#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABR	29	ucsc.edu;bcgsc.ca	37	17	915220	915220	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr17:915220T>C	ENST00000302538.5	-	19	2113	c.1967A>G	c.(1966-1968)gAg>gGg	p.E656G	ABR_ENST00000544583.2_Missense_Mutation_p.E610G|ABR_ENST00000291107.2_Missense_Mutation_p.E619G|ABR_ENST00000572441.1_Missense_Mutation_p.E107G|ABR_ENST00000574437.1_Missense_Mutation_p.E610G|ABR_ENST00000536794.2_Missense_Mutation_p.E438G|ABR_ENST00000543210.2_Missense_Mutation_p.E107G	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	656	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CTTGGAGCGCTCCCGCCTGGG	0.647																																					p.E656G	Esophageal Squamous(197;2016 2115 4129 29033 46447)	.											.	ABR	91	0			c.A1967G						.						134.0	106.0	116.0					17																	915220		2203	4300	6503	SO:0001583	missense	29	exon19			GAGCGCTCCCGCC	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1967A>G	17.37:g.915220T>C	ENSP00000303909:p.Glu656Gly	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	23.0	4.0	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	ENST00000302538.5	37	CCDS10999.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.969890	0.74246	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794;ENST00000543210	T;T;T;T;T	0.12255	2.7;2.7;2.7;2.7;2.7	5.97	5.97	0.96955	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.117444	0.56097	D	0.000025	T	0.41743	0.1172	M	0.82630	2.6	0.50813	D	0.999892	B;D;D;B;B	0.61080	0.044;0.989;0.989;0.092;0.024	B;D;D;B;B	0.72982	0.039;0.969;0.979;0.078;0.027	T	0.39623	-0.9605	10	0.87932	D	0	.	15.3263	0.74164	0.0:0.0:0.0:1.0	.	438;107;619;566;656	B7Z683;F5H3S2;Q12979-2;B7Z2X0;Q12979	.;.;.;.;ABR_HUMAN	G	656;610;619;438;107	ENSP00000303909:E656G;ENSP00000442048:E610G;ENSP00000291107:E619G;ENSP00000437429:E438G;ENSP00000445198:E107G	ENSP00000291107:E619G	E	-	2	0	ABR	861970	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	2.299000	0.77371	0.524000	0.50904	GAG	.		0.647	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
AP5M1	55745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	57741433	57741433	+	Silent	SNP	T	T	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr14:57741433T>C	ENST00000261558.3	+	2	952	c.546T>C	c.(544-546)gaT>gaC	p.D182D	AP5M1_ENST00000431972.2_Silent_p.D196D	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	182					endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											ATTCATTAGATAATACCAATT	0.398																																					p.D182D		.											.	.	.	0			c.T546C						.						59.0	62.0	61.0					14																	57741433		2203	4299	6502	SO:0001819	synonymous_variant	55745	exon2			ATTAGATAATACC	AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.546T>C	14.37:g.57741433T>C		Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	45.0	NM_018229	O95354|Q6ZMD7|Q96DX3|Q9NVC5	Silent	SNP	ENST00000261558.3	37	CCDS9729.1																																																																																			.		0.398	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276922.1	NM_018229	
ATF6	22926	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161823113	161823113	+	Splice_Site	SNP	G	G	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:161823113G>T	ENST00000367942.3	+	12	1600	c.1533G>T	c.(1531-1533)caG>caT	p.Q511H	ATF6_ENST00000476437.1_3'UTR	NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	511	Interaction with THBS4.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	GTATTCTTCAGGTATGTTTCT	0.403																																					p.Q511H		.											.	ATF6	93	0			c.G1533T						.						66.0	69.0	68.0					1																	161823113		2203	4300	6503	SO:0001630	splice_region_variant	22926	exon12			TCTTCAGGTATGT	AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.1533+1G>T	1.37:g.161823113G>T		Somatic	67.0	1.0		WXS	Illumina HiSeq	Phase_I	87.0	17.0	NM_007348	O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	ENST00000367942.3	37	CCDS1235.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.823381	0.71143	.	.	ENSG00000118217	ENST00000367942	T	0.16073	2.37	5.41	5.41	0.78517	.	0.049759	0.85682	D	0.000000	T	0.30386	0.0763	M	0.75777	2.31	.	.	.	D;D	0.76494	0.999;0.998	P;P	0.62014	0.897;0.87	T	0.04281	-1.0963	9	0.66056	D	0.02	-9.3015	14.5643	0.68165	0.0:0.0:1.0:0.0	.	511;512	P18850;Q59H30	ATF6A_HUMAN;.	H	511	ENSP00000356919:Q511H	ENSP00000356919:Q511H	Q	+	3	2	ATF6	160089737	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.460000	0.73518	2.808000	0.96608	0.655000	0.94253	CAG	.		0.403	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2	NM_007348	Missense_Mutation
BEST3	144453	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	70049144	70049144	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr12:70049144delC	ENST00000330891.5	-	10	1776	c.1550delG	c.(1549-1551)ggcfs	p.G517fs	BEST3_ENST00000553096.1_Frame_Shift_Del_p.G411fs|BEST3_ENST00000331471.4_Intron|BEST3_ENST00000488961.1_Frame_Shift_Del_p.G304fs	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	517					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			ATGGTGGTAGCCCCCTGATGT	0.562																																					p.G517fs		.											.	BEST3	248	0			c.1550delG						.						137.0	136.0	136.0					12																	70049144		2070	4207	6277	SO:0001589	frameshift_variant	144453	exon10			TGGTAGCCCCCTG	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1550delG	12.37:g.70049144delC	ENSP00000332413:p.Gly517fs	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	28.0	NM_032735	B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Frame_Shift_Del	DEL	ENST00000330891.5	37	CCDS8992.2																																																																																			.		0.562	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439	
C17orf104	284071	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	42744727	42744728	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr17:42744727_42744728insA	ENST00000409122.2	+	5	1590_1591	c.1448_1449insA	c.(1447-1452)acaaaafs	p.TK483fs	C17orf104_ENST00000409464.1_Frame_Shift_Ins_p.TK317fs|C17orf104_ENST00000359945.3_Frame_Shift_Ins_p.TK483fs	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	483										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						AATGTTCAAACAAAAAATAACA	0.312																																					p.T483fs		.											.	C17orf104	22	0			c.1448_1449insA						.																																			SO:0001589	frameshift_variant	284071	exon5			TTCAAACAAAAAA		CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.1454dupA	17.37:g.42744733_42744733dupA	ENSP00000386452:p.Thr483fs	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	34.0	NM_001145080	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Frame_Shift_Ins	INS	ENST00000409122.2	37	CCDS45703.2																																																																																			.		0.312	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329171.2	NM_001145080	
C1orf21	81563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	184446676	184446676	+	Silent	SNP	T	T	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:184446676T>A	ENST00000235307.6	+	2	468	c.33T>A	c.(31-33)acT>acA	p.T11T		NM_030806.3	NP_110433.1	Q9H246	CA021_HUMAN	chromosome 1 open reading frame 21	11										breast(1)|lung(1)	2		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)		ATGTTGCCACTGTTCAAAATG	0.478																																					p.T11T		.											.	C1orf21	90	0			c.T33A						.						85.0	76.0	79.0					1																	184446676		2203	4300	6503	SO:0001819	synonymous_variant	81563	exon2			TGCCACTGTTCAA	AF312864	CCDS1362.1	1q25	2008-07-18			ENSG00000116667	ENSG00000116667			15494	protein-coding gene	gene with protein product	"""proliferation-inducing protein 13"""					11318611	Standard	NM_030806		Approved	PIG13	uc001gqv.1	Q9H246	OTTHUMG00000035386	ENST00000235307.6:c.33T>A	1.37:g.184446676T>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	48.0	NM_030806	B2R551	Silent	SNP	ENST00000235307.6	37	CCDS1362.1																																																																																			.		0.478	C1orf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085784.2	NM_030806	
CAPZA3	93661	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	18892064	18892064	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr12:18892064A>G	ENST00000317658.3	+	1	1020	c.862A>G	c.(862-864)Att>Gtt	p.I288V	PLCZ1_ENST00000435379.1_5'Flank|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000539875.1_5'Flank|PLCZ1_ENST00000447925.2_5'Flank|PLCZ1_ENST00000266505.7_5'Flank	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3	288					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				AGGATATGTCATTTATTCAAG	0.373																																					p.I288V		.											.	CAPZA3	91	0			c.A862G						.						53.0	55.0	54.0					12																	18892064		2185	4242	6427	SO:0001583	missense	93661	exon1			TATGTCATTTATT	AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001	ENST00000317658.3:c.862A>G	12.37:g.18892064A>G	ENSP00000326238:p.Ile288Val	Somatic	99.0	1.0		WXS	Illumina HiSeq	Phase_I	86.0	36.0	NM_033328	Q969J0	Missense_Mutation	SNP	ENST00000317658.3	37	CCDS8681.1	.	.	.	.	.	.	.	.	.	.	A	10.41	1.343832	0.24339	.	.	ENSG00000177938	ENST00000317658	.	.	.	4.54	3.38	0.38709	.	0.236066	0.31092	U	0.008261	T	0.16938	0.0407	N	0.08118	0	0.24644	N	0.99356	B	0.02656	0.0	B	0.01281	0.0	T	0.14172	-1.0482	9	0.87932	D	0	-10.4796	4.8011	0.13298	0.7123:0.1887:0.099:0.0	.	288	Q96KX2	CAZA3_HUMAN	V	288	.	ENSP00000326238:I288V	I	+	1	0	CAPZA3	18783331	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.462000	0.35266	0.770000	0.33336	0.379000	0.24179	ATT	.		0.373	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401902.1	NM_033328	
CATSPERG	57828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38855544	38855544	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr19:38855544A>T	ENST00000409235.3	+	21	2604	c.2489A>T	c.(2488-2490)gAt>gTt	p.D830V	AC005625.1_ENST00000590304.1_RNA|CATSPERG_ENST00000410018.1_Missense_Mutation_p.D790V|CATSPERG_ENST00000215069.4_3'UTR	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	830					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						ACGCTCAAGGATAAAAAGCTT	0.498																																					p.D830V		.											.	CATSPERG	92	0			c.A2489T						.						110.0	107.0	108.0					19																	38855544		2203	4300	6503	SO:0001583	missense	57828	exon21			TCAAGGATAAAAA	AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.2489A>T	19.37:g.38855544A>T	ENSP00000386962:p.Asp830Val	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	17.0	NM_021185	A6NEG6|Q659E1	Missense_Mutation	SNP	ENST00000409235.3	37	CCDS12514.2	.	.	.	.	.	.	.	.	.	.	A	16.77	3.214251	0.58452	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410	T;T	0.39056	1.1;1.1	4.5	4.5	0.54988	.	0.106098	0.40908	D	0.000983	T	0.60612	0.2282	M	0.71581	2.175	0.50813	D	0.999893	D;D	0.89917	1.0;1.0	D;D	0.91635	0.985;0.999	T	0.64054	-0.6497	10	0.72032	D	0.01	-22.5564	10.1172	0.42598	1.0:0.0:0.0:0.0	.	830;790	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	V	790;830;830	ENSP00000387057:D790V;ENSP00000386962:D830V	ENSP00000386962:D830V	D	+	2	0	CATSPERG	43547384	0.972000	0.33761	0.039000	0.18376	0.408000	0.30992	4.007000	0.57093	1.897000	0.54924	0.459000	0.35465	GAT	.		0.498	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330204.1	NM_021185	
CCDC73	493860	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	32635624	32635625	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr11:32635624_32635625insT	ENST00000335185.5	-	16	2282_2283	c.2239_2240insA	c.(2239-2241)actfs	p.T747fs	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	747										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					TTTACACATAGTTTTTCCCCCA	0.332																																					p.E747fs		.											.	CCDC73	91	0			c.2240_2241insA						.																																			SO:0001589	frameshift_variant	493860	exon16			CACATAGTTTTTC	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.2240dupA	11.37:g.32635629_32635629dupT	ENSP00000335325:p.Thr747fs	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	20.0	NM_001008391	Q6P5Q7|Q6ZMW0|Q86WE7	Frame_Shift_Ins	INS	ENST00000335185.5	37	CCDS41630.1																																																																																			.		0.332	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179965731	179965731	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:179965731G>A	ENST00000367607.3	+	6	857	c.439G>A	c.(439-441)Gaa>Aaa	p.E147K		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	147					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CAGCCATCTGGAATCAAAGCA	0.378																																					p.E147K		.											.	CEP350	26	0			c.G439A						.						41.0	39.0	39.0					1																	179965731		2202	4300	6502	SO:0001583	missense	9857	exon6			CATCTGGAATCAA	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.439G>A	1.37:g.179965731G>A	ENSP00000356579:p.Glu147Lys	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	82.0	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423465	0.62733	.	.	ENSG00000135837	ENST00000367607;ENST00000491495	T;T	0.57595	0.39;0.99	5.1	5.1	0.69264	.	0.140761	0.31897	N	0.006888	T	0.51787	0.1695	L	0.27053	0.805	0.54753	D	0.999983	B;B;P	0.50272	0.361;0.361;0.933	B;B;P	0.51101	0.039;0.086;0.659	T	0.45891	-0.9230	9	.	.	.	.	18.4523	0.90709	0.0:0.0:1.0:0.0	.	147;147;121	E7EU22;Q5VT06;E9PIK0	.;CE350_HUMAN;.	K	147;121	ENSP00000356579:E147K;ENSP00000435808:E121K	.	E	+	1	0	CEP350	178232354	1.000000	0.71417	0.998000	0.56505	0.629000	0.37895	7.113000	0.77095	2.526000	0.85167	0.579000	0.79373	GAA	.		0.378	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	180003175	180003175	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:180003175G>A	ENST00000367607.3	+	16	4322	c.3904G>A	c.(3904-3906)Gca>Aca	p.A1302T		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1302					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TCTGAACCCGGCAGCCAGCAG	0.403																																					p.A1302T		.											.	CEP350	26	0			c.G3904A						.						79.0	74.0	76.0					1																	180003175		2203	4300	6503	SO:0001583	missense	9857	exon16			AACCCGGCAGCCA	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3904G>A	1.37:g.180003175G>A	ENSP00000356579:p.Ala1302Thr	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	249.0	160.0	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902788	0.33628	.	.	ENSG00000135837	ENST00000367607	T	0.56611	0.45	5.44	1.18	0.20946	.	0.635955	0.13753	N	0.365101	T	0.33177	0.0854	L	0.27053	0.805	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.04013	0.001;0.001	T	0.18209	-1.0344	9	.	.	.	.	5.8265	0.18556	0.1741:0.2957:0.5302:0.0	.	1302;1302	E7EU22;Q5VT06	.;CE350_HUMAN	T	1302	ENSP00000356579:A1302T	.	A	+	1	0	CEP350	178269798	0.465000	0.25815	0.002000	0.10522	0.090000	0.18270	0.635000	0.24629	-0.042000	0.13535	0.563000	0.77884	GCA	.		0.403	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
COLEC10	10584	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	120118098	120118103	+	In_Frame_Del	DEL	AACTAC	AACTAC	-	rs57284713		TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	AACTAC	AACTAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr8:120118098_120118103delAACTAC	ENST00000332843.2	+	6	543_548	c.502_507delAACTAC	c.(502-507)aactacdel	p.NY168del		NM_006438.3	NP_006429.2	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 (C-type lectin)	168	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	mannose binding (GO:0005537)			endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			GGAAGAGAAGAACTACAGGGAATCCC	0.471																																					p.168_169del		.											.	COLEC10	229	0			c.502_507del						.																																			SO:0001651	inframe_deletion	10584	exon6			GAGAAGAACTACA	AB002631	CCDS6327.1	8q23-q24.1	2007-12-19				ENSG00000184374		"""Collectins"""	2220	protein-coding gene	gene with protein product		607620				10224141	Standard	NM_006438		Approved	CL-L1	uc003yoo.3	Q9Y6Z7		ENST00000332843.2:c.502_507delAACTAC	8.37:g.120118098_120118103delAACTAC	ENSP00000332723:p.Asn168_Tyr169del	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	256.0	17.0	NM_006438	Q3SYH6|Q6UW19	In_Frame_Del	DEL	ENST00000332843.2	37	CCDS6327.1																																																																																			.		0.471	COLEC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381225.1		
CORO1C	23603	broad.mit.edu;bcgsc.ca	37	12	109095009	109095009	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr12:109095009A>G	ENST00000261401.3	-	2	258	c.86T>C	c.(85-87)gTt>gCt	p.V29A	CORO1C_ENST00000541050.1_Missense_Mutation_p.V29A|CORO1C_ENST00000549384.1_Intron|CORO1C_ENST00000549772.1_Missense_Mutation_p.V35A|CORO1C_ENST00000420959.2_Missense_Mutation_p.V82A	NM_001105237.2|NM_001276471.1|NM_014325.2	NP_001098707.1|NP_001263400.1|NP_055140.1	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C	29					actin cytoskeleton organization (GO:0030036)|phagocytosis (GO:0006909)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|skin(4)	24						CACACGAGAAACCCGGATGTC	0.502																																					p.V29A		.											.	CORO1C	228	0			c.T86C						.						172.0	140.0	151.0					12																	109095009		2203	4300	6503	SO:0001583	missense	23603	exon2			CGAGAAACCCGGA	BC002342	CCDS9120.1, CCDS61236.1	12q24.1	2013-01-10	2001-11-28			ENSG00000110880		"""Coronins"", ""WD repeat domain containing"""	2254	protein-coding gene	gene with protein product		605269	"""coronin, actin-binding protein, 1C"""			9778037, 10461187	Standard	NM_014325		Approved	coronin-3, HCRNN4	uc009zva.4	Q9ULV4		ENST00000261401.3:c.86T>C	12.37:g.109095009A>G	ENSP00000261401:p.Val29Ala	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	5.0	NM_014325	A7MAP0|A7MAP1|B3KU12|Q9NSK5	Missense_Mutation	SNP	ENST00000261401.3	37	CCDS9120.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.605647	0.87157	.	.	ENSG00000110880	ENST00000261401;ENST00000541050;ENST00000549772;ENST00000420959;ENST00000547294;ENST00000550032;ENST00000551550;ENST00000546571;ENST00000551044	T;T;T;T;T;T;T;T;T	0.80033	-0.29;-0.29;-0.23;-0.37;-0.54;-0.17;-0.75;-0.92;-1.33	5.37	4.23	0.50019	WD40/YVTN repeat-like-containing domain (1);Domain of unknown function DUF1899 (1);	0.000000	0.85682	D	0.000000	D	0.90597	0.7052	M	0.92026	3.265	0.80722	D	1	D;D;D	0.71674	0.998;0.983;0.966	D;D;D	0.75484	0.986;0.977;0.977	D	0.91102	0.4915	10	0.87932	D	0	-12.7375	10.8681	0.46866	0.9262:0.0:0.0738:0.0	.	29;82;29	B4DMH3;A7MAP1;Q9ULV4	.;.;COR1C_HUMAN	A	29;29;35;82;29;29;29;29;29	ENSP00000261401:V29A;ENSP00000438341:V29A;ENSP00000447534:V35A;ENSP00000394496:V82A;ENSP00000449330:V29A;ENSP00000447989:V29A;ENSP00000448527:V29A;ENSP00000448195:V29A;ENSP00000447049:V29A	ENSP00000261401:V29A	V	-	2	0	CORO1C	107619138	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	8.910000	0.92685	0.875000	0.35847	0.482000	0.46254	GTT	.		0.502	CORO1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403802.1	NM_014325	
CWC27	10283	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	64314004	64314005	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr5:64314004_64314005insTT	ENST00000381070.3	+	14	1492_1493	c.1275_1276insTT	c.(1276-1278)tttfs	p.F426fs	RP11-307L14.1_ENST00000607786.1_lincRNA|CWC27_ENST00000545000.1_3'UTR|RP11-307L14.2_ENST00000606057.1_lincRNA	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	426					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						ATGTACTTCAGTTTGAGGATAA	0.376																																					p.Q425fs		.											.	CWC27	90	0			c.1275_1276insTT						.																																			SO:0001589	frameshift_variant	10283	exon14			ACTTCAGTTTGAG	AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.1276_1277dupTT	5.37:g.64314005_64314006dupTT	ENSP00000370460:p.Phe426fs	Somatic	202.0	0.0		WXS	Illumina HiSeq	Phase_I	262.0	145.0	NM_005869	O60529|O60530|Q96EM3	Frame_Shift_Ins	INS	ENST00000381070.3	37	CCDS3982.2																																																																																			.		0.376	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157247.4	NM_005869	
DGKG	1608	ucsc.edu;mdanderson.org	37	3	186006618	186006618	+	Missense_Mutation	SNP	C	C	A	rs1004588	byFrequency	TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr3:186006618C>A	ENST00000265022.3	-	6	964	c.425G>T	c.(424-426)aGc>aTc	p.S142I	DGKG_ENST00000382164.4_Missense_Mutation_p.S142I|DGKG_ENST00000344484.4_Missense_Mutation_p.S142I|DGKG_ENST00000544847.1_Missense_Mutation_p.S142I	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	142			T -> S (in dbSNP:rs1004588). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TTCCAGGGGGGTCGCAGCCAC	0.522																																					p.T142I		.											.	DGKG	714	0			c.C425T						.						123.0	137.0	132.0					3																	186006618		2203	4300	6503	SO:0001583	missense	1608	exon6			AGGGGGGTCGCAG	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.425G>T	3.37:g.186006618C>A	ENSP00000265022:p.Ser142Ile	Somatic	132.0	0.0		WXS	Illumina HiSeq	.	94.0	34.0	NM_001346	B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	ENST00000265022.3	37	CCDS3274.1																																																																																			C|0.491;G|0.509		0.522	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
DHODH	1723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	72058091	72058091	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr16:72058091G>C	ENST00000219240.4	+	9	1202	c.1181G>C	c.(1180-1182)cGg>cCg	p.R394P	DHODH_ENST00000572887.1_Missense_Mutation_p.R392P	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)	394					'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	GCAGATCATCGGAGGTGAGGA	0.537																																					p.R394P		.											.	DHODH	227	0			c.G1181C						.						117.0	125.0	122.0					16																	72058091		2163	4285	6448	SO:0001583	missense	1723	exon9			ATCATCGGAGGTG		CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.1181G>C	16.37:g.72058091G>C	ENSP00000219240:p.Arg394Pro	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	53.0	NM_001361	A8K8C8|Q6P176	Missense_Mutation	SNP	ENST00000219240.4	37	CCDS42192.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.533341	0.64972	.	.	ENSG00000102967	ENST00000219240	D	0.94232	-3.38	5.0	0.941	0.19519	Aldolase-type TIM barrel (1);	0.255981	0.43747	D	0.000526	D	0.91216	0.7232	L	0.56340	1.77	0.48632	D	0.999684	P	0.49253	0.921	P	0.48227	0.571	D	0.87868	0.2669	10	0.87932	D	0	-5.4628	7.4792	0.27395	0.3389:0.0:0.6611:0.0	.	394	Q02127	PYRD_HUMAN	P	394	ENSP00000219240:R394P	ENSP00000219240:R394P	R	+	2	0	DHODH	70615592	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	1.526000	0.35964	0.056000	0.16144	-0.258000	0.10820	CGG	.		0.537	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001361	
DMXL1	1657	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	118484603	118484603	+	Silent	SNP	A	A	G			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr5:118484603A>G	ENST00000311085.8	+	18	3161	c.3081A>G	c.(3079-3081)ccA>ccG	p.P1027P	DMXL1_ENST00000539542.1_Silent_p.P1027P	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1027										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AAGAATGGCCATTACTTATTG	0.393																																					p.P1027P		.											.	DMXL1	92	0			c.A3081G						.						145.0	136.0	139.0					5																	118484603		2202	4300	6502	SO:0001819	synonymous_variant	1657	exon18			ATGGCCATTACTT	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.3081A>G	5.37:g.118484603A>G		Somatic	220.0	1.0		WXS	Illumina HiSeq	Phase_I	257.0	68.0	NM_005509		Silent	SNP	ENST00000311085.8	37	CCDS4125.1																																																																																			.		0.393	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38747842	38747842	+	Splice_Site	SNP	G	G	T	rs376576474		TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr6:38747842G>T	ENST00000359357.3	+	13	1742		c.e13+1		DNAH8_ENST00000441566.1_Splice_Site|DNAH8_ENST00000449981.2_Splice_Site			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TACTAAGAAGGCAAGTGTCAT	0.353																																					.		.											.	DNAH8	615	0			c.2139+1G>T						.						100.0	94.0	96.0					6																	38747842		2203	4300	6503	SO:0001630	splice_region_variant	1769	exon15			AAGAAGGCAAGTG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1488+1G>T	6.37:g.38747842G>T		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	21.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Splice_Site	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	16.43	3.120370	0.56613	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7715	0.88494	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH8	38855820	1.000000	0.71417	0.991000	0.47740	0.529000	0.34654	7.580000	0.82523	2.720000	0.93068	0.591000	0.81541	.	.		0.353	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	Intron
DNASE2B	58511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	84864291	84864291	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:84864291C>A	ENST00000370665.3	+	1	77	c.44C>A	c.(43-45)gCt>gAt	p.A15D		NM_021233.2	NP_067056.2	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta	15					apoptotic DNA fragmentation (GO:0006309)	extracellular region (GO:0005576)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)			endometrium(1)|lung(4)|skin(1)	6				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		ACATCCTTTGCTTTGCTCTTC	0.443																																					p.A15D	Pancreas(54;788 1175 11852 16034 30034)	.											.	DNASE2B	90	0			c.C44A						.						226.0	232.0	230.0					1																	84864291		2009	4179	6188	SO:0001583	missense	58511	exon1			CCTTTGCTTTGCT	AF274571	CCDS694.1, CCDS44167.1	1p22.3	2008-02-05			ENSG00000137976	ENSG00000137976			28875	protein-coding gene	gene with protein product		608057				12594037, 11376952	Standard	NM_021233		Approved	DLAD	uc001djt.1	Q8WZ79	OTTHUMG00000009860	ENST00000370665.3:c.44C>A	1.37:g.84864291C>A	ENSP00000359699:p.Ala15Asp	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	40.0	NM_021233	Q5VXD0|Q5VXD1|Q8WZ80|Q9NQW3	Missense_Mutation	SNP	ENST00000370665.3	37	CCDS44167.1	.	.	.	.	.	.	.	.	.	.	C	0.370	-0.934652	0.02340	.	.	ENSG00000137976	ENST00000370665	T	0.12255	2.7	5.23	2.37	0.29283	.	1.288080	0.04783	N	0.430212	T	0.03305	0.0096	L	0.36672	1.1	0.19775	N	0.999953	B	0.27498	0.18	B	0.27076	0.076	T	0.43909	-0.9362	10	0.12766	T	0.61	0.1643	7.2221	0.25994	0.0:0.7282:0.0:0.2718	.	15	Q8WZ79	DNS2B_HUMAN	D	15	ENSP00000359699:A15D	ENSP00000359699:A15D	A	+	2	0	DNASE2B	84636879	0.093000	0.21703	0.056000	0.19401	0.009000	0.06853	0.221000	0.17680	0.459000	0.27016	-0.137000	0.14449	GCT	.		0.443	DNASE2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027248.1	NM_021233	
DOC2A	8448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30018527	30018527	+	Silent	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr16:30018527C>T	ENST00000350119.4	-	6	811	c.621G>A	c.(619-621)aaG>aaA	p.K207K	DOC2A_ENST00000564944.1_Silent_p.K207K|DOC2A_ENST00000564979.1_Silent_p.K207K	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	207					nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						TGTTAAAATGCTTCTTCTGCG	0.632																																					p.K207K		.											.	DOC2A	92	0			c.G621A						.						47.0	48.0	47.0					16																	30018527		2197	4300	6497	SO:0001819	synonymous_variant	8448	exon6			AAAATGCTTCTTC	D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.621G>A	16.37:g.30018527C>T		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	23.0	NM_003586	B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Silent	SNP	ENST00000350119.4	37	CCDS10666.1																																																																																			.		0.632	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255148.2	NM_003586	
DOCK10	55619	broad.mit.edu;bcgsc.ca	37	2	225670909	225670909	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr2:225670909T>C	ENST00000258390.7	-	34	3815	c.3748A>G	c.(3748-3750)Aca>Gca	p.T1250A	DOCK10_ENST00000409592.3_Missense_Mutation_p.T1244A	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1250					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TTGATAGCTGTCTGGCTTTGA	0.343																																					p.T1250A		.											.	DOCK10	92	0			c.A3748G						.						145.0	145.0	145.0					2																	225670909		1863	4087	5950	SO:0001583	missense	55619	exon34			TAGCTGTCTGGCT	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.3748A>G	2.37:g.225670909T>C	ENSP00000258390:p.Thr1250Ala	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	6.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	T	10.99	1.508166	0.27036	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.22134	1.97;1.97	5.96	3.31	0.37934	.	0.336949	0.32093	N	0.006582	T	0.14313	0.0346	L	0.38838	1.175	0.30330	N	0.786703	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.09143	-1.0688	10	0.30078	T	0.28	.	6.7088	0.23266	0.4307:0.0772:0.0:0.4921	.	1250;113;1244	Q96BY6;B4DF07;B3FL70	DOC10_HUMAN;.;.	A	1244;1250	ENSP00000386694:T1244A;ENSP00000258390:T1250A	ENSP00000258390:T1250A	T	-	1	0	DOCK10	225379153	1.000000	0.71417	0.996000	0.52242	0.814000	0.46013	1.000000	0.29770	1.071000	0.40834	0.533000	0.62120	ACA	.		0.343	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
DYNLL2	140735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56166589	56166589	+	Silent	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr17:56166589C>T	ENST00000579991.2	+	3	497	c.219C>T	c.(217-219)ttC>ttT	p.F73F		NM_080677.2	NP_542408.1	Q96FJ2	DYL2_HUMAN	dynein, light chain, LC8-type 2	73					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|microtubule-based process (GO:0007017)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|synaptic target recognition (GO:0008039)|transport (GO:0006810)	centrosome (GO:0005813)|cytosol (GO:0005829)|dynein complex (GO:0030286)|membrane (GO:0016020)|microtubule (GO:0005874)|myosin complex (GO:0016459)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	motor activity (GO:0003774)			lung(3)	3						CAAAGCACTTCATCTATTTTT	0.478																																					p.F73F		.											.	DYNLL2	90	0			c.C219T						.						163.0	182.0	175.0					17																	56166589		2203	4300	6503	SO:0001819	synonymous_variant	140735	exon3			GCACTTCATCTAT	AF112997	CCDS11601.1	17q23.2	2009-11-18				ENSG00000264364		"""Cytoplasmic dyneins"""	24596	protein-coding gene	gene with protein product	"""radial spoke 22 homolog (Chlamydomonas)"""	608942				16260502	Standard	NM_080677		Approved	MGC17810, Dlc2, DNCL1B, RSPH22	uc010wnn.1	Q96FJ2		ENST00000579991.2:c.219C>T	17.37:g.56166589C>T		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	27.0	NM_080677	B2R5B4	Silent	SNP	ENST00000579991.2	37	CCDS11601.1																																																																																			.		0.478	DYNLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443338.2	NM_080677	
ELF4	2000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	129200820	129200820	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chrX:129200820G>T	ENST00000308167.5	-	9	2247	c.1868C>A	c.(1867-1869)tCc>tAc	p.S623Y	ELF4_ENST00000335997.7_Missense_Mutation_p.S623Y	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CATCAGCAGGGACCCTGAGCC	0.592			T	ERG	AML																																p.S623Y		.		Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	.	ELF4	659	0			c.C1868A						.						79.0	88.0	85.0					X																	129200820		2203	4300	6503	SO:0001583	missense	2000	exon9			AGCAGGGACCCTG	U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.1868C>A	X.37:g.129200820G>T	ENSP00000311280:p.Ser623Tyr	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	47.0	NM_001421		Missense_Mutation	SNP	ENST00000308167.5	37	CCDS14617.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.042032	0.55003	.	.	ENSG00000102034	ENST00000335997;ENST00000308167	T;T	0.23552	1.9;1.9	4.96	4.96	0.65561	.	.	.	.	.	T	0.25901	0.0631	L	0.27053	0.805	0.28847	N	0.896242	P	0.50943	0.94	P	0.48030	0.564	T	0.07654	-1.0761	9	0.72032	D	0.01	.	12.6614	0.56815	0.0:0.0:1.0:0.0	.	623	Q99607	ELF4_HUMAN	Y	623	ENSP00000338608:S623Y;ENSP00000311280:S623Y	ENSP00000311280:S623Y	S	-	2	0	ELF4	129028501	1.000000	0.71417	0.958000	0.39756	0.497000	0.33675	5.459000	0.66685	2.040000	0.60383	0.513000	0.50165	TCC	.		0.592	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058243.1	NM_001421	
FABP1	2168	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	88424070	88424072	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr2:88424070_88424072delCAC	ENST00000295834.3	-	3	372_374	c.274_276delGTG	c.(274-276)gtgdel	p.V92del	FABP1_ENST00000495375.1_5'UTR|FABP1_ENST00000393750.3_In_Frame_Del_p.V92del	NM_001443.2	NP_001434.1	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver	92					cellular lipid metabolic process (GO:0044255)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|intestinal absorption (GO:0050892)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of hydrolase activity (GO:0051345)|small molecule metabolic process (GO:0044281)	apical cortex (GO:0045179)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|peroxisomal matrix (GO:0005782)	antioxidant activity (GO:0016209)|bile acid binding (GO:0032052)|chromatin binding (GO:0003682)|drug binding (GO:0008144)|fatty acid binding (GO:0005504)|long-chain fatty acid transporter activity (GO:0005324)|phospholipid binding (GO:0005543)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|stomach(1)	6						TGAAAGTTGTCACCAGTTTATTG	0.507																																					p.92_92del		.											.	FABP1	90	0			c.274_276del						.																																			SO:0001651	inframe_deletion	2168	exon3			AGTTGTCACCAGT	M10617	CCDS2001.1	2p11	2013-03-01			ENSG00000163586	ENSG00000163586		"""Fatty acid binding protein family"""	3555	protein-coding gene	gene with protein product		134650				3012800, 17698986	Standard	NM_001443		Approved	L-FABP	uc002sst.2	P07148	OTTHUMG00000130312	ENST00000295834.3:c.274_276delGTG	2.37:g.88424070_88424072delCAC	ENSP00000295834:p.Val92del	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	16.0	NM_001443		In_Frame_Del	DEL	ENST00000295834.3	37	CCDS2001.1																																																																																			.		0.507	FABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252660.1	NM_001443	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	39338482	39338482	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr13:39338482G>C	ENST00000280481.7	+	3	5521	c.5305G>C	c.(5305-5307)Gca>Cca	p.A1769P		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1769	Calx-beta 1.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCTGAATTGGGCATGGATCTC	0.343																																					p.A1769P		.											.	FREM2	100	0			c.G5305C						.						93.0	96.0	95.0					13																	39338482		2203	4299	6502	SO:0001583	missense	341640	exon3			AATTGGGCATGGA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5305G>C	13.37:g.39338482G>C	ENSP00000280481:p.Ala1769Pro	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	45.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.583882	0.86748	.	.	ENSG00000150893	ENST00000280481	T	0.26067	1.76	5.34	4.48	0.54585	Na-Ca exchanger/integrin-beta4 (1);	0.000000	0.85682	D	0.000000	T	0.56381	0.1981	M	0.86651	2.83	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.65483	-0.6157	10	0.59425	D	0.04	.	15.6233	0.76829	0.0:0.0:0.8613:0.1387	.	1769	Q5SZK8	FREM2_HUMAN	P	1769	ENSP00000280481:A1769P	ENSP00000280481:A1769P	A	+	1	0	FREM2	38236482	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.781000	0.99029	1.359000	0.45940	0.563000	0.77884	GCA	.		0.343	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
GNG5	2787	broad.mit.edu;mdanderson.org	37	1	84971732	84971732	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:84971732G>A	ENST00000370641.3	-	1	516	c.43C>T	c.(43-45)Caa>Taa	p.Q15*	GNG5_ENST00000487806.1_5'Flank|SPATA1_ENST00000370638.2_RNA|GNG5_ENST00000370645.4_Nonsense_Mutation_p.Q15*			P63218	GBG5_HUMAN	guanine nucleotide binding protein (G protein), gamma 5	15					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|PDZ domain binding (GO:0030165)|signal transducer activity (GO:0004871)			lung(1)|skin(1)	2				all cancers(265;0.00634)|Epithelial(280;0.0175)|OV - Ovarian serous cystadenocarcinoma(397;0.159)		CGGAGCTGTTGAACCACTTTC	0.721																																					p.Q15X		.											.	GNG5	227	0			c.C43T						.						12.0	14.0	13.0					1																	84971732		2181	4277	6458	SO:0001587	stop_gained	2787	exon2			GCTGTTGAACCAC	AF038955	CCDS696.1	1p22	2014-05-14			ENSG00000174021	ENSG00000174021			4408	protein-coding gene	gene with protein product		600874				7606925	Standard	NM_005274		Approved		uc001djw.4	P63218	OTTHUMG00000009858	ENST00000370641.3:c.43C>T	1.37:g.84971732G>A	ENSP00000359675:p.Gln15*	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	5.0	NM_005274	B2R5A0|P30670|Q5VX54|Q61015	Nonsense_Mutation	SNP	ENST00000370641.3	37	CCDS696.1	.	.	.	.	.	.	.	.	.	.	G	40	8.522897	0.98848	.	.	ENSG00000174021	ENST00000370645;ENST00000370641	.	.	.	5.06	5.06	0.68205	.	0.067341	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	18.419	0.90582	0.0:0.0:1.0:0.0	.	.	.	.	X	15	.	ENSP00000359675:Q15X	Q	-	1	0	GNG5	84744320	1.000000	0.71417	0.999000	0.59377	0.695000	0.40330	6.302000	0.72788	2.342000	0.79632	0.563000	0.77884	CAA	.		0.721	GNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027240.1	NM_005274	
GBP2	2634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	89575922	89575922	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:89575922C>T	ENST00000370466.3	-	9	1658	c.1390G>A	c.(1390-1392)Gag>Aag	p.E464K	GBP2_ENST00000463660.1_5'UTR	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	464					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		TCCTTGGACTCCAAATATTTT	0.438																																					p.E464K		.											.	GBP2	91	0			c.G1390A						.						185.0	166.0	172.0					1																	89575922		2203	4300	6503	SO:0001583	missense	2634	exon9			TGGACTCCAAATA	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.1390G>A	1.37:g.89575922C>T	ENSP00000359497:p.Glu464Lys	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	54.0	NM_004120	Q6GPH0|Q6IAU2|Q86TB0	Missense_Mutation	SNP	ENST00000370466.3	37	CCDS719.1	.	.	.	.	.	.	.	.	.	.	C	6.217	0.408220	0.11754	.	.	ENSG00000162645	ENST00000370466	T	0.53423	0.62	3.68	-5.51	0.02568	Guanylate-binding protein, C-terminal (3);	0.578615	0.12970	U	0.424245	T	0.04679	0.0127	N	0.02721	-0.515	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.37979	-0.9682	10	0.12430	T	0.62	-15.3283	6.0082	0.19559	0.0:0.307:0.354:0.339	.	464	P32456	GBP2_HUMAN	K	464	ENSP00000359497:E464K	ENSP00000359497:E464K	E	-	1	0	GBP2	89348510	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-2.023000	0.01438	-1.131000	0.02910	-0.781000	0.03364	GAG	.		0.438	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029406.2	NM_004120	
HBG1	3047	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	5269688	5269688	+	Silent	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr11:5269688C>T	ENST00000330597.3	-	3	432	c.345G>A	c.(343-345)ttG>ttA	p.L115L	CTD-2643I7.1_ENST00000564523.1_RNA	NM_000559.2	NP_000550.2	P69891	HBG1_HUMAN	hemoglobin, gamma A	115					blood coagulation (GO:0007596)	cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			large_intestine(1)|lung(3)|skin(1)	5		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AATGGATTGCCAAAACGGTCA	0.527																																					p.L115L	Ovarian(117;2080 2193 33416 49679)	.											.	HBG1	90	0			c.G345A						.						44.0	44.0	44.0					11																	5269688		2201	4294	6495	SO:0001819	synonymous_variant	3047	exon3			GATTGCCAAAACG	M91036	CCDS7754.1	11p15.5	2014-05-19			ENSG00000213934	ENSG00000213934			4831	protein-coding gene	gene with protein product		142200				2649166	Standard	NM_000559		Approved	HBG-T2	uc001mah.1	P69891	OTTHUMG00000066681	ENST00000330597.3:c.345G>A	11.37:g.5269688C>T		Somatic	248.0	0.0		WXS	Illumina HiSeq	Phase_I	214.0	66.0	NM_000559	P02096|P62027|Q549G1|Q8TDA1|Q96FH7	Silent	SNP	ENST00000330597.3	37	CCDS7754.1																																																																																			.		0.527	HBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142982.1	NM_000559	
HES1	3280	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	193855598	193855598	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr3:193855598T>G	ENST00000232424.3	+	4	655	c.419T>G	c.(418-420)cTc>cGc	p.L140R		NM_005524.3	NP_005515.1	P30042	ES1_HUMAN	hes family bHLH transcription factor 1	0						mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		ACTCGGCTGCTCGGCCACCTG	0.682																																					p.L140R		.											.	HES1	659	0			c.T419G						.						64.0	57.0	59.0					3																	193855598		2203	4300	6503	SO:0001583	missense	3280	exon4			GGCTGCTCGGCCA	L19314	CCDS3305.1	3q28-q29	2013-10-17	2013-10-17	2003-01-10	ENSG00000114315	ENSG00000114315		"""Basic helix-loop-helix proteins"""	5192	protein-coding gene	gene with protein product		139605	"""hairy homolog (Drosophila)"", ""hairy and enhancer of split 1, (Drosophila)"""	HRY		8020957	Standard	NM_005524		Approved	FLJ20408, HES-1, Hes1, bHLHb39	uc003ftq.2	Q14469	OTTHUMG00000155984	ENST00000232424.3:c.419T>G	3.37:g.193855598T>G	ENSP00000232424:p.Leu140Arg	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	15.0	NM_005524	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	ENST00000232424.3	37	CCDS3305.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.011301	0.75046	.	.	ENSG00000114315	ENST00000232424	T	0.59083	0.29	4.46	4.46	0.54185	Orange subgroup (1);Orange (2);	0.000000	0.64402	U	0.000001	T	0.75309	0.3832	M	0.90814	3.15	0.80722	D	1	P	0.52316	0.952	P	0.56127	0.792	T	0.81682	-0.0822	10	0.87932	D	0	-10.9537	13.2438	0.60012	0.0:0.0:0.0:1.0	.	140	Q14469	HES1_HUMAN	R	140	ENSP00000232424:L140R	ENSP00000232424:L140R	L	+	2	0	HES1	195338292	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.905000	0.87416	1.777000	0.52277	0.454000	0.30748	CTC	.		0.682	HES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342632.1		
HFM1	164045	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	91784735	91784735	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:91784735C>A	ENST00000370425.3	-	25	2810	c.2712G>T	c.(2710-2712)aaG>aaT	p.K904N	HFM1_ENST00000370424.3_Missense_Mutation_p.K583N|HFM1_ENST00000294696.5_Missense_Mutation_p.K136N|HFM1_ENST00000462405.1_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	904	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CAGCAAACTTCTTTTCTTGAG	0.289																																					p.K904N		.											.	HFM1	112	0			c.G2712T						.						49.0	52.0	51.0					1																	91784735		2203	4300	6503	SO:0001583	missense	164045	exon25			AAACTTCTTTTCT	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.2712G>T	1.37:g.91784735C>A	ENSP00000359454:p.Lys904Asn	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	46.0	NM_001017975	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	CCDS30769.2	.	.	.	.	.	.	.	.	.	.	C	5.078	0.200004	0.09652	.	.	ENSG00000162669	ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421	T;T;T	0.58940	0.3;0.3;0.3	5.14	0.635	0.17723	Sec63 domain (2);	0.462331	0.18260	U	0.146668	T	0.20536	0.0494	L	0.36672	1.1	0.23798	N	0.996814	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.003	T	0.21177	-1.0253	10	0.32370	T	0.25	.	5.7659	0.18227	0.1105:0.3413:0.4654:0.0827	.	583;904	A6NGI5;A2PYH4	.;HFM1_HUMAN	N	904;136;583;588	ENSP00000359454:K904N;ENSP00000294696:K136N;ENSP00000359453:K583N	ENSP00000294696:K136N	K	-	3	2	HFM1	91557323	1.000000	0.71417	0.991000	0.47740	0.636000	0.38137	0.958000	0.29227	0.231000	0.21079	0.650000	0.86243	AAG	.		0.289	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
IL17RA	23765	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	17577966	17577966	+	Silent	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr22:17577966G>A	ENST00000319363.6	+	2	286	c.153G>A	c.(151-153)acG>acA	p.T51T	IL17RA_ENST00000477874.1_Intron	NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	51					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		TAAACTGCACGGTCAAGAATA	0.463																																					p.T51T		.											.	IL17RA	92	0			c.G153A						.						223.0	190.0	201.0					22																	17577966		2203	4300	6503	SO:0001819	synonymous_variant	23765	exon2			CTGCACGGTCAAG	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.153G>A	22.37:g.17577966G>A		Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	70.0	NM_014339	O43844|Q20WK1	Silent	SNP	ENST00000319363.6	37	CCDS13739.1																																																																																			.		0.463	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	
KDR	3791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55976858	55976858	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr4:55976858C>A	ENST00000263923.4	-	8	1349	c.1054G>T	c.(1054-1056)Gcg>Tcg	p.A352S		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	352	Ig-like C2-type 4.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGGTACTTCGCAGGGATTCTG	0.413			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.A352S		.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	KDR,brain,glioma,+1	KDR	2298	0			c.G1054T						.						78.0	86.0	83.0					4																	55976858		2202	4300	6502	SO:0001583	missense	3791	exon8			ACTTCGCAGGGAT	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1054G>T	4.37:g.55976858C>A	ENSP00000263923:p.Ala352Ser	Somatic	230.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	74.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.251076	0.59212	.	.	ENSG00000128052	ENST00000263923	T	0.80480	-1.38	5.65	5.65	0.86999	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.060061	0.64402	D	0.000003	T	0.81408	0.4816	L	0.58810	1.83	0.20403	N	0.999908	B;B	0.22211	0.066;0.063	B;B	0.31946	0.068;0.138	T	0.74185	-0.3747	10	0.72032	D	0.01	.	17.8994	0.88899	0.0:1.0:0.0:0.0	.	352;352	P35968-2;P35968	.;VGFR2_HUMAN	S	352	ENSP00000263923:A352S	ENSP00000263923:A352S	A	-	1	0	KDR	55671615	1.000000	0.71417	0.996000	0.52242	0.406000	0.30931	6.474000	0.73578	2.665000	0.90641	0.563000	0.77884	GCG	.		0.413	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
INPP4B	8821	broad.mit.edu;bcgsc.ca	37	4	143044547	143044547	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr4:143044547A>G	ENST00000513000.1	-	21	2348	c.1915T>C	c.(1915-1917)Ttt>Ctt	p.F639L	INPP4B_ENST00000308502.4_Missense_Mutation_p.F639L|INPP4B_ENST00000262992.4_Missense_Mutation_p.F639L|INPP4B_ENST00000508116.1_Missense_Mutation_p.F639L|INPP4B_ENST00000509777.1_Missense_Mutation_p.F639L	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	639					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					TTGATGATAAAACCACAAACC	0.348																																					p.F639L		.											.	INPP4B	228	0			c.T1915C						.						86.0	82.0	84.0					4																	143044547		2203	4300	6503	SO:0001583	missense	8821	exon21			TGATAAAACCACA	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.1915T>C	4.37:g.143044547A>G	ENSP00000425487:p.Phe639Leu	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	37	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.476445	0.84640	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	6.03	4.83	0.62350	.	0.051424	0.85682	D	0.000000	T	0.61362	0.2341	L	0.53249	1.67	0.80722	D	1	D;P	0.61697	0.99;0.459	D;B	0.72982	0.979;0.264	T	0.57271	-0.7840	10	0.28530	T	0.3	.	13.3095	0.60371	0.8679:0.1321:0.0:0.0	.	510;639	B7Z6T2;O15327	.;INP4B_HUMAN	L	639;639;639;510;639;639;454;454;639;510	ENSP00000425487:F639L;ENSP00000262992:F639L;ENSP00000308441:F639L;ENSP00000423954:F639L;ENSP00000422793:F639L;ENSP00000426207:F454L;ENSP00000427250:F639L;ENSP00000421065:F510L	ENSP00000262992:F639L	F	-	1	0	INPP4B	143263997	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.657000	0.74402	1.071000	0.40834	0.455000	0.32223	TTT	.		0.348	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
KIF2B	84643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	51901390	51901390	+	Silent	SNP	G	G	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr17:51901390G>T	ENST00000268919.4	+	1	1152	c.996G>T	c.(994-996)gtG>gtT	p.V332V		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	332	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATGCTCTGGTGGCACAGGATG	0.488																																					p.V332V		.											.	KIF2B	98	0			c.G996T						.						107.0	109.0	108.0					17																	51901390		2203	4300	6503	SO:0001819	synonymous_variant	84643	exon1			TCTGGTGGCACAG	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.996G>T	17.37:g.51901390G>T		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	30.0	NM_032559	Q96MA2|Q9BXG6	Silent	SNP	ENST00000268919.4	37	CCDS32685.1																																																																																			.		0.488	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
KRTAP5-4	387267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1642677	1642677	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr11:1642677G>T	ENST00000399682.1	-	1	691	c.647C>A	c.(646-648)tCt>tAt	p.S216Y		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACAGCAACTAGACTGGGAGCA	0.567																																					p.S216Y		.											.	.	.	0			c.C647A						.						93.0	81.0	85.0					11																	1642677		692	1591	2283	SO:0001583	missense	387267	exon1			CAACTAGACTGGG	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.647C>A	11.37:g.1642677G>T	ENSP00000382590:p.Ser216Tyr	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	18.0	NM_001012709		Missense_Mutation	SNP	ENST00000399682.1	37		.	.	.	.	.	.	.	.	.	.	G	4.293	0.053617	0.08291	.	.	ENSG00000241598	ENST00000399682;ENST00000328953	T	0.00922	5.54	2.29	1.25	0.21368	.	.	.	.	.	T	0.04272	0.0118	M	0.92317	3.295	0.21822	N	0.999522	P	0.49185	0.92	P	0.52109	0.69	T	0.12142	-1.0559	9	0.72032	D	0.01	.	7.8919	0.29682	0.0:0.5103:0.4897:0.0	.	276	Q6L8H1	KRA54_HUMAN	Y	216;207	ENSP00000382590:S216Y	ENSP00000331603:S207Y	S	-	2	0	KRTAP5-4	1599253	0.995000	0.38212	0.793000	0.32043	0.028000	0.11728	0.414000	0.21164	0.228000	0.21019	0.580000	0.79431	TCT	.		0.567	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
MAP2	4133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	210517999	210517999	+	Silent	SNP	C	C	A	rs149857613		TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr2:210517999C>A	ENST00000360351.4	+	4	611	c.105C>A	c.(103-105)ggC>ggA	p.G35G	MAP2_ENST00000447185.1_Silent_p.G35G|MAP2_ENST00000392194.1_Silent_p.G35G|MAP2_ENST00000199940.6_Silent_p.G35G|MAP2_ENST00000361559.4_Silent_p.G35G	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	35					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AGGATCAAGGCGGAGCAGGGG	0.537																																					p.G35G	Pancreas(27;423 979 28787 29963)	.											.	MAP2	591	0			c.C105A						.						110.0	81.0	91.0					2																	210517999		2203	4300	6503	SO:0001819	synonymous_variant	4133	exon5			TCAAGGCGGAGCA		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.105C>A	2.37:g.210517999C>A		Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	59.0	NM_001039538	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	37	CCDS2384.1																																																																																			C|1.000;T|0.000		0.537	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
MPP6	51678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	24690139	24690139	+	Silent	SNP	A	A	G	rs548751295		TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr7:24690139A>G	ENST00000222644.5	+	5	709	c.459A>G	c.(457-459)gtA>gtG	p.V153V	MPP6_ENST00000409761.1_Silent_p.V41V|MPP6_ENST00000396475.2_Silent_p.V153V			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						ATGATCTGGTAATTGCCCGAA	0.358																																					p.V153V		.											.	MPP6	90	0			c.A459G						.						79.0	82.0	81.0					7																	24690139		2203	4300	6503	SO:0001819	synonymous_variant	51678	exon6			TCTGGTAATTGCC	AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.459A>G	7.37:g.24690139A>G		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	29.0	NM_016447	B2RAF0	Silent	SNP	ENST00000222644.5	37	CCDS5388.1																																																																																			.		0.358	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250272.4		
MUC20	200958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195452957	195452957	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr3:195452957A>T	ENST00000447234.2	+	2	1609	c.1483A>T	c.(1483-1485)Acg>Tcg	p.T495S	MUC20_ENST00000445522.2_Missense_Mutation_p.T460S|MUC20_ENST00000320736.6_Missense_Mutation_p.T324S|MUC20_ENST00000436408.1_Missense_Mutation_p.T495S	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	495	Involved in oligomerization.		Missing. {ECO:0000269|PubMed:14702039}.		activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		ACCTGATGCCACGGTTGGGAC	0.602																																					p.T324S		.											.	.	.	0			c.A970T						.						55.0	50.0	51.0					3																	195452957		2182	4279	6461	SO:0001583	missense	200958	exon3			GATGCCACGGTTG	AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1483A>T	3.37:g.195452957A>T	ENSP00000414350:p.Thr495Ser	Somatic	353.0	0.0		WXS	Illumina HiSeq	Phase_I	302.0	64.0	NM_152673	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	ENST00000447234.2	37		.	.	.	.	.	.	.	.	.	.	A	11.64	1.697698	0.30142	.	.	ENSG00000176945	ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.34859	1.86;2.18;2.01;1.34	3.16	0.464	0.16706	.	0.358470	0.20556	N	0.090019	T	0.39627	0.1085	L	0.39245	1.2	0.09310	N	1	D	0.64830	0.994	P	0.60886	0.88	T	0.17228	-1.0376	10	0.38643	T	0.18	-3.511	7.0492	0.25063	0.525:0.475:0.0:0.0	.	324	E9PH32	.	S	495;324;495;460	ENSP00000414350:T495S;ENSP00000325431:T324S;ENSP00000396774:T495S;ENSP00000405629:T460S	ENSP00000325431:T324S	T	+	1	0	MUC20	196938628	0.001000	0.12720	0.003000	0.11579	0.036000	0.12997	0.592000	0.23984	0.089000	0.17243	0.421000	0.28195	ACG	.		0.602	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000341835.1	NM_152673	
NDST2	8509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	75567215	75567215	+	Missense_Mutation	SNP	C	C	T	rs377733383		TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr10:75567215C>T	ENST00000309979.6	-	3	1488	c.932G>A	c.(931-933)cGc>cAc	p.R311H	NDST2_ENST00000299641.4_Missense_Mutation_p.R188H|RP11-574K11.31_ENST00000603027.1_Missense_Mutation_p.R311H			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	311	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					CAAGATGTAGCGGTCAAGGTC	0.488																																					p.R311H		.											.	NDST2	91	0			c.G932A						.	C	HIS/ARG	0,4406		0,0,2203	94.0	89.0	91.0		932	5.8	1.0	10		91	1,8599	1.2+/-3.3	0,1,4299	no	missense	NDST2	NM_003635.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	311/884	75567215	1,13005	2203	4300	6503	SO:0001583	missense	8509	exon3			ATGTAGCGGTCAA	U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.932G>A	10.37:g.75567215C>T	ENSP00000310657:p.Arg311His	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	35.0	NM_003635	Q2TB32|Q59H89	Missense_Mutation	SNP	ENST00000309979.6	37	CCDS7335.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779805	0.90195	0.0	1.16E-4	ENSG00000166507	ENST00000309979;ENST00000299641	T;T	0.60171	0.44;0.21	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.81931	0.4927	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84887	0.0834	10	0.87932	D	0	.	19.9417	0.97165	0.0:1.0:0.0:0.0	.	188;311	B4E139;P52849	.;NDST2_HUMAN	H	311;188	ENSP00000310657:R311H;ENSP00000299641:R188H	ENSP00000299641:R188H	R	-	2	0	NDST2	75237221	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.810000	0.86072	2.720000	0.93068	0.655000	0.94253	CGC	.		0.488	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048710.1	NM_003635	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	29541512	29541512	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr17:29541512delA	ENST00000358273.4	+	13	1819	c.1436delA	c.(1435-1437)gaafs	p.E479fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.E479fs|NF1_ENST00000431387.4_Frame_Shift_Del_p.E479fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	479					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAATTTAAAGAAAAACCTACA	0.328			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.E479fs		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	3353	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|lung(1)	c.1436delA						.						33.0	34.0	34.0					17																	29541512		2201	4294	6495	SO:0001589	frameshift_variant	4763	exon13	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TTAAAGAAAAACC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1436delA	17.37:g.29541512delA	ENSP00000351015:p.Glu479fs	Somatic	183.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	103.0	NM_001128147	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	CCDS42292.1																																																																																			.		0.328	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
NIPBL	25836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	36976173	36976173	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr5:36976173T>A	ENST00000282516.8	+	9	1663	c.1164T>A	c.(1162-1164)aaT>aaA	p.N388K	NIPBL_ENST00000448238.2_Missense_Mutation_p.N388K|NIPBL_ENST00000504430.1_3'UTR	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	388					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TTTCAGAAAATGATATTCCTT	0.393																																					p.N388K		.											.	NIPBL	293	0			c.T1164A						.						94.0	100.0	98.0					5																	36976173		2203	4300	6503	SO:0001583	missense	25836	exon9			AGAAAATGATATT	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1164T>A	5.37:g.36976173T>A	ENSP00000282516:p.Asn388Lys	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	226.0	121.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	T	13.32	2.201900	0.38905	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.92752	-3.1;-3.1	5.45	3.07	0.35406	.	0.389888	0.28538	N	0.014995	T	0.77611	0.4156	N	0.14661	0.345	0.29618	N	0.846443	B;B	0.09022	0.001;0.002	B;B	0.09377	0.002;0.004	T	0.62455	-0.6851	10	0.06365	T	0.9	.	1.6478	0.02765	0.1379:0.1516:0.1433:0.5672	.	388;388	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	K	388	ENSP00000282516:N388K;ENSP00000406266:N388K	ENSP00000282516:N388K	N	+	3	2	NIPBL	37011930	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.496000	0.35638	0.899000	0.36444	0.383000	0.25322	AAT	.		0.393	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
NOTCH3	4854	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	15303036	15303036	+	Silent	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr19:15303036G>A	ENST00000263388.2	-	4	489	c.414C>T	c.(412-414)ccC>ccT	p.P138P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	138	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AGCGTCCATCGGGCCCCACTG	0.687																																					p.P138P		.											.	NOTCH3	855	0			c.C414T						.						21.0	23.0	22.0					19																	15303036		2198	4295	6493	SO:0001819	synonymous_variant	4854	exon4			TCCATCGGGCCCC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.414C>T	19.37:g.15303036G>A		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	15.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	37	CCDS12326.1																																																																																			.		0.687	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
OFD1	8481	ucsc.edu;bcgsc.ca	37	X	13779284	13779284	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chrX:13779284A>G	ENST00000340096.6	+	17	2668	c.2341A>G	c.(2341-2343)Agc>Ggc	p.S781G	OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380567.1_Missense_Mutation_p.S641G|OFD1_ENST00000380550.3_Missense_Mutation_p.S741G	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	781	Mediates the interaction with SDCCAG8.				axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						GTCTAGGCACAGCCTCTCCAT	0.512																																					p.S781G		.											.	OFD1	108	0			c.A2341G						.						133.0	96.0	109.0					X																	13779284		2203	4300	6503	SO:0001583	missense	8481	exon17			AGGCACAGCCTCT	Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.2341A>G	X.37:g.13779284A>G	ENSP00000344314:p.Ser781Gly	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_003611	B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	ENST00000340096.6	37	CCDS14157.1	.	.	.	.	.	.	.	.	.	.	A	12.47	1.948012	0.34377	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	D;D;D	0.97352	-4.35;-4.3;-2.14	5.03	1.13	0.20643	.	0.652316	0.16428	N	0.214844	D	0.93592	0.7954	M	0.62723	1.935	0.09310	N	1	P;P;B;B;P	0.42296	0.775;0.775;0.033;0.033;0.775	B;B;B;B;B	0.36464	0.225;0.225;0.027;0.027;0.225	D	0.87886	0.2681	10	0.66056	D	0.02	-1.5933	3.345	0.07132	0.6377:0.0:0.1917:0.1706	.	781;741;449;641;781	A8K2T9;O75665-3;B4DLQ3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	G	741;781;641	ENSP00000369923:S741G;ENSP00000344314:S781G;ENSP00000369941:S641G	ENSP00000344314:S781G	S	+	1	0	OFD1	13689205	0.101000	0.21875	0.000000	0.03702	0.001000	0.01503	2.593000	0.46180	-0.078000	0.12730	-1.026000	0.02426	AGC	.		0.512	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055808.1	NM_003611	
OPRM1	4988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	154412549	154412549	+	Missense_Mutation	SNP	G	G	A	rs199984546		TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr6:154412549G>A	ENST00000330432.7	+	3	1343	c.1106G>A	c.(1105-1107)cGt>cAt	p.R369H	OPRM1_ENST00000524163.1_Missense_Mutation_p.R369H|OPRM1_ENST00000452687.2_Missense_Mutation_p.R369H|OPRM1_ENST00000337049.4_Missense_Mutation_p.R369H|OPRM1_ENST00000518759.1_Missense_Mutation_p.R288H|OPRM1_ENST00000434900.2_Missense_Mutation_p.R462H|OPRM1_ENST00000520708.1_Missense_Mutation_p.R269H|OPRM1_ENST00000419506.2_Missense_Mutation_p.R369H|OPRM1_ENST00000360422.4_Missense_Mutation_p.R369H|OPRM1_ENST00000229768.5_Missense_Mutation_p.R369H|OPRM1_ENST00000522555.1_Missense_Mutation_p.R269H|OPRM1_ENST00000522236.1_Missense_Mutation_p.R269H|OPRM1_ENST00000414028.2_Missense_Mutation_p.R369H|OPRM1_ENST00000435918.2_Missense_Mutation_p.R369H|OPRM1_ENST00000428397.2_Missense_Mutation_p.R369H	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1	369					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)	p.R369H(2)|p.R462H(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	ACTCGAATTCGTCAGAACACT	0.438																																					p.R462H		.											.	OPRM1	69	3	Substitution - Missense(3)	kidney(3)	c.G1385A						.						54.0	53.0	54.0					6																	154412549		1915	4123	6038	SO:0001583	missense	4988	exon5			GAATTCGTCAGAA	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.1106G>A	6.37:g.154412549G>A	ENSP00000328264:p.Arg369His	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	22.0	NM_001145279	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	37	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.237880	0.79800	.	.	ENSG00000112038	ENST00000434900;ENST00000520708;ENST00000518759;ENST00000330432;ENST00000360422;ENST00000428397;ENST00000452687;ENST00000229768;ENST00000419506;ENST00000524163;ENST00000414028;ENST00000435918;ENST00000337049;ENST00000522555;ENST00000522236	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14	6.16	6.16	0.99307	.	0.048138	0.85682	D	0.000000	T	0.57140	0.2033	M	0.76170	2.325	0.80722	D	1	D;B;B;D;P;B;B;P;B;P;P;B	0.76494	0.998;0.187;0.187;0.999;0.713;0.025;0.014;0.738;0.364;0.815;0.738;0.187	D;B;B;D;B;B;B;B;B;B;B;B	0.66716	0.909;0.118;0.118;0.946;0.211;0.013;0.009;0.19;0.055;0.22;0.19;0.118	T	0.57429	-0.7813	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	369;369;369;369;462;288;269;369;369;369;369;369	P35372-4;P35372-8;P35372-11;P35372-9;P35372-10;B8Q1L9;Q6UPP1;P35372-5;P35372;P35372-7;P35372-3;P35372-2	.;.;.;.;.;.;.;.;OPRM_HUMAN;.;.;.	H	462;269;288;369;369;369;369;369;369;369;369;369;369;269;269	ENSP00000394624:R462H;ENSP00000430876:R269H;ENSP00000430260:R288H;ENSP00000328264:R369H;ENSP00000353598:R369H;ENSP00000411903:R369H;ENSP00000410497:R369H;ENSP00000229768:R369H;ENSP00000403549:R369H;ENSP00000430097:R369H;ENSP00000399359:R369H;ENSP00000413752:R369H;ENSP00000338381:R369H;ENSP00000429719:R269H;ENSP00000429373:R269H	ENSP00000229768:R369H	R	+	2	0	OPRM1	154454242	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	CGT	.		0.438	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
PACS2	23241	broad.mit.edu;bcgsc.ca	37	14	105821449	105821449	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr14:105821449C>T	ENST00000325438.8	+	4	862	c.358C>T	c.(358-360)Cgc>Tgc	p.R120C	PACS2_ENST00000458164.2_Missense_Mutation_p.R120C|PACS2_ENST00000447393.1_Missense_Mutation_p.R120C|PACS2_ENST00000547217.1_Missense_Mutation_p.R90C|PACS2_ENST00000430725.2_Missense_Mutation_p.R53C			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	120					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		GCGCAGAAAGCGCTACAAGAA	0.602																																					p.R120C		.											.	PACS2	69	0			c.C358T						.						79.0	64.0	69.0					14																	105821449		2203	4300	6503	SO:0001583	missense	23241	exon4			AGAAAGCGCTACA	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.358C>T	14.37:g.105821449C>T	ENSP00000321834:p.Arg120Cys	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	5.0	NM_001100913	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	ENST00000325438.8	37	CCDS32168.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.488079	0.26686	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217;ENST00000546915	T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28	4.62	3.73	0.42828	.	0.000000	0.64402	D	0.000006	T	0.41811	0.1175	M	0.87269	2.87	0.80722	D	1	P;D;B;D	0.89917	0.893;0.993;0.027;1.0	B;P;B;D	0.81914	0.273;0.736;0.005;0.995	T	0.32824	-0.9892	10	0.87932	D	0	-25.5836	6.688	0.23156	0.1759:0.731:0.0:0.0931	.	120;120;120;129	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	C	53;120;120;120;90;53	ENSP00000393524:R53C;ENSP00000321834:R120C;ENSP00000399732:R120C;ENSP00000393559:R120C;ENSP00000449525:R90C	ENSP00000321834:R120C	R	+	1	0	PACS2	104892494	0.933000	0.31639	0.985000	0.45067	0.987000	0.75469	0.527000	0.22987	0.920000	0.36970	0.563000	0.77884	CGC	.		0.602	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355	
PCDHGA2	56113	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140720406	140720406	+	Missense_Mutation	SNP	C	C	T	rs370683887		TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr5:140720406C>T	ENST00000394576.2	+	1	1868	c.1868C>T	c.(1867-1869)aCg>aTg	p.T623M	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	623	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T623M(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTCTGCACACGGGCGAGGTG	0.687																																					p.T623M		.											.	PCDHGA2	71	1	Substitution - Missense(1)	large_intestine(1)	c.C1868T						.	C	,MET/THR,MET/THR	1,4389		0,1,2194	34.0	42.0	39.0		,1868,1868	5.1	1.0	5		39	1,8559		0,1,4279	no	intron,missense,missense	PCDHGA2,PCDHGA1	NM_018912.2,NM_018915.2,NM_032009.1	,81,81	0,2,6473	TT,TC,CC		0.0117,0.0228,0.0154	,,	,623/933,623/824	140720406	2,12948	2195	4280	6475	SO:0001583	missense	56113	exon1			TGCACACGGGCGA	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1868C>T	5.37:g.140720406C>T	ENSP00000378077:p.Thr623Met	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	22.0	NM_018915	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	12.11	1.840122	0.32513	2.28E-4	1.17E-4	ENSG00000081853	ENST00000394576	T	0.58060	0.36	5.14	5.14	0.70334	Cadherin (4);Cadherin-like (1);	0.179052	0.25951	U	0.027248	T	0.79936	0.4532	H	0.94183	3.505	0.23827	N	0.996738	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.75764	-0.3203	10	0.87932	D	0	.	15.3383	0.74277	0.0:0.8598:0.1401:0.0	.	623;623	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	M	623	ENSP00000378077:T623M	ENSP00000378077:T623M	T	+	2	0	PCDHGA2	140700590	0.007000	0.16637	0.969000	0.41365	0.150000	0.21749	0.099000	0.15210	2.589000	0.87451	0.485000	0.47835	ACG	.		0.687	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
PHACTR4	65979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	28818225	28818225	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:28818225G>T	ENST00000373839.3	+	12	2203	c.1942G>T	c.(1942-1944)Gta>Tta	p.V648L	PHACTR4_ENST00000373836.3_Missense_Mutation_p.V658L|PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	648					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		TAATGAATATGTAGAGGTAAC	0.483																																					p.V658L		.											.	PHACTR4	90	0			c.G1972T						.						85.0	90.0	88.0					1																	28818225		1936	4143	6079	SO:0001583	missense	65979	exon11			GAATATGTAGAGG	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1942G>T	1.37:g.28818225G>T	ENSP00000362945:p.Val648Leu	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	32.0	NM_023923	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	ENST00000373839.3	37	CCDS41293.1	.	.	.	.	.	.	.	.	.	.	G	35	5.421743	0.96111	.	.	ENSG00000204138	ENST00000373839;ENST00000373836	T;T	0.38887	1.13;1.11	5.77	5.77	0.91146	.	0.114194	0.64402	D	0.000016	T	0.61073	0.2318	M	0.89968	3.075	0.80722	D	1	P;B	0.37176	0.586;0.181	B;B	0.42495	0.389;0.119	T	0.68273	-0.5452	10	0.87932	D	0	-4.2906	19.0261	0.92932	0.0:0.0:1.0:0.0	.	658;648	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	L	648;658	ENSP00000362945:V648L;ENSP00000362942:V658L	ENSP00000362942:V658L	V	+	1	0	PHACTR4	28690812	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.818000	0.99354	2.737000	0.93849	0.558000	0.71614	GTA	.		0.483	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	NM_023923	
PHLDB1	23187	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118513074	118513074	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr11:118513074C>A	ENST00000361417.2	+	14	3250	c.2839C>A	c.(2839-2841)Ccc>Acc	p.P947T	PHLDB1_ENST00000524713.1_Missense_Mutation_p.P90T|PHLDB1_ENST00000534672.1_Intron|PHLDB1_ENST00000527898.1_Intron|PHLDB1_ENST00000356063.5_Intron	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	947										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TCACTCTTCTCCCCCGCCTCT	0.642																																					p.P947T		.											.	PHLDB1	90	0			c.C2839A						.						69.0	73.0	71.0					11																	118513074		2200	4295	6495	SO:0001583	missense	23187	exon13			TCTTCTCCCCCGC		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2839C>A	11.37:g.118513074C>A	ENSP00000354498:p.Pro947Thr	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	7.0	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401158	0.83120	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000524713	T;T	0.59224	1.09;0.28	4.89	4.89	0.63831	.	0.261847	0.38111	N	0.001802	T	0.68007	0.2954	L	0.49126	1.545	0.48975	D	0.999737	D;D;D	0.89917	1.0;1.0;0.963	D;D;P	0.91635	0.999;0.998;0.63	T	0.62445	-0.6853	10	0.15499	T	0.54	-23.2777	14.7972	0.69886	0.0:1.0:0.0:0.0	.	85;90;947	B7Z2B9;B4DK17;Q86UU1	.;.;PHLB1_HUMAN	T	947;706;311;90	ENSP00000354498:P947T;ENSP00000434905:P90T	ENSP00000350921:P311T	P	+	1	0	PHLDB1	118018284	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.643000	0.61390	2.254000	0.74563	0.455000	0.32223	CCC	.		0.642	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
PLA2R1	22925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	160901606	160901606	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr2:160901606C>G	ENST00000283243.7	-	2	378	c.172G>C	c.(172-174)Gtt>Ctt	p.V58L	PLA2R1_ENST00000392771.1_Missense_Mutation_p.V58L	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	58	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						AGGGTCAGAACCGATTTACCT	0.413																																					p.V58L		.											.	PLA2R1	93	0			c.G172C						.						64.0	60.0	61.0					2																	160901606		2203	4300	6503	SO:0001583	missense	22925	exon2			TCAGAACCGATTT	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.172G>C	2.37:g.160901606C>G	ENSP00000283243:p.Val58Leu	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	44.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	4.213	0.038262	0.08148	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.30182	1.54;1.54	6.17	2.36	0.29203	Ricin B-related lectin (1);Ricin B lectin (2);	0.886117	0.10056	N	0.721568	T	0.19208	0.0461	L	0.33485	1.01	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.37430	-0.9706	10	0.10377	T	0.69	.	5.5728	0.17206	0.0:0.5225:0.1284:0.3491	.	58;58;58	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	L	58	ENSP00000283243:V58L;ENSP00000376524:V58L	ENSP00000283243:V58L	V	-	1	0	PLA2R1	160609852	0.041000	0.20044	0.092000	0.20876	0.315000	0.28087	1.120000	0.31271	0.160000	0.19432	-0.136000	0.14681	GTT	.		0.413	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
POLQ	10721	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121200622	121200622	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr3:121200622G>A	ENST00000264233.5	-	19	6136	c.6008C>T	c.(6007-6009)cCg>cTg	p.P2003L		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2003					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		ATGAAGAGTCGGCTCCTGAGA	0.438								DNA polymerases (catalytic subunits)																													p.P2003L	Pancreas(152;907 1925 26081 31236 36904)	.											.	POLQ	664	0			c.C6008T						.						80.0	80.0	80.0					3																	121200622		2203	4300	6503	SO:0001583	missense	10721	exon19			AGAGTCGGCTCCT	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.6008C>T	3.37:g.121200622G>A	ENSP00000264233:p.Pro2003Leu	Somatic	130.0	1.0		WXS	Illumina HiSeq	Phase_I	112.0	42.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.049302	0.36181	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.20332	2.08	5.17	5.17	0.71159	Ribonuclease H-like (1);	0.305250	0.33854	N	0.004500	T	0.29321	0.0730	L	0.41236	1.265	0.45025	D	0.998047	D;D	0.89917	1.0;0.998	D;P	0.69654	0.965;0.752	T	0.03166	-1.1065	10	0.10377	T	0.69	.	9.398	0.38415	0.0:0.3111:0.5546:0.1343	.	2003;1175	O75417;O75417-2	DPOLQ_HUMAN;.	L	1626;2003;2139	ENSP00000264233:P2003L	ENSP00000264233:P2003L	P	-	2	0	POLQ	122683312	0.998000	0.40836	0.988000	0.46212	0.993000	0.82548	3.721000	0.54941	2.688000	0.91661	0.650000	0.86243	CCG	.		0.438	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
POSTN	10631	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	38159033	38159033	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr13:38159033delG	ENST00000379747.4	-	8	1045	c.928delC	c.(928-930)cagfs	p.Q310fs	POSTN_ENST00000541179.1_Frame_Shift_Del_p.Q310fs|POSTN_ENST00000379743.4_Frame_Shift_Del_p.Q310fs|POSTN_ENST00000541481.1_Frame_Shift_Del_p.Q310fs|POSTN_ENST00000379749.4_Frame_Shift_Del_p.Q310fs|POSTN_ENST00000379742.4_Frame_Shift_Del_p.Q310fs	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	310	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TCAGAACACTGGAGAGTATTT	0.388																																					p.Q310fs		.											.	POSTN	516	0			c.928delC						.						112.0	105.0	107.0					13																	38159033		2203	4300	6503	SO:0001589	frameshift_variant	10631	exon8			AACACTGGAGAGT	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.928delC	13.37:g.38159033delG	ENSP00000369071:p.Gln310fs	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	41.0	NM_006475	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Frame_Shift_Del	DEL	ENST00000379747.4	37	CCDS9364.1																																																																																			.		0.388	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
PRDM2	7799	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	14108628	14108628	+	Silent	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:14108628G>A	ENST00000235372.7	+	8	5194	c.4338G>A	c.(4336-4338)ttG>ttA	p.L1446L	PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000311066.5_Silent_p.L1446L|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_Silent_p.L1245L|PRDM2_ENST00000413440.1_Silent_p.L1245L	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1446	Arg/Lys-rich (basic).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		AGGCCGACTTGAAAAATGCTT	0.408																																					p.L1446L		.											.	PRDM2	116	0			c.G4338A						.						176.0	200.0	192.0					1																	14108628		2203	4300	6503	SO:0001819	synonymous_variant	7799	exon8			CGACTTGAAAAAT	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.4338G>A	1.37:g.14108628G>A		Somatic	134.0	1.0		WXS	Illumina HiSeq	Phase_I	124.0	51.0	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Silent	SNP	ENST00000235372.7	37	CCDS150.1																																																																																			.		0.408	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
PRDX1	5052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	45977016	45977016	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:45977016G>C	ENST00000262746.1	-	6	924	c.585C>G	c.(583-585)ttC>ttG	p.F195L	PRDX1_ENST00000319248.8_Missense_Mutation_p.F195L|PRDX1_ENST00000372079.1_Missense_Mutation_p.F93L	NM_002574.3|NM_181696.2	NP_002565.1|NP_859047.1	Q06830	PRDX1_HUMAN	peroxiredoxin 1	195					cell proliferation (GO:0008283)|erythrocyte homeostasis (GO:0034101)|hydrogen peroxide catabolic process (GO:0042744)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of NF-kappaB import into nucleus (GO:0042345)|regulation of stress-activated MAPK cascade (GO:0032872)|removal of superoxide radicals (GO:0019430)|retina homeostasis (GO:0001895)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)	heme binding (GO:0020037)|peroxidase activity (GO:0004601)|poly(A) RNA binding (GO:0044822)|thioredoxin peroxidase activity (GO:0008379)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	12	Acute lymphoblastic leukemia(166;0.155)					TCTGCTTGGAGAAATATTCTT	0.453																																					p.F195L		.											.	PRDX1	514	0			c.C585G						.						202.0	212.0	209.0					1																	45977016		2203	4300	6503	SO:0001583	missense	5052	exon6			CTTGGAGAAATAT	BC021683	CCDS522.1	1p34.1	2008-02-05			ENSG00000117450	ENSG00000117450			9352	protein-coding gene	gene with protein product		176763		PAGA		8496166	Standard	NM_181697		Approved	NKEFA	uc021omw.1	Q06830	OTTHUMG00000007738	ENST00000262746.1:c.585C>G	1.37:g.45977016G>C	ENSP00000262746:p.Phe195Leu	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	28.0	NM_181696	B5BU26|D3DPZ8|P35703|Q2V576|Q5T154|Q5T155	Missense_Mutation	SNP	ENST00000262746.1	37	CCDS522.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.640237	0.87859	.	.	ENSG00000117450	ENST00000262746;ENST00000319248;ENST00000372079	T;T;T	0.27720	1.65;1.65;1.65	5.04	3.18	0.36537	Peroxiredoxin, C-terminal (1);Thioredoxin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.38746	0.1052	L	0.52573	1.65	0.80722	D	1	P	0.42692	0.787	P	0.50934	0.654	T	0.18147	-1.0346	10	0.87932	D	0	-10.1385	11.234	0.48929	0.1484:0.0:0.8516:0.0	.	195	Q06830	PRDX1_HUMAN	L	195;195;93	ENSP00000262746:F195L;ENSP00000361152:F195L;ENSP00000361150:F93L	ENSP00000262746:F195L	F	-	3	2	PRDX1	45749603	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	4.000000	0.57039	0.547000	0.28938	0.462000	0.41574	TTC	.		0.453	PRDX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020845.1	NM_181697	
PRKACA	5566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14208204	14208204	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr19:14208204A>G	ENST00000308677.4	-	8	930	c.734T>C	c.(733-735)aTc>aCc	p.I245T	PRKACA_ENST00000590853.1_Intron|PRKACA_ENST00000350356.3_5'UTR|PRKACA_ENST00000589994.1_Missense_Mutation_p.I237T	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	245	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						ATAGATCTGGATGGGCTGGTC	0.582																																					p.I245T		.											.	PRKACA	978	0			c.T734C						.						44.0	46.0	45.0					19																	14208204		2203	4300	6503	SO:0001583	missense	5566	exon8			ATCTGGATGGGCT		CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.734T>C	19.37:g.14208204A>G	ENSP00000309591:p.Ile245Thr	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	22.0	NM_002730	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	ENST00000308677.4	37	CCDS12304.1	.	.	.	.	.	.	.	.	.	.	A	15.10	2.733348	0.48939	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695;ENST00000536649	T	0.65364	-0.15	4.68	3.64	0.41730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41823	U	0.000806	T	0.49218	0.1544	N	0.16602	0.42	0.40251	D	0.978076	P;B;B	0.41232	0.743;0.039;0.022	P;B;B	0.44623	0.455;0.409;0.123	T	0.52328	-0.8590	10	0.87932	D	0	.	8.8154	0.34993	0.8315:0.0:0.0:0.1685	.	187;245;237	B7Z708;P17612;P17612-2	.;KAPCA_HUMAN;.	T	245;237;245;187	ENSP00000309591:I245T	ENSP00000309591:I245T	I	-	2	0	PRKACA	14069204	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.134000	0.94467	0.613000	0.30089	0.482000	0.46254	ATC	.		0.582	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459004.1	NM_002730	
PRUNE2	158471	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	79323927	79323927	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr9:79323927T>G	ENST00000376718.3	-	8	3386	c.3263A>C	c.(3262-3264)tAc>tCc	p.Y1088S	PRUNE2_ENST00000428286.1_Missense_Mutation_p.Y729S	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1088					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TGTTTCATTGTACAGTTGCAT	0.517																																					p.Y1088S		.											.	PRUNE2	157	0			c.A3263C						.						299.0	250.0	265.0					9																	79323927		1568	3582	5150	SO:0001583	missense	158471	exon8			TCATTGTACAGTT	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.3263A>C	9.37:g.79323927T>G	ENSP00000365908:p.Tyr1088Ser	Somatic	245.0	1.0		WXS	Illumina HiSeq	Phase_I	227.0	87.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.168483	0.57584	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.58797	0.31;0.38	5.94	4.81	0.61882	.	0.530381	0.17500	N	0.172036	T	0.44307	0.1287	L	0.32530	0.975	0.80722	D	1	P	0.43431	0.807	B	0.39217	0.294	T	0.42832	-0.9428	10	0.87932	D	0	-1.0293	7.1781	0.25757	0.0:0.0737:0.1468:0.7795	.	1088	Q8WUY3	PRUN2_HUMAN	S	1088;729;1087	ENSP00000365908:Y1088S;ENSP00000397425:Y729S	ENSP00000365908:Y1088S	Y	-	2	0	PRUNE2	78513747	0.996000	0.38824	0.997000	0.53966	0.596000	0.36781	1.356000	0.34079	1.084000	0.41184	0.459000	0.35465	TAC	.		0.517	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
RBFOX1	54715	broad.mit.edu;bcgsc.ca	37	16	7743337	7743337	+	Intron	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr16:7743337C>T	ENST00000550418.1	+	15	1983				RBFOX1_ENST00000355637.4_Missense_Mutation_p.A360V|RBFOX1_ENST00000422070.4_Intron|RBFOX1_ENST00000547372.1_Missense_Mutation_p.A382V|RBFOX1_ENST00000340209.4_Intron|RBFOX1_ENST00000535565.2_Missense_Mutation_p.A296V|RBFOX1_ENST00000436368.2_Intron|RBFOX1_ENST00000311745.5_Intron|RBFOX1_ENST00000553186.1_Intron|RBFOX1_ENST00000547338.1_Intron|RBFOX1_ENST00000552089.1_Missense_Mutation_p.A356V	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1						mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						GTCTTCGTTGCAGCAGATGAA	0.398																																					p.A360V	Ovarian(157;934 2567 15163 39509)	.											.	RBFOX1	92	0			c.C1079T						.						155.0	138.0	144.0					16																	7743337		2197	4300	6497	SO:0001627	intron_variant	54715	exon12			TCGTTGCAGCAGA	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.996-15721C>T	16.37:g.7743337C>T		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	5.0	NM_145893	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.105830	0.77096	.	.	ENSG00000078328	ENST00000547372;ENST00000535565;ENST00000552089;ENST00000355637	T;T	0.41065	1.01;1.09	5.98	5.98	0.97165	.	.	.	.	.	T	0.58352	0.2116	L	0.36672	1.1	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.73380	0.98;0.98	T	0.57843	-0.7741	9	0.87932	D	0	.	20.521	0.99222	0.0:1.0:0.0:0.0	.	296;360	F5H0M1;Q9NWB1-5	.;.	V	382;296;356;360	ENSP00000446842:A382V;ENSP00000347855:A360V	ENSP00000347855:A360V	A	+	2	0	RBFOX1	7683338	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.013000	0.70776	2.861000	0.98227	0.650000	0.86243	GCA	.		0.398	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
RUSC1	23623	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	155296520	155296520	+	Silent	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:155296520C>T	ENST00000368352.5	+	8	2162	c.2011C>T	c.(2011-2013)Ctg>Ttg	p.L671L	RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368349.4_Silent_p.L202L|RUSC1_ENST00000292254.4_Silent_p.L202L|RUSC1_ENST00000368354.3_Intron|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368347.4_Silent_p.L261L|RUSC1_ENST00000462780.1_3'UTR	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	671	Interaction with IKBKG.				positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CCACCACCACCTGCCCCTGGG	0.657																																					p.L671L		.											.	RUSC1	92	0			c.C2011T						.						48.0	55.0	53.0					1																	155296520		2203	4300	6503	SO:0001819	synonymous_variant	23623	exon8			CACCACCTGCCCC	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.2011C>T	1.37:g.155296520C>T		Somatic	47.0	1.0		WXS	Illumina HiSeq	Phase_I	80.0	52.0	NM_001105203	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Silent	SNP	ENST00000368352.5	37	CCDS41410.1																																																																																			.		0.657	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
SAMD9	54809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92733944	92733944	+	Silent	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr7:92733944G>A	ENST00000379958.2	-	3	1736	c.1467C>T	c.(1465-1467)ccC>ccT	p.P489P		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	489						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			AAATCCAGCTGGGTTGATGGT	0.403																																					p.P489P		.											.	SAMD9	140	0			c.C1467T						.						88.0	91.0	90.0					7																	92733944		2203	4299	6502	SO:0001819	synonymous_variant	54809	exon2			CCAGCTGGGTTGA	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.1467C>T	7.37:g.92733944G>A		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	44.0	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Silent	SNP	ENST00000379958.2	37	CCDS34680.1																																																																																			.		0.403	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
SF3B2	10992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65828070	65828070	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr11:65828070G>T	ENST00000322535.6	+	14	1696	c.1647G>T	c.(1645-1647)atG>atT	p.M549I	SF3B2_ENST00000528302.1_Missense_Mutation_p.M532I	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	549					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						AGAAGACCATGAAGTCAAAAA	0.443																																					p.M549I		.											.	SF3B2	92	0			c.G1647T						.						114.0	104.0	108.0					11																	65828070		2201	4295	6496	SO:0001583	missense	10992	exon14			GACCATGAAGTCA	U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1647G>T	11.37:g.65828070G>T	ENSP00000318861:p.Met549Ile	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	24.0	NM_006842	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Missense_Mutation	SNP	ENST00000322535.6	37	CCDS31612.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519037	0.85495	.	.	ENSG00000087365	ENST00000528302;ENST00000322535;ENST00000355456	.	.	.	5.82	5.82	0.92795	Domain of unknown function DUF382 (1);	0.000000	0.85682	D	0.000000	T	0.61048	0.2316	L	0.28400	0.85	0.80722	D	1	P	0.43352	0.804	P	0.52031	0.688	T	0.61907	-0.6966	9	0.59425	D	0.04	-32.2593	17.5904	0.87994	0.0:0.0:1.0:0.0	.	549	Q13435	SF3B2_HUMAN	I	532;549;453	.	ENSP00000318861:M549I	M	+	3	0	SF3B2	65584646	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.976000	0.76135	2.751000	0.94390	0.650000	0.86243	ATG	.		0.443	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
SLC34A2	10568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	25664369	25664369	+	Missense_Mutation	SNP	C	C	T	rs374467761		TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr4:25664369C>T	ENST00000382051.3	+	3	205	c.155C>T	c.(154-156)cCg>cTg	p.P52L	SLC34A2_ENST00000504570.1_Missense_Mutation_p.P51L|SLC34A2_ENST00000503434.1_Missense_Mutation_p.P51L	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	52					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GAACTTCTGCCGTCCTACTCC	0.517			T	ROS1	NSCLC																																p.P52L		.		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	SLC34A2	95	0			c.C155T						.						141.0	141.0	141.0					4																	25664369		2203	4300	6503	SO:0001583	missense	10568	exon3			TTCTGCCGTCCTA	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.155C>T	4.37:g.25664369C>T	ENSP00000371483:p.Pro52Leu	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	47.0	NM_006424	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439479	0.83885	.	.	ENSG00000157765	ENST00000513204;ENST00000504570;ENST00000382051;ENST00000503434;ENST00000507530	T;T;T;T;T	0.74737	-0.87;1.05;1.48;1.05;-0.05	5.45	4.6	0.57074	.	0.000000	0.85682	D	0.000000	D	0.85279	0.5660	M	0.81497	2.545	0.80722	D	1	P;D	0.89917	0.832;1.0	B;D	0.68039	0.337;0.955	D	0.87264	0.2281	10	0.87932	D	0	-16.73	14.284	0.66232	0.0:0.9264:0.0:0.0736	.	51;52	O95436-2;O95436	.;NPT2B_HUMAN	L	51;51;52;51;52	ENSP00000423038:P51L;ENSP00000425501:P51L;ENSP00000371483:P52L;ENSP00000423021:P51L;ENSP00000424266:P52L	ENSP00000371483:P52L	P	+	2	0	SLC34A2	25273467	0.991000	0.36638	0.690000	0.30148	0.014000	0.08584	4.040000	0.57333	2.568000	0.86640	0.650000	0.86243	CCG	.		0.517	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
SORCS1	114815	broad.mit.edu;mdanderson.org	37	10	108339225	108339225	+	Silent	SNP	C	C	A	rs142773000	byFrequency	TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr10:108339225C>A	ENST00000263054.6	-	25	3280	c.3273G>T	c.(3271-3273)ctG>ctT	p.L1091L	SORCS1_ENST00000344440.6_Silent_p.L1091L|SORCS1_ENST00000369698.1_Silent_p.L626L	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	1091					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TGAGGTCCACCAGGGGGGCTT	0.517																																					p.L1091L		.											.	SORCS1	153	0			c.G3273T						.	C	,,,,,	0,4406		0,0,2203	69.0	59.0	62.0		3273,3273,3273,3273,3273,3273	3.7	1.0	10	dbSNP_134	62	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SORCS1	NM_001013031.2,NM_001206569.1,NM_001206570.1,NM_001206571.1,NM_001206572.1,NM_052918.4	,,,,,	0,3,6500	AA,AC,CC		0.0349,0.0,0.0231	,,,,,	1091/1199,1091/1180,1091/1131,1091/1160,1091/1180,1091/1169	108339225	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	114815	exon25			GTCCACCAGGGGG	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.3273G>T	10.37:g.108339225C>A		Somatic	47.0	1.0		WXS	Illumina HiSeq	Phase_I	32.0	11.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	3.385	-0.125563	0.06795	0.0	3.49E-4	ENSG00000108018	ENST00000452214	.	.	.	5.62	3.65	0.41850	.	.	.	.	.	T	0.63177	0.2489	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62229	-0.6898	4	.	.	.	-13.0661	12.3957	0.55382	0.1214:0.6434:0.2352:0.0	.	.	.	.	L	106	.	.	W	-	2	0	SORCS1	108329215	0.984000	0.35163	0.998000	0.56505	0.590000	0.36582	0.207000	0.17395	1.502000	0.48669	0.557000	0.71058	TGG	C|1.000;A|0.000		0.517	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
SPACA7	122258	ucsc.edu;bcgsc.ca	37	13	113047360	113047360	+	Silent	SNP	T	T	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr13:113047360T>C	ENST00000283550.3	+	2	187	c.120T>C	c.(118-120)agT>agC	p.S40S	SPACA7_ENST00000375699.3_Intron	NM_145248.4	NP_660291.2	Q96KW9	SPAC7_HUMAN	sperm acrosome associated 7	40						acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)				large_intestine(5)|lung(4)|skin(3)|urinary_tract(1)	13						TACCATTCAGTTCAAAACAGG	0.393																																					p.S40S		.											.	SPACA7	154	0			c.T120C						.						108.0	107.0	107.0					13																	113047360		2203	4300	6503	SO:0001819	synonymous_variant	122258	exon2			ATTCAGTTCAAAA	BC016750	CCDS9524.1	13q34	2013-10-11	2011-03-15	2011-03-15	ENSG00000153498	ENSG00000153498			29575	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 28"""	C13orf28		22495889	Standard	NM_145248		Approved		uc001vsd.2	Q96KW9	OTTHUMG00000017365	ENST00000283550.3:c.120T>C	13.37:g.113047360T>C		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_145248	Q5T8L1	Silent	SNP	ENST00000283550.3	37	CCDS9524.1																																																																																			.		0.393	SPACA7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045820.2	NM_145248	
SPATA5	166378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	123900511	123900511	+	Silent	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr4:123900511C>T	ENST00000274008.4	+	10	1908	c.1839C>T	c.(1837-1839)gcC>gcT	p.A613A	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	613					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						GACCCAGTGCCATGAGGGAAA	0.408																																					p.A613A		.											.	SPATA5	90	0			c.C1839T						.						166.0	158.0	161.0					4																	123900511		2203	4300	6503	SO:0001819	synonymous_variant	166378	exon10			CAGTGCCATGAGG	AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.1839C>T	4.37:g.123900511C>T		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	38.0	NM_145207	C9JT97|Q86XW1|Q8NI20|Q8TDL7	Silent	SNP	ENST00000274008.4	37	CCDS3730.1																																																																																			.		0.408	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256714.2	NM_145207	
SRPX	8406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	38020249	38020249	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chrX:38020249G>A	ENST00000378533.3	-	6	818	c.712C>T	c.(712-714)Cag>Tag	p.Q238*	SRPX_ENST00000538295.1_Nonsense_Mutation_p.Q238*|SRPX_ENST00000479015.1_5'Flank|SRPX_ENST00000544439.1_Nonsense_Mutation_p.Q218*|SRPX_ENST00000432886.2_Nonsense_Mutation_p.Q179*|TM4SF2_ENST00000465127.1_Intron|SRPX_ENST00000343800.6_Nonsense_Mutation_p.Q225*	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	238	HYR. {ECO:0000255|PROSITE- ProRule:PRU00113}.				autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						ACTGTGTACTGGATCTTGTGG	0.423																																					p.Q238X		.											.	SRPX	130	0			c.C712T						.						120.0	106.0	111.0					X																	38020249		2202	4299	6501	SO:0001587	stop_gained	8406	exon6			TGTACTGGATCTT	U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.712C>T	X.37:g.38020249G>A	ENSP00000367794:p.Gln238*	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	30.0	NM_001170752	A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	Nonsense_Mutation	SNP	ENST00000378533.3	37	CCDS14245.1	.	.	.	.	.	.	.	.	.	.	g	38	6.975654	0.97975	.	.	ENSG00000101955	ENST00000544439;ENST00000432886;ENST00000538295;ENST00000378533;ENST00000343800	.	.	.	5.86	4.98	0.66077	.	0.153881	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-12.6791	15.7122	0.77641	0.0:0.1366:0.8634:0.0	.	.	.	.	X	218;179;238;238;225	.	ENSP00000339211:Q225X	Q	-	1	0	SRPX	37905193	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.354000	0.66040	1.191000	0.43056	0.597000	0.82753	CAG	.		0.423	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056243.1	NM_006307	
STAT3	6774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40481576	40481576	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr17:40481576T>C	ENST00000264657.5	-	13	1541	c.1229A>G	c.(1228-1230)cAc>cGc	p.H410R	STAT3_ENST00000404395.3_Missense_Mutation_p.H410R|STAT3_ENST00000585517.1_Missense_Mutation_p.H410R|STAT3_ENST00000389272.3_Missense_Mutation_p.H312R|STAT3_ENST00000588969.1_Missense_Mutation_p.H410R	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	410					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		ACATACCAAGTGTTTGAATTC	0.498									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.H410R		.											.	STAT3	1271	0			c.A1229G						.						114.0	115.0	115.0					17																	40481576		2203	4300	6503	SO:0001583	missense	6774	exon13	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	ACCAAGTGTTTGA	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1229A>G	17.37:g.40481576T>C	ENSP00000264657:p.His410Arg	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	79.0	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.699209	0.88830	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.88277	-2.36;-2.36;-2.36	6.02	6.02	0.97574	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94132	0.8118	M	0.78049	2.395	0.80722	D	1	D;D;D	0.55172	0.962;0.97;0.97	P;D;D	0.66351	0.905;0.943;0.943	D	0.94548	0.7751	10	0.72032	D	0.01	-34.673	16.5446	0.84426	0.0:0.0:0.0:1.0	.	410;410;410	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	R	410;312;410	ENSP00000264657:H410R;ENSP00000373923:H312R;ENSP00000384943:H410R	ENSP00000264657:H410R	H	-	2	0	STAT3	37735102	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	8.040000	0.89188	2.311000	0.77944	0.533000	0.62120	CAC	.		0.498	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
STK3	6788	hgsc.bcm.edu;mdanderson.org	37	8	99719383	99719383	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr8:99719383G>A	ENST00000419617.2	-	5	648	c.508C>T	c.(508-510)Cag>Tag	p.Q170*	STK3_ENST00000523601.1_Nonsense_Mutation_p.Q198*	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		ACTGTTAACTGACCAGCCACT	0.328																																					p.Q198X		.											.	STK3	978	0			c.C592T						.						55.0	54.0	54.0					8																	99719383		1823	4112	5935	SO:0001587	stop_gained	6788	exon7			TTAACTGACCAGC	BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.508C>T	8.37:g.99719383G>A	ENSP00000390500:p.Gln170*	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	228.0	16.0	NM_001256312	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Nonsense_Mutation	SNP	ENST00000419617.2	37	CCDS47900.1	.	.	.	.	.	.	.	.	.	.	G	39	7.738800	0.98462	.	.	ENSG00000104375	ENST00000419617;ENST00000523601	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9913	0.92793	0.0:0.0:1.0:0.0	.	.	.	.	X	170;198	.	ENSP00000390500:Q170X	Q	-	1	0	STK3	99788559	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	7.876000	0.87215	2.493000	0.84123	0.561000	0.74099	CAG	.		0.328	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379635.1	NM_006281	
TBC1D13	54662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131566320	131566320	+	Silent	SNP	G	G	T	rs373890081		TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr9:131566320G>T	ENST00000372648.5	+	9	990	c.840G>T	c.(838-840)tcG>tcT	p.S280S	TBC1D13_ENST00000223865.8_Intron|TBC1D13_ENST00000539497.1_Silent_p.S99S	NM_018201.3	NP_060671.3	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	280	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6						TGGATGACTCGCAGTGTGGCA	0.532																																					p.S280S		.											.	TBC1D13	90	0			c.G840T						.						111.0	99.0	103.0					9																	131566320		2203	4300	6503	SO:0001819	synonymous_variant	54662	exon9			TGACTCGCAGTGT	AK001605	CCDS6911.1, CCDS69677.1	9q34.13	2013-07-09			ENSG00000107021	ENSG00000107021			25571	protein-coding gene	gene with protein product						22762500	Standard	XM_005252060		Approved	FLJ10743	uc010myj.3	Q9NVG8	OTTHUMG00000020760	ENST00000372648.5:c.840G>T	9.37:g.131566320G>T		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	24.0	NM_018201	A7E2E7|B3KW04|B9EGJ8|Q5T270|Q5T271	Silent	SNP	ENST00000372648.5	37	CCDS6911.1																																																																																			.		0.532	TBC1D13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054496.1	NM_018201	
TMEM177	80775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	120438937	120438937	+	Missense_Mutation	SNP	G	G	T	rs547985745	byFrequency	TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr2:120438937G>T	ENST00000424086.1	+	2	981	c.508G>T	c.(508-510)Gcc>Tcc	p.A170S	TMEM177_ENST00000272521.6_Missense_Mutation_p.A170S|TMEM177_ENST00000409951.1_Intron|TMEM177_ENST00000401466.1_Missense_Mutation_p.A170S|TMEM177_ENST00000496203.1_Intron	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	170						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					TGCCGTGCACGCCCTGCTGGC	0.652																																					p.A170S		.											.	TMEM177	91	0			c.G508T						.						53.0	58.0	56.0					2																	120438937		2203	4300	6503	SO:0001583	missense	80775	exon2			GTGCACGCCCTGC	BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.508G>T	2.37:g.120438937G>T	ENSP00000402661:p.Ala170Ser	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	15.0	NM_030577	Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	37	CCDS2128.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.899219	0.52227	.	.	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521;ENST00000415646	T;T;T	0.59224	0.28;0.28;0.28	4.48	0.425	0.16473	.	0.110120	0.64402	N	0.000009	T	0.41766	0.1173	L	0.52206	1.635	0.43919	D	0.996563	P	0.37330	0.59	B	0.34242	0.178	T	0.09684	-1.0663	10	0.36615	T	0.2	-21.526	4.2505	0.10693	0.185:0.0:0.4997:0.3153	.	170	Q53S58	TM177_HUMAN	S	170	ENSP00000385966:A170S;ENSP00000402661:A170S;ENSP00000272521:A170S	ENSP00000272521:A170S	A	+	1	0	TMEM177	120155407	0.000000	0.05858	0.461000	0.27105	0.892000	0.51952	0.734000	0.26101	-0.024000	0.13941	0.549000	0.68633	GCC	.		0.652	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577	
TRAF3IP3	80342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	209936844	209936844	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr1:209936844T>A	ENST00000367024.1	+	8	1130	c.614T>A	c.(613-615)cTa>cAa	p.L205Q	TRAF3IP3_ENST00000367025.3_Missense_Mutation_p.L205Q|TRAF3IP3_ENST00000367026.3_Missense_Mutation_p.L185Q|TRAF3IP3_ENST00000010338.4_Missense_Mutation_p.L185Q|TRAF3IP3_ENST00000400959.3_Missense_Mutation_p.L185Q			Q9Y228	T3JAM_HUMAN	TRAF3 interacting protein 3	205						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32				OV - Ovarian serous cystadenocarcinoma(81;0.045)		CAGGAGGCCCTACAAAGGGAG	0.537																																					p.L205Q		.											.	TRAF3IP3	291	0			c.T614A						.						89.0	94.0	92.0					1																	209936844		2203	4300	6503	SO:0001583	missense	80342	exon8			AGGCCCTACAAAG		CCDS1490.1, CCDS1490.2, CCDS73023.1	1q32.3-q41	2008-02-05			ENSG00000009790	ENSG00000009790			30766	protein-coding gene	gene with protein product	"""TRAF3 interacting Jun N terminal kinase (JNK) activating modulator"""	608255				14572659	Standard	XR_247044		Approved	T3JAM	uc001hho.3	Q9Y228	OTTHUMG00000036480	ENST00000367024.1:c.614T>A	1.37:g.209936844T>A	ENSP00000355991:p.Leu205Gln	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	200.0	40.0	NM_025228	A1L464|A6NIU9|Q2YDB5|Q4VY06|Q7Z706	Missense_Mutation	SNP	ENST00000367024.1	37	CCDS1490.2	.	.	.	.	.	.	.	.	.	.	T	18.86	3.713509	0.68730	.	.	ENSG00000009790	ENST00000400959;ENST00000367025;ENST00000458110;ENST00000367026;ENST00000367024;ENST00000010338	T;T;T;T;T	0.56275	0.51;0.47;0.49;0.47;0.49	4.51	4.51	0.55191	.	0.000000	0.53938	D	0.000051	T	0.69504	0.3118	M	0.76328	2.33	0.47778	D	0.999517	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.73059	-0.4102	10	0.87932	D	0	-5.2705	10.4049	0.44252	0.0:0.0:0.0:1.0	.	205;185;205;185	Q9Y228;Q9Y228-2;Q9Y228-3;E2QRE5	T3JAM_HUMAN;.;.;.	Q	185;205;188;185;205;185	ENSP00000383743:L185Q;ENSP00000355992:L205Q;ENSP00000355993:L185Q;ENSP00000355991:L205Q;ENSP00000010338:L185Q	ENSP00000010338:L185Q	L	+	2	0	TRAF3IP3	208003467	0.999000	0.42202	1.000000	0.80357	0.943000	0.58893	3.797000	0.55514	2.023000	0.59567	0.482000	0.46254	CTA	.		0.537	TRAF3IP3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088734.2		
TRIM21	6737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4411479	4411479	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr11:4411479C>T	ENST00000254436.7	-	2	273	c.161G>A	c.(160-162)tGc>tAc	p.C54Y	TRIM21_ENST00000543625.1_Missense_Mutation_p.C54Y	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21	54					cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		GCGCTGCCGGCACACAGGACA	0.577																																					p.C54Y		.											.	TRIM21	229	0			c.G161A						.						89.0	94.0	92.0					11																	4411479		2131	4245	6376	SO:0001583	missense	6737	exon2			TGCCGGCACACAG	AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.161G>A	11.37:g.4411479C>T	ENSP00000254436:p.Cys54Tyr	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	19.0	NM_003141	Q5XPV5|Q96RF8	Missense_Mutation	SNP	ENST00000254436.7	37	CCDS44525.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761332	0.69763	.	.	ENSG00000132109	ENST00000254436;ENST00000543625	T;T	0.54866	0.55;0.55	4.46	3.54	0.40534	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.56097	D	0.000039	T	0.81903	0.4921	H	0.98542	4.26	0.44129	D	0.996912	D	0.89917	1.0	D	0.91635	0.999	D	0.88231	0.2903	10	0.87932	D	0	.	12.9248	0.58254	0.0:0.8356:0.1644:0.0	.	54	P19474	RO52_HUMAN	Y	54	ENSP00000254436:C54Y;ENSP00000444045:C54Y	ENSP00000254436:C54Y	C	-	2	0	TRIM21	4368055	1.000000	0.71417	0.979000	0.43373	0.832000	0.47134	7.074000	0.76791	1.461000	0.47929	0.655000	0.94253	TGC	.		0.577	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385842.1	NM_003141	
TRMT10B	158234	broad.mit.edu;bcgsc.ca	37	9	37769962	37769962	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr9:37769962T>C	ENST00000297994.3	+	6	663	c.598T>C	c.(598-600)Ttt>Ctt	p.F200L	TRMT10B_ENST00000377754.2_Missense_Mutation_p.F105L|RP11-613M10.9_ENST00000540557.1_Intron|TRMT10B_ENST00000537911.1_Missense_Mutation_p.F149L|TRMT10B_ENST00000377753.2_Missense_Mutation_p.F122L	NM_144964.2	NP_659401.2	Q6PF06	TM10B_HUMAN	tRNA methyltransferase 10 homolog B (S. cerevisiae)	200	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.						methyltransferase activity (GO:0008168)										AGAAGACTGCTTTAGTTTATT	0.448																																					p.F200L		.											.	.	.	0			c.T598C						.						225.0	220.0	222.0					9																	37769962		2009	4165	6174	SO:0001583	missense	158234	exon6			GACTGCTTTAGTT	BC057774	CCDS43804.1, CCDS69598.1, CCDS69600.1, CCDS69601.1	9p13.1	2012-06-28	2012-06-28	2012-06-28	ENSG00000165275	ENSG00000165275			26454	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 3"""	RG9MTD3		14702039	Standard	XM_005251373		Approved	FLJ31455, bA3J10.9	uc004aai.3	Q6PF06	OTTHUMG00000019933	ENST00000297994.3:c.598T>C	9.37:g.37769962T>C	ENSP00000297994:p.Phe200Leu	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	5.0	NM_144964	B7Z216|B7Z3D3|Q05DJ4|Q5QP83|Q8NAG2|Q96N36	Missense_Mutation	SNP	ENST00000297994.3	37	CCDS43804.1	.	.	.	.	.	.	.	.	.	.	T	10.28	1.307823	0.23821	.	.	ENSG00000165275	ENST00000377753;ENST00000537911;ENST00000377754;ENST00000297994	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.16	2.36	0.29203	.	0.467988	0.24024	N	0.042251	T	0.06188	0.0160	N	0.04203	-0.255	0.80722	D	1	B;B;B;B;B	0.09022	0.001;0.002;0.0;0.0;0.0	B;B;B;B;B	0.10450	0.003;0.005;0.001;0.003;0.004	T	0.29792	-1.0000	10	0.06365	T	0.9	-16.2092	2.7909	0.05388	0.0:0.2232:0.2439:0.5329	.	89;122;149;105;200	B7Z9F7;B7Z216;B7Z3D3;Q6PF06-2;Q6PF06	.;.;.;.;RG9D3_HUMAN	L	122;149;105;200	ENSP00000366982:F122L;ENSP00000444997:F149L;ENSP00000366983:F105L;ENSP00000297994:F200L	ENSP00000297994:F200L	F	+	1	0	RG9MTD3	37759962	0.997000	0.39634	1.000000	0.80357	0.764000	0.43329	1.501000	0.35693	1.956000	0.56807	0.377000	0.23210	TTT	.		0.448	TRMT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052482.1	NM_144964	
TRMT44	152992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	8465812	8465812	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr4:8465812C>T	ENST00000389737.4	+	7	1304	c.1304C>T	c.(1303-1305)gCa>gTa	p.A435V	TRMT44_ENST00000513449.2_Missense_Mutation_p.A194V	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	435					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										CCTGTCATTGCAGCCAGGTGA	0.463																																					p.A435V		.											.	.	.	0			c.C1304T						.						148.0	133.0	138.0					4																	8465812		2203	4300	6503	SO:0001583	missense	152992	exon7			TCATTGCAGCCAG	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1304C>T	4.37:g.8465812C>T	ENSP00000374387:p.Ala435Val	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	40.0	NM_152544	Q8NA95	Missense_Mutation	SNP	ENST00000389737.4	37	CCDS3402.2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.960839	0.92791	.	.	ENSG00000155275	ENST00000513449;ENST00000389737;ENST00000285635	T;T	0.47869	0.83;0.83	4.18	4.18	0.49190	.	0.058244	0.64402	D	0.000002	T	0.74450	0.3718	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.81810	-0.0762	10	0.87932	D	0	-19.8751	17.1324	0.86729	0.0:1.0:0.0:0.0	.	435;194	Q8IYL2;Q8IYL2-2	TRM44_HUMAN;.	V	194;435;43	ENSP00000424643:A194V;ENSP00000374387:A435V	ENSP00000285635:A43V	A	+	2	0	METTL19	8516712	1.000000	0.71417	0.547000	0.28179	0.956000	0.61745	6.528000	0.73807	2.350000	0.79820	0.558000	0.71614	GCA	.		0.463	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544	
TRPV1	7442	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	3493227	3493227	+	Silent	SNP	C	C	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr17:3493227C>A	ENST00000571088.1	-	6	1131	c.918G>T	c.(916-918)gtG>gtT	p.V306V	TRPV1_ENST00000399756.4_Silent_p.V306V|TRPV1_ENST00000425167.2_Silent_p.V306V|TRPV1_ENST00000174621.6_Silent_p.V304V|SHPK_ENST00000572705.1_Silent_p.V306V|TRPV1_ENST00000399759.3_Silent_p.V306V|TRPV1_ENST00000310522.5_Silent_p.V306V|TRPV1_ENST00000576351.1_Silent_p.V306V	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	306					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)	p.V306V(2)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	ACATGCTCGTCACAAACTTcg	0.617																																					p.V306V	Melanoma(38;962 1762 15789)	.											.	TRPV1	23	2	Substitution - coding silent(2)	endometrium(2)	c.G918T						.						39.0	46.0	43.0					17																	3493227		2149	4247	6396	SO:0001819	synonymous_variant	7442	exon6			GCTCGTCACAAAC	AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.918G>T	17.37:g.3493227C>A		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	36.0	NM_018727	A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Silent	SNP	ENST00000571088.1	37	CCDS45576.1																																																																																			.		0.617	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438254.1	NM_018727	
TRPV1	7442	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	3493239	3493239	+	Silent	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr17:3493239G>A	ENST00000571088.1	-	6	1119	c.906C>T	c.(904-906)aaC>aaT	p.N302N	TRPV1_ENST00000399756.4_Silent_p.N302N|TRPV1_ENST00000425167.2_Silent_p.N302N|TRPV1_ENST00000174621.6_Silent_p.N300N|SHPK_ENST00000572705.1_Silent_p.N302N|TRPV1_ENST00000399759.3_Silent_p.N302N|TRPV1_ENST00000310522.5_Silent_p.N302N|TRPV1_ENST00000576351.1_Silent_p.N302N	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	302					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	CAAACTTcgtgttgtcggccg	0.597																																					p.N302N	Melanoma(38;962 1762 15789)	.											.	TRPV1	23	0			c.C906T						.						36.0	43.0	41.0					17																	3493239		2148	4245	6393	SO:0001819	synonymous_variant	7442	exon6			CTTCGTGTTGTCG	AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.906C>T	17.37:g.3493239G>A		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	29.0	NM_018727	A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Silent	SNP	ENST00000571088.1	37	CCDS45576.1																																																																																			.		0.597	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438254.1	NM_018727	
WISP1	8840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	134232984	134232984	+	Silent	SNP	G	G	A			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr8:134232984G>A	ENST00000250160.6	+	3	616	c.510G>A	c.(508-510)ccG>ccA	p.P170P	WISP1_ENST00000220856.6_Intron|WISP1_ENST00000377863.2_Intron|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000517423.1_Intron	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	170	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GCCCCCACCCGCGGCGCGTGA	0.667																																					p.P170P		.											.	WISP1	610	0			c.G510A						.						39.0	39.0	39.0					8																	134232984		2202	4300	6502	SO:0001819	synonymous_variant	8840	exon3			CCACCCGCGGCGC	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.510G>A	8.37:g.134232984G>A		Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	21.0	NM_003882	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Silent	SNP	ENST00000250160.6	37	CCDS6371.1																																																																																			.		0.667	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	NM_003882	
ZNF543	125919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57840110	57840110	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A3-01A-11D-A22F-10	TCGA-DD-A3A3-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23566732-cbc1-407d-aa01-5ae509f9fe44	17a04c22-ddc8-4da6-87c4-c27e1b7c6585	g.chr19:57840110A>C	ENST00000321545.4	+	4	1625	c.1280A>C	c.(1279-1281)gAa>gCa	p.E427A		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	427					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GAATGCAGTGAATGTGGAAAG	0.478																																					p.E427A		.											.	ZNF543	92	0			c.A1280C						.						89.0	72.0	78.0					19																	57840110		2203	4300	6503	SO:0001583	missense	125919	exon4			GCAGTGAATGTGG	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.1280A>C	19.37:g.57840110A>C	ENSP00000322545:p.Glu427Ala	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	15.0	NM_213598	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	ENST00000321545.4	37	CCDS33130.1	.	.	.	.	.	.	.	.	.	.	A	9.958	1.221907	0.22457	.	.	ENSG00000178229	ENST00000321545	T	0.06933	3.24	3.0	3.0	0.34707	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21718	0.0523	L	0.60012	1.86	0.09310	N	1	P	0.48407	0.91	D	0.63283	0.913	T	0.02031	-1.1226	9	0.72032	D	0.01	.	10.5184	0.44903	1.0:0.0:0.0:0.0	.	427	Q08ER8	ZN543_HUMAN	A	427	ENSP00000322545:E427A	ENSP00000322545:E427A	E	+	2	0	ZNF543	62531922	0.000000	0.05858	0.063000	0.19743	0.204000	0.24138	1.130000	0.31393	1.353000	0.45828	0.459000	0.35465	GAA	.		0.478	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865	
