#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	48318670	48318670	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:48318670C>A	ENST00000435803.1	+	18	7903	c.7879C>A	c.(7879-7881)Caa>Aaa	p.Q2627K		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2627					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATATATGAACCAATCTAAGGA	0.333																																					p.Q2627K		.											.	ABCA13	521	0			c.C7879A						.						42.0	41.0	41.0					7																	48318670		1808	4066	5874	SO:0001583	missense	154664	exon18			ATGAACCAATCTA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7879C>A	7.37:g.48318670C>A	ENSP00000411096:p.Gln2627Lys	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	20.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	2.973	-0.211932	0.06140	.	.	ENSG00000179869	ENST00000435803	T	0.56611	0.45	4.93	2.15	0.27550	.	0.632381	0.13900	N	0.354941	T	0.33294	0.0858	N	0.20986	0.625	0.09310	N	0.999998	B	0.06786	0.001	B	0.06405	0.002	T	0.20505	-1.0273	10	0.46703	T	0.11	.	3.8515	0.08957	0.1687:0.5792:0.1627:0.0894	.	2627	Q86UQ4	ABCAD_HUMAN	K	2627	ENSP00000411096:Q2627K	ENSP00000411096:Q2627K	Q	+	1	0	ABCA13	48289216	0.002000	0.14202	0.008000	0.14137	0.006000	0.05464	-0.167000	0.09940	0.163000	0.19507	-0.776000	0.03382	CAA	.		0.333	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABI3BP	25890	hgsc.bcm.edu;bcgsc.ca	37	3	100569517	100569517	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:100569517T>C	ENST00000284322.5	-	14	1396	c.1287A>G	c.(1285-1287)ccA>ccG	p.P429P	ABI3BP_ENST00000495063.1_Silent_p.P478P|ABI3BP_ENST00000471714.1_Silent_p.P478P	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	429	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						GTGTTGCCCTTGGCTGTTCAA	0.333																																					p.P429P		.											.	ABI3BP	138	0			c.A1287G						.						124.0	121.0	122.0					3																	100569517		1805	4070	5875	SO:0001819	synonymous_variant	25890	exon14			TGCCCTTGGCTGT	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1287A>G	3.37:g.100569517T>C		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	5.0	NM_015429	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Silent	SNP	ENST00000284322.5	37	CCDS46880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.226|9.226	1.034565|1.034565	0.19590|0.19590	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000459682|ENST00000533855	.|.	.|.	.|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|.	.|.	.|.	.|.	T|T	0.71643|0.71643	0.3364|0.3364	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.70443|0.70443	-0.4870|-0.4870	4|4	.|.	.|.	.|.	-17.0179|-17.0179	15.1469|15.1469	0.72662|0.72662	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	E|R	55|107	.|.	.|.	K|Q	-|-	1|2	0|0	ABI3BP|ABI3BP	102052207|102052207	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.846000|4.846000	0.62860|0.62860	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	AAG|CAA	.		0.333	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1		
ACADVL	37	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7123814	7123814	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:7123814C>A	ENST00000356839.5	+	3	349	c.170C>A	c.(169-171)tCt>tAt	p.S57Y	ACADVL_ENST00000581562.1_3'UTR|MIR324_ENST00000362183.1_RNA|DLG4_ENST00000399510.2_5'Flank|ACADVL_ENST00000543245.2_Missense_Mutation_p.S80Y|ACADVL_ENST00000350303.5_Intron	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	57	Catalytic.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						TCCCACCCCTCTGACGCTCTG	0.577																																					p.S80Y		.											.	ACADVL	93	0			c.C239A						.						68.0	70.0	69.0					17																	7123814		2203	4300	6503	SO:0001583	missense	37	exon4			ACCCCTCTGACGC	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.170C>A	17.37:g.7123814C>A	ENSP00000349297:p.Ser57Tyr	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	36.0	NM_001270447	B4DEB6|F5H2A9|O76056|Q8WUL0	Missense_Mutation	SNP	ENST00000356839.5	37	CCDS11090.1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.616576	0.66672	.	.	ENSG00000072778	ENST00000543245;ENST00000356839;ENST00000322910;ENST00000542255	D	0.96967	-4.19	5.82	2.5	0.30297	.	0.814642	0.11767	N	0.531520	D	0.93661	0.7975	L	0.36672	1.1	0.19300	N	0.99997	P;P;P	0.49635	0.797;0.926;0.8	B;B;B	0.44315	0.332;0.446;0.365	D	0.86613	0.1874	10	0.59425	D	0.04	.	11.3334	0.49490	0.4807:0.5193:0.0:0.0	.	103;80;57	G3V1M7;F5H2A9;P49748	.;.;ACADV_HUMAN	Y	80;103;57;103	ENSP00000438689:S80Y	ENSP00000325395:S57Y	S	+	2	0	ACADVL	7064538	0.000000	0.05858	0.256000	0.24389	0.007000	0.05969	0.662000	0.25038	0.756000	0.33013	0.655000	0.94253	TCT	.		0.577	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220001.5	NM_000018	
APLP2	334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	130011950	130011950	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:130011950T>G	ENST00000263574.5	+	17	2243	c.2171T>G	c.(2170-2172)aTc>aGc	p.I724S	APLP2_ENST00000543137.1_Missense_Mutation_p.I619S|APLP2_ENST00000338167.5_Missense_Mutation_p.I712S|APLP2_ENST00000539648.1_Missense_Mutation_p.I512S|APLP2_ENST00000528499.1_Missense_Mutation_p.I656S|APLP2_ENST00000278756.7_Missense_Mutation_p.I722S|APLP2_ENST00000345598.5_Missense_Mutation_p.I483S	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	724					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TATGGCACCATCAGCCACGGG	0.592																																					p.I724S		.											.	APLP2	93	0			c.T2171G						.						75.0	58.0	63.0					11																	130011950		2201	4297	6498	SO:0001583	missense	334	exon17			GCACCATCAGCCA	L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.2171T>G	11.37:g.130011950T>G	ENSP00000263574:p.Ile724Ser	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	33.0	NM_001642	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	ENST00000263574.5	37	CCDS8486.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.474193	0.84640	.	.	ENSG00000084234	ENST00000528499;ENST00000539648;ENST00000263574;ENST00000345598;ENST00000338167;ENST00000278756;ENST00000543137	D;D;D;D;D;D;D	0.95885	-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84	5.75	5.75	0.90469	Beta-amyloid precursor protein C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97015	0.9025	M	0.63428	1.95	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D	0.91635	0.996;0.999;0.996;0.999;0.999;0.994;0.997	D	0.96843	0.9619	9	.	.	.	-29.7097	15.2493	0.73532	0.0:0.0:0.0:1.0	.	512;724;668;483;650;656;712	F5H845;Q06481;Q06481-2;Q06481-5;B4E3I5;Q06481-4;Q06481-3	.;APLP2_HUMAN;.;.;.;.;.	S	656;512;724;483;712;722;619	ENSP00000435914:I656S;ENSP00000443728:I512S;ENSP00000263574:I724S;ENSP00000263575:I483S;ENSP00000345444:I712S;ENSP00000278756:I722S;ENSP00000444122:I619S	.	I	+	2	0	APLP2	129517160	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.640000	0.83355	2.188000	0.69820	0.528000	0.53228	ATC	.		0.592	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386109.1	NM_001642	
AQP3	360	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33442307	33442307	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:33442307T>C	ENST00000297991.4	-	5	782	c.702A>G	c.(700-702)gcA>gcG	p.A234A	AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)	234					excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		ACGTGAAGACTGCAGAGCCCC	0.642																																					p.A234A		.											.	AQP3	90	0			c.A702G						.						17.0	23.0	21.0					9																	33442307		2203	4300	6503	SO:0001819	synonymous_variant	360	exon5			GAAGACTGCAGAG		CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.702A>G	9.37:g.33442307T>C		Somatic	69.0	1.0		WXS	Illumina HiSeq	Phase_I	60.0	21.0	NM_004925	A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	Silent	SNP	ENST00000297991.4	37	CCDS6542.1																																																																																			.		0.642	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052055.1	NM_004925	
ATP12A	479	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	25274939	25274939	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:25274939A>G	ENST00000381946.3	+	13	1927	c.1760A>G	c.(1759-1761)gAc>gGc	p.D587G	RNY1P7_ENST00000384743.1_RNA|ATP12A_ENST00000218548.6_Missense_Mutation_p.D593G			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	587					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		TACTCATTTGACATAGACGCT	0.458																																					p.D593G	Pancreas(156;1582 1935 18898 22665 26498)	.											ATP12A,NS,carcinoma,+1	ATP12A	137	0			c.A1778G						.						137.0	125.0	129.0					13																	25274939		2203	4300	6503	SO:0001583	missense	479	exon13			CATTTGACATAGA	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1760A>G	13.37:g.25274939A>G	ENSP00000371372:p.Asp587Gly	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	60.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	A	16.13	3.035648	0.54896	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	T;T	0.80909	-1.43;-1.43	6.17	5.0	0.66597	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.063239	0.64402	D	0.000005	D	0.84070	0.5391	L	0.47716	1.5	0.58432	D	0.999999	D;D	0.67145	0.996;0.996	D;P	0.63597	0.916;0.903	D	0.84454	0.0590	10	0.66056	D	0.02	.	10.5257	0.44948	0.9246:0.0:0.0754:0.0	.	593;587	P54707-2;P54707	.;AT12A_HUMAN	G	593;587	ENSP00000218548:D593G;ENSP00000371372:D587G	ENSP00000218548:D593G	D	+	2	0	ATP12A	24172939	1.000000	0.71417	0.831000	0.32960	0.010000	0.07245	9.228000	0.95250	1.161000	0.42604	-0.250000	0.11733	GAC	.		0.458	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
CACNG4	27092	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65026831	65026831	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:65026831G>A	ENST00000262138.3	+	4	697	c.695G>A	c.(694-696)aGg>aAg	p.R232K	RP11-74H8.1_ENST00000579138.1_RNA|AC005544.1_ENST00000375684.1_5'Flank	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	232					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			CCTTATGCCAGGATGCCGAGC	0.552																																					p.R232K		.											.	CACNG4	90	0			c.G695A						.						73.0	77.0	76.0					17																	65026831		2203	4300	6503	SO:0001583	missense	27092	exon4			ATGCCAGGATGCC	AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.695G>A	17.37:g.65026831G>A	ENSP00000262138:p.Arg232Lys	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	68.0	NM_014405	B2RCK0	Missense_Mutation	SNP	ENST00000262138.3	37	CCDS11667.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.537970	0.85917	.	.	ENSG00000075461	ENST00000262138	T	0.58060	0.36	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.56337	0.1978	M	0.79123	2.44	0.80722	D	1	D	0.58268	0.982	B	0.44315	0.446	T	0.59815	-0.7383	10	0.11485	T	0.65	-0.0339	18.0456	0.89331	0.0:0.0:1.0:0.0	.	232	Q9UBN1	CCG4_HUMAN	K	232	ENSP00000262138:R232K	ENSP00000262138:R232K	R	+	2	0	CACNG4	62457293	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.319000	0.96338	2.274000	0.75844	0.556000	0.70494	AGG	.		0.552	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447036.1	NM_014405	
CASD1	64921	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	94164818	94164818	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:94164818G>C	ENST00000297273.4	+	8	1113	c.826G>C	c.(826-828)Gaa>Caa	p.E276Q		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	276						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ACATCTTCCTGAATCGAGCAG	0.323																																					p.E276Q		.											.	CASD1	70	0			c.G826C						.						85.0	83.0	83.0					7																	94164818		2203	4300	6503	SO:0001583	missense	64921	exon8			CTTCCTGAATCGA	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.826G>C	7.37:g.94164818G>C	ENSP00000297273:p.Glu276Gln	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	77.0	NM_022900	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	ENST00000297273.4	37	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057289	0.76074	.	.	ENSG00000127995	ENST00000297273	T	0.17370	2.28	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.21509	0.0518	N	0.19112	0.55	0.80722	D	1	D;D	0.61080	0.989;0.989	P;P	0.55785	0.784;0.784	T	0.04103	-1.0977	10	0.16896	T	0.51	.	19.0801	0.93178	0.0:0.0:1.0:0.0	.	276;276	Q8WZ77;Q96PB1	.;CASD1_HUMAN	Q	276	ENSP00000297273:E276Q	ENSP00000297273:E276Q	E	+	1	0	CASD1	94002754	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.391000	0.97249	2.593000	0.87608	0.591000	0.81541	GAA	.		0.323	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1	NM_022900	
CHRM5	1133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34355738	34355738	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:34355738T>C	ENST00000383263.5	+	3	1490	c.820T>C	c.(820-822)Tcc>Ccc	p.S274P	CHRM5_ENST00000557872.1_Missense_Mutation_p.S274P	NM_012125.3	NP_036257.1	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	274					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|dopamine transport (GO:0015872)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|gastric acid secretion (GO:0001696)|metabolic process (GO:0008152)|regulation of phosphatidylinositol dephosphorylation (GO:0060304)|transmission of nerve impulse (GO:0019226)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	20		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Imipramine(DB00458)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CTGGTCATCCTCCCGCAGGAG	0.622																																					p.S274P		.											CHRM5,brain,glioma,-1	CHRM5	91	0			c.T820C						.						47.0	47.0	47.0					15																	34355738		2201	4298	6499	SO:0001583	missense	1133	exon3			TCATCCTCCCGCA		CCDS10031.1	15q26	2012-08-08			ENSG00000184984	ENSG00000184984		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1954	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 5"""	118496					Standard	NM_012125		Approved		uc001zhk.1	P08912	OTTHUMG00000129369	ENST00000383263.5:c.820T>C	15.37:g.34355738T>C	ENSP00000372750:p.Ser274Pro	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	24.0	NM_012125	Q96RG7	Missense_Mutation	SNP	ENST00000383263.5	37	CCDS10031.1	.	.	.	.	.	.	.	.	.	.	T	11.50	1.656802	0.29425	.	.	ENSG00000184984	ENST00000383263	T	0.63255	-0.03	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.306724	0.32028	N	0.006691	T	0.56702	0.2003	L	0.39085	1.19	0.58432	D	0.999995	B	0.32939	0.391	B	0.37731	0.257	T	0.55296	-0.8163	10	0.33141	T	0.24	-21.8193	15.6252	0.76851	0.0:0.0:0.0:1.0	.	274	P08912	ACM5_HUMAN	P	274	ENSP00000372750:S274P	ENSP00000372750:S274P	S	+	1	0	CHRM5	32143030	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	7.812000	0.86109	2.275000	0.75901	0.528000	0.53228	TCC	.		0.622	CHRM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251521.2		
CELF6	60677	hgsc.bcm.edu;bcgsc.ca	37	15	72581260	72581260	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:72581260C>A	ENST00000569547.1	-	9	1113	c.1042G>T	c.(1042-1044)Ggc>Tgc	p.G348C	CELF6_ENST00000539635.1_Missense_Mutation_p.G209C|RP11-106M3.2_ENST00000379915.4_RNA|CELF6_ENST00000543764.2_Intron|RP11-106M3.3_ENST00000570175.1_RNA|CELF6_ENST00000395258.2_Missense_Mutation_p.G235C|CELF6_ENST00000287202.5_Missense_Mutation_p.G348C|CELF6_ENST00000567083.1_Missense_Mutation_p.G348C|CELF6_ENST00000569311.1_5'Flank			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	348					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						TCAGCCACGCCGGGGCTCTGG	0.677																																					p.G348C		.											.	CELF6	154	0			c.G1042T						.						5.0	5.0	5.0					15																	72581260		2019	3993	6012	SO:0001583	missense	60677	exon9			CCACGCCGGGGCT	AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.1042G>T	15.37:g.72581260C>A	ENSP00000454749:p.Gly348Cys	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	207.0	92.0	NM_001172684	B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Missense_Mutation	SNP	ENST00000569547.1	37	CCDS10242.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063340	0.36373	.	.	ENSG00000140488	ENST00000287202;ENST00000437872;ENST00000379915;ENST00000395258;ENST00000539635	T;T;T	0.24908	1.83;2.07;3.57	4.75	1.26	0.21427	.	0.285626	0.24838	U	0.035190	T	0.37812	0.1017	L	0.57536	1.79	0.27313	N	0.957257	D;D;D;D	0.65815	0.988;0.995;0.994;0.988	P;D;P;P	0.67725	0.687;0.953;0.757;0.687	T	0.09975	-1.0650	10	0.66056	D	0.02	.	5.2205	0.15366	0.0:0.4738:0.0:0.5262	.	348;235;209;348	B4DJB6;Q96J87-2;B3KWE6;Q96J87	.;.;.;CELF6_HUMAN	C	348;348;199;235;209	ENSP00000287202:G348C;ENSP00000378677:G235C;ENSP00000443162:G209C	ENSP00000287202:G348C	G	-	1	0	CELF6	70368314	0.044000	0.20184	0.989000	0.46669	0.986000	0.74619	0.761000	0.26489	0.410000	0.25675	0.561000	0.74099	GGC	.		0.677	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000420180.1	NM_052840	
CHST3	9469	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	10	73767842	73767842	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:73767842C>T	ENST00000373115.4	+	3	1490	c.1053C>T	c.(1051-1053)tcC>tcT	p.S351S		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	351					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						TCCGCCTGTCCGCGGAGCTGG	0.706																																					p.S351S		.											.	CHST3	90	0			c.C1053T						.						6.0	5.0	5.0					10																	73767842		1770	3355	5125	SO:0001819	synonymous_variant	9469	exon3			CCTGTCCGCGGAG	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.1053C>T	10.37:g.73767842C>T		Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	19.0	NM_004273	O75099|Q52M30	Silent	SNP	ENST00000373115.4	37	CCDS7312.1																																																																																			.		0.706	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273	
CNTROB	116840	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	7851016	7851016	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:7851016G>C	ENST00000563694.1	+	14	3046	c.2121G>C	c.(2119-2121)gaG>gaC	p.E707D	CNTROB_ENST00000380255.3_3'UTR|CNTROB_ENST00000380262.3_Missense_Mutation_p.E707D|CNTROB_ENST00000565740.1_Missense_Mutation_p.E707D	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	707	Pro-rich.|Required for centrosome localization.				centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				CTCAGCTGGAGGGCCTCAAGA	0.542																																					p.E707D		.											.	CNTROB	153	0			c.G2121C						.						82.0	88.0	86.0					17																	7851016		2203	4300	6503	SO:0001583	missense	116840	exon14			GCTGGAGGGCCTC	AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.2121G>C	17.37:g.7851016G>C	ENSP00000456335:p.Glu707Asp	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	72.0	NM_001037144	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Missense_Mutation	SNP	ENST00000563694.1	37	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	G	11.30	1.598749	0.28445	.	.	ENSG00000170037	ENST00000380262	T	0.10192	2.9	5.41	-5.03	0.02973	.	0.536026	0.16924	N	0.193956	T	0.04952	0.0133	L	0.27053	0.805	0.51482	D	0.999927	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.30794	-0.9966	10	0.72032	D	0.01	-1.0222	1.0312	0.01538	0.4235:0.1135:0.1943:0.2688	.	707;707;707	Q8N137-3;Q8N137;Q8N137-2	.;CNTRB_HUMAN;.	D	707	ENSP00000369614:E707D	ENSP00000369614:E707D	E	+	3	2	CNTROB	7791741	0.725000	0.28048	0.263000	0.24496	0.490000	0.33462	-0.594000	0.05733	-0.705000	0.05035	-1.210000	0.01631	GAG	.		0.542	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	
COL11A2	1302	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33141808	33141808	+	Silent	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:33141808G>T	ENST00000374708.4	-	31	2509	c.2251C>A	c.(2251-2253)Cgg>Agg	p.R751R	COL11A2_ENST00000361917.1_Silent_p.R730R|COL11A2_ENST00000374712.1_Silent_p.R756R|COL11A2_ENST00000374713.1_Silent_p.R790R|COL11A2_ENST00000395197.1_Silent_p.R777R|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000341947.2_Silent_p.R837R|COL11A2_ENST00000357486.1_Silent_p.R816R|COL11A2_ENST00000374714.1_Silent_p.R811R	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	837	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CGTTCTCCCCGAGGCCCTGAC	0.612																																					p.R837R	Melanoma(1;90 116 3946 5341 17093)	.											.	COL11A2	95	0			c.C2509A						.						55.0	56.0	56.0					6																	33141808		1511	2709	4220	SO:0001819	synonymous_variant	1302	exon33			CTCCCCGAGGCCC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.2251C>A	6.37:g.33141808G>T		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	187.0	66.0	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000374708.4	37	CCDS43452.1																																																																																			.		0.612	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
COMP	1311	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	18899995	18899995	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:18899995G>A	ENST00000222271.2	-	5	546	c.502C>T	c.(502-504)Ctg>Ttg	p.L168L	COMP_ENST00000425807.1_Intron|COMP_ENST00000542601.2_Silent_p.L135L	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	168	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GCGAAAGCCAGCCCCACGCCC	0.647																																					p.L168L		.											.	COMP	90	0			c.C502T						.						12.0	15.0	14.0					19																	18899995		2192	4255	6447	SO:0001819	synonymous_variant	1311	exon5			AAGCCAGCCCCAC	L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.502C>T	19.37:g.18899995G>A		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	31.0	NM_000095	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Silent	SNP	ENST00000222271.2	37	CCDS12385.1																																																																																			.		0.647	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1	NM_000095	
CPA5	93979	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	130007288	130007288	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:130007288C>T	ENST00000485477.1	+	10	2043	c.914C>T	c.(913-915)gCc>gTc	p.A305V	CPA5_ENST00000461828.1_Missense_Mutation_p.A305V|CPA5_ENST00000393213.3_Missense_Mutation_p.A305V|CPA5_ENST00000431780.2_Missense_Mutation_p.A305V|CPA5_ENST00000355388.3_Missense_Mutation_p.A305V|CPA5_ENST00000474905.1_Missense_Mutation_p.A305V|CPA5_ENST00000466363.2_Missense_Mutation_p.A305V			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	305						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					GAGGTGGCTGCCATAGTGAAC	0.522																																					p.A305V		.											.	CPA5	92	0			c.C914T						.						96.0	91.0	93.0					7																	130007288		2203	4300	6503	SO:0001583	missense	93979	exon11			TGGCTGCCATAGT	AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.914C>T	7.37:g.130007288C>T	ENSP00000420237:p.Ala305Val	Somatic	269.0	0.0		WXS	Illumina HiSeq	Phase_I	301.0	91.0	NM_080385	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Missense_Mutation	SNP	ENST00000485477.1	37	CCDS5819.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344562	0.61073	.	.	ENSG00000158525	ENST00000355388;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	T;T;T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32;2.32;2.32	5.87	5.87	0.94306	Peptidase M14, carboxypeptidase A (2);	0.099447	0.44688	D	0.000433	T	0.36880	0.0983	M	0.68728	2.09	0.20307	N	0.999917	D;P	0.54964	0.969;0.873	P;P	0.56216	0.794;0.791	T	0.10337	-1.0634	9	.	.	.	.	19.2073	0.93736	0.0:1.0:0.0:0.0	.	305;305	G3V0G8;Q8WXQ8	.;CBPA5_HUMAN	V	305	ENSP00000347549:A305V;ENSP00000418183:A305V;ENSP00000419025:A305V;ENSP00000420237:A305V;ENSP00000393045:A305V;ENSP00000417314:A305V;ENSP00000376907:A305V	.	A	+	2	0	CPA5	129794524	0.974000	0.33945	0.983000	0.44433	0.003000	0.03518	4.787000	0.62432	2.780000	0.95670	0.655000	0.94253	GCC	.		0.522	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441	
CSMD3	114788	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	113585826	113585826	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:113585826G>T	ENST00000297405.5	-	24	4190	c.3946C>A	c.(3946-3948)Cgc>Agc	p.R1316S	CSMD3_ENST00000455883.2_Missense_Mutation_p.R1212S|CSMD3_ENST00000352409.3_Missense_Mutation_p.R1316S|CSMD3_ENST00000343508.3_Missense_Mutation_p.R1276S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1316	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTCAGTCCGCGCATAGATGCA	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.R1316S		.											.	CSMD3	1132	0			c.C3946A						.						123.0	124.0	123.0					8																	113585826		2203	4300	6503	SO:0001583	missense	114788	exon24			GTCCGCGCATAGA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3946C>A	8.37:g.113585826G>T	ENSP00000297405:p.Arg1316Ser	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	35.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415716	0.25552	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	4.85	-2.53	0.06326	CUB (5);	0.191183	0.33572	N	0.004775	T	0.22085	0.0532	N	0.10760	0.04	0.25265	N	0.98957	P;P;D	0.53619	0.706;0.75;0.961	B;P;P	0.51582	0.421;0.557;0.674	T	0.34700	-0.9818	10	0.19147	T	0.46	.	18.8933	0.92413	0.0:0.0:0.2404:0.7596	.	1212;1316;1276	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	1276;1316;656;1212;1316	ENSP00000345799:R1276S;ENSP00000297405:R1316S;ENSP00000341558:R656S;ENSP00000412263:R1212S;ENSP00000343124:R1316S	ENSP00000297405:R1316S	R	-	1	0	CSMD3	113655002	0.485000	0.25972	0.985000	0.45067	0.986000	0.74619	-0.233000	0.09041	-0.337000	0.08426	0.591000	0.81541	CGC	.		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CYP11B2	1585	hgsc.bcm.edu;bcgsc.ca	37	8	143996601	143996601	+	Missense_Mutation	SNP	C	C	G	rs552105650		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:143996601C>G	ENST00000323110.2	-	3	458	c.456G>C	c.(454-456)aaG>aaC	p.K152N		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	152					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TCTGCACGGCCTTGGGCGACA	0.642									Familial Hyperaldosteronism type I				.|||	1	0.000199681	0.0	0.0	5008	,	,		19898	0.0		0.0	False		,,,				2504	0.001				p.K152N		.											.	CYP11B2	90	0			c.G456C						.						62.0	52.0	55.0					8																	143996601		2203	4300	6503	SO:0001583	missense	1585	exon3	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	CACGGCCTTGGGC	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.456G>C	8.37:g.143996601C>G	ENSP00000325822:p.Lys152Asn	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	297.0	24.0	NM_000498	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	8.417	0.845455	0.16963	.	.	ENSG00000179142	ENST00000323110	T	0.69685	-0.42	3.44	-4.07	0.03975	.	0.994613	0.08154	N	0.989473	T	0.56156	0.1966	L	0.58810	1.83	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.51212	-0.8734	10	0.56958	D	0.05	.	5.076	0.14632	0.2202:0.1889:0.0:0.5909	.	152	P19099	C11B2_HUMAN	N	152	ENSP00000325822:K152N	ENSP00000325822:K152N	K	-	3	2	CYP11B2	143993603	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.715000	0.04997	-0.723000	0.04915	-0.258000	0.10820	AAG	.		0.642	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
DCP1A	55802	hgsc.bcm.edu;ucsc.edu	37	3	53326495	53326495	+	Silent	SNP	T	T	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:53326495T>A	ENST00000607628.1	-	7	1096	c.987A>T	c.(985-987)gcA>gcT	p.A329A	DCP1A_ENST00000606822.1_Silent_p.A291A|DCP1A_ENST00000480258.1_5'UTR|Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000294241.6_Silent_p.A329A	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	329					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		GGGGAACCTGTGCAGTAGGAG	0.562																																					p.A329A		.											.	DCP1A	90	0			c.A987T						.						67.0	74.0	72.0					3																	53326495		2142	4253	6395	SO:0001819	synonymous_variant	55802	exon7			AACCTGTGCAGTA	AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.987A>T	3.37:g.53326495T>A		Somatic	465.0	0.0		WXS	Illumina HiSeq	Phase_I	431.0	163.0	NM_018403	B4DHN9|U3KQM8	Silent	SNP	ENST00000607628.1	37																																																																																				.		0.562	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018403	
DDX46	9879	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	134121198	134121198	+	Silent	SNP	T	T	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:134121198T>A	ENST00000354283.4	+	11	1521	c.1386T>A	c.(1384-1386)acT>acA	p.T462T	DDX46_ENST00000452510.2_Silent_p.T462T|DDX46_ENST00000509178.1_3'UTR			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	462	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.			TKECKKFS -> PKGVRSF (in Ref. 1; AAD43033). {ECO:0000305}.	mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TACAGATTACTAAAGAGTGTA	0.393																																					p.T462T	Colon(13;391 453 4901 21675 24897)	.											.	DDX46	227	0			c.T1386A						.						154.0	155.0	155.0					5																	134121198		2203	4300	6503	SO:0001819	synonymous_variant	9879	exon11			GATTACTAAAGAG		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.1386T>A	5.37:g.134121198T>A		Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	35.0	NM_014829	O94894|Q96EI0|Q9Y658	Silent	SNP	ENST00000354283.4	37	CCDS34240.1																																																																																			.		0.393	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
DHX34	9704	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47876048	47876048	+	Silent	SNP	C	C	A	rs562906654	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:47876048C>A	ENST00000328771.4	+	8	2179	c.1830C>A	c.(1828-1830)gcC>gcA	p.A610A		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	610					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CCATCGCAGCCGCACTTAGCG	0.682																																					p.A610A		.											.	DHX34	231	0			c.C1830A						.						45.0	41.0	42.0					19																	47876048		2202	4300	6502	SO:0001819	synonymous_variant	9704	exon8			CGCAGCCGCACTT	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1830C>A	19.37:g.47876048C>A		Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	106.0	NM_014681	B4DMY8	Silent	SNP	ENST00000328771.4	37	CCDS12700.1																																																																																			.		0.682	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
DNAH17	8632	hgsc.bcm.edu;ucsc.edu	37	17	76472713	76472713	+	Nonsense_Mutation	SNP	C	C	A	rs116230343	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:76472713C>A	ENST00000585328.1	-	52	8204	c.8080G>T	c.(8080-8082)Gaa>Taa	p.E2694*	DNAH17_ENST00000586052.1_Intron|DNAH17_ENST00000389840.5_Nonsense_Mutation_p.E2685*	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2685					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGGTCTTTTTCGTCAACCATT	0.488																																					p.E2699X		.											.	DNAH17	142	0			c.G8095T						.						156.0	177.0	170.0					17																	76472713		2014	4177	6191	SO:0001587	stop_gained	8632	exon52			CTTTTTCGTCAAC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.8080G>T	17.37:g.76472713C>A	ENSP00000465516:p.Glu2694*	Somatic	279.0	0.0		WXS	Illumina HiSeq	Phase_I	513.0	295.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Nonsense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	C	49	15.769301	0.99844	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	.	.	.	4.64	2.47	0.30058	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	8.0951	0.30824	0.0:0.6116:0.3066:0.0818	.	.	.	.	X	2694;2685	.	ENSP00000300671:E2694X	E	-	1	0	DNAH17	73984308	0.408000	0.25360	0.141000	0.22245	0.808000	0.45660	1.708000	0.37899	0.935000	0.37341	0.455000	0.32223	GAA	C|0.986;T|0.014		0.488	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
DNAJC2	27000	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	102957429	102957429	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:102957429C>T	ENST00000379263.3	-	13	1525	c.1275G>A	c.(1273-1275)gaG>gaA	p.E425E	PMPCB_ENST00000420236.2_Intron|DNAJC2_ENST00000249270.7_Silent_p.E372E	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	425					'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						CTTCCTCTTTCTCTTTTCTGA	0.393																																					p.E425E		.											.	DNAJC2	158	0			c.G1275A						.						127.0	117.0	120.0					7																	102957429		1860	4098	5958	SO:0001819	synonymous_variant	27000	exon13			CTCTTTCTCTTTT	X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.1275G>A	7.37:g.102957429C>T		Somatic	280.0	0.0		WXS	Illumina HiSeq	Phase_I	232.0	88.0	NM_014377	A4VCI0|Q9BVX1	Silent	SNP	ENST00000379263.3	37	CCDS43628.1																																																																																			.		0.393	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1		
DOCK9	23348	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	99515318	99515318	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:99515318C>T	ENST00000376460.1	-	32	3614	c.3534G>A	c.(3532-3534)cgG>cgA	p.R1178R	DOCK9_ENST00000448493.2_Silent_p.R1190R|DOCK9_ENST00000339416.2_Silent_p.R1179R|DOCK9_ENST00000442173.1_Silent_p.R1178R|DOCK9_ENST00000461998.1_5'UTR	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1179					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TCACATTGATCCGCTGGACGT	0.522																																					p.R1179R		.											.	DOCK9	90	0			c.G3537A						.						54.0	53.0	54.0					13																	99515318		2016	4180	6196	SO:0001819	synonymous_variant	23348	exon32			ATTGATCCGCTGG	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.3534G>A	13.37:g.99515318C>T		Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	43.0	NM_001130049	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Silent	SNP	ENST00000376460.1	37	CCDS45062.1																																																																																			.		0.522	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
EDN3	1908	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	57896179	57896179	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:57896179G>T	ENST00000337938.2	+	3	859	c.473G>T	c.(472-474)cGc>cTc	p.R158L	EDN3_ENST00000371025.3_Missense_Mutation_p.R158L|EDN3_ENST00000395654.3_Missense_Mutation_p.R158L|EDN3_ENST00000311585.7_Missense_Mutation_p.R158L|EDN3_ENST00000371028.2_Missense_Mutation_p.R158L	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	158					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					CCACACTTGCGCTGCGCTTGT	0.567																																					p.R158L		.											.	EDN3	91	0			c.G473T						.						112.0	104.0	107.0					20																	57896179		2203	4300	6503	SO:0001583	missense	1908	exon3			ACTTGCGCTGCGC	X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.473G>T	20.37:g.57896179G>T	ENSP00000337128:p.Arg158Leu	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	65.0	NM_207034	E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Missense_Mutation	SNP	ENST00000337938.2	37	CCDS13477.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.820469	0.50633	.	.	ENSG00000124205	ENST00000337938;ENST00000311585;ENST00000371028;ENST00000371025;ENST00000395654	D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1	4.87	4.87	0.63330	Endothelin-like toxin (1);	0.000000	0.85682	D	0.000000	D	0.91872	0.7427	M	0.62723	1.935	0.38627	D	0.951288	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.999	D	0.93303	0.6678	10	0.87932	D	0	-37.8245	13.8571	0.63534	0.0:0.0:1.0:0.0	.	158;158;158;158	P14138-2;Q7Z6D2;P14138;Q4FAT2	.;.;EDN3_HUMAN;.	L	158	ENSP00000337128:R158L;ENSP00000311854:R158L;ENSP00000360067:R158L;ENSP00000360064:R158L;ENSP00000379015:R158L	ENSP00000311854:R158L	R	+	2	0	EDN3	57329574	1.000000	0.71417	0.933000	0.37362	0.010000	0.07245	5.390000	0.66261	2.409000	0.81822	0.561000	0.74099	CGC	.		0.567	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079919.2	NM_000114	
EFCAB6	64800	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	43936088	43936088	+	Silent	SNP	G	G	A	rs144783076	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:43936088G>A	ENST00000262726.7	-	28	4051	c.3798C>T	c.(3796-3798)gaC>gaT	p.D1266D	EFCAB6_ENST00000396231.2_Silent_p.D1114D|EFCAB6_ENST00000461800.1_5'UTR	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	1266					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				CTTCCGAGACGTCAGGGACAC	0.607																																					p.D1266D		.											.	EFCAB6	97	0			c.C3798T						.	G	,	0,4406		0,0,2203	104.0	86.0	92.0		3798,3342	-11.0	0.0	22	dbSNP_134	92	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	EFCAB6	NM_022785.3,NM_198856.2	,	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	,	1266/1502,1114/1350	43936088	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	64800	exon28			CGAGACGTCAGGG	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.3798C>T	22.37:g.43936088G>A		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	53.0	NM_022785	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Silent	SNP	ENST00000262726.7	37	CCDS14049.1																																																																																			G|1.000;A|0.000		0.607	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
CC2D2B	387707	bcgsc.ca;mdanderson.org	37	10	97772065	97772065	+	Intron	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:97772065A>G	ENST00000344386.3	+	4	284				ENTPD1-AS1_ENST00000451364.1_RNA|CC2D2B_ENST00000371198.2_Intron|ENTPD1-AS1_ENST00000452728.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|CC2D2B_ENST00000410012.2_Intron|ENTPD1-AS1_ENST00000454638.1_RNA|RP11-690P14.4_ENST00000475252.2_Intron	NM_001001732.3	NP_001001732.2	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B											large_intestine(1)|lung(7)|ovary(1)|urinary_tract(1)	10		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		ATTCTTAAATATTTTTGCTAC	0.303																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	0	.			TTAAATATTTTTG	BC075861	CCDS41555.1, CCDS53560.1	10q23.33	2008-11-06	2007-10-19	2007-10-19	ENSG00000188649	ENSG00000188649			31666	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 130"""	C10orf130			Standard	NM_001001732		Approved	bA248J23.4	uc010qop.2	Q6DHV5	OTTHUMG00000018820	ENST00000344386.3:c.121-224A>G	10.37:g.97772065A>G		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_1	25.0	11.0	.	A2A3E9|B4DYD4|E9PCC3|Q5VUS0	RNA	SNP	ENST00000344386.3	37	CCDS41555.1	.	.	.	.	.	.	.	.	.	.	A	15.70	2.911746	0.52439	.	.	ENSG00000188649	ENST00000424464	D	0.94417	-3.42	5.17	5.17	0.71159	.	.	.	.	.	D	0.95341	0.8488	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.94659	0.7846	6	0.41790	T	0.15	.	12.8733	0.57977	1.0:0.0:0.0:0.0	.	.	.	.	V	82	ENSP00000391834:I82V	ENSP00000391834:I82V	I	+	1	0	CC2D2B	97762055	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.349000	0.44054	2.090000	0.63153	0.456000	0.33151	ATT	.		0.303	CC2D2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049573.3	NM_001001732	
EXOC4	60412	ucsc.edu;bcgsc.ca	37	7	133314861	133314861	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:133314861G>A	ENST00000253861.4	+	10	1510	c.1481G>A	c.(1480-1482)aGa>aAa	p.R494K	EXOC4_ENST00000460346.1_3'UTR|EXOC4_ENST00000539845.1_Missense_Mutation_p.R393K|EXOC4_ENST00000545148.1_Missense_Mutation_p.R104K	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	494					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				CCTGGAGCCAGAAACATTACC	0.363																																					p.R494K		.											.	EXOC4	159	0			c.G1481A						.						127.0	122.0	124.0					7																	133314861		2203	4300	6503	SO:0001583	missense	60412	exon10			GAGCCAGAAACAT	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1481G>A	7.37:g.133314861G>A	ENSP00000253861:p.Arg494Lys	Somatic	101.0	0.0		WXS	Illumina HiSeq	.	89.0	29.0	NM_021807	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511126	0.85389	.	.	ENSG00000131558	ENST00000253861;ENST00000546185;ENST00000539845;ENST00000545148	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.53706	0.1813	L	0.31065	0.9	0.80722	D	1	B;B;B	0.29432	0.244;0.104;0.073	B;B;B	0.27887	0.041;0.084;0.031	T	0.45585	-0.9251	9	0.30078	T	0.28	.	20.1519	0.98089	0.0:0.0:1.0:0.0	.	26;104;494	B7Z689;F5GZT1;Q96A65	.;.;EXOC4_HUMAN	K	494;113;393;104	.	ENSP00000253861:R494K	R	+	2	0	EXOC4	132965401	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.004000	0.93583	2.861000	0.98227	0.655000	0.94253	AGA	.		0.363	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
FAM13A	10144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	89652508	89652508	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:89652508A>C	ENST00000264344.5	-	23	3122	c.2915T>G	c.(2914-2916)tTt>tGt	p.F972C	FAM13A_ENST00000508369.1_Missense_Mutation_p.F646C|FAM13A-AS1_ENST00000511543.1_RNA|FAM13A-AS1_ENST00000500765.1_RNA|FAM13A_ENST00000511976.1_Missense_Mutation_p.F558C|FAM13A_ENST00000513837.1_Missense_Mutation_p.F618C|FAM13A_ENST00000503556.1_Missense_Mutation_p.F632C|FAM13A_ENST00000395002.2_Missense_Mutation_p.F618C	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	972					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						GTTGTCTTCAAAATCCCGAAG	0.483																																					p.F972C		.											.	FAM13A	70	0			c.T2915G						.						54.0	58.0	57.0					4																	89652508		2203	4300	6503	SO:0001583	missense	10144	exon23			TCTTCAAAATCCC	AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.2915T>G	4.37:g.89652508A>C	ENSP00000264344:p.Phe972Cys	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	8.0	NM_014883	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	ENST00000264344.5	37	CCDS34029.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.640699	0.87859	.	.	ENSG00000138640	ENST00000395002;ENST00000264344;ENST00000503556;ENST00000511976;ENST00000508369;ENST00000513837	T;T;T;T;T;T	0.63417	-0.04;0.96;0.27;0.41;0.26;0.27	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.80829	0.4698	M	0.83012	2.62	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.998;0.997;0.999;0.999;0.999	D	0.83885	0.0281	10	0.87932	D	0	.	15.7623	0.78096	1.0:0.0:0.0:0.0	.	618;558;972;618;632;646	O94988-6;E9PGM7;O94988;O94988-3;O94988-5;O94988-1	.;.;FA13A_HUMAN;.;.;.	C	618;972;632;558;646;618	ENSP00000378450:F618C;ENSP00000264344:F972C;ENSP00000427189:F632C;ENSP00000421914:F558C;ENSP00000421562:F646C;ENSP00000423252:F618C	ENSP00000264344:F972C	F	-	2	0	FAM13A	89871531	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.469000	0.73555	2.311000	0.77944	0.533000	0.62120	TTT	.		0.483	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363371.1		
FAM47C	442444	hgsc.bcm.edu;bcgsc.ca	37	X	37026590	37026590	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:37026590G>A	ENST00000358047.3	+	1	159	c.107G>A	c.(106-108)aGg>aAg	p.R36K		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	36										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CGCAAGCACAGGCGCCTGAGG	0.617																																					p.R36K		.											.	FAM47C	111	0			c.G107A						.						27.0	26.0	27.0					X																	37026590		2202	4296	6498	SO:0001583	missense	442444	exon1			AGCACAGGCGCCT	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.107G>A	X.37:g.37026590G>A	ENSP00000367913:p.Arg36Lys	Somatic	285.0	0.0		WXS	Illumina HiSeq	Phase_I	313.0	218.0	NM_001013736	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506146	0.26949	.	.	ENSG00000198173	ENST00000358047	T	0.19394	2.15	0.462	-0.569	0.11756	.	.	.	.	.	T	0.16128	0.0388	L	0.56769	1.78	0.09310	N	1	B	0.28783	0.222	B	0.27170	0.077	T	0.35895	-0.9770	8	0.15066	T	0.55	.	.	.	.	.	36	Q5HY64	FA47C_HUMAN	K	36	ENSP00000367913:R36K	ENSP00000367913:R36K	R	+	2	0	FAM47C	36936511	0.000000	0.05858	0.009000	0.14445	0.050000	0.14768	0.040000	0.13905	-0.369000	0.08028	0.287000	0.19450	AGG	.		0.617	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
FAM46D	169966	broad.mit.edu;bcgsc.ca	37	X	79699173	79699173	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:79699173C>T	ENST00000308293.5	+	3	1374	c.1135C>T	c.(1135-1137)Cca>Tca	p.P379S	FAM46D_ENST00000538312.1_Missense_Mutation_p.P379S	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	379										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						GCCATACCACCCACTGCACTT	0.408																																					p.P379S		.											.	FAM46D	130	0			c.C1135T						.						36.0	35.0	35.0					X																	79699173		2203	4298	6501	SO:0001583	missense	169966	exon5			TACCACCCACTGC	BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.1135C>T	X.37:g.79699173C>T	ENSP00000308575:p.Pro379Ser	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	5.0	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	37	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	C	2.958	-0.215187	0.06101	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.23348	1.91;1.91	5.21	2.38	0.29361	.	0.331275	0.28393	N	0.015516	T	0.20861	0.0502	L	0.48877	1.53	0.09310	N	0.999994	B	0.17038	0.02	B	0.17979	0.02	T	0.19257	-1.0311	10	0.54805	T	0.06	-0.0106	7.3091	0.26465	0.315:0.5095:0.1755:0.0	.	379	Q8NEK8	FA46D_HUMAN	S	379	ENSP00000443410:P379S;ENSP00000308575:P379S	ENSP00000308575:P379S	P	+	1	0	FAM46D	79585829	0.032000	0.19561	0.002000	0.10522	0.003000	0.03518	0.676000	0.25247	0.065000	0.16485	0.594000	0.82650	CCA	.		0.408	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
FAM8A1	51439	hgsc.bcm.edu;mdanderson.org	37	6	17601073	17601073	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:17601073C>T	ENST00000259963.3	+	1	488	c.433C>T	c.(433-435)Cag>Tag	p.Q145*		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	145						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			CTGCAGCCCCCAGCCCTCCCC	0.701																																					p.Q145X		.											.	FAM8A1	90	0			c.C433T						.						11.0	14.0	13.0					6																	17601073		2082	4090	6172	SO:0001587	stop_gained	51439	exon1			AGCCCCCAGCCCT	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.433C>T	6.37:g.17601073C>T	ENSP00000259963:p.Gln145*	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	28.0	NM_016255	B2R725	Nonsense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	C	36	5.712685	0.96830	.	.	ENSG00000137414	ENST00000259963	.	.	.	4.11	4.11	0.48088	.	0.585175	0.13297	N	0.398547	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-1.2679	14.4741	0.67535	0.0:1.0:0.0:0.0	.	.	.	.	X	145	.	ENSP00000259963:Q145X	Q	+	1	0	FAM8A1	17709052	0.003000	0.15002	0.862000	0.33874	0.716000	0.41182	1.327000	0.33746	1.986000	0.57962	0.484000	0.47621	CAG	.		0.701	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
FANCA	2175	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	89849430	89849430	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:89849430C>T	ENST00000389301.3	-	16	1581	c.1551G>A	c.(1549-1551)cgG>cgA	p.R517R	FANCA_ENST00000568369.1_Silent_p.R517R	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	517					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GGTCGGCCAGCCGTGTCTTGG	0.557			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.R517R		.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	1130	0			c.G1551A						.						183.0	133.0	150.0					16																	89849430		2198	4300	6498	SO:0001819	synonymous_variant	2175	exon16	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GGCCAGCCGTGTC	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1551G>A	16.37:g.89849430C>T		Somatic	327.0	0.0		WXS	Illumina HiSeq	Phase_I	394.0	155.0	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Silent	SNP	ENST00000389301.3	37	CCDS32515.1																																																																																			.		0.557	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
FANCF	2188	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	22646565	22646565	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:22646565A>G	ENST00000327470.3	-	1	822	c.792T>C	c.(790-792)acT>acC	p.T264T	AC103801.2_ENST00000428556.2_5'Flank	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	264					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						GGTGGCGGCTAGTCACTAAAG	0.552			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T264T		.	yes	Rec		Fanconi anaemia F	11	11p15	2188	"""Fanconi anemia, complementation group F"""		L	.	FANCF	1083	0			c.T792C						.						51.0	61.0	58.0					11																	22646565		2203	4300	6503	SO:0001819	synonymous_variant	2188	exon1	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GCGGCTAGTCACT		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.792T>C	11.37:g.22646565A>G		Somatic	67.0	0.0	757	WXS	Illumina HiSeq	Phase_I	108.0	32.0	NM_022725	Q52LM0	Silent	SNP	ENST00000327470.3	37	CCDS7857.1																																																																																			.		0.552	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387712.2	NM_022725	
FHOD3	80206	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	18	34182680	34182680	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:34182680A>G	ENST00000359247.4	+	8	762	c.762A>G	c.(760-762)aaA>aaG	p.K254K	FHOD3_ENST00000591635.1_5'UTR|FHOD3_ENST00000445677.1_Silent_p.K254K|FHOD3_ENST00000257209.4_Silent_p.K254K|FHOD3_ENST00000590592.1_Silent_p.K254K	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	254	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				TGGAGGAAAAAGATGGAGTTG	0.368																																					p.K254K		.											.	FHOD3	139	0			c.A762G						.						214.0	198.0	204.0					18																	34182680		2203	4300	6503	SO:0001819	synonymous_variant	80206	exon8			GGAAAAAGATGGA	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.762A>G	18.37:g.34182680A>G		Somatic	236.0	0.0		WXS	Illumina HiSeq	Phase_I	244.0	22.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37																																																																																				.		0.368	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
FLG	2312	hgsc.bcm.edu;bcgsc.ca	37	1	152277969	152277969	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:152277969A>C	ENST00000368799.1	-	3	9428	c.9393T>G	c.(9391-9393)gaT>gaG	p.D3131E	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3131	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCAGAGCTATCTACCGAAT	0.587									Ichthyosis																												p.D3131E		.											.	FLG	106	0			c.T9393G						.						69.0	92.0	84.0					1																	152277969		2197	4272	6469	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	AGAGCTATCTACC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9393T>G	1.37:g.152277969A>C	ENSP00000357789:p.Asp3131Glu	Somatic	344.0	0.0		WXS	Illumina HiSeq	Phase_I	448.0	112.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	A	9.659	1.143502	0.21205	.	.	ENSG00000143631	ENST00000368799	T	0.04234	3.67	2.49	0.55	0.17219	.	.	.	.	.	T	0.04227	0.0117	M	0.79475	2.455	0.09310	N	1	D	0.71674	0.998	D	0.64144	0.922	T	0.20009	-1.0288	9	0.06099	T	0.92	.	4.881	0.13679	0.3146:0.0:0.6854:0.0	.	3131	P20930	FILA_HUMAN	E	3131	ENSP00000357789:D3131E	ENSP00000357789:D3131E	D	-	3	2	FLG	150544593	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.963000	0.03837	0.138000	0.18790	-0.429000	0.05907	GAT	.		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FREM2	341640	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	13	39343836	39343836	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:39343836T>C	ENST00000280481.7	+	4	5748	c.5532T>C	c.(5530-5532)gaT>gaC	p.D1844D		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1844	Calx-beta 1.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCCTGAGTGATGGGGAGCATG	0.542																																					p.D1844D		.											.	FREM2	100	0			c.T5532C						.						142.0	115.0	124.0					13																	39343836		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon4			GAGTGATGGGGAG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5532T>C	13.37:g.39343836T>C		Somatic	259.0	0.0		WXS	Illumina HiSeq	Phase_I	303.0	114.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																			.		0.542	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FSBP	100861412	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	95449096	95449096	+	Start_Codon_SNP	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:95449096T>C	ENST00000481490.2	-	1	74	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	RAD54B_ENST00000336148.5_Intron|RAD54B_ENST00000297592.5_Intron	NM_001256141.1	NP_001243070.1	O95073	FSBP_HUMAN	fibrinogen silencer binding protein	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											TTTCCTACCATTGTTCTTTTC	0.388																																					p.M1V		.											.	.	.	0			c.A1G						.																																			SO:0001582	initiator_codon_variant	100861412	exon1			CTACCATTGTTCT		CCDS59106.1	8q22.1	2012-08-13			ENSG00000265817	ENSG00000265817			43653	protein-coding gene	gene with protein product						20531236	Standard	NM_001256141		Approved		uc003ygm.3	O95073	OTTHUMG00000178341	ENST00000481490.2:c.1A>G	8.37:g.95449096T>C	ENSP00000420405:p.Met1Val	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	50.0	NM_001256141	Q8N4S5	Missense_Mutation	SNP	ENST00000481490.2	37	CCDS59106.1	.	.	.	.	.	.	.	.	.	.	T	10.07	1.249386	0.22880	.	.	ENSG00000197275	ENST00000481490	T	0.55234	0.53	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.69133	0.3077	.	.	.	0.80722	D	1	P	0.49447	0.924	P	0.57776	0.827	T	0.73665	-0.3911	9	0.87932	D	0	-9.7135	15.5617	0.76253	0.0:0.0:0.0:1.0	.	1	O95073	FSBP_HUMAN	V	1	ENSP00000420405:M1V	ENSP00000420405:M1V	M	-	1	0	RAD54B	95518272	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.655000	0.83696	2.147000	0.66899	0.533000	0.62120	ATG	.		0.388	FSBP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000441631.1	NM_001256141	Missense_Mutation
GAB4	128954	ucsc.edu;bcgsc.ca;mdanderson.org	37	22	17489003	17489003	+	Start_Codon_SNP	SNP	A	A	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:17489003A>T	ENST00000400588.1	-	1	109	c.2T>A	c.(1-3)aTg>aAg	p.M1K	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	1										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				CGGCAGGGACATGGGGGCTGC	0.697																																					p.M1K		.											.	GAB4	91	0			c.T2A						.						10.0	12.0	11.0					22																	17489003		2145	4234	6379	SO:0001582	initiator_codon_variant	128954	exon1			AGGGACATGGGGG	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.2T>A	22.37:g.17489003A>T	ENSP00000383431:p.Met1Lys	Somatic	95.0	0.0		WXS	Illumina HiSeq	.	109.0	34.0	NM_001037814		Missense_Mutation	SNP	ENST00000400588.1	37	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	A	6.340	0.430867	0.12045	.	.	ENSG00000215568	ENST00000400588	T	0.30448	1.53	0.637	0.637	0.17735	.	.	.	.	.	T	0.23451	0.0567	.	.	.	0.80722	D	1	B	0.12630	0.006	B	0.06405	0.002	T	0.11155	-1.0599	7	0.62326	D	0.03	.	.	.	.	.	1	Q2WGN9	GAB4_HUMAN	K	1	ENSP00000383431:M1K	ENSP00000383431:M1K	M	-	2	0	GAB4	15869003	0.054000	0.20591	0.013000	0.15412	0.024000	0.10985	1.084000	0.30828	0.495000	0.27882	0.260000	0.18958	ATG	.		0.697	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882	Missense_Mutation
GAREM	64762	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	18	29867200	29867200	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:29867200C>T	ENST00000269209.6	-	4	1363	c.1360G>A	c.(1360-1362)Gaa>Aaa	p.E454K	GAREM_ENST00000578619.1_5'Flank|RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000399218.4_Missense_Mutation_p.E454K			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	454					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										CACAGCTCTTCGTAGGGAAGT	0.537																																					p.E454K		.											.	.	.	0			c.G1360A						.						97.0	99.0	98.0					18																	29867200		2203	4300	6503	SO:0001583	missense	64762	exon4			GCTCTTCGTAGGG	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1360G>A	18.37:g.29867200C>T	ENSP00000269209:p.Glu454Lys	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	12.0	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480505	0.84747	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.33438	1.41;1.41	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.44603	0.1301	L	0.43152	1.355	0.80722	D	1	D;D	0.63880	0.982;0.993	B;P	0.56823	0.383;0.807	T	0.25745	-1.0123	10	0.54805	T	0.06	-21.1773	19.0993	0.93268	0.0:1.0:0.0:0.0	.	454;454	Q9H706;Q9H706-3	FA59A_HUMAN;.	K	454	ENSP00000382165:E454K;ENSP00000269209:E454K	ENSP00000269209:E454K	E	-	1	0	FAM59A	28121198	1.000000	0.71417	0.975000	0.42487	0.741000	0.42261	7.220000	0.78008	2.821000	0.97095	0.561000	0.74099	GAA	.		0.537	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
GOLGA2	2801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	131022366	131022366	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:131022366G>A	ENST00000421699.2	-	18	1792	c.1780C>T	c.(1780-1782)Ctg>Ttg	p.L594L	AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_Silent_p.L582L	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	594					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						GTTTCCTTCAGCTCGCTCAGC	0.632																																					p.L594L		.											.	GOLGA2	91	0			c.C1780T						.						87.0	82.0	84.0					9																	131022366		2203	4300	6503	SO:0001819	synonymous_variant	2801	exon18			CCTTCAGCTCGCT	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.1780C>T	9.37:g.131022366G>A		Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	8.0	NM_004486	Q6GRM9|Q9BRB0|Q9NYF9	Silent	SNP	ENST00000421699.2	37	CCDS6896.2																																																																																			.		0.632	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486	
GPR125	166647	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	22425934	22425934	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:22425934C>T	ENST00000334304.5	-	11	1754	c.1485G>A	c.(1483-1485)ttG>ttA	p.L495L	GPR125_ENST00000508133.1_Silent_p.L269L|GPR125_ENST00000282943.5_5'UTR|GPR125_ENST00000502482.1_Silent_p.L495L	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	495					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				GTTCATCAGCCAACATGATGT	0.483																																					p.L495L		.											.	GPR125	91	0			c.G1485A						.						136.0	119.0	125.0					4																	22425934		2203	4300	6503	SO:0001819	synonymous_variant	166647	exon11			ATCAGCCAACATG	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.1485G>A	4.37:g.22425934C>T		Somatic	247.0	0.0		WXS	Illumina HiSeq	Phase_I	220.0	88.0	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	ENST00000334304.5	37	CCDS33964.1																																																																																			.		0.483	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
GPR17	2840	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128408959	128408959	+	Missense_Mutation	SNP	G	G	A	rs151092449		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:128408959G>A	ENST00000272644.3	+	3	808	c.734G>A	c.(733-735)cGc>cAc	p.R245H	LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000409455.1_Intron|GPR17_ENST00000393018.3_Missense_Mutation_p.R245H|LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000409254.1_5'Flank|GPR17_ENST00000544369.1_Missense_Mutation_p.R245H|LIMS2_ENST00000545738.2_Intron|GPR17_ENST00000486700.1_3'UTR|LIMS2_ENST00000355119.4_Intron	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	245					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		CTGATCATCCGCAGCCTGCGG	0.632													G|||	0	0.0	0.0	0.0	5008	,	,		19678	0.0		0.0	False		,,,				2504	0.0				p.R245H		.											.	GPR17	514	0			c.G734A						.	G	,,,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,	0,4406		0,0,2203	122.0	109.0	113.0		,,,734,650,650,734,	4.5	1.0	2	dbSNP_134	113	2,8598		0,2,4298	yes	intron,intron,intron,missense,missense,missense,missense,intron	GPR17,LIMS2	NM_001136037.2,NM_001161403.1,NM_001161404.1,NM_001161415.1,NM_001161416.1,NM_001161417.1,NM_005291.2,NM_017980.4	,,,29,29,29,29,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	,,,245/368,217/340,217/340,245/368,	128408959	2,13004	2203	4300	6503	SO:0001583	missense	2840	exon3			TCATCCGCAGCCT		CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.734G>A	2.37:g.128408959G>A	ENSP00000272644:p.Arg245His	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	60.0	NM_005291	A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Missense_Mutation	SNP	ENST00000272644.3	37	CCDS2148.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	.	13.89	2.370769	0.42003	0.0	2.33E-4	ENSG00000144230	ENST00000544369;ENST00000272644;ENST00000393018	T;T;T	0.39592	1.07;1.07;1.07	5.34	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.328950	0.32753	N	0.005685	T	0.35128	0.0921	L	0.60067	1.865	0.32046	N	0.597579	B	0.31227	0.314	B	0.23018	0.043	T	0.46275	-0.9203	10	0.39692	T	0.17	.	9.4684	0.38826	0.2221:0.0:0.7779:0.0	.	245	Q13304	GPR17_HUMAN	H	245	ENSP00000442982:R245H;ENSP00000272644:R245H;ENSP00000376741:R245H	ENSP00000272644:R245H	R	+	2	0	GPR17	128125429	0.998000	0.40836	1.000000	0.80357	0.982000	0.71751	3.101000	0.50283	1.255000	0.44051	0.561000	0.74099	CGC	G|1.000;A|0.000		0.632	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254390.1		
HIP1	3092	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	75174427	75174427	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:75174427G>C	ENST00000336926.6	-	26	2645	c.2619C>G	c.(2617-2619)atC>atG	p.I873M	HIP1_ENST00000434438.2_Missense_Mutation_p.I822M	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	873	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.|Important for actin binding. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGGAGGCTGAGATAAGTCCTT	0.473			T	PDGFRB	CMML																																p.I873M		.		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	HIP1	1085	0			c.C2619G						.						126.0	128.0	128.0					7																	75174427		2203	4300	6503	SO:0001583	missense	3092	exon26			GGCTGAGATAAGT	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2619C>G	7.37:g.75174427G>C	ENSP00000336747:p.Ile873Met	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	25.0	NM_005338	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	g	18.44	3.623706	0.66901	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.62788	0.0;0.0	5.6	1.69	0.24217	I/LWEQ (4);	0.000000	0.85682	D	0.000000	T	0.80742	0.4681	H	0.94771	3.58	0.43771	D	0.99629	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.77474	-0.2574	10	0.87932	D	0	-29.4678	5.955	0.19269	0.2214:0.0:0.6411:0.1375	.	822;873	E7ES17;O00291	.;HIP1_HUMAN	M	873;822	ENSP00000336747:I873M;ENSP00000410300:I822M	ENSP00000336747:I873M	I	-	3	3	HIP1	75012363	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	1.353000	0.34045	0.032000	0.15435	0.655000	0.94253	ATC	.		0.473	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
IGF1R	3480	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	99467825	99467825	+	Silent	SNP	G	G	A	rs146023463		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:99467825G>A	ENST00000268035.6	+	13	3305	c.2694G>A	c.(2692-2694)ccG>ccA	p.P898P	IGF1R_ENST00000558762.1_Silent_p.P898P	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	898	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GGCTAAACCCGGGGAACTACA	0.498																																					p.P898P		.											.	IGF1R	1490	0			c.G2694A						.	G		0,4394		0,0,2197	138.0	129.0	132.0		2694	-11.8	0.5	15	dbSNP_134	132	2,8592	2.2+/-6.3	0,2,4295	no	coding-synonymous	IGF1R	NM_000875.3		0,2,6492	AA,AG,GG		0.0233,0.0,0.0154		898/1368	99467825	2,12986	2197	4297	6494	SO:0001819	synonymous_variant	3480	exon13			AAACCCGGGGAAC	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2694G>A	15.37:g.99467825G>A		Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	72.0	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Silent	SNP	ENST00000268035.6	37	CCDS10378.1																																																																																			G|1.000;A|0.000		0.498	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
IL18	3606	hgsc.bcm.edu;ucsc.edu	37	11	112020884	112020884	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:112020884G>C	ENST00000280357.7	-	4	356	c.137C>G	c.(136-138)tCa>tGa	p.S46*	IL18_ENST00000528832.1_Nonsense_Mutation_p.S46*|IL18_ENST00000524595.1_Nonsense_Mutation_p.S42*|SDHD_ENST00000532699.1_Intron|IL18_ENST00000533858.1_5'UTR	NM_001562.3	NP_001553.1	Q14116	IL18_HUMAN	interleukin 18	46					angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|cellular response to organic cyclic compound (GO:0071407)|chemokine biosynthetic process (GO:0042033)|granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0042253)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma biosynthetic process (GO:0042095)|interleukin-13 biosynthetic process (GO:0042231)|interleukin-2 biosynthetic process (GO:0042094)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|natural killer cell activation (GO:0030101)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of tissue remodeling (GO:0034105)|regulation of cell adhesion (GO:0030155)|sleep (GO:0030431)|T-helper 1 type immune response (GO:0042088)|type 2 immune response (GO:0042092)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)						all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|Epithelial(105;8.15e-07)|all cancers(92;1.43e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.055)		TCTTATGACTGATAATTTAGA	0.299																																					p.S46X		.											.	IL18	90	0			c.C137G						.						95.0	89.0	91.0					11																	112020884		1791	4063	5854	SO:0001587	stop_gained	3606	exon4			ATGACTGATAATT	U90434	CCDS44731.1, CCDS58180.1	11q22.2-q22.3	2014-04-04	2014-04-04		ENSG00000150782	ENSG00000150782		"""Interleukins and interleukin receptors"""	5986	protein-coding gene	gene with protein product	"""interferon-gamma-inducing factor"""	600953	"""interleukin 18 (interferon-gamma-inducing factor)"""			7477296, 9693051	Standard	NM_001562		Approved	IGIF, IL1F4, IL-1g, IL-18	uc001pnb.2	Q14116	OTTHUMG00000167006	ENST00000280357.7:c.137C>G	11.37:g.112020884G>C	ENSP00000280357:p.Ser46*	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	37.0	NM_001562	O75599|Q6FGY3|Q6WWJ7	Nonsense_Mutation	SNP	ENST00000280357.7	37	CCDS44731.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263835	0.80358	.	.	ENSG00000150782	ENST00000280357;ENST00000524595;ENST00000528832	.	.	.	4.97	4.97	0.65823	.	0.642927	0.13849	N	0.358505	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	0.8517	13.9222	0.63940	0.0:0.0:1.0:0.0	.	.	.	.	X	46;42;46	.	ENSP00000280357:S46X	S	-	2	0	IL18	111526094	0.285000	0.24296	0.480000	0.27341	0.287000	0.27160	3.965000	0.56788	2.740000	0.93945	0.650000	0.86243	TCA	.		0.299	IL18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392409.1	NM_001562	
IL7R	3575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	35867499	35867499	+	Missense_Mutation	SNP	A	A	G	rs199742437		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:35867499A>G	ENST00000303115.3	+	3	442	c.313A>G	c.(313-315)Agc>Ggc	p.S105G	IL7R_ENST00000506850.1_Missense_Mutation_p.S105G|IL7R_ENST00000511982.1_Missense_Mutation_p.S105G|IL7R_ENST00000511031.1_3'UTR|IL7R_ENST00000343305.4_Missense_Mutation_p.S105G	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	105					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			GATTGGAAAGAGCAATATATG	0.373			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																														p.S105G		.		Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	.	IL7R	157	0			c.A313G						.						94.0	96.0	95.0					5																	35867499		2203	4300	6503	SO:0001583	missense	3575	exon3			GGAAAGAGCAATA	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.313A>G	5.37:g.35867499A>G	ENSP00000306157:p.Ser105Gly	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	25.0	NM_002185	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	A	9.228	1.035063	0.19590	.	.	ENSG00000168685	ENST00000303115;ENST00000343305;ENST00000506850;ENST00000511982	T;T;T;T	0.76709	-1.04;-1.04;-1.04;1.39	5.7	3.18	0.36537	.	0.418548	0.28192	N	0.016249	T	0.73916	0.3648	M	0.62723	1.935	0.09310	N	1	B;D	0.71674	0.135;0.998	B;P	0.50162	0.027;0.633	T	0.62718	-0.6795	10	0.23302	T	0.38	-4.551	3.9495	0.09363	0.6719:0.0:0.1001:0.228	.	105;105	D6RGV2;P16871	.;IL7RA_HUMAN	G	105	ENSP00000306157:S105G;ENSP00000345819:S105G;ENSP00000421207:S105G;ENSP00000425309:S105G	ENSP00000306157:S105G	S	+	1	0	IL7R	35903256	0.306000	0.24490	0.073000	0.20177	0.009000	0.06853	1.654000	0.37334	0.983000	0.38602	0.528000	0.53228	AGC	.		0.373	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2		
INADL	10207	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	62321778	62321778	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:62321778G>T	ENST00000371158.2	+	18	2303	c.2189G>T	c.(2188-2190)gGa>gTa	p.G730V	INADL_ENST00000316485.6_Missense_Mutation_p.G730V	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	730	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AGAAGTGGGGGACTATTACCT	0.488																																					p.G730V		.											.	INADL	94	0			c.G2189T						.						142.0	132.0	135.0					1																	62321778		2203	4300	6503	SO:0001583	missense	10207	exon18			GTGGGGGACTATT	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.2189G>T	1.37:g.62321778G>T	ENSP00000360200:p.Gly730Val	Somatic	226.0	1.0		WXS	Illumina HiSeq	.	341.0	66.0	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	G	7.647	0.682009	0.14907	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.16196	2.36;2.36	5.44	-3.1	0.05315	PDZ/DHR/GLGF (4);	0.329412	0.28072	N	0.016716	T	0.10723	0.0262	L	0.39467	1.215	0.09310	N	0.999999	B;B;B	0.32753	0.383;0.042;0.216	B;B;B	0.29785	0.107;0.061;0.073	T	0.10543	-1.0625	10	0.62326	D	0.03	.	7.4627	0.27304	0.636:0.2056:0.1584:0.0	.	730;730;730	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	V	730	ENSP00000360200:G730V;ENSP00000326199:G730V	ENSP00000255202:G730V	G	+	2	0	INADL	62094366	0.792000	0.28813	0.006000	0.13384	0.163000	0.22366	1.621000	0.36986	-0.771000	0.04608	-0.986000	0.02555	GGA	.		0.488	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
ITGA10	8515	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	145534216	145534216	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:145534216A>G	ENST00000369304.3	+	14	1896	c.1721A>G	c.(1720-1722)gAa>gGa	p.E574G	ITGA10_ENST00000538811.1_Missense_Mutation_p.E443G|ITGA10_ENST00000539363.1_Missense_Mutation_p.E431G	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	574					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCGCCTCTGGAAGATGGGCAC	0.587																																					p.E574G		.											.	ITGA10	231	0			c.A1721G						.						109.0	114.0	113.0					1																	145534216		2203	4300	6503	SO:0001583	missense	8515	exon14			CTCTGGAAGATGG	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1721A>G	1.37:g.145534216A>G	ENSP00000358310:p.Glu574Gly	Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	50.0	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.175848	0.78564	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.60797	0.16;0.16;0.16	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000001	T	0.67961	0.2949	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.85130	0.997;0.997;0.995;0.994	T	0.73398	-0.3995	10	0.87932	D	0	.	12.9882	0.58604	1.0:0.0:0.0:0.0	.	540;443;431;574	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	G	574;540;431;443	ENSP00000358310:E574G;ENSP00000439894:E431G;ENSP00000440011:E443G	ENSP00000358310:E574G	E	+	2	0	ITGA10	144245573	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	8.959000	0.93110	2.014000	0.59158	0.533000	0.62120	GAA	.		0.587	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
IQGAP3	128239	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	156496391	156496391	+	Splice_Site	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:156496391C>A	ENST00000361170.2	-	38	4793	c.4783G>T	c.(4783-4785)Gat>Tat	p.D1595Y	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1595					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGCAGGAGATCCTAGGAGGGA	0.498																																					p.D1595Y		.											.	IQGAP3	96	0			c.G4783T						.						71.0	64.0	66.0					1																	156496391		2203	4300	6503	SO:0001630	splice_region_variant	128239	exon38			GGAGATCCTAGGA	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4783-1G>T	1.37:g.156496391C>A		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	20.0	NM_178229	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	37	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572555	0.86542	.	.	ENSG00000183856	ENST00000361170	T	0.06849	3.25	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.30262	0.0759	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.34229	-0.9837	10	0.87932	D	0	-29.8599	16.507	0.84274	0.0:1.0:0.0:0.0	.	1595	Q86VI3	IQGA3_HUMAN	Y	1595	ENSP00000354451:D1595Y	ENSP00000354451:D1595Y	D	-	1	0	IQGAP3	154763015	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.584000	0.82572	2.475000	0.83589	0.561000	0.74099	GAT	.		0.498	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	Missense_Mutation
KANK1	23189	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	713074	713074	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:713074T>C	ENST00000382303.1	+	7	2960	c.2308T>C	c.(2308-2310)Tat>Cat	p.Y770H	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Missense_Mutation_p.Y770H|KANK1_ENST00000382293.3_Missense_Mutation_p.Y612H	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	770					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TAACGACAACTATCTGGTTGG	0.522																																					p.Y770H		.											.	KANK1	517	0			c.T2308C						.						90.0	92.0	91.0					9																	713074		2203	4300	6503	SO:0001583	missense	23189	exon7			GACAACTATCTGG	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2308T>C	9.37:g.713074T>C	ENSP00000371740:p.Tyr770His	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	40.0	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	37	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.642458	0.87859	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.18016	2.24;2.24;2.24	5.97	5.97	0.96955	.	0.000000	0.51477	D	0.000094	T	0.41488	0.1161	M	0.67953	2.075	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.71184	0.972;0.909	T	0.23833	-1.0177	10	0.87932	D	0	-12.1515	16.4608	0.84044	0.0:0.0:0.0:1.0	.	770;770	Q5W0W1;Q14678	.;KANK1_HUMAN	H	770;770;770;612	ENSP00000371740:Y770H;ENSP00000371734:Y770H;ENSP00000371730:Y612H	ENSP00000346479:Y770H	Y	+	1	0	KANK1	703074	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.950000	0.87804	2.288000	0.76882	0.533000	0.62120	TAT	.		0.522	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
KCNA3	3738	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	111216834	111216834	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:111216834delC	ENST00000369769.2	-	1	821	c.598delG	c.(598-600)gacfs	p.D200fs		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	200					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	AAGCCCTCGTCCTCGCGGAAC	0.692																																					p.D200fs		.											.	KCNA3	95	0			c.598delG						.						43.0	49.0	47.0					1																	111216834		2203	4300	6503	SO:0001589	frameshift_variant	3738	exon1			CCTCGTCCTCGCG	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.598delG	1.37:g.111216834delC	ENSP00000358784:p.Asp200fs	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	55.0	NM_002232	Q5VWN2	Frame_Shift_Del	DEL	ENST00000369769.2	37	CCDS828.2																																																																																			.		0.692	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232	
KIAA0100	9703	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26961916	26961916	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:26961916T>C	ENST00000528896.2	-	16	2763	c.2689A>G	c.(2689-2691)Atg>Gtg	p.M897V	KIAA0100_ENST00000544884.1_Missense_Mutation_p.M754V|RP11-192H23.7_ENST00000577814.1_RNA|RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.M754V	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	897						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TCATCCTTCATCAGCTCGTAG	0.478																																					p.M897V		.											.	KIAA0100	93	0			c.A2689G						.						219.0	239.0	232.0					17																	26961916		2203	4300	6503	SO:0001583	missense	9703	exon16			CCTTCATCAGCTC	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2689A>G	17.37:g.26961916T>C	ENSP00000436773:p.Met897Val	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	34.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	T	17.86	3.493281	0.64186	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.24350	1.86;1.86	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.45856	0.1363	M	0.61703	1.905	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.18178	-1.0345	10	0.30854	T	0.27	.	16.2996	0.82804	0.0:0.0:0.0:1.0	.	897	Q14667	K0100_HUMAN	V	897;867;897;754	ENSP00000436773:M897V;ENSP00000446443:M754V	ENSP00000005905:M897V	M	-	1	0	KIAA0100	23986043	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.828000	0.69307	2.252000	0.74401	0.455000	0.32223	ATG	.		0.478	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
KRTAP26-1	388818	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	21	31691918	31691918	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr21:31691918G>T	ENST00000360542.3	-	1	689	c.436C>A	c.(436-438)Caa>Aaa	p.Q146K		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	146						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						AAGCAGAATTGGGGGCGATAG	0.547																																					p.Q146K		.											.	KRTAP26-1	69	0			c.C436A						.						188.0	186.0	187.0					21																	31691918		2203	4300	6503	SO:0001583	missense	388818	exon1			AGAATTGGGGGCG	AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.436C>A	21.37:g.31691918G>T	ENSP00000353742:p.Gln146Lys	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	71.0	NM_203405	B0RZD3	Missense_Mutation	SNP	ENST00000360542.3	37	CCDS13588.1	.	.	.	.	.	.	.	.	.	.	G	9.470	1.095348	0.20471	.	.	ENSG00000197683	ENST00000360542	T	0.03181	4.02	3.77	-4.27	0.03744	.	1.243450	0.06023	U	0.651676	T	0.02342	0.0072	L	0.32530	0.975	0.09310	N	1	P	0.35307	0.494	B	0.33799	0.17	T	0.42766	-0.9432	10	0.06099	T	0.92	-0.0422	4.7346	0.12982	0.4564:0.31:0.2336:0.0	.	146	Q6PEX3	KR261_HUMAN	K	146	ENSP00000353742:Q146K	ENSP00000353742:Q146K	Q	-	1	0	KRTAP26-1	30613789	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.947000	0.03901	-0.679000	0.05217	-0.140000	0.14226	CAA	.		0.547	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128218.1	NM_203405	
LAMC1	3915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	183095398	183095398	+	Splice_Site	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:183095398G>T	ENST00000258341.4	+	16	3201		c.e16+1		LAMC1_ENST00000466964.1_Splice_Site	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GGCTGCAAACGTAAGGGGTGT	0.532																																					.		.											.	LAMC1	252	0			c.2944+1G>T						.						86.0	77.0	80.0					1																	183095398		2203	4300	6503	SO:0001630	splice_region_variant	3915	exon16			GCAAACGTAAGGG	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2944+1G>T	1.37:g.183095398G>T		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	284.0	131.0	NM_002293	Q5VYE7	Splice_Site	SNP	ENST00000258341.4	37	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.814480	0.90790	.	.	ENSG00000135862	ENST00000258341	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6934	0.96010	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LAMC1	181362021	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.135000	0.94478	2.651000	0.90000	0.655000	0.94253	.	.		0.532	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	Intron
LARP1B	55132	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	129028308	129028308	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:129028308C>A	ENST00000326639.6	+	9	1039	c.828C>A	c.(826-828)agC>agA	p.S276R	LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000264584.5_Missense_Mutation_p.S229R|LARP1B_ENST00000432347.2_Missense_Mutation_p.S276R|LARP1B_ENST00000512292.1_Missense_Mutation_p.S276R|LARP1B_ENST00000427266.1_Missense_Mutation_p.S276R|LARP1B_ENST00000441387.1_Missense_Mutation_p.S276R|LARP1B_ENST00000394288.3_Missense_Mutation_p.S276R	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	276	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						TGAAGGATAGCACAGAAGTAG	0.383																																					p.S276R		.											.	LARP1B	68	0			c.C828A						.						58.0	62.0	60.0					4																	129028308		2203	4300	6503	SO:0001583	missense	55132	exon9			GGATAGCACAGAA		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.828C>A	4.37:g.129028308C>A	ENSP00000321997:p.Ser276Arg	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	46.0	NM_032239	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	37	CCDS3738.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.10|16.10	3.027507|3.027507	0.54683|0.54683	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000507377|ENST00000326639;ENST00000512292;ENST00000508819;ENST00000394288;ENST00000432347;ENST00000264584;ENST00000441387;ENST00000427266	.|T;T;T;T;T;T;T;T	.|0.58358	.|0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.38|5.38	3.51|3.51	0.40186|0.40186	.|Winged helix-turn-helix transcription repressor DNA-binding (1);RNA-binding protein Lupus La (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80177|0.80177	0.4575|0.4575	H|H	0.99117|0.99117	4.435|4.435	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.999;0.998;0.998	T|T	0.80665|0.80665	-0.1281|-0.1281	5|10	.|0.87932	.|D	.|0	.|.	4.4731|4.4731	0.11722|0.11722	0.0:0.6006:0.0:0.3994|0.0:0.6006:0.0:0.3994	.|.	.|276;276;276;276	.|Q659C4;G3XAJ5;Q659C4-3;G3V0E9	.|LAR1B_HUMAN;.;.;.	N|R	245|276;276;229;276;276;229;276;276	.|ENSP00000321997:S276R;ENSP00000422850:S276R;ENSP00000427281:S229R;ENSP00000377829:S276R;ENSP00000390395:S276R;ENSP00000264584:S229R;ENSP00000396521:S276R;ENSP00000403586:S276R	.|ENSP00000264584:S229R	H|S	+|+	1|3	0|2	LARP1B|LARP1B	129247758|129247758	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	0.813000|0.813000	0.27225|0.27225	1.500000|1.500000	0.48636|0.48636	0.655000|0.655000	0.94253|0.94253	CAC|AGC	.		0.383	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
LRP12	29967	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	105503084	105503084	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:105503084G>A	ENST00000276654.5	-	7	2505	c.2397C>T	c.(2395-2397)gcC>gcT	p.A799A	LRP12_ENST00000518375.1_5'UTR|LRP12_ENST00000424843.2_Silent_p.A780A	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	799					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTGATCTGAGGCAAGATCAA	0.438																																					p.A799A		.											.	LRP12	90	0			c.C2397T						.						161.0	132.0	142.0					8																	105503084		2203	4300	6503	SO:0001819	synonymous_variant	29967	exon7			ATCTGAGGCAAGA	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.2397C>T	8.37:g.105503084G>A		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	37.0	NM_013437	A8K137|B4DRQ2	Silent	SNP	ENST00000276654.5	37	CCDS6303.1																																																																																			.		0.438	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
LRP8	7804	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	53716471	53716471	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:53716471G>T	ENST00000306052.6	-	17	2668	c.2567C>A	c.(2566-2568)aCc>aAc	p.T856N	LRP8_ENST00000465675.1_Missense_Mutation_p.T409N|LRP8_ENST00000354412.3_Missense_Mutation_p.T652N|LRP8_ENST00000371454.2_Missense_Mutation_p.T856N|LRP8_ENST00000347547.2_Missense_Mutation_p.T686N	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	856					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						CATGCTTTTGGTGTTCTTCCG	0.493																																					p.T856N		.											.	LRP8	90	0			c.C2567A						.						302.0	255.0	271.0					1																	53716471		2203	4300	6503	SO:0001583	missense	7804	exon17			CTTTTGGTGTTCT	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2567C>A	1.37:g.53716471G>T	ENSP00000303634:p.Thr856Asn	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	111.0	NM_004631	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	.	.	.	.	.	.	.	.	.	.	G	33	5.285224	0.95517	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	5.42	5.42	0.78866	.	.	.	.	.	T	0.53238	0.1784	M	0.72353	2.195	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.996;0.998;0.999	D;D;D;D;D;D	0.91635	0.979;0.999;0.996;0.99;0.954;0.979	T	0.54873	-0.8228	9	0.66056	D	0.02	.	19.2098	0.93749	0.0:0.0:1.0:0.0	.	409;652;686;856;856;409	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	N	856;856;409;652;686	ENSP00000303634:T856N;ENSP00000360509:T856N;ENSP00000437009:T409N;ENSP00000346391:T652N;ENSP00000334522:T686N	ENSP00000303634:T856N	T	-	2	0	LRP8	53489059	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.855000	0.99526	2.528000	0.85240	0.563000	0.77884	ACC	.		0.493	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
MCAT	27349	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	43538972	43538972	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:43538972G>A	ENST00000290429.6	-	1	428	c.383C>T	c.(382-384)tCg>tTg	p.S128L	MCAT_ENST00000327555.5_Missense_Mutation_p.S128L|MCAT_ENST00000464244.1_5'UTR	NM_173467.4	NP_775738.3	Q8IVS2	FABD_HUMAN	malonyl CoA:ACP acyltransferase (mitochondrial)	128					fatty acid biosynthetic process (GO:0006633)|metabolic process (GO:0008152)	mitochondrion (GO:0005739)	[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)	p.S128L(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	11		Ovarian(80;0.0694)				AGCGGCCAGCGATGCCACGAA	0.682																																					p.S128L		.											.	MCAT	91	1	Substitution - Missense(1)	urinary_tract(1)	c.C383T						.						18.0	16.0	17.0					22																	43538972		2200	4299	6499	SO:0001583	missense	27349	exon1			GCCAGCGATGCCA	AL359401	CCDS14045.1, CCDS33660.1	22q13.2	2010-04-27			ENSG00000100294	ENSG00000100294	2.3.1.39		29622	protein-coding gene	gene with protein product		614479				12882974	Standard	NM_173467		Approved	MT, MCT, fabD, FASN2C, NET62	uc003bdl.1	Q8IVS2	OTTHUMG00000150704	ENST00000290429.6:c.383C>T	22.37:g.43538972G>A	ENSP00000290429:p.Ser128Leu	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	70.0	NM_014507	B0QY72|O95510|O95511	Missense_Mutation	SNP	ENST00000290429.6	37	CCDS33660.1	.	.	.	.	.	.	.	.	.	.	G	32	5.190008	0.94923	.	.	ENSG00000100294	ENST00000327555;ENST00000290429	T;T	0.42513	0.97;0.97	4.6	4.6	0.57074	Acyl transferase/acyl hydrolase/lysophospholipase (1);Acyl transferase (1);Acyl transferase domain (1);	0.000000	0.85682	D	0.000000	T	0.76772	0.4034	H	0.96970	3.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.85868	0.1414	10	0.87932	D	0	-35.372	17.6259	0.88093	0.0:0.0:1.0:0.0	.	128;128	B0QY72;Q8IVS2	.;FABD_HUMAN	L	128	ENSP00000331306:S128L;ENSP00000290429:S128L	ENSP00000290429:S128L	S	-	2	0	MCAT	41868916	1.000000	0.71417	0.977000	0.42913	0.603000	0.37013	7.895000	0.87343	2.394000	0.81467	0.467000	0.42956	TCG	.		0.682	MCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319677.2	NM_173467	
MED10	84246	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	6374436	6374436	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:6374436C>T	ENST00000255764.3	-	3	420		c.e3+1			NM_032286.2	NP_115662.2	Q9BTT4	MED10_HUMAN	mediator complex subunit 10						gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)			kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|urinary_tract(1)	5						TAGAGTCTTACCTTCATGGTG	0.418																																					.		.											.	MED10	91	0			c.309+1G>A						.						170.0	164.0	166.0					5																	6374436		2203	4300	6503	SO:0001630	splice_region_variant	84246	exon4			GTCTTACCTTCAT		CCDS34134.1	5p15.31	2008-02-05	2007-07-30		ENSG00000133398	ENSG00000133398			28760	protein-coding gene	gene with protein product	"""NUT2 homolog (S. cerevisiae)"""	612382	"""mediator of RNA polymerase II transcription, subunit 10 homolog (NUT2, S. cerevisiae)"""			15657623, 15175163	Standard	NM_032286		Approved	TRG20, L6, MGC5309, NUT2	uc003jdo.3	Q9BTT4	OTTHUMG00000161682	ENST00000255764.3:c.309+1G>A	5.37:g.6374436C>T		Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	266.0	59.0	NM_032286	C6G491	Splice_Site	SNP	ENST00000255764.3	37	CCDS34134.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358031	0.82243	.	.	ENSG00000133398	ENST00000255764	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7542	0.91826	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MED10	6427436	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	7.149000	0.77396	2.735000	0.93741	0.655000	0.94253	.	.		0.418	MED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365714.1	NM_032286	Intron
MRPS16	51021	ucsc.edu;bcgsc.ca	37	10	75010617	75010617	+	Missense_Mutation	SNP	T	T	C	rs146290698		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:75010617T>C	ENST00000372945.3	-	3	617	c.407A>G	c.(406-408)gAa>gGa	p.E136G	RP11-152N13.5_ENST00000457758.1_RNA|DNAJC9-AS1_ENST00000440197.2_RNA|DNAJC9-AS1_ENST00000513954.1_RNA|RP11-152N13.5_ENST00000457147.1_RNA|RP11-152N13.5_ENST00000394864.2_RNA|MRPS16_ENST00000416782.2_Intron|MRPS16_ENST00000479005.1_5'UTR|TTC18_ENST00000493787.1_5'Flank|MRPS16_ENST00000372940.3_Intron|DNAJC9_ENST00000372950.4_5'Flank	NM_016065.3	NP_057149.1	Q9Y3D3	RT16_HUMAN	mitochondrial ribosomal protein S16	136					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(2)	4	Prostate(51;0.0119)					CATTTATGTTTCTGTAGCCTC	0.428																																					p.E136G		.											.	MRPS16	90	0			c.A407G						.	T	GLY/GLU	0,4406		0,0,2203	203.0	186.0	191.0		407	4.6	0.8	10	dbSNP_134	191	1,8599	1.2+/-3.3	0,1,4299	no	missense	MRPS16	NM_016065.3	98	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	136/138	75010617	1,13005	2203	4300	6503	SO:0001583	missense	51021	exon3			TATGTTTCTGTAG	AB051351	CCDS7323.1	10q22.1	2012-09-13			ENSG00000182180	ENSG00000182180		"""Mitochondrial ribosomal proteins / small subunits"""	14048	protein-coding gene	gene with protein product		609204				10810093	Standard	NM_016065		Approved	CGI-132	uc001jts.1	Q9Y3D3	OTTHUMG00000018454	ENST00000372945.3:c.407A>G	10.37:g.75010617T>C	ENSP00000362036:p.Glu136Gly	Somatic	137.0	2.0		WXS	Illumina HiSeq	.	148.0	54.0	NM_016065	B4E032|Q96Q60	Missense_Mutation	SNP	ENST00000372945.3	37	CCDS7323.1	.	.	.	.	.	.	.	.	.	.	T	17.41	3.382834	0.61845	0.0	1.16E-4	ENSG00000182180	ENST00000372945	T	0.46451	0.87	4.58	4.58	0.56647	.	0.477308	0.16139	U	0.227829	T	0.30448	0.0765	N	0.22421	0.69	0.80722	D	1	B	0.17268	0.021	B	0.18871	0.023	T	0.12502	-1.0545	10	0.62326	D	0.03	0.0111	10.8979	0.47034	0.0:0.0:0.0:1.0	.	136	Q9Y3D3	RT16_HUMAN	G	136	ENSP00000362036:E136G	ENSP00000362036:E136G	E	-	2	0	MRPS16	74680623	0.178000	0.23122	0.842000	0.33263	0.314000	0.28054	0.743000	0.26231	2.003000	0.58678	0.260000	0.18958	GAA	T|1.000;C|0.000		0.428	MRPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048616.1		
MTF1	4520	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	38281195	38281195	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:38281195G>A	ENST00000373036.4	-	11	2015	c.1875C>T	c.(1873-1875)atC>atT	p.I625I		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	625					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTTGTTTGATGATGATCACAG	0.577																																					p.I625I		.											.	MTF1	92	0			c.C1875T						.						62.0	61.0	61.0					1																	38281195		2203	4300	6503	SO:0001819	synonymous_variant	4520	exon11			TTTGATGATGATC	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.1875C>T	1.37:g.38281195G>A		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	239.0	110.0	NM_005955	B2RAK6|Q96CB1	Silent	SNP	ENST00000373036.4	37	CCDS30676.1																																																																																			.		0.577	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	
MUC5B	727897	bcgsc.ca;mdanderson.org	37	11	1276338	1276338	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:1276338G>A	ENST00000529681.1	+	36	15790	c.15732G>A	c.(15730-15732)aaG>aaA	p.K5244K	MUC5B_ENST00000447027.1_Silent_p.K5247K	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5244	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCAGTTGCAAGGACATGGCCA	0.677																																					p.K5244K		.											.	.	.	0			c.G15732A						.						20.0	28.0	25.0					11																	1276338		2096	4189	6285	SO:0001819	synonymous_variant	727897	exon36			TTGCAAGGACATG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.15732G>A	11.37:g.1276338G>A		Somatic	153.0	1.0		WXS	Illumina HiSeq	Phase_1	197.0	61.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.		0.677	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MYPOP	339344	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	46393962	46393962	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:46393962G>A	ENST00000322217.5	-	3	1205	c.1119C>T	c.(1117-1119)ctC>ctT	p.L373L		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	373	Pro-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			large_intestine(2)|lung(1)|skin(1)	4						CGTGCGGAGGGAGCGGGGCTG	0.642																																					p.L373L		.											.	MYPOP	90	0			c.C1119T						.						9.0	11.0	10.0					19																	46393962		2117	4202	6319	SO:0001819	synonymous_variant	339344	exon3			CGGAGGGAGCGGG	BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.1119C>T	19.37:g.46393962G>A		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	25.0	NM_001012643		Silent	SNP	ENST00000322217.5	37	CCDS33055.1																																																																																			.		0.642	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461684.1	NM_001012643	
NCOA7	135112	broad.mit.edu;bcgsc.ca	37	6	126203615	126203615	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:126203615T>C	ENST00000368357.3	+	8	969	c.617T>C	c.(616-618)gTc>gCc	p.V206A	NCOA7_ENST00000229634.9_Missense_Mutation_p.V102A|NCOA7_ENST00000392477.2_Missense_Mutation_p.V206A	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	206					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		ATTGAAAGAGTCTTATCGTCT	0.338																																					p.V206A		.											.	NCOA7	227	0			c.T617C						.						57.0	55.0	55.0					6																	126203615		2203	4300	6503	SO:0001583	missense	135112	exon8			AAAGAGTCTTATC	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.617T>C	6.37:g.126203615T>C	ENSP00000357341:p.Val206Ala	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	4.0	NM_001199619	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	ENST00000368357.3	37	CCDS5132.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.480371	0.84747	.	.	ENSG00000111912	ENST00000368357;ENST00000392477;ENST00000229634;ENST00000413085	T;T;T;T	0.37752	2.42;2.42;2.42;1.18	5.63	5.63	0.86233	.	0.280930	0.34628	N	0.003811	T	0.49762	0.1576	M	0.61703	1.905	0.51482	D	0.999924	D;D;D;D	0.89917	1.0;0.998;0.993;0.995	D;D;P;D	0.87578	0.998;0.913;0.826;0.914	T	0.49790	-0.8902	10	0.49607	T	0.09	-0.3706	16.1251	0.81386	0.0:0.0:0.0:1.0	.	206;206;206;206	B3KXK4;Q8NI08-2;Q8NI08-4;Q8NI08	.;.;.;NCOA7_HUMAN	A	206;206;102;15	ENSP00000357341:V206A;ENSP00000376269:V206A;ENSP00000229634:V102A;ENSP00000389186:V15A	ENSP00000229634:V102A	V	+	2	0	NCOA7	126245308	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.999000	0.57031	2.261000	0.74972	0.528000	0.53228	GTC	.		0.338	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748	
NDST4	64579	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	115858629	115858629	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:115858629C>A	ENST00000264363.2	-	5	1930	c.1252G>T	c.(1252-1254)Gct>Tct	p.A418S		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	418	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GGGGCCACAGCATAGCCCATG	0.453																																					p.A418S		.											.	NDST4	94	0			c.G1252T						.						121.0	104.0	110.0					4																	115858629		2203	4300	6503	SO:0001583	missense	64579	exon5			CCACAGCATAGCC	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1252G>T	4.37:g.115858629C>A	ENSP00000264363:p.Ala418Ser	Somatic	255.0	0.0		WXS	Illumina HiSeq	Phase_I	270.0	97.0	NM_022569	Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766399	0.69878	.	.	ENSG00000138653	ENST00000264363	T	0.42513	0.97	5.47	5.47	0.80525	.	0.094770	0.64402	D	0.000001	T	0.50446	0.1616	M	0.63208	1.945	0.80722	D	1	P	0.42556	0.783	P	0.46585	0.521	T	0.34925	-0.9809	10	0.20519	T	0.43	.	19.6922	0.96007	0.0:1.0:0.0:0.0	.	418	Q9H3R1	NDST4_HUMAN	S	418	ENSP00000264363:A418S	ENSP00000264363:A418S	A	-	1	0	NDST4	116078078	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	7.740000	0.84986	2.704000	0.92352	0.655000	0.94253	GCT	.		0.453	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
NEGR1	257194	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	72400944	72400944	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:72400944C>T	ENST00000357731.5	-	2	466	c.227G>A	c.(226-228)aGt>aAt	p.S76N	NEGR1_ENST00000306821.3_5'UTR|NEGR1_ENST00000434200.1_Missense_Mutation_p.S74N|NEGR1_ENST00000467479.1_5'UTR	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	76	Ig-like C2-type 1.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		AAAAATAATACTTGACCGGTT	0.383																																					p.S76N		.											.	NEGR1	92	0			c.G227A						.						96.0	94.0	95.0					1																	72400944		2203	4300	6503	SO:0001583	missense	257194	exon2			ATAATACTTGACC	AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.227G>A	1.37:g.72400944C>T	ENSP00000350364:p.Ser76Asn	Somatic	72.0	0.0		WXS	Illumina HiSeq	.	103.0	25.0	NM_173808	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	37	CCDS661.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.146642	0.37923	.	.	ENSG00000172260	ENST00000357731;ENST00000434200	T;T	0.69435	-0.4;-0.4	5.71	5.71	0.89125	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.038224	0.85682	D	0.000000	T	0.48390	0.1497	L	0.28556	0.865	0.58432	D	0.999998	B;B	0.23806	0.091;0.03	B;B	0.31101	0.124;0.124	T	0.43458	-0.9390	10	0.31617	T	0.26	-13.4697	19.8408	0.96685	0.0:1.0:0.0:0.0	.	74;76	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	N	76;74	ENSP00000350364:S76N;ENSP00000413294:S74N	ENSP00000350364:S76N	S	-	2	0	NEGR1	72173532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.898000	0.63238	2.699000	0.92147	0.655000	0.94253	AGT	.		0.383	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808	
OR2M5	127059	ucsc.edu;bcgsc.ca	37	1	248308863	248308863	+	Silent	SNP	C	C	A	rs558517060	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:248308863C>A	ENST00000366476.1	+	1	414	c.414C>A	c.(412-414)ccC>ccA	p.P138P		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			TCATGAGACCCAAAATTTGTG	0.458																																					p.P138P		.											.	OR2M5	71	0			c.C414A						.						263.0	264.0	264.0					1																	248308863		2203	4298	6501	SO:0001819	synonymous_variant	127059	exon1			GAGACCCAAAATT		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.414C>A	1.37:g.248308863C>A		Somatic	393.0	2.0		WXS	Illumina HiSeq	.	512.0	237.0	NM_001004690		Silent	SNP	ENST00000366476.1	37	CCDS31105.1																																																																																			.		0.458	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690	
OR5F1	338674	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55761365	55761365	+	Missense_Mutation	SNP	G	G	A	rs377087548		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:55761365G>A	ENST00000278409.1	-	1	736	c.737C>T	c.(736-738)aCa>aTa	p.T246I		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	246					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					AATTATGGCTGTCAGGTGAGA	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		18311	0.0		0.0	False		,,,				2504	0.001				p.T246I		.											.	OR5F1	70	0			c.C737T						.						86.0	82.0	84.0					11																	55761365		2201	4296	6497	SO:0001583	missense	338674	exon1			ATGGCTGTCAGGT	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.737C>T	11.37:g.55761365G>A	ENSP00000278409:p.Thr246Ile	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	34.0	NM_003697	Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	G	3.668	-0.068137	0.07228	.	.	ENSG00000149133	ENST00000278409	T	0.36157	1.27	2.99	-1.74	0.08056	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.33760	0.0874	L	0.52266	1.64	0.09310	N	1	P	0.39601	0.68	B	0.43155	0.41	T	0.30504	-0.9976	9	0.51188	T	0.08	.	8.5481	0.33435	0.5023:0.0:0.4977:0.0	.	246	O95221	OR5F1_HUMAN	I	246	ENSP00000278409:T246I	ENSP00000278409:T246I	T	-	2	0	OR5F1	55517941	0.000000	0.05858	0.028000	0.17463	0.115000	0.19883	-0.029000	0.12329	-0.336000	0.08438	-0.738000	0.03535	ACA	.		0.493	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
OR5T2	219464	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56000212	56000212	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:56000212T>A	ENST00000313264.4	-	1	525	c.450A>T	c.(448-450)gaA>gaT	p.E150D		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					AGAGAAAGCATTCTGTGGTTC	0.423																																					p.E150D		.											.	OR5T2	70	0			c.A450T						.						178.0	153.0	161.0					11																	56000212		2201	4296	6497	SO:0001583	missense	219464	exon1			AAAGCATTCTGTG	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.450A>T	11.37:g.56000212T>A	ENSP00000323688:p.Glu150Asp	Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	77.0	NM_001004746	B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	T	18.28	3.588863	0.66105	.	.	ENSG00000181718	ENST00000313264	T	0.00354	7.92	5.07	-1.8	0.07907	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	U	0.000668	T	0.00271	0.0008	L	0.55481	1.735	0.09310	N	0.999995	P	0.44690	0.841	B	0.41412	0.356	T	0.50533	-0.8817	10	0.62326	D	0.03	.	11.3966	0.49845	0.0:0.5914:0.0:0.4086	.	150	Q8NGG2	OR5T2_HUMAN	D	150	ENSP00000323688:E150D	ENSP00000323688:E150D	E	-	3	2	OR5T2	55756788	0.000000	0.05858	0.938000	0.37757	0.731000	0.41821	-1.558000	0.02164	-0.164000	0.10927	0.386000	0.25728	GAA	.		0.423	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
PACSIN2	11252	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	43284655	43284655	+	Silent	SNP	A	A	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:43284655A>C	ENST00000263246.3	-	5	804	c.603T>G	c.(601-603)gtT>gtG	p.V201V	PACSIN2_ENST00000402229.1_Silent_p.V201V|PACSIN2_ENST00000407585.1_Silent_p.V201V|PACSIN2_ENST00000337959.4_Silent_p.V201V|PACSIN2_ENST00000403744.3_Silent_p.V201V	NM_001184970.1	NP_001171899.1	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in neurons 2	201	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cell projection morphogenesis (GO:0048858)|membrane tubulation (GO:0097320)|negative regulation of endocytosis (GO:0045806)|protein localization to endosome (GO:0036010)	caveola (GO:0005901)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	19		Glioma(61;0.222)				TTACCTTAAGAACATCTTGCT	0.453																																					p.V201V		.											.	PACSIN2	68	0			c.T603G						.						252.0	237.0	242.0					22																	43284655		2009	4158	6167	SO:0001819	synonymous_variant	11252	exon5			CTTAAGAACATCT	AF128536	CCDS43023.1, CCDS54536.1	22q13.2-q13.33	2009-05-08			ENSG00000100266	ENSG00000100266			8571	protein-coding gene	gene with protein product	"""syndapin II"""	604960				10431838, 11082044	Standard	NM_007229		Approved	SDPII	uc003bdg.4	Q9UNF0	OTTHUMG00000150701	ENST00000263246.3:c.603T>G	22.37:g.43284655A>C		Somatic	202.0	0.0		WXS	Illumina HiSeq	Phase_I	236.0	103.0	NM_007229	O95921|Q96HV9|Q9H0D3|Q9NPN1|Q9Y4V2	Silent	SNP	ENST00000263246.3	37	CCDS43023.1																																																																																			.		0.453	PACSIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319665.1	NM_007229	
PAQR7	164091	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	26189417	26189417	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:26189417T>G	ENST00000374296.3	-	2	1580	c.914A>C	c.(913-915)gAg>gCg	p.E305A	RP1-125I3.2_ENST00000455431.1_RNA	NM_178422.5	NP_848509.1	Q86WK9	MPRA_HUMAN	progestin and adipoQ receptor family member VII	305					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|response to steroid hormone (GO:0048545)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)			breast(3)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.16e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000724)|BRCA - Breast invasive adenocarcinoma(304;0.000965)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0136)|READ - Rectum adenocarcinoma(331;0.0649)		GTGCAGAGGCTCATAGATGGG	0.602																																					p.E305A	Esophageal Squamous(111;1206 1556 18433 19151 38418)	.											.	PAQR7	71	0			c.A914C						.						68.0	68.0	68.0					1																	26189417		2203	4300	6503	SO:0001583	missense	164091	exon2			AGAGGCTCATAGA		CCDS267.1	1p35.3	2012-08-10			ENSG00000182749	ENSG00000182749			23146	protein-coding gene	gene with protein product	"""membrane progestin receptor alpha"""	607779					Standard	NM_178422		Approved	mSR, MPRA	uc001bkx.3	Q86WK9	OTTHUMG00000007373	ENST00000374296.3:c.914A>C	1.37:g.26189417T>G	ENSP00000363414:p.Glu305Ala	Somatic	306.0	0.0		WXS	Illumina HiSeq	Phase_I	248.0	149.0	NM_178422	A2A2D3|Q5XKF9|Q86VE4	Missense_Mutation	SNP	ENST00000374296.3	37	CCDS267.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.618986	0.46736	.	.	ENSG00000182749	ENST00000374296	T	0.23147	1.92	5.07	5.07	0.68467	.	0.216294	0.38111	N	0.001807	T	0.18341	0.0440	L	0.36672	1.1	0.45648	D	0.998571	B	0.28055	0.199	B	0.28991	0.097	T	0.06023	-1.0850	10	0.12766	T	0.61	-11.1793	9.474	0.38860	0.0:0.0:0.2321:0.7678	.	305	Q86WK9	MPRA_HUMAN	A	305	ENSP00000363414:E305A	ENSP00000363414:E305A	E	-	2	0	PAQR7	26062004	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.476000	0.60216	2.117000	0.64856	0.460000	0.39030	GAG	.		0.602	PAQR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019312.1	NM_178422	
PCDHA11	56138	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140249054	140249054	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:140249054G>A	ENST00000398640.2	+	1	366	c.366G>A	c.(364-366)gaG>gaA	p.E122E	PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	122	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAACGTGGAGGTGAAGGACA	0.577																																					p.E122E		.											.	PCDHA11	67	0			c.G366A						.						114.0	128.0	123.0					5																	140249054		2203	4300	6503	SO:0001819	synonymous_variant	56138	exon1			CGTGGAGGTGAAG	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.366G>A	5.37:g.140249054G>A		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	78.0	NM_018902	B2RN58|O75279	Silent	SNP	ENST00000398640.2	37	CCDS47284.1																																																																																			.		0.577	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
PIK3CA	5290	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.H1047R	Colon(199;1504 1750 3362 26421 31210 32040)	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,bladder,carcinoma,0	PIK3CA	27752	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	c.A3140G						.						99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	5290	exon21			ATGCACATCATGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	47.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	.		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PLEKHG1	57480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	151144808	151144808	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:151144808A>G	ENST00000358517.2	+	14	1677	c.1466A>G	c.(1465-1467)cAa>cGa	p.Q489R	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.Q489R			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	489							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		CAAGACATCCAAAAGGTAAGC	0.358																																					p.Q489R		.											.	PLEKHG1	92	0			c.A1466G						.						95.0	92.0	93.0					6																	151144808		2203	4299	6502	SO:0001583	missense	57480	exon15			ACATCCAAAAGGT	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1466A>G	6.37:g.151144808A>G	ENSP00000351318:p.Gln489Arg	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	15.0	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	A	11.76	1.735276	0.30774	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.60171	0.21;0.21	5.42	2.99	0.34606	.	0.357494	0.32719	N	0.005727	T	0.30386	0.0763	L	0.51422	1.61	0.42169	D	0.991637	B;B;B	0.12013	0.0;0.005;0.005	B;B;B	0.09377	0.001;0.004;0.004	T	0.17349	-1.0372	10	0.54805	T	0.06	.	7.198	0.25864	0.779:0.146:0.0751:0.0	.	296;489;489	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	R	489	ENSP00000356297:Q489R;ENSP00000351318:Q489R	ENSP00000351318:Q489R	Q	+	2	0	PLEKHG1	151186501	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	1.643000	0.37217	0.420000	0.25954	-0.274000	0.10170	CAA	.		0.358	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
POLE	5426	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	133219191	133219191	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:133219191T>C	ENST00000320574.5	-	37	4896	c.4853A>G	c.(4852-4854)aAc>aGc	p.N1618S	POLE_ENST00000434528.3_5'Flank|POLE_ENST00000535270.1_Missense_Mutation_p.N1591S	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1618					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GACCCCATAGTTGATCTTGTC	0.582								DNA polymerases (catalytic subunits)																													p.N1618S		.											.	POLE	233	0			c.A4853G						.						58.0	59.0	59.0					12																	133219191		2203	4300	6503	SO:0001583	missense	5426	exon37			CCATAGTTGATCT		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4853A>G	12.37:g.133219191T>C	ENSP00000322570:p.Asn1618Ser	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	39.0	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	T	2.489	-0.317887	0.05386	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.20738	2.05;2.05;2.05	5.6	2.78	0.32641	DNA polymerase epsilon, catalytic subunit A, C-terminal (1);	0.108697	0.85682	N	0.000000	T	0.06050	0.0157	N	0.02011	-0.69	0.22521	N	0.999026	B	0.02656	0.0	B	0.06405	0.002	T	0.41034	-0.9531	10	0.02654	T	1	.	8.9578	0.35829	0.0:0.6997:0.0:0.3003	.	1618	Q07864	DPOE1_HUMAN	S	1618;1629;1591	ENSP00000322570:N1618S;ENSP00000406383:N1629S;ENSP00000445753:N1591S	ENSP00000322570:N1618S	N	-	2	0	POLE	131729264	0.999000	0.42202	1.000000	0.80357	0.933000	0.57130	0.721000	0.25911	0.714000	0.32081	-0.248000	0.11899	AAC	.		0.582	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
PPAPDC3	84814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	134183331	134183331	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:134183331C>T	ENST00000372264.3	+	2	777	c.473C>T	c.(472-474)aCg>aTg	p.T158M		NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	158					negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		GACATCATGACGGTGGCCGGC	0.682																																					p.T158M		.											.	PPAPDC3	153	0			c.C473T						.						23.0	22.0	23.0					9																	134183331		2200	4296	6496	SO:0001583	missense	84814	exon2			TCATGACGGTGGC	AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.473C>T	9.37:g.134183331C>T	ENSP00000361338:p.Thr158Met	Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	8.0	NM_032728	Q5T6P0|Q96SS7|Q9BRC3	Missense_Mutation	SNP	ENST00000372264.3	37	CCDS6942.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.771215	0.49680	.	.	ENSG00000160539	ENST00000372264	T	0.75260	-0.92	4.68	4.68	0.58851	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.051238	0.85682	D	0.000000	T	0.77718	0.4172	L	0.45352	1.415	0.80722	D	1	D	0.71674	0.998	D	0.63033	0.91	T	0.76639	-0.2885	10	0.41790	T	0.15	-18.2091	10.6287	0.45523	0.0:0.8993:0.0:0.1007	.	158	Q8NBV4	PPAC3_HUMAN	M	158	ENSP00000361338:T158M	ENSP00000361338:T158M	T	+	2	0	PPAPDC3	133173152	1.000000	0.71417	0.978000	0.43139	0.032000	0.12392	4.316000	0.59178	2.296000	0.77279	0.505000	0.49811	ACG	.		0.682	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054724.1	NM_032728	
PRMT3	10196	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	20409581	20409581	+	Silent	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:20409581G>T	ENST00000331079.6	+	2	262	c.45G>T	c.(43-45)gtG>gtT	p.V15V	PRMT3_ENST00000437750.2_Intron	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	15					histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						GGGGCGCTGTGGAGAATGAGG	0.667																																					p.V15V		.											.	PRMT3	90	0			c.G45T						.						55.0	51.0	53.0					11																	20409581		2202	4300	6502	SO:0001819	synonymous_variant	10196	exon2			CGCTGTGGAGAAT	AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.45G>T	11.37:g.20409581G>T		Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	213.0	76.0	NM_005788	B4DUC7	Silent	SNP	ENST00000331079.6	37	CCDS7853.1																																																																																			.		0.667	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387489.1	NM_005788	
PPP2R5B	5526	ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64700298	64700298	+	Missense_Mutation	SNP	A	A	G	rs75667682		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:64700298A>G	ENST00000164133.2	+	12	1800	c.1178A>G	c.(1177-1179)aAc>aGc	p.N393S		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	393					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						ATTGAGGACAACTGCCACACT	0.522																																					p.N393S		.											.	PPP2R5B	660	0			c.A1178G						.						103.0	95.0	98.0					11																	64700298		2201	4297	6498	SO:0001583	missense	5526	exon12			AGGACAACTGCCA	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.1178A>G	11.37:g.64700298A>G	ENSP00000164133:p.Asn393Ser	Somatic	118.0	1.0		WXS	Illumina HiSeq	.	132.0	42.0	NM_006244	Q13853	Missense_Mutation	SNP	ENST00000164133.2	37	CCDS8085.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.698005	0.88830	.	.	ENSG00000068971	ENST00000164133;ENST00000527441	.	.	.	4.85	4.85	0.62838	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76983	0.4064	M	0.87456	2.885	0.58432	D	0.999999	P	0.52316	0.952	P	0.55999	0.789	T	0.81786	-0.0773	9	0.87932	D	0	-29.5842	12.7295	0.57191	1.0:0.0:0.0:0.0	.	393	Q15173	2A5B_HUMAN	S	393	.	ENSP00000164133:N393S	N	+	2	0	PPP2R5B	64456874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.704000	0.91351	2.172000	0.68678	0.533000	0.62120	AAC	.		0.522	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244	
PRUNE2	158471	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	79322807	79322807	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:79322807C>T	ENST00000376718.3	-	8	4506	c.4383G>A	c.(4381-4383)aaG>aaA	p.K1461K	PRUNE2_ENST00000428286.1_Silent_p.K1102K	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1461					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TCTCAAGATCCTTTTCAGGTA	0.428																																					p.K1461K		.											.	PRUNE2	157	0			c.G4383A						.						63.0	64.0	64.0					9																	79322807		1568	3582	5150	SO:0001819	synonymous_variant	158471	exon8			AAGATCCTTTTCA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.4383G>A	9.37:g.79322807C>T		Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	45.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.539480	0.00942	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.35	2.52	0.30459	.	.	.	.	.	T	0.35480	0.0933	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.21177	-1.0253	4	.	.	.	-0.0249	8.6948	0.34289	0.0:0.6754:0.0:0.3246	.	.	.	.	R	783	.	.	G	-	1	0	PRUNE2	78512627	0.400000	0.25295	0.001000	0.08648	0.007000	0.05969	0.798000	0.27014	0.348000	0.23949	-0.258000	0.10820	GGA	.		0.428	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
PYHIN1	149628	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158908887	158908887	+	Silent	SNP	T	T	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:158908887T>A	ENST00000368140.1	+	4	674	c.429T>A	c.(427-429)tcT>tcA	p.S143S	PYHIN1_ENST00000392252.3_Silent_p.S134S|PYHIN1_ENST00000368138.3_Silent_p.S134S|PYHIN1_ENST00000392254.2_Silent_p.S143S|PYHIN1_ENST00000368135.4_Silent_p.S143S	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	143					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AAAAACCATCTGAAGAAGAGA	0.413																																					p.S143S		.											.	PYHIN1	94	0			c.T429A						.						53.0	53.0	53.0					1																	158908887		2203	4300	6503	SO:0001819	synonymous_variant	149628	exon4			ACCATCTGAAGAA	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.429T>A	1.37:g.158908887T>A		Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	50.0	NM_152501	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Silent	SNP	ENST00000368140.1	37	CCDS1178.1																																																																																			.		0.413	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	
RAB32	10981	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	146875606	146875606	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:146875606A>G	ENST00000367495.3	+	3	722	c.543A>G	c.(541-543)atA>atG	p.I181M		NM_006834.3	NP_006825.1	Q13637	RAB32_HUMAN	RAB32, member RAS oncogene family	181	PKA-RII subunit binding domain.				antigen processing and presentation (GO:0019882)|endosome to melanosome transport (GO:0035646)|GTP catabolic process (GO:0006184)|melanosome organization (GO:0032438)|phagosome maturation (GO:0090382)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|melanosome (GO:0042470)|membrane (GO:0016020)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)	AP-1 adaptor complex binding (GO:0035650)|AP-3 adaptor complex binding (GO:0035651)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	8		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)		ACATAAACATAGAGGAAGCTG	0.363																																					p.I181M		.											.	RAB32	651	0			c.A543G						.						77.0	78.0	78.0					6																	146875606		2203	4300	6503	SO:0001583	missense	10981	exon3			AAACATAGAGGAA	U71127	CCDS5210.1	6q24.2	2010-08-20			ENSG00000118508	ENSG00000118508		"""RAB, member RAS oncogene"", ""A-kinase anchor proteins"""	9772	protein-coding gene	gene with protein product		612906					Standard	NM_006834		Approved		uc003qln.1	Q13637	OTTHUMG00000015755	ENST00000367495.3:c.543A>G	6.37:g.146875606A>G	ENSP00000356465:p.Ile181Met	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	38.0	NM_006834		Missense_Mutation	SNP	ENST00000367495.3	37	CCDS5210.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.499544	0.64298	.	.	ENSG00000118508	ENST00000367495	T	0.78924	-1.22	5.8	-3.7	0.04437	Small GTP-binding protein domain (1);	0.044767	0.85682	D	0.000000	D	0.84656	0.5520	H	0.95187	3.635	0.53005	D	0.999965	D	0.67145	0.996	D	0.71414	0.973	D	0.84060	0.0374	10	0.87932	D	0	-20.0784	7.5792	0.27955	0.2846:0.3199:0.0:0.3955	.	181	Q13637	RAB32_HUMAN	M	181	ENSP00000356465:I181M	ENSP00000356465:I181M	I	+	3	3	RAB32	146917299	0.771000	0.28555	0.979000	0.43373	0.719000	0.41307	-0.036000	0.12185	-0.467000	0.06932	0.533000	0.62120	ATA	.		0.363	RAB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042579.1	NM_006834	
RAC2	5880	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	37622734	37622734	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:37622734C>T	ENST00000249071.6	-	6	679	c.558G>A	c.(556-558)aaG>aaA	p.K186K	RAC2_ENST00000406508.1_Silent_p.K142K|RAC2_ENST00000405484.1_Silent_p.K179K	NM_002872.3	NP_002863.1	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)	186					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell projection assembly (GO:0030031)|G-protein coupled receptor signaling pathway (GO:0007186)|lymphocyte aggregation (GO:0071593)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|regulation of cell-substrate adhesion (GO:0010810)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of neutrophil migration (GO:1902622)|regulation of respiratory burst (GO:0060263)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	12					Dextromethorphan(DB00514)	TGCAGGCGCGCTTCTGCTGCC	0.627																																					p.K186K		.											.	RAC2	723	0			c.G558A						.						49.0	51.0	50.0					22																	37622734		2203	4299	6502	SO:0001819	synonymous_variant	5880	exon6			GGCGCGCTTCTGC	M64595	CCDS13945.1	22q13.1	2014-09-17			ENSG00000128340	ENSG00000128340		"""Endogenous ligands"""	9802	protein-coding gene	gene with protein product		602049				2674130	Standard	NM_002872		Approved	EN-7	uc003arc.3	P15153	OTTHUMG00000150540	ENST00000249071.6:c.558G>A	22.37:g.37622734C>T		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	24.0	NM_002872	Q9UDJ4	Silent	SNP	ENST00000249071.6	37	CCDS13945.1																																																																																			.		0.627	RAC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318812.1		
RBMXL2	27288	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7111267	7111267	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:7111267G>T	ENST00000306904.5	+	1	1103	c.916G>T	c.(916-918)Ggc>Tgc	p.G306C		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	306	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGGAGGAGGAGGCCGCTACGA	0.667																																					p.G306C		.											.	RBMXL2	68	0			c.G916T						.						18.0	21.0	20.0					11																	7111267		2198	4293	6491	SO:0001583	missense	27288	exon1			GGAGGAGGCCGCT	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.916G>T	11.37:g.7111267G>T	ENSP00000304139:p.Gly306Cys	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	48.0	NM_014469	Q6PEZ2|Q9NQU0	Missense_Mutation	SNP	ENST00000306904.5	37	CCDS7777.1	.	.	.	.	.	.	.	.	.	.	g	12.81	2.050157	0.36181	.	.	ENSG00000170748	ENST00000306904	T	0.78816	-1.21	3.51	-0.579	0.11720	.	0.220955	0.46145	U	0.000308	T	0.74642	0.3743	L	0.38531	1.155	0.30422	N	0.777987	D	0.76494	0.999	D	0.65573	0.936	T	0.68416	-0.5414	10	0.36615	T	0.2	.	4.0236	0.09677	0.4188:0.1771:0.404:0.0	.	306	O75526	HNRGT_HUMAN	C	306	ENSP00000304139:G306C	ENSP00000304139:G306C	G	+	1	0	RBMXL2	7067843	1.000000	0.71417	0.470000	0.27216	0.848000	0.48234	3.677000	0.54619	-0.098000	0.12285	-1.096000	0.02151	GGC	.		0.667	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384552.1	NM_014469	
RGS7	6000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	240978079	240978079	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:240978079T>C	ENST00000407727.1	-	11	783		c.e11-2		RGS7_ENST00000366564.1_Splice_Site|RGS7_ENST00000331110.7_Splice_Site|RGS7_ENST00000348120.2_Splice_Site|RGS7_ENST00000366562.4_Splice_Site|RGS7_ENST00000401882.1_Splice_Site|RGS7_ENST00000366565.1_Splice_Site|RGS7_ENST00000366563.1_Splice_Site|RGS7_ENST00000446183.2_Splice_Site			P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			ATATTTTATCTGAAAAGAGGG	0.323																																					.		.											.	RGS7	232	0			c.784-2A>G						.						98.0	105.0	102.0					1																	240978079		2203	4296	6499	SO:0001630	splice_region_variant	6000	exon13			TTTATCTGAAAAG	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.784-2A>G	1.37:g.240978079T>C		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	24.0	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Splice_Site	SNP	ENST00000407727.1	37		.	.	.	.	.	.	.	.	.	.	T	24.5	4.535076	0.85812	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7905	0.78357	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RGS7	239044702	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.825000	0.86693	2.324000	0.78689	0.533000	0.62120	.	.		0.323	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	Intron
RLTPR	146206	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67683061	67683061	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:67683061C>T	ENST00000334583.6	+	18	2002	c.1674C>T	c.(1672-1674)ttC>ttT	p.F558F	RLTPR_ENST00000545661.1_Silent_p.F522F	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	558					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		GAAGGAACTTCAACGTCCGGT	0.652																																					p.F558F		.											.	RLTPR	67	0			c.C1674T						.						54.0	64.0	60.0					16																	67683061		2067	4193	6260	SO:0001819	synonymous_variant	146206	exon18			GAACTTCAACGTC	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1674C>T	16.37:g.67683061C>T		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	50.0	NM_001013838	B8X2Z3	Silent	SNP	ENST00000334583.6	37	CCDS45513.1																																																																																			.		0.652	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838	
TATDN1	83940	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	125498418	125498418	+	IGR	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:125498418G>T	ENST00000276692.6	-	0	1018				RP11-158K1.3_ENST00000518639.1_RNA|RNF139_ENST00000303545.3_Missense_Mutation_p.E176D	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			ACATCAGAGAGACTTTACTGT	0.353																																					p.E176D		.											.	RNF139	226	0			c.G528T						.						143.0	141.0	142.0					8																	125498418		2203	4300	6503	SO:0001628	intergenic_variant	11236	exon2			CAGAGAGACTTTA	AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068		8.37:g.125498418G>T		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	192.0	104.0	NM_007218	B2R5J0|Q8TD02|Q9BY40	Missense_Mutation	SNP	ENST00000276692.6	37	CCDS6351.1	.	.	.	.	.	.	.	.	.	.	G	7.633	0.679177	0.14907	.	.	ENSG00000170881	ENST00000303545;ENST00000517684	T	0.23754	1.89	5.34	4.45	0.53987	.	0.059734	0.64402	D	0.000003	T	0.13927	0.0337	N	0.14661	0.345	0.32414	N	0.550302	B	0.33777	0.425	B	0.34418	0.182	T	0.11665	-1.0578	10	0.21540	T	0.41	-13.5081	9.5266	0.39169	0.2098:0.0:0.7902:0.0	.	176	Q8WU17	RN139_HUMAN	D	176;49	ENSP00000304051:E176D	ENSP00000304051:E176D	E	+	3	2	RNF139	125567599	1.000000	0.71417	1.000000	0.80357	0.526000	0.34562	2.903000	0.48711	2.642000	0.89623	0.650000	0.86243	GAG	.		0.353	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381655.1	NM_032026	
RSPH6A	81492	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	19	46305378	46305378	+	Splice_Site	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:46305378C>A	ENST00000221538.3	-	4	1940	c.1798G>T	c.(1798-1800)Gaa>Taa	p.E600*	RSPH6A_ENST00000597055.1_Splice_Site_p.E600*|RSPH6A_ENST00000600188.1_Splice_Site_p.E336*	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	600	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						GCTTCCTTACCTGCATCTTCT	0.637																																					p.E600X		.											.	RSPH6A	91	0			c.G1798T						.						96.0	69.0	78.0					19																	46305378		2203	4300	6503	SO:0001630	splice_region_variant	81492	exon4			CCTTACCTGCATC	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1798+1G>T	19.37:g.46305378C>A		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	45.0	NM_030785	Q53FE2|Q6PEZ9	Nonsense_Mutation	SNP	ENST00000221538.3	37	CCDS12675.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.912655	0.92178	.	.	ENSG00000104941	ENST00000221538	.	.	.	4.15	4.15	0.48705	.	0.165132	0.52532	D	0.000078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.5686	12.2908	0.54817	0.0:1.0:0.0:0.0	.	.	.	.	X	600	.	.	E	-	1	0	RSPH6A	50997218	1.000000	0.71417	0.998000	0.56505	0.119000	0.20118	4.199000	0.58426	2.606000	0.88127	0.456000	0.33151	GAA	.		0.637	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		Nonsense_Mutation
SCAF11	9169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	46357973	46357973	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:46357973T>C	ENST00000369367.3	-	2	213		c.e2-2		SCAF11_ENST00000395453.2_Splice_Site|SCAF11_ENST00000395454.2_Splice_Site|SCAF11_ENST00000419565.2_Splice_Site	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						AAGGGTTTCCTATAAGATAAA	0.264																																					.		.											.	SCAF11	93	0			.						.						38.0	36.0	37.0					12																	46357973		1777	4042	5819	SO:0001630	splice_region_variant	9169	.			GTTTCCTATAAGA	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.21-2A>G	12.37:g.46357973T>C		Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	13.0	.	A6NEU9|A6NLW5|Q8IW59	Splice_Site	SNP	ENST00000369367.3	37	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638202	0.29157	.	.	ENSG00000139218	ENST00000266589	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2066	0.54355	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCAF11	44644240	0.999000	0.42202	0.932000	0.37286	0.189000	0.23516	4.167000	0.58209	2.207000	0.71202	0.459000	0.35465	.	.		0.264	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	Intron
CAPN1	823	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	64981537	64981537	+	IGR	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:64981537C>T	ENST00000527323.1	+	0	3086				SLC22A20_ENST00000525437.1_RNA			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		ACCAACGACTCGGGGGCCTGG	0.697																																					p.S65L		.											.	SLC22A20	23	0			c.C194T						.						9.0	12.0	11.0					11																	64981537		1865	4064	5929	SO:0001628	intergenic_variant	440044	exon1			ACGACTCGGGGGC	X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614		11.37:g.64981537C>T		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	20.0	NM_001004326	Q2TTR0|Q6DHV4	Missense_Mutation	SNP	ENST00000527323.1	37	CCDS44644.1																																																																																			.		0.697	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385325.1		
SLC8A1	6546	ucsc.edu;bcgsc.ca	37	2	40366656	40366656	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:40366656C>A	ENST00000403092.1	-	10	2463	c.2430G>T	c.(2428-2430)atG>atT	p.M810I	SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1_ENST00000402441.1_Missense_Mutation_p.M774I|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1_ENST00000542024.1_Missense_Mutation_p.M774I|SLC8A1_ENST00000332839.4_Missense_Mutation_p.M810I|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1_ENST00000542756.1_Missense_Mutation_p.M805I|SLC8A1_ENST00000406391.2_Missense_Mutation_p.M774I|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1_ENST00000406785.2_Missense_Mutation_p.M774I|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000408028.2_Missense_Mutation_p.M802I|SLC8A1_ENST00000405901.3_Missense_Mutation_p.M805I|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1_ENST00000405269.1_Missense_Mutation_p.M774I			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	810					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GTAGGCCAATCATGAGGATGG	0.512																																					p.M810I		.											.	SLC8A1	93	0			c.G2430T						.						119.0	101.0	107.0					2																	40366656		2203	4300	6503	SO:0001583	missense	6546	exon9			GCCAATCATGAGG		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2430G>T	2.37:g.40366656C>A	ENSP00000384763:p.Met810Ile	Somatic	174.0	0.0		WXS	Illumina HiSeq	.	178.0	60.0	NM_021097	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	10.18	1.278203	0.23307	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07;0.07;0.07;0.07;0.07;0.07	5.06	5.06	0.68205	Sodium/calcium exchanger membrane region (1);	0.041889	0.85682	N	0.000000	T	0.40398	0.1115	N	0.08118	0	0.80722	D	1	B;B;B;B	0.21753	0.031;0.06;0.013;0.016	B;B;B;B	0.34652	0.187;0.026;0.006;0.026	T	0.26815	-1.0092	10	0.07482	T	0.82	.	15.9345	0.79691	0.0:1.0:0.0:0.0	.	774;797;805;810	P32418-2;P32418-3;F6VPY9;P32418	.;.;.;NAC1_HUMAN	I	774;810;805;810;805;774;774;810;802;797;774;774	ENSP00000383886:M774I;ENSP00000440727:M805I;ENSP00000384763:M810I;ENSP00000385678:M805I;ENSP00000385188:M774I;ENSP00000385535:M774I;ENSP00000332931:M810I;ENSP00000384908:M802I;ENSP00000385811:M774I;ENSP00000443515:M774I	ENSP00000332931:M810I	M	-	3	0	SLC8A1	40220160	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.042000	0.57347	2.333000	0.79357	0.563000	0.77884	ATG	.		0.512	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
SLITRK4	139065	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	142717685	142717685	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:142717685T>C	ENST00000381779.4	-	2	1465	c.1240A>G	c.(1240-1242)Aca>Gca	p.T414A	SLITRK4_ENST00000356928.1_Missense_Mutation_p.T414A|SLITRK4_ENST00000338017.4_Missense_Mutation_p.T414A	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	414						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TTAATCACTGTAATTTGATTG	0.398																																					p.T414A		.											.	SLITRK4	193	0			c.A1240G						.						141.0	119.0	126.0					X																	142717685		2203	4300	6503	SO:0001583	missense	139065	exon2			TCACTGTAATTTG	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1240A>G	X.37:g.142717685T>C	ENSP00000371198:p.Thr414Ala	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	80.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	T	0.484	-0.878560	0.02550	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.55760	0.5;0.5;0.5	5.29	5.29	0.74685	.	0.270580	0.35739	N	0.003009	T	0.39200	0.1069	L	0.41236	1.265	0.35519	D	0.801312	B	0.02656	0.0	B	0.04013	0.001	T	0.42649	-0.9439	10	0.12430	T	0.62	-2.5162	9.3055	0.37872	0.1627:0.0:0.0:0.8373	.	414	Q8IW52	SLIK4_HUMAN	A	414	ENSP00000371198:T414A;ENSP00000349400:T414A;ENSP00000336627:T414A	ENSP00000336627:T414A	T	-	1	0	SLITRK4	142545351	0.110000	0.22057	0.959000	0.39883	0.990000	0.78478	0.276000	0.18716	1.874000	0.54306	0.437000	0.28790	ACA	.		0.398	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
SMPD1	6609	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6412065	6412065	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:6412065G>A	ENST00000342245.4	+	1	405	c.237G>A	c.(235-237)cgG>cgA	p.R79R	SMPD1_ENST00000533196.1_Intron|SMPD1_ENST00000527275.1_Silent_p.R79R|SMPD1_ENST00000356761.2_Silent_p.R79R|SMPD1_ENST00000299397.3_Silent_p.R79R	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	77					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	TAGTGCCCCGGCTCCGAGATG	0.607																																					p.R79R		.											.	SMPD1	90	0			c.G237A						.						56.0	59.0	58.0					11																	6412065		2201	4296	6497	SO:0001819	synonymous_variant	6609	exon1			GCCCCGGCTCCGA	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.237G>A	11.37:g.6412065G>A		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	23.0	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Silent	SNP	ENST00000342245.4	37	CCDS44531.1																																																																																			.		0.607	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
SPTBN1	6711	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	54850714	54850714	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:54850714T>G	ENST00000356805.4	+	10	1444	c.1163T>G	c.(1162-1164)cTc>cGc	p.L388R	SPTBN1_ENST00000333896.5_Missense_Mutation_p.L375R	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	388					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GAGGGGAAGCTCATCTCTGAC	0.522																																					p.L388R		.											.	SPTBN1	140	0			c.T1163G						.						87.0	83.0	85.0					2																	54850714		2203	4300	6503	SO:0001583	missense	6711	exon10			GGAAGCTCATCTC		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.1163T>G	2.37:g.54850714T>G	ENSP00000349259:p.Leu388Arg	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	57.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.788548	0.90367	.	.	ENSG00000115306	ENST00000356805;ENST00000389980;ENST00000333896	T;T;T	0.40225	1.04;1.04;1.04	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.66470	0.2792	M	0.88310	2.945	0.80722	D	1	P;P	0.49253	0.721;0.921	B;P	0.56960	0.414;0.81	T	0.72626	-0.4236	10	0.56958	D	0.05	.	16.0044	0.80349	0.0:0.0:0.0:1.0	.	375;388	Q01082-3;Q01082	.;SPTB2_HUMAN	R	388;388;375	ENSP00000349259:L388R;ENSP00000374630:L388R;ENSP00000334156:L375R	ENSP00000334156:L375R	L	+	2	0	SPTBN1	54704218	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.250000	0.72435	2.191000	0.70037	0.528000	0.53228	CTC	.		0.522	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
SYCE1L	100130958	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	77245136	77245136	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:77245136A>G	ENST00000378644.4	+	7	441	c.386A>G	c.(385-387)gAt>gGt	p.D129G	RP11-538I12.2_ENST00000569032.1_RNA	NM_001129979.1	NP_001123451.1	A8MT33	SYC1L_HUMAN	synaptonemal complex central element protein 1-like	129					synaptonemal complex assembly (GO:0007130)	synaptonemal complex (GO:0000795)				breast(1)|prostate(1)	2						CAGCTGGAGGATCTGATGGGC	0.562																																					p.D129G		.											.	.	.	0			c.A386G						.						168.0	157.0	160.0					16																	77245136		692	1591	2283	SO:0001583	missense	100130958	exon7			TGGAGGATCTGAT		CCDS45533.1	16q23.1	2009-10-06			ENSG00000205078	ENSG00000205078			37236	protein-coding gene	gene with protein product	"""meiosis-related protein"""					16328886	Standard	NM_001129979		Approved	MRP2	uc010vnh.1	A8MT33		ENST00000378644.4:c.386A>G	16.37:g.77245136A>G	ENSP00000367911:p.Asp129Gly	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	84.0	NM_001129979	A6NF23	Missense_Mutation	SNP	ENST00000378644.4	37	CCDS45533.1	.	.	.	.	.	.	.	.	.	.	A	12.85	2.060333	0.36373	.	.	ENSG00000205078	ENST00000378644	T	0.32023	1.47	3.82	1.51	0.23008	.	0.170354	0.25402	U	0.030923	T	0.29850	0.0746	M	0.62723	1.935	0.09310	N	1	P	0.52061	0.95	P	0.46339	0.513	T	0.18999	-1.0319	10	0.66056	D	0.02	.	3.8292	0.08867	0.6629:0.2209:0.1162:0.0	.	129	A8MT33	SYC1L_HUMAN	G	129	ENSP00000367911:D129G	ENSP00000367911:D129G	D	+	2	0	SYCE1L	75802637	0.392000	0.25229	0.007000	0.13788	0.415000	0.31203	1.051000	0.30417	0.292000	0.22492	0.460000	0.39030	GAT	.		0.562	SYCE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433889.1	NM_001129979	
SYT9	143425	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7324549	7324549	+	Missense_Mutation	SNP	C	C	T	rs200034628		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:7324549C>T	ENST00000318881.6	+	2	662	c.425C>T	c.(424-426)aCg>aTg	p.T142M	SYT9_ENST00000396716.2_Missense_Mutation_p.T110M	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	142					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		TCCACCCAGACGGGGATCCAG	0.602													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18297	0.0		0.0	False		,,,				2504	0.0				p.T142M		.											.	SYT9	155	0			c.C425T						.	C	MET/THR	1,4401	2.1+/-5.4	0,1,2200	65.0	53.0	57.0		425	1.9	0.0	11		57	0,8592		0,0,4296	no	missense	SYT9	NM_175733.3	81	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	benign	142/492	7324549	1,12993	2201	4296	6497	SO:0001583	missense	143425	exon2			CCCAGACGGGGAT	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.425C>T	11.37:g.7324549C>T	ENSP00000324419:p.Thr142Met	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	23.0	NM_175733		Missense_Mutation	SNP	ENST00000318881.6	37	CCDS7778.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	0.618	-0.822274	0.02755	2.27E-4	0.0	ENSG00000170743	ENST00000396716;ENST00000318881	T;T	0.56611	0.45;0.53	5.73	1.87	0.25490	.	0.731833	0.13345	N	0.394835	T	0.32526	0.0832	N	0.17082	0.46	0.09310	N	1	B	0.22746	0.074	B	0.14578	0.011	T	0.16512	-1.0400	10	0.24483	T	0.36	.	9.0765	0.36525	0.0:0.7025:0.0:0.2975	.	142	Q86SS6	SYT9_HUMAN	M	110;142	ENSP00000379944:T110M;ENSP00000324419:T142M	ENSP00000324419:T142M	T	+	2	0	SYT9	7281125	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.567000	0.23608	0.096000	0.17463	0.655000	0.94253	ACG	C|0.999;T|0.000		0.602	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733	
TBX22	50945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	79282219	79282219	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:79282219T>C	ENST00000373294.5	+	5	678	c.650T>C	c.(649-651)aTg>aCg	p.M217T	TBX22_ENST00000373296.3_Missense_Mutation_p.M217T|TBX22_ENST00000442340.1_Missense_Mutation_p.M97T|TBX22_ENST00000373291.1_Missense_Mutation_p.M97T	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	217					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CTGCAATCCATGCATAAGTAC	0.483																																					p.M217T		.											.	TBX22	628	0			c.T650C						.						148.0	121.0	130.0					X																	79282219		2203	4300	6503	SO:0001583	missense	50945	exon5			AATCCATGCATAA	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.650T>C	X.37:g.79282219T>C	ENSP00000362390:p.Met217Thr	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	44.0	NM_016954	Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	ENST00000373294.5	37	CCDS14445.1	.	.	.	.	.	.	.	.	.	.	T	17.24	3.338130	0.60963	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5	3.88	3.88	0.44766	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.95900	0.8665	H	0.98027	4.13	0.80722	D	1	D	0.63046	0.992	D	0.66716	0.946	D	0.96018	0.9007	10	0.87932	D	0	.	9.9835	0.41828	0.0:0.0:0.0:1.0	.	217	Q9Y458	TBX22_HUMAN	T	217;97;217;97	ENSP00000362393:M217T;ENSP00000396394:M97T;ENSP00000362390:M217T;ENSP00000362388:M97T	ENSP00000362388:M97T	M	+	2	0	TBX22	79168875	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.012000	0.76366	1.547000	0.49401	0.486000	0.48141	ATG	.		0.483	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954	
TEX14	56155	hgsc.bcm.edu;bcgsc.ca	37	17	56692692	56692692	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:56692692C>T	ENST00000240361.8	-	8	885	c.800G>A	c.(799-801)gGg>gAg	p.G267E	TEX14_ENST00000349033.5_Missense_Mutation_p.G261E|TEX14_ENST00000389934.3_Missense_Mutation_p.G261E			Q8IWB6	TEX14_HUMAN	testis expressed 14	267	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GACCCTGCTCCCATTCCACAC	0.532																																					p.G267E		.											.	TEX14	810	0			c.G800A						.						96.0	83.0	87.0					17																	56692692		2203	4300	6503	SO:0001583	missense	56155	exon8			CTGCTCCCATTCC	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.800G>A	17.37:g.56692692C>T	ENSP00000240361:p.Gly267Glu	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	5.0	NM_001201457	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255705	0.59321	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.53640	0.61;0.61;0.61	5.58	5.58	0.84498	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.156845	0.45867	D	0.000323	T	0.65015	0.2651	M	0.73753	2.245	0.28585	N	0.909916	D;D;D	0.67145	0.996;0.973;0.991	D;P;P	0.64877	0.93;0.885;0.885	T	0.64385	-0.6420	10	0.72032	D	0.01	-20.4935	11.5868	0.50923	0.0:0.9182:0.0:0.0818	.	267;261;261	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	E	267;261;261	ENSP00000240361:G267E;ENSP00000374584:G261E;ENSP00000268910:G261E	ENSP00000240361:G267E	G	-	2	0	TEX14	54047691	0.998000	0.40836	0.996000	0.52242	0.282000	0.26991	3.458000	0.53014	2.646000	0.89796	0.561000	0.74099	GGG	.		0.532	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
THAP1	55145	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	42693397	42693397	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:42693397C>A	ENST00000254250.3	-	3	580	c.350G>T	c.(349-351)gGa>gTa	p.G117V	THAP1_ENST00000345117.2_Missense_Mutation_p.D52Y|THAP1_ENST00000532093.1_5'Flank	NM_018105.2	NP_060575.1	Q9NVV9	THAP1_HUMAN	THAP domain containing, apoptosis associated protein 1	117					cell cycle (GO:0007049)|endothelial cell proliferation (GO:0001935)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|lung(4)|prostate(1)|skin(1)	7	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Acute lymphoblastic leukemia(644;0.000299)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0377)|LUSC - Lung squamous cell carcinoma(45;0.0869)			CATTAGTAATCCAATAGCAGC	0.453																																					p.G117V		.											.	THAP1	90	0			c.G350T						.						115.0	129.0	124.0					8																	42693397		2203	4300	6503	SO:0001583	missense	55145	exon3			AGTAATCCAATAG	BC021721	CCDS6136.1, CCDS6137.1	8p11.1	2013-01-25			ENSG00000131931	ENSG00000131931		"""THAP (C2CH-type zinc finger) domain containing"""	20856	protein-coding gene	gene with protein product		609520	"""dystonia 6, torsion (autosomal dominant)"""	DYT6		12575992, 12717420, 19182804	Standard	NM_018105		Approved	FLJ10477, 4833431A01Rik	uc003xpk.3	Q9NVV9	OTTHUMG00000165276	ENST00000254250.3:c.350G>T	8.37:g.42693397C>A	ENSP00000254250:p.Gly117Val	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	65.0	NM_018105	A6NCB6|D3DSY5|H9KV49|Q53FQ1|Q6IA99	Missense_Mutation	SNP	ENST00000254250.3	37	CCDS6136.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.73|13.73	2.325825|2.325825	0.41197|0.41197	.|.	.|.	ENSG00000131931|ENSG00000131931	ENST00000345117|ENST00000254250	D|D	0.97575|0.97811	-4.44|-4.55	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.164655	.|0.52532	.|D	.|0.000063	D|D	0.97210|0.97210	0.9088|0.9088	.|.	.|.	.|.	0.38563|0.38563	D|D	0.949741|0.949741	.|D	.|0.59357	.|0.985	.|P	.|0.50270	.|0.636	D|D	0.96583|0.96583	0.9432|0.9432	6|9	0.87932|0.24483	D|T	0|0.36	-35.9057|-35.9057	19.7971|19.7971	0.96490|0.96490	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|117	.|Q9NVV9	.|THAP1_HUMAN	Y|V	52|117	ENSP00000344966:D52Y|ENSP00000254250:G117V	ENSP00000344966:D52Y|ENSP00000254250:G117V	D|G	-|-	1|2	0|0	THAP1|THAP1	42812554|42812554	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.978000|0.978000	0.69477|0.69477	3.393000|3.393000	0.52544|0.52544	2.757000|2.757000	0.94681|0.94681	0.585000|0.585000	0.79938|0.79938	GAT|GGA	.		0.453	THAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383161.1	NM_018105	
THSD7A	221981	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	11446083	11446083	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:11446083C>G	ENST00000423059.4	-	22	4332	c.4081G>C	c.(4081-4083)Ggg>Cgg	p.G1361R	AC004160.4_ENST00000425837.1_RNA|AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1361	TSP type-1 14. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GTTCTGGTCCCTTCTCCACAC	0.418										HNSCC(18;0.044)																											p.G1361R		.											.	THSD7A	71	0			c.G4081C						.						60.0	59.0	59.0					7																	11446083		1909	4125	6034	SO:0001583	missense	221981	exon21			TGGTCCCTTCTCC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4081G>C	7.37:g.11446083C>G	ENSP00000406482:p.Gly1361Arg	Somatic	193.0	0.0		WXS	Illumina HiSeq	Phase_I	242.0	84.0	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712990	0.89112	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	D	0.83673	-1.75	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.92198	0.7526	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91831	0.5475	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1361	Q9UPZ6	THS7A_HUMAN	R	1361	ENSP00000406482:G1361R	ENSP00000262042:G1361R	G	-	1	0	THSD7A	11412608	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.790000	0.85794	2.941000	0.99782	0.655000	0.94253	GGG	.		0.418	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
TIGD7	91151	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	3349414	3349414	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:3349414T>C	ENST00000396862.1	-	2	3029	c.1201A>G	c.(1201-1203)Aat>Gat	p.N401D	TIGD7_ENST00000268674.2_Missense_Mutation_p.N401D|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	401						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						TAAAGAAGATTTTCCCATGCA	0.308																																					p.N401D		.											.	TIGD7	90	0			c.A1201G						.						91.0	101.0	98.0					16																	3349414		2197	4299	6496	SO:0001583	missense	91151	exon2			GAAGATTTTCCCA	AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.1201A>G	16.37:g.3349414T>C	ENSP00000380071:p.Asn401Asp	Somatic	243.0	0.0		WXS	Illumina HiSeq	Phase_I	220.0	81.0	NM_033208	Q9BXZ0	Missense_Mutation	SNP	ENST00000396862.1	37	CCDS10500.1	.	.	.	.	.	.	.	.	.	.	T	8.165	0.790433	0.16258	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.33865	1.39;1.39	5.32	5.32	0.75619	.	0.000000	0.42682	U	0.000664	T	0.44623	0.1302	L	0.27053	0.805	0.28178	N	0.928306	D	0.63880	0.993	D	0.70227	0.968	T	0.36578	-0.9742	10	0.52906	T	0.07	.	11.6709	0.51401	0.0:0.0:0.0:1.0	.	401	Q6NT04	TIGD7_HUMAN	D	401	ENSP00000380071:N401D;ENSP00000268674:N401D	ENSP00000268674:N401D	N	-	1	0	TIGD7	3289415	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.321000	0.43805	2.006000	0.58801	0.533000	0.62120	AAT	.		0.308	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251465.1	NM_033208	
TLL1	7092	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	167020635	167020635	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:167020635C>G	ENST00000061240.2	+	20	3510	c.2863C>G	c.(2863-2865)Ctt>Gtt	p.L955V	TLL1_ENST00000507499.1_Missense_Mutation_p.L978V	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	955	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CTTTGATGGTCTTGATTCAAC	0.448																																					p.L955V		.											.	TLL1	158	0			c.C2863G						.						199.0	203.0	202.0					4																	167020635		2203	4300	6503	SO:0001583	missense	7092	exon20			GATGGTCTTGATT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2863C>G	4.37:g.167020635C>G	ENSP00000061240:p.Leu955Val	Somatic	269.0	0.0		WXS	Illumina HiSeq	Phase_I	290.0	100.0	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	C	2.910	-0.225583	0.06022	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.18174	2.23;2.23	5.54	4.7	0.59300	CUB (5);	0.145379	0.47093	U	0.000248	T	0.11367	0.0277	N	0.16602	0.42	0.80722	D	1	B;B	0.24317	0.101;0.081	B;B	0.31442	0.13;0.089	T	0.17899	-1.0354	10	0.17369	T	0.5	.	10.7403	0.46149	0.0:0.8542:0.0:0.1458	.	978;955	E9PD25;O43897	.;TLL1_HUMAN	V	955;978	ENSP00000061240:L955V;ENSP00000426082:L978V	ENSP00000061240:L955V	L	+	1	0	TLL1	167240085	0.021000	0.18746	0.123000	0.21794	0.006000	0.05464	1.892000	0.39748	1.342000	0.45619	-0.244000	0.11960	CTT	.		0.448	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
TMEM132B	114795	ucsc.edu;bcgsc.ca;mdanderson.org	37	12	126138497	126138497	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:126138497A>G	ENST00000299308.3	+	9	2486	c.2478A>G	c.(2476-2478)agA>agG	p.R826R	TMEM132B_ENST00000535886.1_Silent_p.R338R	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	826						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		ACCAGGAGAGAGCAGTCCAGG	0.498																																					p.R826R		.											.	TMEM132B	185	0			c.A2478G						.						67.0	69.0	68.0					12																	126138497		2013	4154	6167	SO:0001819	synonymous_variant	114795	exon9			GGAGAGAGCAGTC	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2478A>G	12.37:g.126138497A>G		Somatic	92.0	0.0		WXS	Illumina HiSeq	.	176.0	57.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Silent	SNP	ENST00000299308.3	37	CCDS41859.1																																																																																			.		0.498	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
TNRC6A	27327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	24815534	24815534	+	Missense_Mutation	SNP	A	A	G	rs146427035	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:24815534A>G	ENST00000395799.3	+	12	3860	c.3731A>G	c.(3730-3732)cAt>cGt	p.H1244R	CTD-2515A14.1_ENST00000568895.1_RNA|TNRC6A_ENST00000315183.7_Missense_Mutation_p.H1244R	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1244	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ATAGATAAACATAGCCTAAAT	0.403													A|||	2	0.000399361	0.0008	0.0	5008	,	,		16833	0.0		0.001	False		,,,				2504	0.0				p.H1244R		.											.	TNRC6A	92	0			c.A3731G						.	A	ARG/HIS	7,4387	12.9+/-30.5	0,7,2190	91.0	85.0	87.0		3731	6.1	1.0	16	dbSNP_134	87	57,8543	36.4+/-91.3	0,57,4243	yes	missense	TNRC6A	NM_014494.2	29	0,64,6433	GG,GA,AA		0.6628,0.1593,0.4925	possibly-damaging	1244/1963	24815534	64,12930	2197	4300	6497	SO:0001583	missense	27327	exon12			ATAAACATAGCCT	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.3731A>G	16.37:g.24815534A>G	ENSP00000379144:p.His1244Arg	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	22.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	3	0.0013736263736263737	2	0.0040650406504065045	0	0.0	0	0.0	1	0.0013192612137203166	A	6.817	0.519862	0.13005	0.001593	0.006628	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.05580	3.56;3.42	6.08	6.08	0.98989	UBA-like (1);	0.151017	0.52532	D	0.000064	T	0.01976	0.0062	N	0.01874	-0.695	0.80722	D	1	P;P	0.48764	0.557;0.915	P;P	0.45343	0.447;0.477	T	0.51687	-0.8674	10	0.02654	T	1	-2.8395	12.4913	0.55901	0.8608:0.1392:0.0:0.0	.	1244;1244	Q8NDV7-6;Q8NDV7	.;TNR6A_HUMAN	R	1244	ENSP00000326900:H1244R;ENSP00000379144:H1244R	ENSP00000326900:H1244R	H	+	2	0	TNRC6A	24723035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.926000	0.48892	2.333000	0.79357	0.482000	0.46254	CAT	A|0.995;G|0.005		0.403	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
TNRC6B	23112	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	40708594	40708594	+	Silent	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:40708594G>T	ENST00000454349.2	+	18	4732	c.4521G>T	c.(4519-4521)ggG>ggT	p.G1507G	TNRC6B_ENST00000335727.9_Silent_p.G1397G|TNRC6B_ENST00000301923.9_Silent_p.G703G|TNRC6B_ENST00000402203.1_Silent_p.G703G	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1507	Silencing domain; interaction with CNOT1 and PAN3.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						GTGTGCTGGGGGGTACAGCCA	0.488																																					p.G1507G		.											.	TNRC6B	22	0			c.G4521T						.						126.0	124.0	125.0					22																	40708594		2014	4191	6205	SO:0001819	synonymous_variant	23112	exon18			GCTGGGGGGTACA	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.4521G>T	22.37:g.40708594G>T		Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	46.0	NM_001162501	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Silent	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	G	9.640	1.138665	0.21123	.	.	ENSG00000100354	ENST00000446273	T	0.15256	2.44	5.16	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.27098	0.0664	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.01889	-1.1253	7	0.52906	T	0.07	-0.7393	9.7368	0.40392	0.2229:0.0:0.7771:0.0	.	.	.	.	V	1193	ENSP00000409429:G1193V	ENSP00000409429:G1193V	G	+	2	0	TNRC6B	39038540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.372000	0.44257	0.580000	0.29522	0.655000	0.94253	GGG	.		0.488	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
TTC17	55761	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	43411338	43411338	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:43411338G>C	ENST00000039989.4	+	3	400	c.386G>C	c.(385-387)gGc>gCc	p.G129A	TTC17_ENST00000299240.6_Missense_Mutation_p.G129A|RP11-484D2.4_ENST00000394183.2_RNA	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	129					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CTATATGATGGCACATACATA	0.393																																					p.G129A		.											.	TTC17	95	0			c.G386C						.						136.0	133.0	134.0					11																	43411338		2203	4300	6503	SO:0001583	missense	55761	exon3			ATGATGGCACATA	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.386G>C	11.37:g.43411338G>C	ENSP00000039989:p.Gly129Ala	Somatic	219.0	0.0		WXS	Illumina HiSeq	Phase_I	203.0	58.0	NM_018259	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.476333	0.84640	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.31510	1.49;1.49	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.45776	0.1359	L	0.51422	1.61	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.998	P;D;D	0.75020	0.792;0.985;0.948	T	0.27938	-1.0059	10	0.02654	T	1	-14.4097	18.713	0.91664	0.0:0.0:1.0:0.0	.	129;129;129	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	A	129	ENSP00000299240:G129A;ENSP00000039989:G129A	ENSP00000039989:G129A	G	+	2	0	TTC17	43367914	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.477000	0.83638	0.563000	0.77884	GGC	.		0.393	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
TPCN2	219931	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	68835002	68835002	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:68835002C>G	ENST00000294309.3	+	8	859	c.758C>G	c.(757-759)aCc>aGc	p.T253S	TPCN2_ENST00000442692.2_3'UTR|TPCN2_ENST00000542467.1_Missense_Mutation_p.T253S	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	253					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GAGAGGCTGACCTACTTCCAG	0.657																																					p.T253S		.											.	TPCN2	90	0			c.C758G						.						134.0	104.0	114.0					11																	68835002		2200	4294	6494	SO:0001583	missense	219931	exon8			GGCTGACCTACTT	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.758C>G	11.37:g.68835002C>G	ENSP00000294309:p.Thr253Ser	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	10.0	NM_139075	Q9NT82	Missense_Mutation	SNP	ENST00000294309.3	37	CCDS8189.1	.	.	.	.	.	.	.	.	.	.	c	6.762	0.509544	0.12883	.	.	ENSG00000162341	ENST00000356782;ENST00000294309;ENST00000535009;ENST00000542467	D;D	0.98531	-4.98;-4.98	4.97	-1.68	0.08212	Ion transport (1);	1.166550	0.05931	N	0.635100	D	0.93119	0.7809	N	0.22421	0.69	0.09310	N	1	P;B;B	0.40360	0.714;0.238;0.317	B;B;B	0.37550	0.253;0.186;0.164	D	0.90096	0.4181	10	0.10111	T	0.7	-14.4464	4.1192	0.10098	0.1654:0.3636:0.0:0.471	.	253;253;168	E7ETX0;Q8NHX9;F5H1G5	.;TPC2_HUMAN;.	S	183;253;168;253	ENSP00000294309:T253S;ENSP00000445551:T253S	ENSP00000294309:T253S	T	+	2	0	TPCN2	68591578	0.000000	0.05858	0.910000	0.35882	0.815000	0.46073	-0.007000	0.12810	0.002000	0.14630	0.643000	0.83706	ACC	.		0.657	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075	
UNC13C	440279	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	54590036	54590036	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:54590036C>A	ENST00000260323.11	+	11	4016	c.4016C>A	c.(4015-4017)tCt>tAt	p.S1339Y	UNC13C_ENST00000537900.1_Missense_Mutation_p.S1337Y|UNC13C_ENST00000545554.1_Missense_Mutation_p.S1339Y	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1339					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCAGCTGTATCTGGGGCCATA	0.363																																					p.S1339Y		.											.	UNC13C	51	0			c.C4016A						.						65.0	64.0	64.0					15																	54590036		1856	4087	5943	SO:0001583	missense	440279	exon10			CTGTATCTGGGGC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4016C>A	15.37:g.54590036C>A	ENSP00000260323:p.Ser1339Tyr	Somatic	341.0	0.0		WXS	Illumina HiSeq	Phase_I	307.0	104.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644585	0.87859	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.71579	-0.58;-0.58;-0.58	5.59	5.59	0.84812	C2 calcium/lipid-binding domain, CaLB (1);	0.113447	0.64402	D	0.000009	D	0.85927	0.5811	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.981;0.997	D	0.87560	0.2471	10	0.87932	D	0	.	18.5536	0.91075	0.0:1.0:0.0:0.0	.	1339;1339	F5H090;Q8NB66	.;UN13C_HUMAN	Y	1339;1339;1337	ENSP00000260323:S1339Y;ENSP00000438156:S1339Y;ENSP00000442569:S1337Y	ENSP00000260323:S1339Y	S	+	2	0	UNC13C	52377328	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	7.776000	0.85560	2.605000	0.88082	0.650000	0.86243	TCT	.		0.363	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
VAMP2	6844	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	8064968	8064968	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:8064968G>A	ENST00000316509.6	-	3	335	c.240C>T	c.(238-240)agC>agT	p.S80S	VAMP2_ENST00000488857.1_Silent_p.S82S|VAMP2_ENST00000481878.1_Silent_p.S80S|RP11-599B13.6_ENST00000498285.1_Silent_p.S80S|VAMP2_ENST00000404970.3_Silent_p.S35S	NM_014232.2	NP_055047.2	P63027	VAMP2_HUMAN	vesicle-associated membrane protein 2 (synaptobrevin 2)	80	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|exocytosis (GO:0006887)|glutamate secretion (GO:0014047)|membrane organization (GO:0061024)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	calcium-dependent protein binding (GO:0048306)|protein self-association (GO:0043621)									Botulinum Toxin Type B(DB00042)	GCTTGGCTGCGCTTGTTTCAA	0.567																																					p.S80S		.											.	VAMP2	90	0			c.C240T						.						129.0	123.0	125.0					17																	8064968		2203	4300	6503	SO:0001819	synonymous_variant	6844	exon3			GGCTGCGCTTGTT		CCDS32561.1	17p13.1	2013-09-19			ENSG00000220205	ENSG00000220205		"""Vesicle-associated membrane proteins"""	12643	protein-coding gene	gene with protein product		185881		SYB2		1976629	Standard	NM_014232		Approved	VAMP-2	uc010cnt.1	P63027	OTTHUMG00000150254	ENST00000316509.6:c.240C>T	17.37:g.8064968G>A		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	13.0	NM_014232	P19065|Q9BUC2	Silent	SNP	ENST00000316509.6	37	CCDS32561.1																																																																																			.		0.567	VAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317118.1		
WDR87	83889	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	38378513	38378513	+	Missense_Mutation	SNP	T	T	G	rs528496306		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:38378513T>G	ENST00000303868.5	-	6	5905	c.5681A>C	c.(5680-5682)aAg>aCg	p.K1894T	WDR87_ENST00000447313.2_Missense_Mutation_p.K1933T	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1894	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						CTGTGTCAGCTTCTCCTCTAC	0.398													T|||	1	0.000199681	0.0008	0.0	5008	,	,		20520	0.0		0.0	False		,,,				2504	0.0				p.K1894T		.											.	.	.	0			c.A5681C						.						198.0	142.0	159.0					19																	38378513		692	1591	2283	SO:0001583	missense	83889	exon6			GTCAGCTTCTCCT	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.5681A>C	19.37:g.38378513T>G	ENSP00000368025:p.Lys1894Thr	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	83.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	37	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	T	7.411	0.634647	0.14322	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.23552	1.9;1.9	5.26	-2.7	0.06004	.	.	.	.	.	T	0.10723	0.0262	N	0.19112	0.55	0.09310	N	1	B;B	0.29270	0.24;0.24	B;B	0.20384	0.029;0.029	T	0.25012	-1.0144	9	0.33940	T	0.23	.	1.1911	0.01865	0.243:0.1587:0.3738:0.2245	.	1894;1933	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	T	1933;1894	ENSP00000405012:K1933T;ENSP00000368025:K1894T	ENSP00000368025:K1894T	K	-	2	0	WDR87	43070353	0.000000	0.05858	0.006000	0.13384	0.015000	0.08874	-2.088000	0.01359	-0.194000	0.10399	0.519000	0.50382	AAG	.		0.398	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
XIRP2	129446	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168104144	168104144	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:168104144G>A	ENST00000409195.1	+	9	6331	c.6242G>A	c.(6241-6243)aGa>aAa	p.R2081K	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.R2081K|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.R1859K|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1906					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TATATGAGCAGACAATTAACT	0.373																																					p.R2081K		.											.	XIRP2	104	0			c.G6242A						.						63.0	57.0	59.0					2																	168104144		1910	4135	6045	SO:0001583	missense	129446	exon9			TGAGCAGACAATT	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6242G>A	2.37:g.168104144G>A	ENSP00000386840:p.Arg2081Lys	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	71.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	5.477	0.273026	0.10349	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.20332	2.08;2.08;2.08	5.92	0.254	0.15557	.	0.894418	0.09823	N	0.751235	T	0.08935	0.0221	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.37079	-0.9721	10	0.06099	T	0.92	-0.3941	9.7961	0.40735	0.5242:0.0:0.4758:0.0	.	1906;1906;1859	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	K	2081;2081;1859	ENSP00000386840:R2081K;ENSP00000295237:R2081K;ENSP00000387255:R1859K	ENSP00000295237:R2081K	R	+	2	0	XIRP2	167812390	0.002000	0.14202	0.004000	0.12327	0.180000	0.23129	0.460000	0.21924	-0.010000	0.14271	0.650000	0.86243	AGA	.		0.373	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
ZFP36	7538	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	39899237	39899239	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:39899237_39899239delCTC	ENST00000248673.3	+	2	937_939	c.879_881delCTC	c.(877-882)ggctct>ggt	p.S294del	MIR4530_ENST00000581459.1_RNA|ZFP36_ENST00000597629.1_In_Frame_Del_p.S300del	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	294					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCCTGGGGGGCTCTGACTCTCCC	0.645																																					p.299_300del	NSCLC(67;1164 1324 12056 21056 30097)	.											.	ZFP36	227	0			c.897_899del						.																																			SO:0001651	inframe_deletion	7538	exon2			GGGGGGCTCTGAC	M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.879_881delCTC	19.37:g.39899237_39899239delCTC	ENSP00000248673:p.Ser294del	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	21.0	NM_003407	B2RA54	In_Frame_Del	DEL	ENST00000248673.3	37																																																																																				.		0.645	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
ZFP28	140612	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57066068	57066068	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:57066068C>G	ENST00000301318.3	+	8	1985	c.1914C>G	c.(1912-1914)atC>atG	p.I638M	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	638					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		ATCAGAGAATCCATACTGGAG	0.458																																					p.I638M	Ovarian(124;554 1662 19430 21141 52494)	.											.	ZFP28	91	0			c.C1914G						.						82.0	88.0	86.0					19																	57066068		2203	4300	6503	SO:0001583	missense	140612	exon8			GAGAATCCATACT		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.1914C>G	19.37:g.57066068C>G	ENSP00000301318:p.Ile638Met	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	31.0	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	37	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.143204	0.37825	.	.	ENSG00000196867	ENST00000301318	T	0.08720	3.06	3.78	-2.03	0.07365	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41194	D	0.000929	T	0.18341	0.0440	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00175	-1.1955	10	0.59425	D	0.04	.	10.0715	0.42337	0.0:0.4499:0.0:0.5501	.	638	Q8NHY6	ZFP28_HUMAN	M	638	ENSP00000301318:I638M	ENSP00000301318:I638M	I	+	3	3	ZFP28	61757880	0.000000	0.05858	0.987000	0.45799	0.982000	0.71751	-2.749000	0.00793	-0.377000	0.07930	-0.391000	0.06502	ATC	.		0.458	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
ZNF24	7572	hgsc.bcm.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;ucsc.edu	37	18	32920511	32920512	+	Nonsense_Mutation	DNP	TC	TC	CA			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:32920511_32920512TC>CA	ENST00000261332.6	-	2	282_283	c.103_104GA>TG	c.(103-105)GAa>TGa	p.E35*	ZNF24_ENST00000399061.3_Nonsense_Mutation_p.E35*|ZNF24_ENST00000589881.1_Nonsense_Mutation_p.E35*	NM_006965.2	NP_008896.2	P17028	ZNF24_HUMAN	zinc finger protein 24	35					myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	15						TGATCCCTCTTCGCCATCAGGA	0.495																																					p.E35G|p.E35X	Colon(42;769 913 8916 19469 46270)	.											.	ZNF24	90	0			c.A104G|c.G103T						.																																			SO:0001587	stop_gained	7572	exon2			CCCTCTTCGCCAT|CCTCTTCGCCATC	AF016052	CCDS11912.1	18q12	2013-01-09	2006-05-10		ENSG00000172466	ENSG00000172466		"""-"", ""Zinc fingers, C2H2-type"""	13032	protein-coding gene	gene with protein product		194534	"""zinc finger protein 24 (KOX 17)"""	ZNF191			Standard	NM_006965		Approved	ZSCAN3, Zfp191, KOX17	uc002kys.2	P17028	OTTHUMG00000132565	ENST00000261332.6:c.103_104delinsCA	18.37:g.32920511_32920512delinsCA	ENSP00000261332:p.Glu35*	Somatic	46.0|45.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0|59.0	22.0|20.0	NM_006965	O14754|Q53YE4|Q6ICR5|Q8IZN4	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000261332.6	37	CCDS11912.1																																																																																			.		0.495	ZNF24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255769.1	NM_006965	
ZNF322	79692	hgsc.bcm.edu;bcgsc.ca	37	6	26638586	26638586	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:26638586T>C	ENST00000415922.2	-	4	841	c.196A>G	c.(196-198)Act>Gct	p.T66A	ZNF322_ENST00000471278.1_Missense_Mutation_p.T66A|RP11-457M11.2_ENST00000456172.1_RNA|ZNF322_ENST00000461899.1_5'Flank	NM_024639.4	NP_078915.2	Q6U7Q0	ZN322_HUMAN	zinc finger protein 322	66					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTCTCCCCAGTATGGGTTCTC	0.383																																					p.T66A		.											.	.	.	0			c.A196G						.						157.0	143.0	148.0					6																	26638586		2202	4298	6500	SO:0001583	missense	79692	exon5			CCCCAGTATGGGT	AY376736	CCDS4617.1	6p22.1	2013-01-08	2011-07-29	2011-07-29	ENSG00000181315	ENSG00000181315		"""Zinc fingers, C2H2-type"""	23640	protein-coding gene	gene with protein product		610847	"""zinc finger protein 489"", ""HLA complex group 12"", ""zinc finger protein 322A"""	ZNF489, ZNF388, HCG12, ZNF322A		15555580	Standard	NM_024639		Approved	bA457M11.3, bA457M11.2	uc021yny.1	Q6U7Q0	OTTHUMG00000014460	ENST00000415922.2:c.196A>G	6.37:g.26638586T>C	ENSP00000418897:p.Thr66Ala	Somatic	396.0	0.0		WXS	Illumina HiSeq	Phase_I	397.0	92.0	NM_001242797	A8K1X3|Q0VDH6|Q6B0G2|Q86W72|Q9H5I9	Missense_Mutation	SNP	ENST00000415922.2	37	CCDS4617.1	.	.	.	.	.	.	.	.	.	.	t	10.88	1.476530	0.26511	.	.	ENSG00000181315	ENST00000415922;ENST00000471278	T;T	0.26518	1.73;1.73	4.75	0.888	0.19206	.	0.150080	0.31279	N	0.007940	T	0.06416	0.0165	L	0.38692	1.165	0.31393	N	0.67759	B	0.02656	0.0	B	0.08055	0.003	T	0.16247	-1.0409	10	0.87932	D	0	-5.0444	4.1573	0.10266	0.1514:0.1746:0.0:0.674	.	66	Q6U7Q0	ZN322_HUMAN	A	66	ENSP00000418897:T66A;ENSP00000419728:T66A	ENSP00000418897:T66A	T	-	1	0	ZNF322	26746565	0.003000	0.15002	0.193000	0.23327	0.885000	0.51271	0.400000	0.20932	0.068000	0.16574	0.533000	0.62120	ACT	.		0.383	ZNF322-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040126.2	NM_024639	
ZNF394	84124	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	99091412	99091412	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:99091412T>C	ENST00000337673.6	-	3	1629	c.1426A>G	c.(1426-1428)Aag>Gag	p.K476E	ZNF394_ENST00000394177.3_5'Flank|ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000493485.1_Intron|ZNF394_ENST00000426306.2_3'UTR	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	476					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TTGAAGCTCTTCTCGCATTCT	0.453																																					p.K476E	Ovarian(24;589 697 9939 12704 40742)	.											.	ZNF394	90	0			c.A1426G						.						120.0	116.0	117.0					7																	99091412		2203	4300	6503	SO:0001583	missense	84124	exon3			AGCTCTTCTCGCA	BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.1426A>G	7.37:g.99091412T>C	ENSP00000337363:p.Lys476Glu	Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	222.0	69.0	NM_032164	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	ENST00000337673.6	37	CCDS5666.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.028863	0.75504	.	.	ENSG00000160908	ENST00000337673	T	0.07567	3.18	3.58	3.58	0.41010	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000085	T	0.26340	0.0643	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.01371	-1.1372	10	0.54805	T	0.06	.	10.7684	0.46308	0.0:0.0:0.0:1.0	.	476	Q53GI3	ZN394_HUMAN	E	476	ENSP00000337363:K476E	ENSP00000337363:K476E	K	-	1	0	ZNF394	98929348	0.916000	0.31088	0.963000	0.40424	0.817000	0.46193	3.134000	0.50538	1.858000	0.53909	0.533000	0.62120	AAG	.		0.453	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336498.1	NM_032164	
ZNF395	55893	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	28210089	28210089	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:28210089C>T	ENST00000344423.5	-	6	1052		c.e6+1		ZNF395_ENST00000523202.1_Splice_Site|ZNF395_ENST00000523095.1_Splice_Site	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		CTCGCACATACCCCAGATGGA	0.587																																					.		.											.	ZNF395	90	0			c.920+1G>A						.						126.0	109.0	115.0					8																	28210089		2203	4300	6503	SO:0001630	splice_region_variant	55893	exon7			CACATACCCCAGA	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.920+1G>A	8.37:g.28210089C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	30.0	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Splice_Site	SNP	ENST00000344423.5	37	CCDS6067.1	.	.	.	.	.	.	.	.	.	.	C	19.38	3.815622	0.70912	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4092	0.83701	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF395	28266008	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	7.608000	0.82898	2.466000	0.83321	0.561000	0.74099	.	.		0.587	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		Intron
