23G	LIG1_ENST00000427526.2_Intron|LIG1_ENST00000599165.1_5'UTR|LIG1_ENST00000536218.1_Missense_Mutation_p.E23G	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	23					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	ATTGGATGCCTCCTTCTCAGG	0.458								Nucleotide excision repair (NER)																													p.E23G		.											.	LIG1	722	0			c.A68G						.						193.0	186.0	188.0					19																	48665558		2203	4300	6503	SO:0001583	missense	3978	exon3			GATGCCTCCTTCT		CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.68A>G	19.37:g.48665558T>C	ENSP00000263274:p.Glu23Gly	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	5.0	NM_000234	B2RAI8|Q2TB12|Q32P23	Missense_Mutation	SNP	ENST00000263274.7	37	CCDS12711.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.220080	0.58560	.	.	ENSG00000105486	ENST00000263274;ENST00000544761;ENST00000536218;ENST00000542460	T;T;T	0.56611	0.49;0.45;1.89	4.23	3.1	0.35709	.	0.610961	0.15354	N	0.266809	T	0.40694	0.1127	L	0.60455	1.87	0.27667	N	0.946872	B;B	0.34290	0.447;0.201	B;B	0.26969	0.075;0.039	T	0.21177	-1.0253	10	0.24483	T	0.36	-21.4369	7.1349	0.25523	0.0:0.0:0.2299:0.7701	.	23;23	F5GZ28;P18858	.;DNLI1_HUMAN	G	23;55;23;23	ENSP00000263274:E23G;ENSP00000441531:E23G;ENSP00000445928:E23G	ENSP00000263274:E23G	E	-	2	0	LIG1	53357370	0.953000	0.32496	0.893000	0.35052	0.961000	0.63080	1.800000	0.38833	1.850000	0.53721	0.533000	0.62120	GAG	.		0.458	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465575.1	NM_000234	
LPAR5	57121	hgsc.bcm.edu;bcgsc.ca	37	12	6729711	6729711	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:6729711A>G	ENST00000329858.4	-	2	1460	c.704T>C	c.(703-705)cTc>cCc	p.L235P	LPAR5_ENST00000431922.1_Missense_Mutation_p.L235P|LPAR5_ENST00000540335.1_5'UTR	NM_020400.5	NP_065133.1	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7						AGCCAGCAGGAGGCGCACGGT	0.701																																					p.L235P	NSCLC(74;891 2312 37538)	.											.	LPAR5	70	0			c.T704C						.						10.0	6.0	8.0					12																	6729711		2113	4105	6218	SO:0001583	missense	57121	exon2			AGCAGGAGGCGCA	AJ272207	CCDS8553.1	12p13.31	2012-08-08	2008-04-11	2008-04-11		ENSG00000184574		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	13307	protein-coding gene	gene with protein product		606926	"""G protein-coupled receptor 92"""	GPR93, GPR92		11062477, 11574155, 16774927, 16651401	Standard	NM_020400		Approved	KPG_010, LPA5	uc009zer.2	Q9H1C0		ENST00000329858.4:c.704T>C	12.37:g.6729711A>G	ENSP00000327875:p.Leu235Pro	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	4.0	NM_001142961		Missense_Mutation	SNP	ENST00000329858.4	37	CCDS8553.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.152688	0.78001	.	.	ENSG00000184574	ENST00000329858;ENST00000431922;ENST00000435659	T;T	0.40225	1.04;1.04	4.93	4.93	0.64822	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000039	T	0.70124	0.3188	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.77869	-0.2427	10	0.87932	D	0	.	14.7338	0.69402	1.0:0.0:0.0:0.0	.	235	Q9H1C0	LPAR5_HUMAN	P	235	ENSP00000327875:L235P;ENSP00000393098:L235P	ENSP00000327875:L235P	L	-	2	0	LPAR5	6599972	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	4.770000	0.62309	2.077000	0.62373	0.459000	0.35465	CTC	.		0.701	LPAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400699.1	NM_020400	
MACC1	346389	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	20198917	20198917	+	Missense_Mutation	SNP	G	G	A	rs143555326	byFrequency	TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr7:20198917G>A	ENST00000400331.5	-	5	1375	c.1067C>T	c.(1066-1068)cCg>cTg	p.P356L	MACC1_ENST00000332878.4_Missense_Mutation_p.P356L|MACC1_ENST00000589011.1_Missense_Mutation_p.P356L	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	356					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						AGCTGGTGACGGAAGAGCTTT	0.398																																					p.P356L		.											.	MACC1	93	0			c.C1067T						.	T	LEU/PRO	0,4406		0,0,2203	60.0	55.0	57.0		1067	-3.3	0.0	7	dbSNP_134	57	8,8592		0,8,4292	yes	missense	MACC1	NM_182762.3	98	0,8,6495	AA,AG,GG		0.093,0.0,0.0615	benign	356/853	20198917	8,12998	2203	4300	6503	SO:0001583	missense	346389	exon5			GGTGACGGAAGAG		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.1067C>T	7.37:g.20198917G>A	ENSP00000383185:p.Pro356Leu	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	52.0	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	T	9.111	1.006467	0.19199	0.0	9.3E-4	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.08720	3.06;3.06	5.72	-3.3	0.05003	.	0.477219	0.25558	N	0.029851	T	0.01835	0.0058	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36138	-0.9760	10	0.21540	T	0.41	0.8336	1.5024	0.02479	0.2145:0.1181:0.3105:0.3569	.	356	Q6ZN28	MACC1_HUMAN	L	356	ENSP00000383185:P356L;ENSP00000328410:P356L	ENSP00000328410:P356L	P	-	2	0	MACC1	20165442	0.968000	0.33430	0.000000	0.03702	0.160000	0.22226	1.184000	0.32053	-0.798000	0.04444	-0.335000	0.08231	CCG	A|0.001;G|0.999;T|0.000		0.398	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
LRRN3	54674	hgsc.bcm.edu;bcgsc.ca	37	7	110764583	110764583	+	Silent	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr7:110764583A>G	ENST00000422987.3	+	2	2586	c.1755A>G	c.(1753-1755)ccA>ccG	p.P585P	IMMP2L_ENST00000450877.1_Intron|LRRN3_ENST00000451085.1_Silent_p.P585P|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000331762.3_Intron|LRRN3_ENST00000308478.5_Silent_p.P585P|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000452895.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	585	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		ATCTGAATCCATCAACTGAGT	0.358																																					p.P585P		.											.	LRRN3	154	0			c.A1755G						.						50.0	47.0	48.0					7																	110764583		2203	4300	6503	SO:0001819	synonymous_variant	54674	exon2			GAATCCATCAACT	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1755A>G	7.37:g.110764583A>G		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	4.0	NM_018334	O43377|Q6I9V8|Q8IYQ6	Silent	SNP	ENST00000422987.3	37	CCDS5754.1																																																																																			.		0.358	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
MAML3	55534	hgsc.bcm.edu;bcgsc.ca	37	4	140811105	140811105	+	Silent	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:140811105C>T	ENST00000509479.2	-	2	2341	c.1485G>A	c.(1483-1485)caG>caA	p.Q495Q	MAML3_ENST00000398940.1_Silent_p.Q34Q|MAML3_ENST00000327122.5_Silent_p.Q339Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.537																																					p.Q495Q		.											.	MAML3	455	0			c.G1485A						.						13.0	18.0	17.0					4																	140811105		2146	4255	6401	SO:0001819	synonymous_variant	55534	exon2			CTGCTGCTGCTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1485G>A	4.37:g.140811105C>T		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	19.0	NM_018717		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																			.		0.537	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
MAP3K5	4217	hgsc.bcm.edu;bcgsc.ca	37	6	136935403	136935403	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:136935403T>C	ENST00000359015.4	-	16	2532	c.2172A>G	c.(2170-2172)gaA>gaG	p.E724E	MAP3K5_ENST00000355845.4_5'UTR	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	724	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		ATGCTATTTCTTCATGCAGGG	0.353																																					p.E724E		.											.	MAP3K5	982	0			c.A2172G						.						171.0	166.0	168.0					6																	136935403		2203	4300	6503	SO:0001819	synonymous_variant	4217	exon16			TATTTCTTCATGC	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.2172A>G	6.37:g.136935403T>C		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_005923	A6NIA0|B4DGB2|Q5THN3|Q99461	Silent	SNP	ENST00000359015.4	37	CCDS5179.1																																																																																			.		0.353	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		
MBD1	4152	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	18	47801526	47801526	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr18:47801526T>C	ENST00000591416.1	-	9	1313	c.882A>G	c.(880-882)ccA>ccG	p.P294P	MBD1_ENST00000588937.1_Silent_p.P294P|MBD1_ENST00000436910.1_Silent_p.P294P|MBD1_ENST00000457839.2_Silent_p.P319P|MBD1_ENST00000398493.1_Silent_p.P294P|MBD1_ENST00000269471.5_Silent_p.P294P|MBD1_ENST00000585595.1_Silent_p.P319P|MBD1_ENST00000382948.5_Silent_p.P294P|MBD1_ENST00000590208.1_Silent_p.P294P|MBD1_ENST00000347968.3_Silent_p.P294P|MBD1_ENST00000591535.1_Silent_p.P294P|MBD1_ENST00000398495.2_Silent_p.P319P|MBD1_ENST00000585672.1_Silent_p.P245P|MBD1_ENST00000339998.6_Silent_p.P294P|MBD1_ENST00000424334.2_Silent_p.P345P|MBD1_ENST00000398488.1_Silent_p.P294P|MBD1_ENST00000349085.2_Silent_p.P294P|MBD1_ENST00000353909.3_Silent_p.P245P|MBD1_ENST00000269468.5_Silent_p.P294P|MBD1_ENST00000587605.1_Silent_p.P294P			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	294	Pro-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						GGGACTGTGATGGGGGTGGTG	0.657																																					p.P319P		.											.	MBD1	228	0			c.A957G						.						36.0	44.0	41.0					18																	47801526		2203	4300	6503	SO:0001819	synonymous_variant	4152	exon10			CTGTGATGGGGGT	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.882A>G	18.37:g.47801526T>C		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	35.0	NM_001204137	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Silent	SNP	ENST00000591416.1	37	CCDS11943.1																																																																																			.		0.657	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
MCM3AP	8888	hgsc.bcm.edu;bcgsc.ca	37	21	47685325	47685325	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr21:47685325T>C	ENST00000397708.1	-	13	3398	c.3144A>G	c.(3142-3144)gcA>gcG	p.A1048A	MCM3AP_ENST00000291688.1_Silent_p.A1048A			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1048					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					ACGGGGTCAGTGCCAGGACAG	0.647																																					p.A1048A		.											.	MCM3AP	291	0			c.A3144G						.						73.0	69.0	71.0					21																	47685325		2203	4300	6503	SO:0001819	synonymous_variant	8888	exon12			GGTCAGTGCCAGG	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.3144A>G	21.37:g.47685325T>C		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	4.0	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	37	CCDS13734.1																																																																																			.		0.647	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
MFSD9	84804	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	103334977	103334978	+	Frame_Shift_Ins	INS	-	-	G	rs145424077	byFrequency	TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr2:103334977_103334978insG	ENST00000258436.5	-	6	1369_1370	c.1326_1327insC	c.(1324-1329)cccagcfs	p.S443fs	MFSD9_ENST00000496253.1_5'Flank	NM_032718.3	NP_116107.3	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing 9	443					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(3)|large_intestine(7)|liver(1)|lung(6)|ovary(2)|skin(1)	20						GCGCCCAGGCTGGGGGGGCCGC	0.554																																					p.S443fs		.											.	MFSD9	155	0			c.1327_1328insC						.																																			SO:0001589	frameshift_variant	84804	exon6			CCAGGCTGGGGGG		CCDS2063.1	2q12.1	2007-01-12			ENSG00000135953	ENSG00000135953			28158	protein-coding gene	gene with protein product							Standard	NM_032718		Approved	MGC11332	uc002tcb.2	Q8NBP5	OTTHUMG00000130781	ENST00000258436.5:c.1327dupC	2.37:g.103334984_103334984dupG	ENSP00000258436:p.Ser443fs	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	23.0	NM_032718	Q4ZG89|Q53TU0|Q96GQ4|Q9BRI8	Frame_Shift_Ins	INS	ENST00000258436.5	37	CCDS2063.1																																																																																			.		0.554	MFSD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253295.2	NM_032718	
MPDZ	8777	hgsc.bcm.edu;bcgsc.ca	37	9	13168371	13168371	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr9:13168371T>C	ENST00000319217.7	-	22	3495	c.3248A>G	c.(3247-3249)gAc>gGc	p.D1083G	MPDZ_ENST00000447879.1_Missense_Mutation_p.D1083G|MPDZ_ENST00000538841.1_5'Flank|MPDZ_ENST00000536827.1_Missense_Mutation_p.D1083G|MPDZ_ENST00000546205.1_Missense_Mutation_p.D1083G|MPDZ_ENST00000541718.1_Missense_Mutation_p.D1083G|MPDZ_ENST00000381022.2_Missense_Mutation_p.D1083G|MPDZ_ENST00000381015.4_Missense_Mutation_p.D1083G	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1083	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TTACTTTATGTCAGGGCCAAT	0.388																																					p.D1083G		.											.	MPDZ	231	0			c.A3248G						.						173.0	165.0	168.0					9																	13168371		1880	4122	6002	SO:0001583	missense	8777	exon22			TTTATGTCAGGGC	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.3248A>G	9.37:g.13168371T>C	ENSP00000320006:p.Asp1083Gly	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	5.0	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	T	21.1	4.101891	0.76983	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000545857;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13;1.13;1.13	5.23	4.1	0.47936	.	0.000000	0.45867	D	0.000322	T	0.55386	0.1917	L	0.61218	1.895	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.999	P;D;D	0.70227	0.848;0.968;0.928	T	0.51348	-0.8717	10	0.17832	T	0.49	.	10.9259	0.47191	0.0:0.0737:0.0:0.9263	.	1083;1083;1083	B7ZMI4;O75970-3;O75970-2	.;.;.	G	1083;1083;1083;89;1083;1083;1083;1033;1083	ENSP00000320006:D1083G;ENSP00000439807:D1083G;ENSP00000370410:D1083G;ENSP00000444230:D89G;ENSP00000444151:D1083G;ENSP00000415208:D1083G;ENSP00000370403:D1083G;ENSP00000446358:D1083G	ENSP00000320006:D1083G	D	-	2	0	MPDZ	13158371	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	7.655000	0.83696	0.936000	0.37367	0.460000	0.39030	GAC	.		0.388	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
MROH6	642475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144654667	144654667	+	Missense_Mutation	SNP	G	G	A	rs368816807		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr8:144654667G>A	ENST00000398882.3	-	1	474	c.218C>T	c.(217-219)gCc>gTc	p.A73V	RP11-661A12.9_ENST00000531730.1_RNA|NAPRT1_ENST00000460623.1_5'Flank|MROH6_ENST00000533679.1_5'Flank	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	73																	AGGGACGGTGGCCCCACGTCC	0.682																																					p.A73V		.											.	.	.	0			c.C218T						.		VAL/ALA	0,3968		0,0,1984	15.0	20.0	19.0		218	1.4	0.0	8		19	1,8303		0,1,4151	no	missense	C8orf73	NM_001100878.1	64	0,1,6135	AA,AG,GG		0.012,0.0,0.0081	benign	73/720	144654667	1,12271	1984	4152	6136	SO:0001583	missense	642475	exon1			ACGGTGGCCCCAC	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.218C>T	8.37:g.144654667G>A	ENSP00000381857:p.Ala73Val	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	16.0	NM_001100878	A8MWB1	Missense_Mutation	SNP	ENST00000398882.3	37	CCDS47928.1	.	.	.	.	.	.	.	.	.	.	g	12.09	1.835002	0.32421	0.0	1.2E-4	ENSG00000204839	ENST00000398882;ENST00000529971	T;T	0.24151	4.3;1.87	3.8	1.37	0.22104	.	.	.	.	.	T	0.12050	0.0293	N	0.14661	0.345	0.19775	N	0.999953	B;B	0.19331	0.035;0.002	B;B	0.14023	0.01;0.003	T	0.32587	-0.9901	9	0.23302	T	0.38	-2.2287	4.1419	0.10198	0.1943:0.2146:0.5911:0.0	.	73;73	E9PPP7;A6NGR9	.;CH073_HUMAN	V	73	ENSP00000381857:A73V;ENSP00000436959:A73V	ENSP00000381857:A73V	A	-	2	0	C8orf73	144725810	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.207000	0.09384	0.133000	0.18654	0.558000	0.71614	GCC	.		0.682	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
MTMR3	8897	hgsc.bcm.edu;bcgsc.ca	37	22	30387534	30387534	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr22:30387534A>G	ENST00000401950.2	+	7	677	c.335A>G	c.(334-336)aAg>aGg	p.K112R	MTMR3_ENST00000406629.1_Missense_Mutation_p.K112R|MTMR3_ENST00000415511.1_3'UTR|MTMR3_ENST00000323630.5_5'UTR|MTMR3_ENST00000351488.3_Missense_Mutation_p.K112R|MTMR3_ENST00000333027.3_Missense_Mutation_p.K112R	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	112					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			GAGTGGCTGAAGAGACTGAAC	0.413																																					p.K112R		.											.	MTMR3	292	0			c.A335G						.						119.0	103.0	108.0					22																	30387534		2203	4300	6503	SO:0001583	missense	8897	exon7			GGCTGAAGAGACT	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.335A>G	22.37:g.30387534A>G	ENSP00000384651:p.Lys112Arg	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	5.0	NM_153050	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	ENST00000401950.2	37	CCDS13870.1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.040850	0.35989	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000445401;ENST00000351488;ENST00000406629	D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.76630	0.4014	L	0.32530	0.975	0.80722	D	1	P;B;P	0.40302	0.712;0.125;0.712	B;B;B	0.38683	0.279;0.05;0.279	T	0.77270	-0.2650	10	0.40728	T	0.16	.	15.3779	0.74625	1.0:0.0:0.0:0.0	.	112;112;112	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	R	112	ENSP00000384651:K112R;ENSP00000331649:K112R;ENSP00000409063:K112R;ENSP00000307271:K112R;ENSP00000384077:K112R	ENSP00000331649:K112R	K	+	2	0	MTMR3	28717534	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.225000	0.72522	0.533000	0.62120	AAG	.		0.413	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
MUC16	94025	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9089471	9089471	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:9089471G>C	ENST00000397910.4	-	1	2547	c.2344C>G	c.(2344-2346)Cct>Gct	p.P782A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	782	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACTCTTTCAGGACTTGTTGCT	0.507																																					p.P782A		.											.	MUC16	566	0			c.C2344G						.						232.0	224.0	227.0					19																	9089471		2020	4191	6211	SO:0001583	missense	94025	exon1			TTTCAGGACTTGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2344C>G	19.37:g.9089471G>C	ENSP00000381008:p.Pro782Ala	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	66.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	0.547	-0.851007	0.02651	.	.	ENSG00000181143	ENST00000397910	T	0.03094	4.05	1.56	-3.12	0.05282	.	.	.	.	.	T	0.01661	0.0053	N	0.03608	-0.345	.	.	.	B	0.15473	0.013	B	0.09377	0.004	T	0.44421	-0.9329	8	0.87932	D	0	.	4.2204	0.10554	0.0:0.2703:0.4022:0.3275	.	782	B5ME49	.	A	782	ENSP00000381008:P782A	ENSP00000381008:P782A	P	-	1	0	MUC16	8950471	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-2.843000	0.00736	-1.645000	0.01515	0.205000	0.17691	CCT	.		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
N4BP2	55728	hgsc.bcm.edu;bcgsc.ca	37	4	40121838	40121838	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:40121838A>G	ENST00000261435.6	+	9	2523	c.2107A>G	c.(2107-2109)Ata>Gta	p.I703V		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	703					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AAACGAGCAAATAGAAATGGT	0.368																																					p.I703V		.											.	N4BP2	602	0			c.A2107G						.						91.0	98.0	96.0					4																	40121838		2203	4300	6503	SO:0001583	missense	55728	exon9			GAGCAAATAGAAA	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2107A>G	4.37:g.40121838A>G	ENSP00000261435:p.Ile703Val	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	4.0	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0|0	-2.687186|-2.687186	0.00100|0.00100	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000261435;ENST00000381804|ENST00000513269	T|.	0.15603|.	2.41|.	5.19|5.19	2.35|2.35	0.29111|0.29111	.|.	1.190420|.	0.06024|.	N|.	0.651874|.	T|T	0.06962|0.06962	0.0177|0.0177	N|N	0.00436|0.00436	-1.5|-1.5	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.36040|0.36040	-0.9764|-0.9764	10|5	0.02654|.	T|.	1|.	-1.4195|-1.4195	3.628|3.628	0.08120|0.08120	0.0837:0.1441:0.4759:0.2963|0.0837:0.1441:0.4759:0.2963	.|.	703;703|.	Q86UW6-2;Q86UW6|.	.;N4BP2_HUMAN|.	V|S	703;623|349	ENSP00000261435:I703V|.	ENSP00000261435:I703V|.	I|N	+|+	1|2	0|0	N4BP2|N4BP2	39798233|39798233	0.000000|0.000000	0.05858|0.05858	0.126000|0.126000	0.21872|0.21872	0.037000|0.037000	0.13140|0.13140	0.156000|0.156000	0.16382|0.16382	0.151000|0.151000	0.19162|0.19162	-0.375000|-0.375000	0.07067|0.07067	ATA|AAT	.		0.368	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
NAA25	80018	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	112479858	112479858	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:112479858G>C	ENST00000261745.4	-	20	2673	c.2425C>G	c.(2425-2427)Cta>Gta	p.L809V		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	809						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						AACTGGTCTAGTAAAGACTTA	0.318																																					p.L809V		.											.	NAA25	155	0			c.C2425G						.						86.0	80.0	82.0					12																	112479858		2188	4297	6485	SO:0001583	missense	80018	exon20			GGTCTAGTAAAGA	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.2425C>G	12.37:g.112479858G>C	ENSP00000261745:p.Leu809Val	Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	6.0	NM_024953	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	ENST00000261745.4	37	CCDS9159.1	.	.	.	.	.	.	.	.	.	.	G	9.682	1.149581	0.21288	.	.	ENSG00000111300	ENST00000261745;ENST00000550701	T	0.26223	1.75	5.9	2.78	0.32641	.	0.157403	0.44902	D	0.000416	T	0.11707	0.0285	N	0.17082	0.46	0.29966	N	0.818958	B	0.06786	0.001	B	0.08055	0.003	T	0.15378	-1.0439	10	0.25106	T	0.35	-6.2634	2.4052	0.04411	0.2487:0.1231:0.5018:0.1265	.	809	Q14CX7	NAA25_HUMAN	V	809;15	ENSP00000261745:L809V	ENSP00000261745:L809V	L	-	1	2	NAA25	110964241	0.996000	0.38824	1.000000	0.80357	0.844000	0.47949	0.198000	0.17217	0.265000	0.21872	0.655000	0.94253	CTA	.		0.318	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953	
NAALADL2	254827	hgsc.bcm.edu;bcgsc.ca	37	3	175181236	175181236	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:175181236A>G	ENST00000454872.1	+	7	1410	c.1282A>G	c.(1282-1284)Aca>Gca	p.T428A	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	428						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		AAAATTGAAAACAGTTACTAA	0.284																																					p.T428A		.											.	NAALADL2	47	0			c.A1282G						.						75.0	75.0	75.0					3																	175181236		1827	4079	5906	SO:0001583	missense	254827	exon7			TTGAAAACAGTTA		CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1282A>G	3.37:g.175181236A>G	ENSP00000404705:p.Thr428Ala	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_207015	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	ENST00000454872.1	37	CCDS46960.1	.	.	.	.	.	.	.	.	.	.	A	2.054	-0.417083	0.04766	.	.	ENSG00000177694	ENST00000454872	T	0.44083	0.93	5.23	2.84	0.33178	.	0.222920	0.40064	N	0.001200	T	0.28267	0.0698	L	0.32530	0.975	0.20196	N	0.999926	B	0.13145	0.007	B	0.09377	0.004	T	0.15780	-1.0425	10	0.34782	T	0.22	-6.3495	7.6056	0.28100	0.7624:0.0:0.2375:0.0	.	428	Q58DX5	NADL2_HUMAN	A	428	ENSP00000404705:T428A	ENSP00000404705:T428A	T	+	1	0	NAALADL2	176663930	1.000000	0.71417	0.085000	0.20634	0.056000	0.15407	2.002000	0.40835	0.397000	0.25310	-0.371000	0.07208	ACA	.		0.284	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	
NAF1	92345	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	164085383	164085383	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:164085383C>G	ENST00000274054.2	-	2	719	c.526G>C	c.(526-528)Gaa>Caa	p.E176Q	NAF1_ENST00000422287.2_Missense_Mutation_p.E176Q	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	176					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				AGAAGTAATTCATCTTTTGTT	0.308																																					p.E176Q		.											.	NAF1	70	0			c.G526C						.						29.0	31.0	30.0					4																	164085383		2200	4299	6499	SO:0001583	missense	92345	exon2			GTAATTCATCTTT		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.526G>C	4.37:g.164085383C>G	ENSP00000274054:p.Glu176Gln	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	11.0	NM_138386	D3DP28|E9PAZ2	Missense_Mutation	SNP	ENST00000274054.2	37	CCDS3803.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943608	0.73672	.	.	ENSG00000145414	ENST00000422287;ENST00000274054	T;T	0.54279	0.78;0.58	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.71576	0.3356	M	0.74881	2.28	0.51012	D	0.999908	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	T	0.74682	-0.3583	10	0.87932	D	0	-27.7111	14.4072	0.67090	0.0:1.0:0.0:0.0	.	176;176	E9PAZ2;Q96HR8	.;NAF1_HUMAN	Q	176	ENSP00000408963:E176Q;ENSP00000274054:E176Q	ENSP00000274054:E176Q	E	-	1	0	NAF1	164304833	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.939000	0.56591	2.678000	0.91216	0.591000	0.81541	GAA	.		0.308	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386	
NBPF3	84224	hgsc.bcm.edu;mdanderson.org	37	1	21806573	21806573	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:21806573A>G	ENST00000318249.5	+	11	1588	c.1238A>G	c.(1237-1239)gAg>gGg	p.E413G	NBPF3_ENST00000454000.2_Missense_Mutation_p.E343G|NBPF3_ENST00000342104.5_Missense_Mutation_p.E401G|NBPF3_ENST00000318220.6_Missense_Mutation_p.E357G	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	413	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.E413G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GATGAGAAAGAGCCTGAAGTC	0.463																																					p.F413C		.											.	NBPF3	92	1	Substitution - Missense(1)	endometrium(1)	c.T1238G						.						38.0	29.0	33.0					1																	21806573		2167	3971	6138	SO:0001583	missense	84224	exon11			AGAAAGAGCCTGA	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1238A>G	1.37:g.21806573A>G	ENSP00000316782:p.Glu413Gly	Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	37.0	NM_032264	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	6.316	0.426410	0.11987	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41	0.658	0.658	0.17855	DUF1220 (2);	.	.	.	.	T	0.12689	0.0308	L	0.37850	1.14	0.09310	N	1	B;B;B	0.12013	0.005;0.0;0.004	B;B;B	0.23150	0.044;0.001;0.008	T	0.31724	-0.9933	8	0.31617	T	0.26	.	.	.	.	.	343;401;413	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	G	343;357;413;401;357	ENSP00000415711:E343G;ENSP00000316739:E357G;ENSP00000316782:E413G;ENSP00000340336:E401G;ENSP00000391865:E357G	ENSP00000316739:E357G	E	+	2	0	NBPF3	21679160	0.005000	0.15991	0.004000	0.12327	0.308000	0.27856	0.130000	0.15850	0.565000	0.29255	0.102000	0.15555	GAG	.		0.463	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264	
NEK3	4752	hgsc.bcm.edu;bcgsc.ca	37	13	52707932	52707932	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr13:52707932T>C	ENST00000400357.2	-	13	2571	c.1278A>G	c.(1276-1278)aaA>aaG	p.K426K	NEK3_ENST00000378101.2_Silent_p.K443K|NEK3_ENST00000339406.3_Silent_p.K443K|NEK3_ENST00000452082.2_Silent_p.K447K			P51956	NEK3_HUMAN	NIMA-related kinase 3	443					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		ACAGGGGGCCTTTCAAGAACC	0.413																																					p.K443K		.											.	NEK3	359	0			c.A1329G						.						39.0	37.0	38.0					13																	52707932		1868	4110	5978	SO:0001819	synonymous_variant	4752	exon15			GGGGCCTTTCAAG	AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000400357.2:c.1278A>G	13.37:g.52707932T>C		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_002498	A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Silent	SNP	ENST00000400357.2	37	CCDS53871.1																																																																																			.		0.413	NEK3-002	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045047.3		
NLRP14	338323	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7092523	7092523	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:7092523G>T	ENST00000299481.4	+	12	3612	c.3266G>T	c.(3265-3267)tGg>tTg	p.W1089L		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	1089					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GATGTGTCTTGGTGGTGGTGT	0.368																																					p.W1089L		.											.	NLRP14	295	0			c.G3266T						.						121.0	115.0	117.0					11																	7092523		2201	4296	6497	SO:0001583	missense	338323	exon12			TGTCTTGGTGGTG	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.3266G>T	11.37:g.7092523G>T	ENSP00000299481:p.Trp1089Leu	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	22.0	NM_176822	Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974465	0.53720	.	.	ENSG00000158077	ENST00000299481	T	0.70045	-0.45	4.17	3.26	0.37387	.	0.000000	0.41712	D	0.000823	T	0.72374	0.3452	L	0.46157	1.445	0.32892	D	0.511986	D	0.89917	1.0	D	0.80764	0.994	T	0.77175	-0.2684	10	0.66056	D	0.02	.	7.8046	0.29195	0.1123:0.0:0.8877:0.0	.	1089	Q86W24	NAL14_HUMAN	L	1089	ENSP00000299481:W1089L	ENSP00000299481:W1089L	W	+	2	0	NLRP14	7049099	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	1.000000	0.29770	1.354000	0.45846	0.655000	0.94253	TGG	.		0.368	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
NR1H2	7376	hgsc.bcm.edu;bcgsc.ca	37	19	50881825	50881825	+	Silent	SNP	G	G	A	rs55817866	byFrequency	TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:50881825G>A	ENST00000253727.5	+	6	754	c.519G>A	c.(517-519)caG>caA	p.Q173Q	NR1H2_ENST00000593926.1_Silent_p.Q173Q|NR1H2_ENST00000411902.2_Silent_p.Q76Q|NR1H2_ENST00000599105.1_Silent_p.Q173Q|NR1H2_ENST00000598168.1_Silent_p.Q173Q|NR1H2_ENST00000542413.1_5'UTR	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	173					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TTCGGAAACAGCAGCAGGAGT	0.637																																					p.Q173Q		.											.	NR1H2	186	0			c.G519A						.						38.0	47.0	44.0					19																	50881825		2140	4249	6389	SO:0001819	synonymous_variant	7376	exon6			GAAACAGCAGCAG	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.519G>A	19.37:g.50881825G>A		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	36.0	NM_007121	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	ENST00000253727.5	37	CCDS42593.1																																																																																			G|0.903;A|0.097		0.637	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
NLRP2	55655	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	55508725	55508725	+	Missense_Mutation	SNP	C	C	A	rs61735074	byFrequency	TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:55508725C>A	ENST00000543010.1	+	12	3063	c.2920C>A	c.(2920-2922)Ctc>Atc	p.L974I	NLRP2_ENST00000263437.6_Missense_Mutation_p.L971I|NLRP2_ENST00000448584.2_Missense_Mutation_p.L974I|NLRP2_ENST00000537859.1_Missense_Mutation_p.L952I|NLRP2_ENST00000538819.1_Missense_Mutation_p.L950I|NLRP2_ENST00000391721.4_Missense_Mutation_p.L950I|NLRP2_ENST00000427260.2_Missense_Mutation_p.L951I|NLRP2_ENST00000339757.7_Missense_Mutation_p.L952I	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	974					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TTGTGAAGACCTCTGCTCTGC	0.542																																					p.L974I		.											.	NLRP2	120	0			c.C2920A						.						187.0	157.0	167.0					19																	55508725		2203	4300	6503	SO:0001583	missense	55655	exon12			GAAGACCTCTGCT	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2920C>A	19.37:g.55508725C>A	ENSP00000445135:p.Leu974Ile	Somatic	232.0	0.0		WXS	Illumina HiSeq	Phase_I	321.0	157.0	NM_017852	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.214248	0.39102	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0;-0.0;-0.0;-0.0;-0.0	3.2	0.921	0.19403	.	.	.	.	.	T	0.70745	0.3259	M	0.65320	2	0.09310	N	1	D;D;D;D;D	0.71674	0.998;0.994;0.994;0.994;0.99	D;D;D;D;D	0.70935	0.971;0.971;0.917;0.971;0.936	T	0.57142	-0.7862	9	0.59425	D	0.04	.	5.7987	0.18401	0.0:0.7173:0.0:0.2827	.	951;952;971;950;974	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	I	974;950;952;974;952;951;950;971	ENSP00000445135:L974I;ENSP00000375601:L950I;ENSP00000344074:L952I;ENSP00000409370:L974I;ENSP00000440601:L952I;ENSP00000402474:L951I;ENSP00000441133:L950I;ENSP00000263437:L971I	ENSP00000263437:L971I	L	+	1	0	NLRP2	60200537	0.195000	0.23338	0.014000	0.15608	0.031000	0.12232	1.773000	0.38563	0.153000	0.19213	0.561000	0.74099	CTC	C|0.982;G|0.018		0.542	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852	
OR10J5	127385	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	159505581	159505581	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:159505581A>T	ENST00000334857.2	-	1	261	c.217T>A	c.(217-219)Tac>Aac	p.Y73N		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	73						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					ACCAGTGTGTACACCGTCTCT	0.428																																					p.Y73N		.											.	OR10J5	71	0			c.T217A						.						170.0	136.0	148.0					1																	159505581		2203	4300	6503	SO:0001583	missense	127385	exon1			GTGTGTACACCGT		CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.217T>A	1.37:g.159505581A>T	ENSP00000334441:p.Tyr73Asn	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	206.0	41.0	NM_001004469	B9EH35|Q6IFH2	Missense_Mutation	SNP	ENST00000334857.2	37	CCDS30910.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.981560	0.34942	.	.	ENSG00000184155	ENST00000334857	T	0.00397	7.57	4.31	4.31	0.51392	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00784	0.0026	H	0.94345	3.525	0.35231	D	0.77694	D	0.89917	1.0	D	0.91635	0.999	T	0.22068	-1.0227	9	0.87932	D	0	.	11.7208	0.51680	1.0:0.0:0.0:0.0	.	73	Q8NHC4	O10J5_HUMAN	N	73	ENSP00000334441:Y73N	ENSP00000334441:Y73N	Y	-	1	0	OR10J5	157772205	0.030000	0.19436	0.510000	0.27712	0.058000	0.15608	2.989000	0.49393	1.923000	0.55706	0.377000	0.23210	TAC	.		0.428	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059021.1	NM_001004469	
OR11G2	390439	hgsc.bcm.edu;bcgsc.ca	37	14	20666182	20666182	+	Missense_Mutation	SNP	G	G	A	rs77471263		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr14:20666182G>A	ENST00000357366.3	+	1	688	c.688G>A	c.(688-690)Ggc>Agc	p.G230S		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TTGCAAAAAAGGCCCTGTGAT	0.458																																					p.G230S		.											.	OR11G2	70	0			c.G688A						.						137.0	136.0	136.0					14																	20666182		2203	4300	6503	SO:0001583	missense	390439	exon1			AAAAAAGGCCCTG		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.688G>A	14.37:g.20666182G>A	ENSP00000349930:p.Gly230Ser	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	22.0	NM_001005503	Q6IF09|Q96R33	Missense_Mutation	SNP	ENST00000357366.3	37	CCDS32032.1	.	.	.	.	.	.	.	.	.	.	g	3.284	-0.146469	0.06627	.	.	ENSG00000196832	ENST00000357366	T	0.00029	8.91	4.93	-0.555	0.11807	GPCR, rhodopsin-like superfamily (1);	0.809795	0.10548	N	0.661787	T	0.00039	0.0001	N	0.00746	-1.225	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04115	-1.0976	10	0.48119	T	0.1	.	4.3832	0.11304	0.0809:0.1204:0.2455:0.5532	rs55781225;rs59982948	230	Q8NGC1	O11G2_HUMAN	S	230	ENSP00000349930:G230S	ENSP00000349930:G230S	G	+	1	0	OR11G2	19736022	0.000000	0.05858	0.002000	0.10522	0.062000	0.15995	-0.406000	0.07187	-0.288000	0.09051	-0.271000	0.10264	GGC	.		0.458	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1		
OR6A2	8590	hgsc.bcm.edu;bcgsc.ca	37	11	6816516	6816516	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:6816516T>C	ENST00000332601.3	-	1	612	c.424A>G	c.(424-426)Agt>Ggt	p.S142G		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	142					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AGCCGGCCACTGACAATGACT	0.517																																					p.S142G		.											.	OR6A2	94	0			c.A424G						.						62.0	62.0	62.0					11																	6816516		2201	4296	6497	SO:0001583	missense	8590	exon1			GGCCACTGACAAT	AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.424A>G	11.37:g.6816516T>C	ENSP00000330384:p.Ser142Gly	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_003696	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	ENST00000332601.3	37	CCDS7772.1	.	.	.	.	.	.	.	.	.	.	T	11.30	1.597517	0.28445	.	.	ENSG00000184933	ENST00000332601	T	0.01998	4.51	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.278035	0.31145	N	0.008167	T	0.03871	0.0109	L	0.59912	1.85	0.36081	D	0.842809	B	0.10296	0.003	B	0.09377	0.004	T	0.19451	-1.0305	10	0.52906	T	0.07	.	13.1051	0.59244	0.0:0.0:0.0:1.0	.	142	O95222	OR6A2_HUMAN	G	142	ENSP00000330384:S142G	ENSP00000330384:S142G	S	-	1	0	OR6A2	6773092	0.762000	0.28451	0.345000	0.25642	0.081000	0.17604	0.895000	0.28363	2.264000	0.75181	0.533000	0.62120	AGT	.		0.517	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385981.1	NM_003696	
OR6C70	390327	hgsc.bcm.edu;bcgsc.ca	37	12	55863303	55863303	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:55863303A>G	ENST00000327335.4	-	1	619	c.620T>C	c.(619-621)gTc>gCc	p.V207A	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA	NM_001005499.1	NP_001005499.1	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C, member 70	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	18						AAACAATGTGACAATAAGTGT	0.358																																					p.V207A		.											.	OR6C70	69	0			c.T620C						.						118.0	123.0	121.0					12																	55863303		2203	4300	6503	SO:0001583	missense	390327	exon1			AATGTGACAATAA		CCDS31825.1	12q13.2	2013-09-23			ENSG00000184954	ENSG00000184954		"""GPCR / Class A : Olfactory receptors"""	31299	protein-coding gene	gene with protein product							Standard	NM_001005499		Approved		uc010spn.2	A6NIJ9	OTTHUMG00000171127	ENST00000327335.4:c.620T>C	12.37:g.55863303A>G	ENSP00000329153:p.Val207Ala	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	6.0	NM_001005499		Missense_Mutation	SNP	ENST00000327335.4	37	CCDS31825.1	.	.	.	.	.	.	.	.	.	.	A	8.759	0.923233	0.18056	.	.	ENSG00000184954	ENST00000327335	T	0.39229	1.09	4.13	1.73	0.24493	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000303	T	0.44307	0.1287	L	0.45581	1.43	0.09310	N	1	D	0.55385	0.971	P	0.60068	0.868	T	0.32161	-0.9917	10	0.72032	D	0.01	.	1.6624	0.02795	0.5567:0.1394:0.1685:0.1354	.	207	A6NIJ9	O6C70_HUMAN	A	207	ENSP00000329153:V207A	ENSP00000329153:V207A	V	-	2	0	OR6C70	54149570	0.000000	0.05858	0.026000	0.17262	0.003000	0.03518	0.258000	0.18387	0.255000	0.21593	-0.253000	0.11424	GTC	.		0.358	OR6C70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411820.1		
OSBPL3	26031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	24911688	24911688	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr7:24911688C>T	ENST00000313367.2	-	3	548	c.97G>A	c.(97-99)Gac>Aac	p.D33N	OSBPL3_ENST00000431825.2_Splice_Site_p.D33N|OSBPL3_ENST00000409069.1_Splice_Site_p.D33N|OSBPL3_ENST00000396429.1_Splice_Site_p.D33N|OSBPL3_ENST00000352860.1_Splice_Site_p.D33N|OSBPL3_ENST00000396431.1_Splice_Site_p.D33N|OSBPL3_ENST00000353930.1_Splice_Site_p.D33N	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	33					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						TCCCAGCTGTCCTGTTCCAAC	0.413																																					p.D33N		.											.	OSBPL3	204	0			c.G97A						.						86.0	80.0	82.0					7																	24911688		2203	4300	6503	SO:0001630	splice_region_variant	26031	exon3			AGCTGTCCTGTTC	AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.97-1G>A	7.37:g.24911688C>T		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	46.0	NM_145321	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Missense_Mutation	SNP	ENST00000313367.2	37	CCDS5390.1	.	.	.	.	.	.	.	.	.	.	C	34	5.328783	0.95733	.	.	ENSG00000070882	ENST00000313367;ENST00000352860;ENST00000353930;ENST00000431825;ENST00000396431;ENST00000396429;ENST00000409069;ENST00000415162;ENST00000441059;ENST00000415952	T;T;T;T;T;T;T;T;T;T	0.30714	2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76;1.52	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.57213	0.2038	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.48779	-0.9005	10	0.42905	T	0.14	-2.2432	20.5407	0.99260	0.0:1.0:0.0:0.0	.	33;33;33;33	Q9H4L5-4;Q9H4L5-2;Q9H4L5-3;Q9H4L5	.;.;.;OSBL3_HUMAN	N	33	ENSP00000315410:D33N;ENSP00000315331:D33N;ENSP00000315277:D33N;ENSP00000389779:D33N;ENSP00000379708:D33N;ENSP00000379706:D33N;ENSP00000386953:D33N;ENSP00000407829:D33N;ENSP00000403374:D33N;ENSP00000411249:D33N	ENSP00000315410:D33N	D	-	1	0	OSBPL3	24878213	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.380000	0.79704	2.865000	0.98341	0.655000	0.94253	GAC	.		0.413	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		Missense_Mutation
PAN3	255967	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	28854573	28854573	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr13:28854573G>C	ENST00000380958.3	+	16	2366	c.2214G>C	c.(2212-2214)agG>agC	p.R738S	PAN3_ENST00000282391.5_Missense_Mutation_p.R426S|PAN3_ENST00000399613.1_Missense_Mutation_p.R538S	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		ACCAAAACAGGATGCGAAGTG	0.378																																					p.R738S		.											.	PAN3	69	0			c.G2214C						.						142.0	125.0	131.0					13																	28854573		2203	4300	6503	SO:0001583	missense	255967	exon16			AAACAGGATGCGA	AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.2214G>C	13.37:g.28854573G>C	ENSP00000370345:p.Arg738Ser	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	49.0	NM_175854		Missense_Mutation	SNP	ENST00000380958.3	37	CCDS9329.2	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827725	0.71143	.	.	ENSG00000152520	ENST00000380958;ENST00000399613;ENST00000282391	T;T;T	0.41758	0.99;0.99;0.99	5.74	2.98	0.34508	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.57315	0.2045	M	0.71206	2.165	0.80722	D	1	D;D;D	0.71674	0.998;0.982;0.998	D;P;D	0.70487	0.969;0.873;0.937	T	0.51980	-0.8636	10	0.27785	T	0.31	-12.9652	10.1084	0.42548	0.2872:0.0:0.7128:0.0	.	738;426;684	Q58A45;Q58A45-2;Q58A45-3	PAN3_HUMAN;.;.	S	738;538;426	ENSP00000370345:R738S;ENSP00000382522:R538S;ENSP00000282391:R426S	ENSP00000282391:R426S	R	+	3	2	PAN3	27752573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.656000	0.24948	0.402000	0.25451	0.561000	0.74099	AGG	.		0.378	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854	
PAX9	5083	hgsc.bcm.edu;bcgsc.ca	37	14	37132384	37132384	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr14:37132384G>A	ENST00000361487.6	+	2	512	c.287G>A	c.(286-288)gGc>gAc	p.G96D	PAX9_ENST00000402703.2_Missense_Mutation_p.G96D|PAX9_ENST00000554201.1_5'UTR			P55771	PAX9_HUMAN	paired box 9	96	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				cellular response to growth factor stimulus (GO:0071363)|endoderm development (GO:0007492)|face morphogenesis (GO:0060325)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|regulation of odontogenesis (GO:0042481)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(3)	12	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		AGAGACCCCGGCATCTTCGCC	0.647																																					p.G96D		.											.	PAX9	228	0			c.G287A						.						64.0	67.0	66.0					14																	37132384		2203	4300	6503	SO:0001583	missense	5083	exon3			ACCCCGGCATCTT	AJ238381	CCDS9662.1	14q13.3	2007-07-12	2007-07-12		ENSG00000198807	ENSG00000198807		"""Paired boxes"""	8623	protein-coding gene	gene with protein product		167416	"""paired box gene 9"""			7981748	Standard	NM_006194		Approved		uc001wty.4	P55771	OTTHUMG00000140251	ENST00000361487.6:c.287G>A	14.37:g.37132384G>A	ENSP00000355245:p.Gly96Asp	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	11.0	NM_006194	Q99582|Q9UQR4	Missense_Mutation	SNP	ENST00000361487.6	37	CCDS9662.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961383	0.92791	.	.	ENSG00000198807	ENST00000402703;ENST00000361487	D;D	0.99245	-5.62;-5.62	5.21	5.21	0.72293	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99387	0.9784	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99177	1.0866	10	0.87932	D	0	.	18.742	0.91777	0.0:0.0:1.0:0.0	.	96	P55771	PAX9_HUMAN	D	96	ENSP00000384817:G96D;ENSP00000355245:G96D	ENSP00000355245:G96D	G	+	2	0	PAX9	36202135	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.440000	0.82611	0.561000	0.74099	GGC	.		0.647	PAX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276733.2		
PCDH7	5099	ucsc.edu;bcgsc.ca;mdanderson.org	37	4	30921790	30921790	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:30921790A>G	ENST00000543491.1	+	2	3190	c.3190A>G	c.(3190-3192)Acg>Gcg	p.T1064A	PCDH7_ENST00000509925.1_3'UTR			O60245	PCDH7_HUMAN	protocadherin 7	0					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TCGTAGAGTGACGTTTTCTGT	0.403																																					p.T1064A		.											.	PCDH7	229	0			c.A3190G						.						76.0	80.0	79.0					4																	30921790		2029	4185	6214	SO:0001583	missense	5099	exon2			AGAGTGACGTTTT	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000543491.1:c.3190A>G	4.37:g.30921790A>G	ENSP00000441802:p.Thr1064Ala	Somatic	168.0	1.0		WXS	Illumina HiSeq	.	188.0	67.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000543491.1	37	CCDS54753.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.0|21.0	4.080793|4.080793	0.76528|0.76528	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000543491;ENST00000333135	.|T	.|0.55052	.|0.54	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	.|.	.|.	.|.	.|.	T|T	0.73040|0.73040	0.3536|0.3536	M|M	0.78801|0.78801	2.425|2.425	0.51767|0.51767	D|D	0.999931|0.999931	.|D;P	.|0.69078	.|0.997;0.868	.|D;P	.|0.70935	.|0.971;0.491	T|T	0.75665|0.75665	-0.3239|-0.3239	5|9	.|0.56958	.|D	.|0.05	.|.	16.3322|16.3322	0.83039|0.83039	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1064;1017	.|F5GWJ1;O60245-3	.|.;.	G|A	753|1064;1017	.|ENSP00000441802:T1064A	.|ENSP00000330302:T1017A	D|T	+|+	2|1	0|0	PCDH7|PCDH7	30530888|30530888	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.962000|8.962000	0.93254|0.93254	2.251000|2.251000	0.74343|0.74343	0.528000|0.528000	0.53228|0.53228	GAC|ACG	.		0.403	PCDH7-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032457, NM_002589	
PCDH8	5100	hgsc.bcm.edu;bcgsc.ca	37	13	53418699	53418699	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr13:53418699A>G	ENST00000377942.3	-	3	3412	c.3209T>C	c.(3208-3210)gTg>gCg	p.V1070A	PCDH8_ENST00000338862.4_Missense_Mutation_p.V973A	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	1070					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		ATGGGATTACACATTTTCATT	0.502																																					p.V1070A	GBM(36;25 841 9273 49207)	.											.	PCDH8	153	0			c.T3209C						.						52.0	56.0	55.0					13																	53418699		2203	4300	6503	SO:0001583	missense	5100	exon3			GATTACACATTTT	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.3209T>C	13.37:g.53418699A>G	ENSP00000367177:p.Val1070Ala	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	4.0	NM_002590	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	A	12.79	2.043593	0.36085	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.56444	0.55;0.46	6.07	6.07	0.98685	.	0.000000	0.39834	N	0.001257	T	0.23210	0.0561	N	0.02011	-0.69	0.25048	N	0.991151	B;B	0.09022	0.001;0.002	B;B	0.10450	0.005;0.002	T	0.04255	-1.0965	10	0.87932	D	0	.	2.867	0.05604	0.6247:0.1518:0.0785:0.145	.	973;1070	O95206-2;O95206	.;PCDH8_HUMAN	A	1070;973;596;913	ENSP00000367177:V1070A;ENSP00000341350:V973A	ENSP00000341350:V973A	V	-	2	0	PCDH8	52316700	0.653000	0.27358	1.000000	0.80357	0.988000	0.76386	0.862000	0.27899	2.326000	0.78906	0.533000	0.62120	GTG	.		0.502	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
PDLIM7	9260	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176910650	176910650	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:176910650C>G	ENST00000355841.2	-	13	1435	c.1369G>C	c.(1369-1371)Gtg>Ctg	p.V457L	PDLIM7_ENST00000356618.4_3'UTR|PDLIM7_ENST00000359895.2_Missense_Mutation_p.V423L|PDLIM7_ENST00000505746.1_5'Flank	NM_005451.3	NP_005442.2	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 (enigma)	457	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|receptor-mediated endocytosis (GO:0006898)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ruffle (GO:0001726)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGGCTCACACATGAGAGAAG	0.582																																					p.V457L		.											.	PDLIM7	153	0			c.G1369C						.						71.0	68.0	69.0					5																	176910650		2203	4300	6503	SO:0001583	missense	9260	exon13			CTCACACATGAGA	BC001093	CCDS4422.1, CCDS4423.1, CCDS4424.1	5q35.3	2008-02-05			ENSG00000196923	ENSG00000196923			22958	protein-coding gene	gene with protein product		605903				11874232	Standard	NM_005451		Approved	ENIGMA	uc003mhc.1	Q9NR12	OTTHUMG00000130853	ENST00000355841.2:c.1369G>C	5.37:g.176910650C>G	ENSP00000348099:p.Val457Leu	Somatic	206.0	0.0		WXS	Illumina HiSeq	Phase_I	277.0	104.0	NM_005451	Q14250|Q5XG82|Q6NVZ5|Q96C91|Q9BXB8|Q9BXB9	Missense_Mutation	SNP	ENST00000355841.2	37	CCDS4422.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.007169	0.93287	.	.	ENSG00000196923	ENST00000359895;ENST00000355841	T;T	0.49720	0.88;0.77	5.53	5.53	0.82687	Zinc finger, LIM-type (1);	0.000000	0.47455	D	0.000239	T	0.52108	0.1714	N	0.08118	0	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	T	0.63225	-0.6685	10	0.66056	D	0.02	.	19.128	0.93393	0.0:1.0:0.0:0.0	.	457;423	Q9NR12;Q9NR12-2	PDLI7_HUMAN;.	L	423;457	ENSP00000352964:V423L;ENSP00000348099:V457L	ENSP00000348099:V457L	V	-	1	0	PDLIM7	176843256	0.999000	0.42202	0.977000	0.42913	0.833000	0.47200	5.471000	0.66762	2.625000	0.88918	0.650000	0.86243	GTG	.		0.582	PDLIM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253423.1	NM_005451	
PDX1	3651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	28494372	28494372	+	Missense_Mutation	SNP	C	C	A	rs192902098	byFrequency	TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr13:28494372C>A	ENST00000381033.4	+	1	216	c.97C>A	c.(97-99)Cct>Act	p.P33T	PDX1-AS1_ENST00000499662.2_RNA	NM_000209.3	NP_000200.1	O00330	ODPX_HUMAN	pancreatic and duodenal homeobox 1	0					cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)					all_cancers(110;0.175)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		CGCCAGCCCCCCTGCGTGCCT	0.736													C|||	15	0.00299521	0.0	0.0014	5008	,	,		9273	0.0		0.004	False		,,,				2504	0.0102				p.P33T		.											.	PDX1	514	0			c.C97A	GRCh37	CM056344	PDX1	M	rs192902098	.						5.0	4.0	4.0					13																	28494372		1817	3544	5361	SO:0001583	missense	3651	exon1			AGCCCCCCTGCGT	AF035260	CCDS9327.1	13q12.1	2012-03-09	2006-12-01	2006-12-01	ENSG00000139515	ENSG00000139515		"""Homeoboxes / ANTP class : HOXL subclass"""	6107	protein-coding gene	gene with protein product	"""somatostatin transcription factor 1"""	600733	"""insulin promoter factor 1, homeodomain transcription factor"""	IPF1		7590740	Standard	NM_000209		Approved	IDX-1, STF-1, PDX-1, MODY4	uc001urt.2	P52945	OTTHUMG00000016638	ENST00000381033.4:c.97C>A	13.37:g.28494372C>A	ENSP00000370421:p.Pro33Thr	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	11.0	5.0	NM_000209	B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	ENST00000381033.4	37	CCDS9327.1	7	0.003205128205128205	2	0.0040650406504065045	1	0.0027624309392265192	0	0.0	4	0.005277044854881266	C	33	5.259449	0.95368	.	.	ENSG00000139515	ENST00000381033	D	0.92858	-3.12	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.94748	0.8305	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94311	0.7545	10	0.59425	D	0.04	.	18.9138	0.92496	0.0:1.0:0.0:0.0	.	33	P52945	PDX1_HUMAN	T	33	ENSP00000370421:P33T	ENSP00000370421:P33T	P	+	1	0	PDX1	27392372	1.000000	0.71417	0.998000	0.56505	0.901000	0.52897	7.177000	0.77650	2.578000	0.87016	0.561000	0.74099	CCT	C|0.997;A|0.003		0.736	PDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044310.2	NM_000209	
PHB	5245	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	47489105	47489105	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr17:47489105T>C	ENST00000300408.3	-	3	257	c.185A>G	c.(184-186)cAg>cGg	p.Q62R	RP11-81K2.1_ENST00000576461.1_Intron|PHB_ENST00000508009.1_Intron|PHB_ENST00000511832.1_Missense_Mutation_p.Q62R	NM_001281496.1|NM_001281715.1|NM_002634.2	NP_001268425.1|NP_001268644.1|NP_002625.1	P35232	PHB_HUMAN	prohibitin	62					cellular response to interleukin-6 (GO:0071354)|DNA replication (GO:0006260)|histone deacetylation (GO:0016575)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone receptor signaling pathway (GO:0050847)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|transcription regulatory region DNA binding (GO:0044212)			endometrium(4)|large_intestine(2)|lung(4)	10	all_cancers(4;2.62e-14)|Breast(4;4.21e-29)|all_epithelial(4;6.9e-18)		Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)			AATTGGTTTCTGTACCCACGG	0.502																																					p.Q62R		.											.	PHB	90	0			c.A185G						.						98.0	70.0	79.0					17																	47489105		2203	4300	6503	SO:0001583	missense	5245	exon3			GGTTTCTGTACCC		CCDS11548.1, CCDS62244.1	17q21	2010-11-25			ENSG00000167085	ENSG00000167085			8912	protein-coding gene	gene with protein product		176705				10376528, 8244394	Standard	NM_001281496		Approved	PHB1	uc002iox.1	P35232	OTTHUMG00000134271	ENST00000300408.3:c.185A>G	17.37:g.47489105T>C	ENSP00000300408:p.Gln62Arg	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	26.0	NM_002634	B4DY47|Q4VBQ0	Missense_Mutation	SNP	ENST00000300408.3	37	CCDS11548.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.378621	0.82682	.	.	ENSG00000167085	ENST00000300408;ENST00000511832;ENST00000419140;ENST00000504124;ENST00000512041;ENST00000446735;ENST00000434917	D;D;D;D;D;D;D	0.94376	-3.28;-3.28;-3.28;-3.28;-3.28;-3.28;-3.41	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.94938	0.8363	M	0.87547	2.89	0.80722	D	1	P	0.40909	0.732	B	0.44163	0.443	D	0.95543	0.8614	10	0.87932	D	0	.	15.3327	0.74226	0.0:0.0:0.0:1.0	.	62	P35232	PHB_HUMAN	R	62	ENSP00000300408:Q62R;ENSP00000425035:Q62R;ENSP00000393320:Q62R;ENSP00000426433:Q62R;ENSP00000422182:Q62R;ENSP00000407828:Q62R;ENSP00000410680:Q62R	ENSP00000300408:Q62R	Q	-	2	0	PHB	44844104	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.988000	0.88194	2.095000	0.63458	0.460000	0.39030	CAG	.		0.502	PHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258826.1	NM_002634	
PIK3R1	5295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	67575562	67575565	+	Splice_Site	DEL	GTTT	GTTT	-			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	GTTT	GTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:67575562_67575565delGTTT	ENST00000521381.1	+	5	1250		c.e5+1		PIK3R1_ENST00000274335.5_Splice_Site|PIK3R1_ENST00000396611.1_Splice_Site|PIK3R1_ENST00000521657.1_Splice_Site	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)						B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TTAGCTCCAGGTTTGTTTTTTCTC	0.397			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											.		.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1	4332	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	.						.																																			SO:0001630	splice_region_variant	5295	.			CTCCAGGTTTGTT	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.634+1GTTT>-	5.37:g.67575566_67575569delGTTT		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	34.0	.	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Splice_Site	DEL	ENST00000521381.1	37	CCDS3993.1																																																																																			.		0.397	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	Intron
PITPNM1	9600	hgsc.bcm.edu;bcgsc.ca	37	11	67261213	67261213	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:67261213A>G	ENST00000534749.1	-	20	3292	c.3104T>C	c.(3103-3105)gTc>gCc	p.V1035A	PITPNM1_ENST00000356404.3_Missense_Mutation_p.V1035A|PITPNM1_ENST00000436757.2_Missense_Mutation_p.V1034A|PITPNM1_ENST00000526450.1_5'UTR			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	1035					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						CATGATGGAGACGCTGGCGGT	0.667																																					p.V1035A	GBM(28;144 709 4607 5525)	.											.	PITPNM1	227	0			c.T3104C						.						26.0	23.0	24.0					11																	67261213		2092	4115	6207	SO:0001583	missense	9600	exon21			ATGGAGACGCTGG	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.3104T>C	11.37:g.67261213A>G	ENSP00000437286:p.Val1035Ala	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	10.0	NM_004910	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	37	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	A	29.6	5.022898	0.93462	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.78246	-1.16;-1.16;-1.16	4.2	4.2	0.49525	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.000000	0.44097	D	0.000486	D	0.88351	0.6413	M	0.87180	2.865	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.993;0.994	D	0.90043	0.4143	10	0.72032	D	0.01	-42.8079	12.4022	0.55420	1.0:0.0:0.0:0.0	.	1034;1035	O00562-2;O00562	.;PITM1_HUMAN	A	1035;1034;1035	ENSP00000437286:V1035A;ENSP00000398787:V1034A;ENSP00000348772:V1035A	ENSP00000348772:V1035A	V	-	2	0	PITPNM1	67017789	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.283000	0.95860	1.673000	0.50895	0.402000	0.26972	GTC	.		0.667	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
PLCL1	5334	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	198950766	198950766	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr2:198950766T>A	ENST00000428675.1	+	2	2923	c.2525T>A	c.(2524-2526)tTt>tAt	p.F842Y	PLCL1_ENST00000437704.2_Missense_Mutation_p.F744Y	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	842					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	GTAACCCTTTTTGTCCACATA	0.458																																					p.F842Y		.											.	PLCL1	228	0			c.T2525A						.						150.0	125.0	133.0					2																	198950766		2203	4300	6503	SO:0001583	missense	5334	exon2			CCCTTTTTGTCCA	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2525T>A	2.37:g.198950766T>A	ENSP00000402861:p.Phe842Tyr	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	205.0	78.0	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	T	19.34	3.808520	0.70797	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.14640	2.49;2.49	5.41	5.41	0.78517	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000004	T	0.42630	0.1211	M	0.85945	2.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.43228	-0.9404	9	.	.	.	.	15.6048	0.76658	0.0:0.0:0.0:1.0	.	842;768	Q15111;B4DYZ4	PLCL1_HUMAN;.	Y	842;744	ENSP00000402861:F842Y;ENSP00000414138:F744Y	.	F	+	2	0	PLCL1	198659011	1.000000	0.71417	0.995000	0.50966	0.955000	0.61496	7.857000	0.86963	2.270000	0.75569	0.482000	0.46254	TTT	.		0.458	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
PLK2	10769	hgsc.bcm.edu;bcgsc.ca	37	5	57753128	57753128	+	Silent	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:57753128C>T	ENST00000274289.3	-	7	1188	c.888G>A	c.(886-888)agG>agA	p.R296R	PLK2_ENST00000502671.1_5'UTR	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	296	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		GCATTGTATACCTTGCTTCCC	0.433																																					p.R296R		.											.	PLK2	409	0			c.G888A						.						82.0	79.0	80.0					5																	57753128		2203	4300	6503	SO:0001819	synonymous_variant	10769	exon7			TGTATACCTTGCT		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.888G>A	5.37:g.57753128C>T		Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_006622	O60679|Q96CV7|Q9UE61	Silent	SNP	ENST00000274289.3	37	CCDS3974.1																																																																																			.		0.433	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214150.1	NM_006622	
PNLDC1	154197	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	160241522	160241522	+	Silent	SNP	G	G	A	rs144377714		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:160241522G>A	ENST00000610273.1	+	19	1707	c.1536G>A	c.(1534-1536)gcG>gcA	p.A512A	PNLDC1_ENST00000392167.3_Silent_p.A523A	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	512						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.A512A(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CCCTTCTCGCGTTCATCCTTG	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19156	0.0		0.0	False		,,,				2504	0.0				p.A512A		.											.	PNLDC1	90	1	Substitution - coding silent(1)	lung(1)	c.G1536A						.	G		1,4405	2.1+/-5.4	0,1,2202	140.0	112.0	121.0		1536	-10.4	0.0	6	dbSNP_134	121	0,8600		0,0,4300	no	coding-synonymous	PNLDC1	NM_173516.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		512/521	160241522	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	154197	exon19			TCTCGCGTTCATC	AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1536G>A	6.37:g.160241522G>A		Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	37.0	NM_173516	Q5TAP7|Q8N7X5	Silent	SNP	ENST00000610273.1	37	CCDS5271.1																																																																																			G|1.000;A|0.000		0.627	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516	
PPP2R3A	5523	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	135721003	135721003	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:135721003T>C	ENST00000264977.3	+	2	1280	c.663T>C	c.(661-663)gaT>gaC	p.D221D	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	221					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ATAAAATAGATAATTTTTCTT	0.333																																					p.D221D		.											.	PPP2R3A	662	0			c.T663C						.						43.0	48.0	46.0					3																	135721003		2184	4288	6472	SO:0001819	synonymous_variant	5523	exon2			AATAGATAATTTT	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.663T>C	3.37:g.135721003T>C		Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	14.0	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Silent	SNP	ENST00000264977.3	37	CCDS3087.1																																																																																			.		0.333	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
PRDM1	639	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106536122	106536122	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:106536122C>T	ENST00000369096.4	+	2	323	c.89C>T	c.(88-90)gCa>gTa	p.A30V	PRDM1_ENST00000369091.2_5'UTR	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	30					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CAGGGATTGGCAGAGGGGACC	0.517			"""D, N, Mis, F, S"""		DLBCL																																p.A30V		.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	862	0			c.C89T						.						93.0	82.0	86.0					6																	106536122		2203	4300	6503	SO:0001583	missense	639	exon2			GATTGGCAGAGGG		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.89C>T	6.37:g.106536122C>T	ENSP00000358092:p.Ala30Val	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	58.0	NM_001198	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	C	6.475	0.455764	0.12283	.	.	ENSG00000057657	ENST00000369096	T	0.07021	3.23	5.68	3.66	0.41972	.	.	.	.	.	T	0.00998	0.0033	N	0.02011	-0.69	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.42292	-0.9460	9	0.31617	T	0.26	-1.9257	4.8248	0.13410	0.0:0.5646:0.1843:0.251	.	30	O75626	PRDM1_HUMAN	V	30	ENSP00000358092:A30V	ENSP00000358092:A30V	A	+	2	0	PRDM1	106642815	0.749000	0.28305	0.999000	0.59377	0.644000	0.38419	0.020000	0.13466	1.402000	0.46780	0.655000	0.94253	GCA	.		0.517	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
PRDM1	639	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106553019	106553019	+	Silent	SNP	C	C	T	rs542551556		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:106553019C>T	ENST00000369096.4	+	5	1218	c.984C>T	c.(982-984)ccC>ccT	p.P328P	PRDM1_ENST00000369089.3_Silent_p.P194P|PRDM1_ENST00000369091.2_Silent_p.P292P	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	328					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CTCGCTCCCCCATTCCATCCT	0.607			"""D, N, Mis, F, S"""		DLBCL																																p.P328P		.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	862	0			c.C984T						.						76.0	70.0	72.0					6																	106553019		2203	4300	6503	SO:0001819	synonymous_variant	639	exon5			CTCCCCCATTCCA		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.984C>T	6.37:g.106553019C>T		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	18.0	NM_001198	B2REA6|E1P5E0|Q86WM7	Silent	SNP	ENST00000369096.4	37	CCDS5054.2																																																																																			.		0.607	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
PRMT9	90826	hgsc.bcm.edu;bcgsc.ca	37	4	148559833	148559833	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:148559833T>C	ENST00000322396.6	-	12	2630	c.2388A>G	c.(2386-2388)gaA>gaG	p.E796E	PRMT10_ENST00000541232.1_Silent_p.E683E|TMEM184C_ENST00000508208.1_Intron	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		796	SAM-dependent MTase PRMT-type 2. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						ACCTAATCTCTTCATCAAGGT	0.373																																					p.E796E		.											.	PRMT10	91	0			c.A2388G						.						89.0	81.0	84.0					4																	148559833		2203	4300	6503	SO:0001819	synonymous_variant	90826	exon12			AATCTCTTCATCA																												ENST00000322396.6:c.2388A>G	4.37:g.148559833T>C		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	4.0	NM_138364	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Silent	SNP	ENST00000322396.6	37	CCDS3771.1																																																																																			.		0.373	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		
ZNF512B	57473	hgsc.bcm.edu;bcgsc.ca	37	20	62614445	62614445	+	Intron	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr20:62614445T>C	ENST00000450537.1	-	2	56				PRPF6_ENST00000535781.1_Silent_p.D39D|ZNF512B_ENST00000217130.3_Intron			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCGCCCGTGATGCAAATGACC	0.577																																					p.D39D		.											.	PRPF6	70	0			c.T117C						.						83.0	69.0	74.0					20																	62614445		2203	4300	6503	SO:0001627	intron_variant	24148	exon2			CCGTGATGCAAAT	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-15137A>G	20.37:g.62614445T>C		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	5.0	NM_012469	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	CCDS13548.1																																																																																			.		0.577	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
PSME4	23198	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	54128608	54128608	+	Missense_Mutation	SNP	G	G	C	rs369867748		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr2:54128608G>C	ENST00000404125.1	-	28	3219	c.3164C>G	c.(3163-3165)gCg>gGg	p.A1055G	PSME4_ENST00000421748.2_Missense_Mutation_p.A199G	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1055					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AGAAACAATCGCTGGCCACGT	0.443																																					p.A1055G		.											.	PSME4	275	0			c.C3164G						.						143.0	136.0	138.0					2																	54128608		2203	4300	6503	SO:0001583	missense	23198	exon28			ACAATCGCTGGCC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.3164C>G	2.37:g.54128608G>C	ENSP00000384211:p.Ala1055Gly	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	43.0	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342604	0.82022	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.28069	1.63;1.69	5.6	5.6	0.85130	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	M	0.71581	2.175	0.80722	D	1	D;P;P	0.53151	0.958;0.783;0.93	P;P;P	0.54140	0.743;0.452;0.558	T	0.29212	-1.0019	10	0.21014	T	0.42	.	19.6148	0.95629	0.0:0.0:1.0:0.0	.	430;199;1055	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	G	199;1055	ENSP00000410830:A199G;ENSP00000384211:A1055G	ENSP00000384211:A1055G	A	-	2	0	PSME4	53982112	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.939000	0.87685	2.634000	0.89283	0.557000	0.71058	GCG	.		0.443	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
PTEN	5728	hgsc.bcm.edu;ucsc.edu	37	10	89717725	89717725	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr10:89717725T>A	ENST00000371953.3	+	7	2107	c.750T>A	c.(748-750)tgT>tgA	p.C250*	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	250	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.C250fs*2(5)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.C250*(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TACCTGTGTGTGGTGATATCA	0.403		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.C250X		.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,NS,carcinoma,0	PTEN	17735	54	Whole gene deletion(37)|Deletion - Frameshift(14)|Substitution - Nonsense(1)|Deletion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(10)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|endometrium(3)|breast(3)|ovary(3)|vulva(2)|urinary_tract(2)|large_intestine(1)|soft_tissue(1)	c.T750A						.						126.0	110.0	116.0					10																	89717725		2203	4300	6503	SO:0001587	stop_gained	5728	exon7	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	TGTGTGTGGTGAT	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.750T>A	10.37:g.89717725T>A	ENSP00000361021:p.Cys250*	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	49.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Nonsense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	T	48	14.739521	0.99808	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.15	4.02	0.46733	.	0.127565	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.1324	7.3482	0.26676	0.0:0.2568:0.0:0.7432	.	.	.	.	X	250	.	.	C	+	3	2	PTEN	89707705	0.990000	0.36364	1.000000	0.80357	0.991000	0.79684	0.211000	0.17474	0.801000	0.34066	0.477000	0.44152	TGT	.		0.403	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
PTPN13	5783	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	87556466	87556466	+	Silent	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:87556466A>G	ENST00000411767.2	+	2	120	c.57A>G	c.(55-57)gaA>gaG	p.E19E	PTPN13_ENST00000316707.6_Silent_p.E19E|PTPN13_ENST00000436978.1_Silent_p.E19E|PTPN13_ENST00000511467.1_Silent_p.E19E|PTPN13_ENST00000502971.1_Silent_p.E19E|PTPN13_ENST00000427191.2_Silent_p.E19E			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	19	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TTCAGGAGGAAGAAATATGGG	0.453																																					p.E19E		.											.	PTPN13	230	0			c.A57G						.						62.0	63.0	63.0					4																	87556466		1923	4129	6052	SO:0001819	synonymous_variant	5783	exon2			GGAGGAAGAAATA		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.57A>G	4.37:g.87556466A>G		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	38.0	NM_006264	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	ENST00000411767.2	37	CCDS47094.1																																																																																			.		0.453	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
PTPRC	5788	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	198678836	198678836	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:198678836A>G	ENST00000367376.2	+	11	1219	c.1048A>G	c.(1048-1050)Aaa>Gaa	p.K350E	PTPRC_ENST00000348564.6_Missense_Mutation_p.K191E|PTPRC_ENST00000594404.1_Missense_Mutation_p.K189E|PTPRC_ENST00000352140.3_Missense_Mutation_p.K302E|PTPRC_ENST00000442510.2_Missense_Mutation_p.K352E	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	350					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						ATTTGATAATAAAGAAATTAA	0.254																																					p.K352E		.											.	PTPRC	295	0			c.A1054G						.						29.0	35.0	33.0					1																	198678836		2139	4247	6386	SO:0001583	missense	5788	exon11			GATAATAAAGAAA	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1048A>G	1.37:g.198678836A>G	ENSP00000356346:p.Lys350Glu	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	130.0	NM_002838	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37		.	.	.	.	.	.	.	.	.	.	A	0.078	-1.189267	0.01607	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.02579	4.24	4.21	-3.39	0.04868	.	2.390670	0.01835	N	0.034923	T	0.01387	0.0045	N	0.03324	-0.35	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.001;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.001;0.0;0.0;0.0	T	0.43605	-0.9381	10	0.08381	T	0.77	.	5.4709	0.16670	0.3809:0.2846:0.3344:0.0	.	286;286;191;302;350	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	E	352;286;302;302;236;350;284;189	ENSP00000193532:K302E	ENSP00000306782:K189E	K	+	1	0	PTPRC	196945459	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.531000	0.00220	-1.197000	0.02673	-1.431000	0.01090	AAA	.		0.254	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
PVRL2	5819	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	45375206	45375206	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:45375206C>T	ENST00000252483.5	+	3	575	c.575C>T	c.(574-576)gCc>gTc	p.A192V	PVRL2_ENST00000252485.4_Missense_Mutation_p.A192V	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)	192	Ig-like C2-type 1.				acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		CGCCCACCTGCCCGGATCTCC	0.622																																					p.A192V		.											.	PVRL2	90	0			c.C575T						.						38.0	37.0	37.0					19																	45375206		2203	4300	6503	SO:0001583	missense	5819	exon3			CACCTGCCCGGAT	X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.575C>T	19.37:g.45375206C>T	ENSP00000252483:p.Ala192Val	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	16.0	NM_002856	A8K5L5|O75455|Q6IBI6|Q96J29	Missense_Mutation	SNP	ENST00000252483.5	37	CCDS42576.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737142	0.69304	.	.	ENSG00000130202	ENST00000252483;ENST00000252485	T;T	0.76709	-1.04;-1.04	4.25	4.25	0.50352	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000077	D	0.89687	0.6787	M	0.92923	3.36	0.42513	D	0.992971	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.993	D	0.91776	0.5431	10	0.87932	D	0	.	12.0078	0.53270	0.0:1.0:0.0:0.0	.	192;192	Q92692;Q92692-2	PVRL2_HUMAN;.	V	192	ENSP00000252483:A192V;ENSP00000252485:A192V	ENSP00000252483:A192V	A	+	2	0	PVRL2	50067046	0.937000	0.31787	0.990000	0.47175	0.576000	0.36127	3.927000	0.56499	2.190000	0.69967	0.561000	0.74099	GCC	.		0.622	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453231.1	NM_002856	
RANGAP1	5905	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	41645369	41645369	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr22:41645369C>A	ENST00000455915.2	-	14	3128	c.1659G>T	c.(1657-1659)aaG>aaT	p.K553N	RANGAP1_ENST00000407260.4_Missense_Mutation_p.K498N|RANGAP1_ENST00000405486.1_Missense_Mutation_p.K553N|RANGAP1_ENST00000356244.3_Missense_Mutation_p.K553N			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	553					mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GTGCAAGGGCCTTGGGGAAAT	0.602																																					p.K553N		.											.	RANGAP1	90	0			c.G1659T						.						72.0	60.0	64.0					22																	41645369		2203	4300	6503	SO:0001583	missense	5905	exon15			AAGGGCCTTGGGG	X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1659G>T	22.37:g.41645369C>A	ENSP00000401470:p.Lys553Asn	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	17.0	NM_002883	Q96JJ2	Missense_Mutation	SNP	ENST00000455915.2	37	CCDS14012.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852060	0.71719	.	.	ENSG00000100401	ENST00000405486;ENST00000356244;ENST00000405383;ENST00000455915;ENST00000407260	T;T;T;T	0.47528	0.84;0.84;0.84;1.3	5.4	5.4	0.78164	Ran-GTPase activating protein 1, C-terminal (3);	0.147294	0.64402	D	0.000013	T	0.61135	0.2323	M	0.72894	2.215	0.47584	D	0.999464	D;P	0.67145	0.996;0.928	D;P	0.63597	0.916;0.74	T	0.59241	-0.7491	10	0.30854	T	0.27	-33.7749	9.5133	0.39091	0.0:0.8375:0.0:0.1625	.	498;553	F8W7I9;P46060	.;RAGP1_HUMAN	N	553;553;553;553;498	ENSP00000385866:K553N;ENSP00000348577:K553N;ENSP00000401470:K553N;ENSP00000385354:K498N	ENSP00000348577:K553N	K	-	3	2	RANGAP1	39975315	0.956000	0.32656	1.000000	0.80357	0.858000	0.48976	1.094000	0.30951	2.515000	0.84797	0.467000	0.42956	AAG	.		0.602	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320606.1	NM_002883	
RBMXL3	139804	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	X	114424452	114424452	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chrX:114424452C>T	ENST00000424776.3	+	1	490	c.448C>T	c.(448-450)Cgc>Tgc	p.R150C	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	150							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GCCCAGGAAGCGCGGGCCGCC	0.721																																					p.R150C		.											.	.	.	0			c.C448T						.						4.0	6.0	5.0					X																	114424452		608	1426	2034	SO:0001583	missense	139804	exon1			AGGAAGCGCGGGC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.448C>T	X.37:g.114424452C>T	ENSP00000417451:p.Arg150Cys	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	10.0	8.0	NM_001145346	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.828794	0.32329	.	.	ENSG00000175718	ENST00000424776	T	0.04360	3.64	1.26	-0.00448	0.14022	.	.	.	.	.	T	0.03739	0.0106	L	0.45352	1.415	0.19300	N	0.999975	B	0.29232	0.238	B	0.09377	0.004	T	0.41142	-0.9525	9	0.87932	D	0	.	2.0251	0.03517	0.3989:0.3103:0.0:0.2908	.	150	Q8N7X1	RMXL3_HUMAN	C	150	ENSP00000417451:R150C	ENSP00000417451:R150C	R	+	1	0	RBMXL3	114330708	0.016000	0.18221	0.003000	0.11579	0.001000	0.01503	-1.352000	0.02619	-0.071000	0.12886	-0.625000	0.03995	CGC	.		0.721	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
RCOR2	283248	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	63681765	63681765	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:63681765C>T	ENST00000301459.4	-	7	1030	c.643G>A	c.(643-645)Gga>Aga	p.G215R	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	215					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						TCGGGCTCTCCCTCACTCACG	0.632																																					p.G215R		.											.	RCOR2	92	0			c.G643A						.						65.0	54.0	58.0					11																	63681765		2201	4297	6498	SO:0001583	missense	283248	exon7			GCTCTCCCTCACT	BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.643G>A	11.37:g.63681765C>T	ENSP00000301459:p.Gly215Arg	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	226.0	65.0	NM_173587	Q96FP3	Missense_Mutation	SNP	ENST00000301459.4	37	CCDS8052.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.260926	0.39995	.	.	ENSG00000167771	ENST00000301459	T	0.28895	1.59	4.73	4.73	0.59995	.	0.465811	0.21906	N	0.067380	T	0.16769	0.0403	N	0.14661	0.345	0.30039	N	0.812813	B	0.02656	0.0	B	0.04013	0.001	T	0.10291	-1.0636	10	0.16896	T	0.51	.	10.5414	0.45035	0.0:0.9086:0.0:0.0914	.	215	Q8IZ40	RCOR2_HUMAN	R	215	ENSP00000301459:G215R	ENSP00000301459:G215R	G	-	1	0	RCOR2	63438341	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	4.124000	0.57924	2.333000	0.79357	0.561000	0.74099	GGA	.		0.632	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318233.1	NM_173587	
RHO	6010	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	129251109	129251109	+	Silent	SNP	C	C	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:129251109C>T	ENST00000296271.3	+	3	640	c.546C>T	c.(544-546)ggC>ggT	p.G182G		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	182			G -> S (in RP4). {ECO:0000269|PubMed:1897520}.		G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)			breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	TCCCCGAGGGCCTGCAGTGCT	0.592																																					p.G182G	Esophageal Squamous(118;214 1623 30842 43234 46940)	.											.	RHO	90	0			c.C546T						.						199.0	159.0	173.0					3																	129251109		2203	4300	6503	SO:0001819	synonymous_variant	6010	exon3			CGAGGGCCTGCAG	AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.546C>T	3.37:g.129251109C>T		Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	203.0	92.0	NM_000539	Q16414|Q2M249	Silent	SNP	ENST00000296271.3	37	CCDS3063.1																																																																																			.		0.592	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1	NM_000539	
RFC4	5984	hgsc.bcm.edu;ucsc.edu	37	3	186507957	186507957	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:186507957T>A	ENST00000392481.2	-	10	1251	c.970A>T	c.(970-972)Aag>Tag	p.K324*	RFC4_ENST00000296273.2_Nonsense_Mutation_p.K324*|SNORA63_ENST00000363450.1_RNA|SNORA4_ENST00000584302.1_RNA|RFC4_ENST00000433496.1_Nonsense_Mutation_p.K297*	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	324					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		ATAATAGACTTCTGTTTATCA	0.338																																					p.K324X		.											.	RFC4	291	0			c.A970T						.						106.0	103.0	104.0					3																	186507957		2203	4300	6503	SO:0001587	stop_gained	5984	exon10			TAGACTTCTGTTT		CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.970A>T	3.37:g.186507957T>A	ENSP00000376272:p.Lys324*	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	61.0	NM_181573	B4DM41|D3DNV2|Q6FHX7	Nonsense_Mutation	SNP	ENST00000392481.2	37	CCDS3283.1	.	.	.	.	.	.	.	.	.	.	T	38	6.877691	0.97904	.	.	ENSG00000163918	ENST00000433496;ENST00000392481;ENST00000296273;ENST00000417876	.	.	.	5.75	4.55	0.56014	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.566	0.45173	0.1436:0.0:0.0:0.8564	.	.	.	.	X	297;324;324;99	.	ENSP00000296273:K324X	K	-	1	0	RFC4	187990651	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.705000	0.68355	2.191000	0.70037	0.533000	0.62120	AAG	.		0.338	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344471.1	NM_002916	
RNF8	9025	hgsc.bcm.edu;bcgsc.ca	37	6	37344709	37344709	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:37344709A>G	ENST00000373479.4	+	6	1329	c.1136A>G	c.(1135-1137)aAg>aGg	p.K379R	RNF8_ENST00000469731.1_Missense_Mutation_p.K379R	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	O76064	RNF8_HUMAN	ring finger protein 8, E3 ubiquitin protein ligase	379					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|histone exchange (GO:0043486)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A ubiquitination (GO:0033522)|histone H2B ubiquitination (GO:0033523)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|mitotic nuclear division (GO:0007067)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|response to ionizing radiation (GO:0010212)|spermatid development (GO:0007286)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome, telomeric region (GO:0000781)|nucleolus (GO:0005730)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	13						CAGGAAGAGAAGGAGAAGATG	0.403																																					p.K379R		.											.	RNF8	227	0			c.A1136G						.						136.0	124.0	128.0					6																	37344709		2203	4300	6503	SO:0001583	missense	9025	exon6			AAGAGAAGGAGAA	AB012770	CCDS4833.1, CCDS4834.1	6p21.3	2013-01-09	2012-02-23		ENSG00000112130	ENSG00000112130		"""RING-type (C3HC4) zinc fingers"""	10071	protein-coding gene	gene with protein product		611685	"""ring finger protein (C3HC4 type) 8"", ""ring finger protein 8"""			9734811, 9852682	Standard	NM_003958		Approved	KIAA0646	uc003onq.4	O76064	OTTHUMG00000014620	ENST00000373479.4:c.1136A>G	6.37:g.37344709A>G	ENSP00000362578:p.Lys379Arg	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	5.0	NM_003958	A6NN24|A8MYC0|B4DPG0|Q53H16|Q5NKW5	Missense_Mutation	SNP	ENST00000373479.4	37	CCDS4834.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.689319	0.88735	.	.	ENSG00000112130	ENST00000373479;ENST00000469731	D;T	0.84660	-1.88;-0.4	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.89223	0.6654	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.90435	0.4427	10	0.62326	D	0.03	.	14.8201	0.70065	1.0:0.0:0.0:0.0	.	379	O76064	RNF8_HUMAN	R	379	ENSP00000362578:K379R;ENSP00000418879:K379R	ENSP00000362578:K379R	K	+	2	0	RNF8	37452687	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	8.962000	0.93254	2.093000	0.63338	0.533000	0.62120	AAG	.		0.403	RNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040403.2		
RPAP1	26015	hgsc.bcm.edu;bcgsc.ca	37	15	41826958	41826958	+	Silent	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr15:41826958A>G	ENST00000304330.4	-	6	833	c.717T>C	c.(715-717)gcT>gcC	p.A239A	RPAP1_ENST00000561603.1_Silent_p.A239A|RPAP1_ENST00000568413.1_5'Flank	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	239						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TCTCCTCAGGAGCCATGGCCT	0.562																																					p.A239A		.											.	RPAP1	153	0			c.T717C						.						112.0	89.0	97.0					15																	41826958		2203	4300	6503	SO:0001819	synonymous_variant	26015	exon6			CTCAGGAGCCATG	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.717T>C	15.37:g.41826958A>G		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	5.0	NM_015540	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Silent	SNP	ENST00000304330.4	37	CCDS10079.1																																																																																			.		0.562	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540	
RPS6KB2	6199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	67200629	67200629	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:67200629A>G	ENST00000312629.5	+	9	785	c.740A>G	c.(739-741)aAc>aGc	p.N247S	AP003419.16_ENST00000535922.1_RNA	NM_003952.2	NP_003943.2	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 2	247	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|signal transduction (GO:0007165)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|salivary_gland(1)|stomach(2)	25			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			AGTGGCCACAACCGGGCTGTG	0.692																																					p.N247S		.											.	RPS6KB2	1000	0			c.A740G						.						13.0	16.0	15.0					11																	67200629		1966	4125	6091	SO:0001583	missense	6199	exon9			GCCACAACCGGGC	AB019245	CCDS41677.1	11q13.1	2011-04-05	2002-08-29		ENSG00000175634	ENSG00000175634			10437	protein-coding gene	gene with protein product		608939	"""ribosomal protein S6 kinase, 70kD, polypeptide 2"""			9878560, 9804755	Standard	XM_005274164		Approved	p70S6Kb, P70-BETA, STK14B, KLS	uc001old.3	Q9UBS0	OTTHUMG00000167673	ENST00000312629.5:c.740A>G	11.37:g.67200629A>G	ENSP00000308413:p.Asn247Ser	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	24.0	NM_003952	B2RMZ9|B4DML8|O94809|Q9UEC1	Missense_Mutation	SNP	ENST00000312629.5	37	CCDS41677.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.049764	0.55218	.	.	ENSG00000175634	ENST00000312629	T	0.21932	1.98	4.88	3.73	0.42828	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.058351	0.64402	D	0.000004	T	0.15825	0.0381	N	0.02315	-0.6	0.80722	D	1	P;D	0.56035	0.637;0.974	B;P	0.60012	0.414;0.867	T	0.17531	-1.0366	10	0.17369	T	0.5	.	11.5682	0.50818	0.8502:0.1498:0.0:0.0	.	247;247	Q9BRS0;Q9UBS0	.;KS6B2_HUMAN	S	247	ENSP00000308413:N247S	ENSP00000308413:N247S	N	+	2	0	RPS6KB2	66957205	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.465000	0.90383	0.861000	0.35504	0.459000	0.35465	AAC	.		0.692	RPS6KB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395508.1	NM_003952	
SCN1A	6323	hgsc.bcm.edu;bcgsc.ca	37	2	166866301	166866301	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr2:166866301T>C	ENST00000303395.4	-	20	3929	c.3930A>G	c.(3928-3930)ggA>ggG	p.G1310G	AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Silent_p.G1299G|SCN1A_ENST00000409050.1_Silent_p.G1282G|SCN1A_ENST00000423058.2_Silent_p.G1310G|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1310					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATTTGATGGCTCCAAGTTCTG	0.378																																					p.G1310G		.											.	SCN1A	147	0			c.A3930G						.						91.0	90.0	90.0					2																	166866301		2203	4300	6503	SO:0001819	synonymous_variant	6323	exon20			GATGGCTCCAAGT	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.3930A>G	2.37:g.166866301T>C		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_001165963	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																			.		0.378	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
SEMA6A	57556	hgsc.bcm.edu;bcgsc.ca	37	5	115824677	115824677	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:115824677T>C	ENST00000343348.6	-	8	1349	c.562A>G	c.(562-564)Act>Gct	p.T188A	CTB-118N6.3_ENST00000508640.1_RNA|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000510263.1_Missense_Mutation_p.T188A|SEMA6A_ENST00000257414.8_Missense_Mutation_p.T188A|SEMA6A_ENST00000503962.1_5'UTR	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	188	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		AGGAAGTCAGTCACTGTGGCT	0.473																																					p.T188A		.											.	SEMA6A	92	0			c.A562G						.						43.0	40.0	41.0					5																	115824677		1955	4163	6118	SO:0001583	missense	57556	exon8			AGTCAGTCACTGT	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.562A>G	5.37:g.115824677T>C	ENSP00000345512:p.Thr188Ala	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	5.0	NM_020796	Q9P2H9	Missense_Mutation	SNP	ENST00000343348.6	37	CCDS47256.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.914488	0.33815	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000510263	T;T;T	0.09630	2.96;2.96;2.96	5.58	5.58	0.84498	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.17577	0.0422	N	0.25957	0.775	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.998	T	0.02639	-1.1130	10	0.02654	T	1	.	15.4142	0.74952	0.0:0.0:0.0:1.0	.	188;188	Q9H2E6;Q9H2E6-2	SEM6A_HUMAN;.	A	188	ENSP00000345512:T188A;ENSP00000257414:T188A;ENSP00000424388:T188A	ENSP00000257414:T188A	T	-	1	0	SEMA6A	115852576	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.276000	0.72601	2.130000	0.65690	0.528000	0.53228	ACT	.		0.473	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796	
SETD2	29072	hgsc.bcm.edu;bcgsc.ca	37	3	47168143	47168143	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:47168143T>C	ENST00000409792.3	-	2	124	c.82A>G	c.(82-84)Aat>Gat	p.N28D		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	28					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTTACCTCATTTTCTTCTTCT	0.264			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.N28D		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	1273	0			c.A82G						.						122.0	103.0	108.0					3																	47168143		1475	3412	4887	SO:0001583	missense	29072	exon2			CCTCATTTTCTTC	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.82A>G	3.37:g.47168143T>C	ENSP00000386759:p.Asn28Asp	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	4.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	16.73	3.205346	0.58234	.	.	ENSG00000181555	ENST00000409792	D	0.88818	-2.43	4.46	4.46	0.54185	.	.	.	.	.	D	0.88584	0.6476	N	0.14661	0.345	0.24154	N	0.995682	D	0.63880	0.993	D	0.70935	0.971	T	0.80603	-0.1309	9	0.87932	D	0	.	11.5254	0.50576	0.0:0.0:0.0:1.0	.	28	Q9BYW2	SETD2_HUMAN	D	28	ENSP00000386759:N28D	ENSP00000386759:N28D	N	-	1	0	SETD2	47143147	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.399000	0.59703	1.996000	0.58369	0.402000	0.26972	AAT	.		0.264	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SH3TC1	54436	hgsc.bcm.edu;bcgsc.ca	37	4	8230236	8230236	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr4:8230236G>C	ENST00000245105.3	+	12	2882	c.2815G>C	c.(2815-2817)Ggg>Cgg	p.G939R	SH3TC1_ENST00000539824.1_Missense_Mutation_p.G863R	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	939										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GCTGCCCCTTGGGGAGTGTGG	0.706																																					p.G939R	NSCLC(145;2298 2623 35616 37297)	.											.	SH3TC1	154	0			c.G2815C						.						20.0	23.0	22.0					4																	8230236		2197	4294	6491	SO:0001583	missense	54436	exon12			CCCCTTGGGGAGT	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2815G>C	4.37:g.8230236G>C	ENSP00000245105:p.Gly939Arg	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	6.0	NM_018986	Q4W5G5	Missense_Mutation	SNP	ENST00000245105.3	37	CCDS3399.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.658883	0.00772	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.67865	-0.29;-0.29	4.06	-3.09	0.05331	Tetratricopeptide-like helical (1);	1.841800	0.02336	N	0.074412	T	0.41050	0.1142	N	0.12746	0.255	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.14868	-1.0457	10	0.11794	T	0.64	-9.1413	1.8813	0.03228	0.4062:0.2187:0.2643:0.1108	.	939	Q8TE82	S3TC1_HUMAN	R	677;939;863;768	ENSP00000245105:G939R;ENSP00000441045:G863R	ENSP00000245105:G939R	G	+	1	0	SH3TC1	8281136	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.576000	0.05854	-0.557000	0.06126	-1.459000	0.01027	GGG	.		0.706	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
SLC6A7	6534	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	149583547	149583547	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:149583547C>A	ENST00000230671.2	+	10	1649	c.1278C>A	c.(1276-1278)ttC>ttA	p.F426L	SLC6A7_ENST00000524041.1_Missense_Mutation_p.F426L	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	426					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	AGGCGGTGTTCTCAGGGCTCA	0.587																																					p.F426L		.											.	SLC6A7	90	0			c.C1278A						.						98.0	68.0	78.0					5																	149583547		2203	4300	6503	SO:0001583	missense	6534	exon10			GGTGTTCTCAGGG	S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.1278C>A	5.37:g.149583547C>A	ENSP00000230671:p.Phe426Leu	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	236.0	71.0	NM_014228	Q0VG81|Q52LU6	Missense_Mutation	SNP	ENST00000230671.2	37	CCDS4305.1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.814341	0.32053	.	.	ENSG00000011083	ENST00000230671;ENST00000524041	T;T	0.73575	-0.76;-0.76	5.04	4.17	0.49024	.	0.000000	0.85682	D	0.000000	T	0.59362	0.2188	N	0.13327	0.33	0.58432	D	0.999999	B	0.24317	0.101	B	0.32533	0.147	T	0.55101	-0.8193	10	0.21540	T	0.41	.	12.8423	0.57811	0.0:0.9212:0.0:0.0788	.	426	Q99884	SC6A7_HUMAN	L	426	ENSP00000230671:F426L;ENSP00000428200:F426L	ENSP00000230671:F426L	F	+	3	2	SLC6A7	149563740	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	2.656000	0.46716	2.323000	0.78572	0.561000	0.74099	TTC	.		0.587	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252325.1	NM_014228	
SPICE1	152185	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113188037	113188037	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr3:113188037C>A	ENST00000295872.4	-	8	919	c.660G>T	c.(658-660)ttG>ttT	p.L220F		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	220					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)				NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						TGTCAGTCCACAACTTACTAA	0.353																																					p.L220F		.											.	SPICE1	70	0			c.G660T						.						104.0	99.0	101.0					3																	113188037		2203	4300	6503	SO:0001583	missense	152185	exon8			AGTCCACAACTTA	AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.660G>T	3.37:g.113188037C>A	ENSP00000295872:p.Leu220Phe	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	54.0	NM_144718	D3DN72|Q8WUX6	Missense_Mutation	SNP	ENST00000295872.4	37	CCDS2973.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.22|15.22	2.769395|2.769395	0.49680|0.49680	.|.	.|.	ENSG00000163611|ENSG00000163611	ENST00000467618|ENST00000295872	.|T	.|0.34472	.|1.36	4.91|4.91	0.802|0.802	0.18686|0.18686	.|.	.|0.000000	.|0.49305	.|D	.|0.000155	T|T	0.50956|0.50956	0.1646|0.1646	M|M	0.70595|0.70595	2.14|2.14	0.33229|0.33229	D|D	0.555739|0.555739	.|D;D	.|0.89917	.|0.979;1.0	.|P;D	.|0.87578	.|0.858;0.998	T|T	0.58239|0.58239	-0.7671|-0.7671	5|10	.|0.54805	.|T	.|0.06	-8.0979|-8.0979	5.8902|5.8902	0.18909|0.18909	0.0:0.6236:0.1403:0.236|0.0:0.6236:0.1403:0.236	.|.	.|116;220	.|B3KX77;Q8N0Z3	.|.;SPICE_HUMAN	F|F	32|220	.|ENSP00000295872:L220F	.|ENSP00000295872:L220F	C|L	-|-	2|3	0|2	SPICE1|SPICE1	114670727|114670727	0.993000|0.993000	0.37304|0.37304	0.996000|0.996000	0.52242|0.52242	0.796000|0.796000	0.44982|0.44982	0.097000|0.097000	0.15168|0.15168	0.161000|0.161000	0.19458|0.19458	0.591000|0.591000	0.81541|0.81541	TGT|TTG	.		0.353	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718	
SPINK6	404203	hgsc.bcm.edu;bcgsc.ca	37	5	147593498	147593498	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:147593498C>A	ENST00000325630.2	+	3	363	c.107C>A	c.(106-108)cCc>cAc	p.P36H		NM_001195290.1|NM_205841.3	NP_001182219.1|NP_995313.2	Q6UWN8	ISK6_HUMAN	serine peptidase inhibitor, Kazal type 6	36	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.		P -> T (in dbSNP:rs12186491). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:20667819}.			extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCAGGACCCCAAGGTCTAC	0.458																																					p.P36H		.											.	SPINK6	91	0			c.C107A						.						134.0	110.0	118.0					5																	147593498		2203	4300	6503	SO:0001583	missense	404203	exon3			AGGACCCCAAGGT	AY358716	CCDS34268.1	5q32	2011-08-31	2005-08-17		ENSG00000178172	ENSG00000178172		"""Serine peptidase inhibitors, Kazal type"""	29486	protein-coding gene	gene with protein product	"""protease inhibitor H"""	615868	"""serine protease inhibitor, Kazal type 6"""			15060002	Standard	NM_205841		Approved	MGC21394, UNQ844, BUSI2	uc021yff.1	Q6UWN8	OTTHUMG00000163425	ENST00000325630.2:c.107C>A	5.37:g.147593498C>A	ENSP00000324870:p.Pro36His	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	7.0	NM_205841	E0X656|Q8N5P0	Missense_Mutation	SNP	ENST00000325630.2	37	CCDS34268.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.164563	0.38217	.	.	ENSG00000178172	ENST00000514389;ENST00000325630	T;T	0.79554	-1.28;-0.88	5.75	5.75	0.90469	Proteinase inhibitor I1, Kazal (2);	0.000000	0.64402	D	0.000004	D	0.89581	0.6756	.	.	.	0.39180	D	0.962751	D	0.89917	1.0	D	0.91635	0.999	D	0.90728	0.4640	9	0.72032	D	0.01	-9.9478	15.8177	0.78615	0.0:1.0:0.0:0.0	.	36	Q6UWN8	ISK6_HUMAN	H	36	ENSP00000421119:P36H;ENSP00000324870:P36H	ENSP00000324870:P36H	P	+	2	0	SPINK6	147573691	0.065000	0.20965	1.000000	0.80357	0.407000	0.30961	1.151000	0.31651	2.885000	0.99019	0.655000	0.94253	CCC	.		0.458	SPINK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373332.1	NM_205841	
SPTAN1	6709	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	131374459	131374459	+	Silent	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr9:131374459G>C	ENST00000372731.4	+	38	5072	c.4962G>C	c.(4960-4962)ctG>ctC	p.L1654L	SPTAN1_ENST00000358161.5_Silent_p.L1659L|SPTAN1_ENST00000372739.3_Silent_p.L1659L	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1654					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GCCAGAAACTGAAAGAAGCCA	0.522																																					p.L1659L	NSCLC(120;833 1744 2558 35612 37579)	.											.	SPTAN1	158	0			c.G4977C						.						125.0	124.0	125.0					9																	131374459		2203	4300	6503	SO:0001819	synonymous_variant	6709	exon39			GAAACTGAAAGAA	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4962G>C	9.37:g.131374459G>C		Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	198.0	84.0	NM_001130438	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	CCDS6905.1																																																																																			.		0.522	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
STXBP5	134957	hgsc.bcm.edu;bcgsc.ca	37	6	147631274	147631274	+	Silent	SNP	A	A	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr6:147631274A>G	ENST00000321680.6	+	10	972	c.972A>G	c.(970-972)agA>agG	p.R324R	STXBP5_ENST00000367481.3_Silent_p.R324R|STXBP5_ENST00000367480.3_Silent_p.R324R|STXBP5_ENST00000179882.6_5'UTR	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	324					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TAGGAAGAAGACCTTGCTTAA	0.348																																					p.R324R		.											.	STXBP5	90	0			c.A972G						.						132.0	137.0	136.0					6																	147631274		2203	4300	6503	SO:0001819	synonymous_variant	134957	exon10			AAGAAGACCTTGC	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.972A>G	6.37:g.147631274A>G		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	4.0	NM_139244	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Silent	SNP	ENST00000321680.6	37	CCDS47499.1																																																																																			.		0.348	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
SUSD4	55061	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	223402546	223402546	+	Silent	SNP	G	G	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr1:223402546G>T	ENST00000343846.3	-	5	1542	c.909C>A	c.(907-909)atC>atA	p.I303I	SUSD4_ENST00000454695.2_Silent_p.I143I|SUSD4_ENST00000494793.2_Silent_p.I303I|SUSD4_ENST00000478605.1_Intron|SUSD4_ENST00000366878.4_Silent_p.I303I|SUSD4_ENST00000484758.2_Silent_p.I234I			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	303	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		TACCTGATTTGATGCAGTAGA	0.498																																					p.I303I		.											.	SUSD4	68	0			c.C909A						.						119.0	125.0	123.0					1																	223402546		2069	4219	6288	SO:0001819	synonymous_variant	55061	exon6			TGATTTGATGCAG	AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.909C>A	1.37:g.223402546G>T		Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	234.0	67.0	NM_017982	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Silent	SNP	ENST00000343846.3	37	CCDS41471.1																																																																																			.		0.498	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982	
SYNE2	23224	hgsc.bcm.edu;bcgsc.ca	37	14	64494280	64494280	+	Silent	SNP	A	A	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr14:64494280A>T	ENST00000344113.4	+	43	6695	c.6483A>T	c.(6481-6483)ctA>ctT	p.L2161L	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Silent_p.L2161L|SYNE2_ENST00000358025.3_Silent_p.L2161L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2161					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCATAGAACTAAAGAAGAAAC	0.343																																					p.L2161L		.											.	SYNE2	164	0			c.A6483T						.						90.0	84.0	86.0					14																	64494280		1809	4077	5886	SO:0001819	synonymous_variant	23224	exon43			AGAACTAAAGAAG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6483A>T	14.37:g.64494280A>T		Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	6.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1																																																																																			.		0.343	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TLL2	7093	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	98170214	98170214	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr10:98170214G>T	ENST00000357947.3	-	9	1291	c.1066C>A	c.(1066-1068)Cag>Aag	p.Q356K	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	356	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GTTGTGTCCTGCAGGGTCTCC	0.577																																					p.Q356K		.											.	TLL2	93	0			c.C1066A						.						86.0	74.0	78.0					10																	98170214		2203	4300	6503	SO:0001583	missense	7093	exon9			TGTCCTGCAGGGT	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1066C>A	10.37:g.98170214G>T	ENSP00000350630:p.Gln356Lys	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	40.0	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	G	32	5.133537	0.94517	.	.	ENSG00000095587	ENST00000357947	T	0.34472	1.36	5.64	5.64	0.86602	CUB (5);	0.000000	0.43416	D	0.000567	T	0.55641	0.1933	L	0.53729	1.69	0.80722	D	1	D	0.60160	0.987	D	0.70016	0.967	T	0.38845	-0.9642	10	0.27785	T	0.31	.	19.0544	0.93058	0.0:0.0:1.0:0.0	.	356	Q9Y6L7	TLL2_HUMAN	K	356	ENSP00000350630:Q356K	ENSP00000350630:Q356K	Q	-	1	0	TLL2	98160204	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.736000	0.98828	2.826000	0.97356	0.561000	0.74099	CAG	.		0.577	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
TMEM135	65084	hgsc.bcm.edu;bcgsc.ca	37	11	87020678	87020678	+	Silent	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:87020678T>C	ENST00000305494.5	+	10	939	c.900T>C	c.(898-900)ctT>ctC	p.L300L	TMEM135_ENST00000532959.1_Silent_p.L171L|TMEM135_ENST00000535167.1_Silent_p.L161L|TMEM135_ENST00000340353.7_Silent_p.L278L	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	300					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ACTTCCAGCTTGGAGCTTTTC	0.383																																					p.L300L		.											.	TMEM135	514	0			c.T900C						.						78.0	86.0	83.0					11																	87020678		2201	4299	6500	SO:0001819	synonymous_variant	65084	exon10			CCAGCTTGGAGCT	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.900T>C	11.37:g.87020678T>C		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	5.0	NM_022918	Q6AW91|Q8ND01|Q9H6M3	Silent	SNP	ENST00000305494.5	37	CCDS8280.1																																																																																			.		0.383	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918	
TMEM173	340061	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	138857961	138857961	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:138857961delT	ENST00000330794.4	-	6	986	c.653delA	c.(652-654)aacfs	p.N218fs	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	218	c-di-GMP-binding domain (CBD).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAAGCGAATGTTGGGGTCAGC	0.542																																					p.N218fs		.											.	TMEM173	69	0			c.653delA						.						137.0	123.0	128.0					5																	138857961		2203	4300	6503	SO:0001589	frameshift_variant	340061	exon6			CGAATGTTGGGGT		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.653delA	5.37:g.138857961delT	ENSP00000331288:p.Asn218fs	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	43.0	NM_198282	A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Frame_Shift_Del	DEL	ENST00000330794.4	37	CCDS4215.1																																																																																			.		0.542	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282	
TP53	7157	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577557	7577557	+	Missense_Mutation	SNP	A	A	T	rs397516437		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr17:7577557A>T	ENST00000269305.4	-	7	913	c.724T>A	c.(724-726)Tgc>Agc	p.C242S	TP53_ENST00000420246.2_Missense_Mutation_p.C242S|TP53_ENST00000455263.2_Missense_Mutation_p.C242S|TP53_ENST00000413465.2_Missense_Mutation_p.C242S|TP53_ENST00000359597.4_Missense_Mutation_p.C242S|TP53_ENST00000445888.2_Missense_Mutation_p.C242S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	242	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:16959974}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C242R(12)|p.C242S(10)|p.0?(8)|p.?(5)|p.N239_C242delNSSC(3)|p.C242G(2)|p.S241del(2)|p.N239_C242>S(1)|p.S241_C242insX(1)|p.C238fs*21(1)|p.C242fs*20(1)|p.C242fs*23(1)|p.C242fs*5(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGCCCATGCAGGAACTGTTA	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C242S	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,0	TP53	70225	55	Substitution - Missense(24)|Deletion - In frame(10)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Complex - deletion inframe(1)	breast(8)|large_intestine(7)|biliary_tract(5)|upper_aerodigestive_tract(4)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|ovary(3)|pancreas(3)|prostate(3)|stomach(2)|oesophagus(2)|lung(2)|urinary_tract(1)	c.T724A						.						138.0	106.0	117.0					17																	7577557		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CCATGCAGGAACT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.724T>A	17.37:g.7577557A>T	ENSP00000269305:p.Cys242Ser	Somatic	224.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	76.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.639501	0.87760	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99914	-7.98;-7.98;-7.98;-7.98;-7.98;-7.98;-7.98;-7.98	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99924	0.9965	M	0.92784	3.345	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.999	D	0.95737	0.8780	10	0.87932	D	0	-27.558	12.3101	0.54924	1.0:0.0:0.0:0.0	.	242;242;149;242;242;242	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	242;242;242;242;242;242;231;149;110;149	ENSP00000410739:C242S;ENSP00000352610:C242S;ENSP00000269305:C242S;ENSP00000398846:C242S;ENSP00000391127:C242S;ENSP00000391478:C242S;ENSP00000425104:C110S;ENSP00000423862:C149S	ENSP00000269305:C242S	C	-	1	0	TP53	7518282	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.087000	0.94110	2.074000	0.62210	0.379000	0.24179	TGC	.		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TPP2	7174	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103268804	103268804	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr13:103268804G>T	ENST00000376065.4	+	4	485	c.449G>T	c.(448-450)tGt>tTt	p.C150F	TPP2_ENST00000376052.3_Missense_Mutation_p.C150F	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	150	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCAGAAGCCTGTAGAAAACAG	0.408																																					p.C150F		.											.	TPP2	92	0			c.G449T						.						94.0	102.0	100.0					13																	103268804		2203	4300	6503	SO:0001583	missense	7174	exon4			AAGCCTGTAGAAA	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.449G>T	13.37:g.103268804G>T	ENSP00000365233:p.Cys150Phe	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	37.0	NM_003291	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	37	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.841963	0.51057	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.64	5.64	0.86602	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.102040	0.64402	D	0.000001	T	0.48223	0.1488	L	0.29908	0.895	0.49389	D	0.999781	P	0.39601	0.68	B	0.36378	0.223	T	0.40961	-0.9535	9	0.30078	T	0.28	.	20.0769	0.97748	0.0:0.0:1.0:0.0	.	150	P29144	TPP2_HUMAN	F	150	.	ENSP00000365220:C150F	C	+	2	0	TPP2	102066805	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.172000	0.71932	2.820000	0.97059	0.650000	0.86243	TGT	.		0.408	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
TYR	7299	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	11	89028385	89028385	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:89028385G>C	ENST00000263321.5	+	5	1943	c.1441G>C	c.(1441-1443)Gcg>Ccg	p.A481P		NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	481					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	GCTCCTTGGGGCGGCGATGGT	0.512																																					p.A481P		.											.	TYR	92	0			c.G1441C						.						63.0	64.0	64.0					11																	89028385		2201	4299	6500	SO:0001583	missense	7299	exon5			CTTGGGGCGGCGA	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1441G>C	11.37:g.89028385G>C	ENSP00000263321:p.Ala481Pro	Somatic	238.0	0.0		WXS	Illumina HiSeq	Phase_I	384.0	25.0	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278972	0.59758	.	.	ENSG00000077498	ENST00000263321	D	0.99304	-5.72	5.02	5.02	0.67125	.	0.111169	0.64402	D	0.000011	D	0.99345	0.9770	M	0.79258	2.445	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	D	0.99184	1.0868	9	.	.	.	.	17.4703	0.87645	0.0:0.0:1.0:0.0	.	481	P14679	TYRO_HUMAN	P	481	ENSP00000263321:A481P	.	A	+	1	0	TYR	88668033	1.000000	0.71417	0.929000	0.37066	0.176000	0.22953	6.287000	0.72671	2.488000	0.83962	0.455000	0.32223	GCG	.		0.512	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
UGT1A5	54579	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234622002	234622002	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr2:234622002T>C	ENST00000373414.3	+	1	365	c.365T>C	c.(364-366)tTg>tCg	p.L122S	UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000608381.1_Missense_Mutation_p.L122S|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A6_ENST00000373424.1_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	122						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		AATATGTCTTTGATCATACAT	0.413																																					p.L122S		.											.	UGT1A5	3	0			c.T365C						.						173.0	168.0	170.0					2																	234622002		2203	4300	6503	SO:0001583	missense	54579	exon1			TGTCTTTGATCAT	M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.365T>C	2.37:g.234622002T>C	ENSP00000362513:p.Leu122Ser	Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	232.0	89.0	NM_019078	B8K294	Missense_Mutation	SNP	ENST00000373414.3	37	CCDS33404.1	.	.	.	.	.	.	.	.	.	.	T	5.192	0.221009	0.09863	.	.	ENSG00000240224	ENST00000373414	T	0.58797	0.31	4.69	-9.37	0.00626	.	3.783170	0.01269	N	0.009403	T	0.30103	0.0754	N	0.11284	0.12	0.09310	N	1	B;B	0.19583	0.037;0.037	B;B	0.19666	0.026;0.026	T	0.10382	-1.0632	10	0.26408	T	0.33	.	4.0361	0.09730	0.2323:0.4383:0.0787:0.2506	.	122;122	Q5DSZ9;P35504	.;UD15_HUMAN	S	122	ENSP00000362513:L122S	ENSP00000362513:L122S	L	+	2	0	UGT1A5	234286741	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.690000	0.05138	-1.286000	0.02384	-0.531000	0.04308	TTG	.		0.413	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130985.1	NM_019078	
VASN	114990	hgsc.bcm.edu;bcgsc.ca	37	16	4432163	4432163	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr16:4432163G>A	ENST00000304735.3	+	2	1440	c.1285G>A	c.(1285-1287)Gcg>Acg	p.A429T	CORO7_ENST00000423908.2_Intron|CORO7_ENST00000251166.4_Intron|CORO7_ENST00000539968.1_Intron|CORO7_ENST00000537233.2_Intron|CORO7_ENST00000574025.1_Intron|CORO7-PAM16_ENST00000572467.1_Intron	NM_138440.2	NP_612449.2	Q6EMK4	VASN_HUMAN	vasorin	429	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cellular response to hypoxia (GO:0071456)|cellular response to redox state (GO:0071461)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	transforming growth factor beta binding (GO:0050431)			breast(1)|lung(3)|prostate(1)|skin(1)	6						GCACCACCTGGCGTGCTTGTG	0.692																																					p.A429T		.											.	VASN	68	0			c.G1285A						.						17.0	16.0	16.0					16																	4432163		2168	4272	6440	SO:0001583	missense	114990	exon2			CACCTGGCGTGCT	AY358299	CCDS10514.1	16p13.3	2008-02-05	2006-03-30	2006-03-30	ENSG00000168140	ENSG00000168140			18517	protein-coding gene	gene with protein product		608843	"""slit-like 2 (Drosophila)"""	SLITL2		15247411	Standard	NM_138440		Approved		uc002cwj.1	Q6EMK4	OTTHUMG00000129469	ENST00000304735.3:c.1285G>A	16.37:g.4432163G>A	ENSP00000306864:p.Ala429Thr	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_138440	Q6UXL4|Q6UXL5|Q96CX1	Missense_Mutation	SNP	ENST00000304735.3	37	CCDS10514.1	.	.	.	.	.	.	.	.	.	.	G	2.558	-0.302473	0.05495	.	.	ENSG00000168140	ENST00000304735	D	0.91521	-2.86	5.63	3.66	0.41972	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.761271	0.12153	N	0.494708	T	0.71443	0.3340	N	0.01277	-0.915	0.20638	N	0.999877	B	0.17038	0.02	B	0.14023	0.01	T	0.60667	-0.7218	10	0.13853	T	0.58	-11.1698	6.1836	0.20486	0.0742:0.1337:0.6538:0.1383	.	429	Q6EMK4	VASN_HUMAN	T	429	ENSP00000306864:A429T	ENSP00000306864:A429T	A	+	1	0	VASN	4372164	0.712000	0.27916	0.771000	0.31576	0.131000	0.20780	1.754000	0.38369	0.734000	0.32515	0.650000	0.86243	GCG	.		0.692	VASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251632.1	NM_138440	
VSIG10L	147645	hgsc.bcm.edu;bcgsc.ca	37	19	51835894	51835894	+	Splice_Site	SNP	C	C	G	rs200336358		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:51835894C>G	ENST00000335624.4	-	10	2574	c.2575G>C	c.(2575-2577)Gca>Cca	p.A859P		NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	859						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						GGGGTCTGTGCCTGGAAGAGA	0.537																																					p.A859P		.											.	.	.	0			c.G2575C						.						104.0	119.0	114.0					19																	51835894		692	1591	2283	SO:0001630	splice_region_variant	147645	exon10			TCTGTGCCTGGAA		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.2575-1G>C	19.37:g.51835894C>G		Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	11.0	NM_001163922		Missense_Mutation	SNP	ENST00000335624.4	37	CCDS54300.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.931521	0.34096	.	.	ENSG00000186806	ENST00000335624	T	0.23950	1.88	4.66	0.994	0.19832	.	.	.	.	.	T	0.18593	0.0446	L	0.36672	1.1	0.20403	N	0.999906	B	0.14438	0.01	B	0.11329	0.006	T	0.24693	-1.0153	9	0.62326	D	0.03	0.0	5.9891	0.19450	0.0:0.516:0.3777:0.1063	rs11402251;rs33944140;rs58614229	859	Q86VR7	VS10L_HUMAN	P	859	ENSP00000335623:A859P	ENSP00000335623:A859P	A	-	1	0	VSIG10L	56527706	0.783000	0.28701	0.602000	0.28890	0.172000	0.22775	0.703000	0.25646	0.385000	0.24970	0.462000	0.41574	GCA	.		0.537	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464535.1	NM_001163922	Missense_Mutation
WNT5B	81029	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	1741875	1741875	+	Silent	SNP	C	C	G			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr12:1741875C>G	ENST00000397196.2	+	3	364	c.132C>G	c.(130-132)gcC>gcG	p.A44A	WNT5B_ENST00000537031.1_Silent_p.A44A|WNT5B_ENST00000542408.1_Silent_p.A44A|WNT5B_ENST00000310594.3_Silent_p.A44A	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	44					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			TCATCGGTGCCCAGCCCGTGT	0.562																																					p.A44A		.											.	WNT5B	562	0			c.C132G						.						107.0	111.0	110.0					12																	1741875		2203	4300	6503	SO:0001819	synonymous_variant	81029	exon3			CGGTGCCCAGCCC	AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.132C>G	12.37:g.1741875C>G		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	61.0	NM_032642	A8K315|D3DUP9|Q96S49|Q9BV04	Silent	SNP	ENST00000397196.2	37	CCDS8510.1																																																																																			.		0.562	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206747.2		
XK	7504	hgsc.bcm.edu;bcgsc.ca	37	X	37553772	37553772	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chrX:37553772T>C	ENST00000378616.3	+	2	682	c.479T>C	c.(478-480)gTc>gCc	p.V160A	TM4SF2_ENST00000465127.1_Intron	NM_021083.2	NP_066569.1	P51811	XK_HUMAN	X-linked Kx blood group	160					amino acid transport (GO:0006865)|transport (GO:0006810)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	15		all_lung(315;0.175)				TACATAAGTGTCATGCAGCAG	0.483																																					p.V160A		.											.	XK	130	0			c.T479C						.						68.0	50.0	56.0					X																	37553772		2200	4296	6496	SO:0001583	missense	7504	exon2			TAAGTGTCATGCA	Z32684	CCDS14241.1	Xp21.1	2014-07-19	2014-06-18		ENSG00000047597	ENSG00000047597		"""Blood group antigens"""	12811	protein-coding gene	gene with protein product	"""Kx antigen"", ""McLeod syndrome"""	314850	"""Kell blood group precursor (McLeod phenotype)"", ""XK, Kell blood group complex subunit (McLeod syndrome)"", ""neuroacanthocytosis"", ""neurocanthocytosis"""	NA, NAC		8004674, 11761473	Standard	NM_021083		Approved	XKR1, Kx, X1k	uc004ddq.3	P51811	OTTHUMG00000033171	ENST00000378616.3:c.479T>C	X.37:g.37553772T>C	ENSP00000367879:p.Val160Ala	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	5.0	NM_021083	Q4TTN6|Q8IUK6|Q9UC77	Missense_Mutation	SNP	ENST00000378616.3	37	CCDS14241.1	.	.	.	.	.	.	.	.	.	.	T	11.49	1.653096	0.29425	.	.	ENSG00000047597	ENST00000378616	T	0.66995	-0.24	6.04	3.72	0.42706	.	0.565552	0.19027	N	0.124642	T	0.64382	0.2593	M	0.72894	2.215	0.34753	D	0.73195	B	0.12013	0.005	B	0.20955	0.032	T	0.63902	-0.6532	10	0.31617	T	0.26	-3.2206	11.3662	0.49673	0.0:0.0841:0.0:0.9159	.	160	P51811	XK_HUMAN	A	160	ENSP00000367879:V160A	ENSP00000367879:V160A	V	+	2	0	XK	37438711	0.835000	0.29415	0.001000	0.08648	0.370000	0.29829	4.857000	0.62939	0.384000	0.24942	0.417000	0.27973	GTC	.		0.483	XK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080875.1	NM_021083	
ZFHX3	463	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	72829897	72829897	+	Silent	SNP	G	G	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr16:72829897G>C	ENST00000268489.5	-	9	7356	c.6684C>G	c.(6682-6684)ccC>ccG	p.P2228P	ZFHX3_ENST00000397992.5_Silent_p.P1314P	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2228					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCGGCGAAGGGGGCCGGGAGT	0.527																																					p.P2228P		.											.	ZFHX3	72	0			c.C6684G						.						106.0	105.0	105.0					16																	72829897		2198	4300	6498	SO:0001819	synonymous_variant	463	exon9			CGAAGGGGGCCGG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6684C>G	16.37:g.72829897G>C		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	68.0	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.527	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZNF280B	140883	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	22842944	22842944	+	Silent	SNP	T	T	A			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr22:22842944T>A	ENST00000406426.1	-	4	1522	c.780A>T	c.(778-780)gcA>gcT	p.A260A	ZNF280B_ENST00000360412.2_Silent_p.A260A			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TGTCTGTTTTTGCCAATTCAT	0.363																																					p.A260A		.											.	ZNF280B	70	0			c.A780T						.						106.0	100.0	102.0					22																	22842944		2203	4300	6503	SO:0001819	synonymous_variant	140883	exon4			TGTTTTTGCCAAT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.780A>T	22.37:g.22842944T>A		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	17.0	NM_080764		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																			.		0.363	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
ZNF354B	117608	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	178311121	178311121	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr5:178311121delA	ENST00000322434.3	+	5	1894	c.1668delA	c.(1666-1668)ggafs	p.G556fs	ZNF354B_ENST00000522714.1_3'UTR|RNU1-39P_ENST00000383897.1_RNA	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	556					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATACATGTGGAAAAACTTTTA	0.368																																					p.G556fs		.											.	ZNF354B	92	0			c.1668delA						.						66.0	63.0	64.0					5																	178311121		2203	4300	6503	SO:0001589	frameshift_variant	117608	exon5			ATGTGGAAAAACT	AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.1668delA	5.37:g.178311121delA	ENSP00000327143:p.Gly556fs	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	31.0	NM_058230	A8K0V2|Q5U5Z4	Frame_Shift_Del	DEL	ENST00000322434.3	37	CCDS4439.1																																																																																			.		0.368	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253482.1	NM_058230	
ZNF675	171392	hgsc.bcm.edu;bcgsc.ca	37	19	23837367	23837367	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr19:23837367T>C	ENST00000359788.4	-	4	536	c.368A>G	c.(367-369)aAg>aGg	p.K123R	ZNF675_ENST00000601935.1_Intron|ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	123					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CTTGTGCAACTTACATTCATC	0.294																																					p.K123R		.											.	ZNF675	228	0			c.A368G						.						83.0	81.0	82.0					19																	23837367		2203	4298	6501	SO:0001583	missense	171392	exon4			TGCAACTTACATT		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.368A>G	19.37:g.23837367T>C	ENSP00000352836:p.Lys123Arg	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	5.0	NM_138330	Q8N211	Missense_Mutation	SNP	ENST00000359788.4	37	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	7.721	0.697156	0.15106	.	.	ENSG00000197372	ENST00000359788	T	0.07114	3.22	1.13	1.13	0.20643	.	.	.	.	.	T	0.12433	0.0302	M	0.84156	2.68	0.09310	N	1	B	0.23937	0.094	B	0.25614	0.062	T	0.20638	-1.0269	9	0.41790	T	0.15	.	6.0138	0.19589	0.0:0.0:0.0:1.0	.	123	Q8TD23	ZN675_HUMAN	R	123	ENSP00000352836:K123R	ENSP00000352836:K123R	K	-	2	0	ZNF675	23629207	0.001000	0.12720	0.002000	0.10522	0.021000	0.10359	0.295000	0.19065	0.469000	0.27268	0.254000	0.18369	AAG	.		0.294	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330	
CREB3L1	90993	hgsc.bcm.edu;bcgsc.ca	37	11	46342258	46342259	+	Splice_Site	DNP	CA	CA	AG	rs79068197|rs386373762|rs386373761		TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr11:46342258_46342259CA>AG	ENST00000529193.1	+	12	1974		c.e12-1		CREB3L1_ENST00000288400.3_Splice_Site			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1						regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		CTTCTCTCTCCAGGATCTGGGC	0.579			T	FUS	myxofibrosarcoma																																.	Pancreas(3;159 194 19597 26278 47995)	.		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	.	.	.	0			.						.																																			SO:0001630	splice_region_variant	90993	.			TCTCTCCAGGATC		CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		Exception_encountered	11.37:g.46342258_46342259delinsAG		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	11.0	.	Q8N2D5|Q96CP0	Splice_Site	DNP	ENST00000529193.1	37	CCDS53620.1																																																																																			.		0.579	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854	Intron
BRD1	23774	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	50187702	50187703	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-DD-A3A0-01A-11D-A20W-10	TCGA-DD-A3A0-11A-11D-A20W-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	148ae891-9087-42b8-afa7-4365f5f6f571	e13dd465-5367-4faa-82bf-be30550c67b3	g.chr22:50187702_50187703CC>AA	ENST00000216267.8	-	6	2824_2825	c.2338_2339GG>TT	c.(2338-2340)GGg>TTg	p.G780L	BRD1_ENST00000342989.5_Missense_Mutation_p.G375L|BRD1_ENST00000542442.1_Missense_Mutation_p.G468L|BRD1_ENST00000457780.2_Missense_Mutation_p.G780L|BRD1_ENST00000404034.1_Missense_Mutation_p.G780L|BRD1_ENST00000404760.1_Missense_Mutation_p.G780L	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	780					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.G780V(1)|p.G375V(1)		endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CGCCTCCGGCCCCAGCGCAGCT	0.663																																					p.G780L		.											.	.	.	2	Substitution - Missense(2)	kidney(2)	.						.																																			SO:0001583	missense	23774	.			TCCGGCCCCAGCG	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.2338_2339delinsAA	22.37:g.50187702_50187703delinsAA	ENSP00000216267:p.Gly780Leu	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	43.0	.	A6ZJA4	Missense_Mutation	DNP	ENST00000216267.8	37	CCDS14080.1																																																																																			.		0.663	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1	NM_014577	
