#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABLIM1	3983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	116417799	116417799	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr10:116417799C>T	ENST00000277895.5	-	1	258	c.161G>A	c.(160-162)cGt>cAt	p.R54H	ABLIM1_ENST00000369252.4_Intron|snoU13_ENST00000458910.1_RNA|ABLIM1_ENST00000533213.2_Intron	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	54					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		GATAGTGGCACGCCTATGAGC	0.517																																					p.R54H		.											.	ABLIM1	153	0			c.G161A						.						99.0	90.0	93.0					10																	116417799		2203	4300	6503	SO:0001583	missense	3983	exon1			GTGGCACGCCTAT	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.161G>A	10.37:g.116417799C>T	ENSP00000277895:p.Arg54His	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	10.0	NM_002313	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000277895.5	37	CCDS7590.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.896022	0.33442	.	.	ENSG00000099204	ENST00000336585;ENST00000369262;ENST00000277895	T	0.28255	1.62	5.77	2.93	0.34026	.	1.263470	0.05929	N	0.634786	T	0.20820	0.0501	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.28396	-1.0045	10	0.56958	D	0.05	.	7.7976	0.29156	0.0:0.6266:0.0:0.3734	.	54	O14639	ABLM1_HUMAN	H	54	ENSP00000277895:R54H	ENSP00000277895:R54H	R	-	2	0	ABLIM1	116407789	0.001000	0.12720	0.028000	0.17463	0.107000	0.19398	0.114000	0.15520	0.372000	0.24591	-0.143000	0.13931	CGT	.		0.517	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3		
ADAMTS16	170690	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	5209306	5209306	+	Missense_Mutation	SNP	T	T	A	rs547851789		TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr5:5209306T>A	ENST00000274181.7	+	10	1690	c.1552T>A	c.(1552-1554)Tgc>Agc	p.C518S	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.C518S	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	518	Disintegrin.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						AAACACACAGTGCAAGTGGCA	0.443																																					p.C518S		.											.	ADAMTS16	275	0			c.T1552A						.						139.0	133.0	135.0					5																	5209306		1937	4152	6089	SO:0001583	missense	170690	exon10			ACACAGTGCAAGT	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1552T>A	5.37:g.5209306T>A	ENSP00000274181:p.Cys518Ser	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	7.0	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.737295	0.89482	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	D;D	0.82619	-1.63;-1.63	5.9	5.9	0.94986	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93916	0.8053	H	0.96301	3.8	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.81914	0.994;0.995;0.971	D	0.95594	0.8657	10	0.87932	D	0	.	15.3148	0.74065	0.0:0.0:0.0:1.0	.	518;518;518	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	S	518	ENSP00000274181:C518S;ENSP00000421631:C518S	ENSP00000274181:C518S	C	+	1	0	ADAMTS16	5262306	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.048000	0.76606	2.251000	0.74343	0.528000	0.53228	TGC	.		0.443	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
B4GALT6	9331	broad.mit.edu;bcgsc.ca	37	18	29237968	29237968	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr18:29237968A>G	ENST00000306851.5	-	3	613	c.317T>C	c.(316-318)cTc>cCc	p.L106P	B4GALT6_ENST00000383131.3_Missense_Mutation_p.L106P|B4GALT6_ENST00000237019.7_Missense_Mutation_p.L67P	NM_004775.3	NP_004766.2	Q9UBX8	B4GT6_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6	106					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(6)|pancreas(1)	20			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			TGGACAGGGGAGGTATGGTGA	0.368																																					p.L106P		.											.	B4GALT6	90	0			c.T317C						.						283.0	266.0	271.0					18																	29237968		2203	4300	6503	SO:0001583	missense	9331	exon3			CAGGGGAGGTATG	AF038664	CCDS11900.1	18q11	2013-02-19			ENSG00000118276	ENSG00000118276		"""Beta 4-glycosyltransferases"""	929	protein-coding gene	gene with protein product	"""UDP-Gal:glucosylceramide beta-1,4-galactosyltransferase"""	604017				9597550, 12180132	Standard	NM_004775		Approved	beta4GalT-VI	uc002kwz.4	Q9UBX8	OTTHUMG00000131980	ENST00000306851.5:c.317T>C	18.37:g.29237968A>G	ENSP00000306459:p.Leu106Pro	Somatic	180.0	1.0		WXS	Illumina HiSeq	Phase_I	113.0	6.0	NM_004775	O60514|Q6NT09	Missense_Mutation	SNP	ENST00000306851.5	37	CCDS11900.1	.	.	.	.	.	.	.	.	.	.	A	11.23	1.578749	0.28180	.	.	ENSG00000118276	ENST00000306851;ENST00000237019;ENST00000383131	T;T;T	0.50277	1.1;0.89;0.75	5.37	4.06	0.47325	.	0.262469	0.32736	N	0.005716	T	0.48259	0.1490	L	0.51422	1.61	0.58432	D	0.999995	B;B;B	0.28933	0.045;0.228;0.146	B;B;B	0.42138	0.136;0.377;0.209	T	0.39165	-0.9627	10	0.21540	T	0.41	-16.6085	11.5281	0.50593	0.8198:0.0:0.0:0.1802	.	106;67;106	Q6NT09;G3XA83;Q9UBX8	.;.;B4GT6_HUMAN	P	106;67;106	ENSP00000306459:L106P;ENSP00000237019:L67P;ENSP00000372613:L106P	ENSP00000237019:L67P	L	-	2	0	B4GALT6	27491966	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	3.457000	0.53007	2.150000	0.67090	0.533000	0.62120	CTC	.		0.368	B4GALT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254942.2	NM_004775	
C1orf177	163747	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	55272679	55272679	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr1:55272679T>C	ENST00000371273.3	+	2	130	c.115T>C	c.(115-117)Tct>Cct	p.S39P	C1orf177_ENST00000358193.3_Missense_Mutation_p.S39P	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	39										breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						GTTTGACATCTCTGCTGTTTA	0.587																																					p.S39P		.											.	C1orf177	90	0			c.T115C						.						220.0	205.0	210.0					1																	55272679		2203	4300	6503	SO:0001583	missense	163747	exon2			GACATCTCTGCTG	AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.115T>C	1.37:g.55272679T>C	ENSP00000360320:p.Ser39Pro	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	7.0	NM_001110533	B7WPL2|Q8N7Y9	Missense_Mutation	SNP	ENST00000371273.3	37	CCDS44153.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.595189	0.46318	.	.	ENSG00000162398	ENST00000358193;ENST00000371273	T;T	0.28454	1.61;1.61	3.72	2.57	0.30868	.	0.000000	0.51477	D	0.000089	T	0.43567	0.1253	L	0.59436	1.845	0.38663	D	0.95211	D;D	0.61080	0.971;0.989	P;P	0.61722	0.776;0.893	T	0.44452	-0.9327	10	0.72032	D	0.01	-18.3933	8.5732	0.33583	0.0:0.0:0.1952:0.8048	.	39;39	Q3ZCV2;Q3ZCV2-2	CA177_HUMAN;.	P	39	ENSP00000350924:S39P;ENSP00000360320:S39P	ENSP00000350924:S39P	S	+	1	0	C1orf177	55045267	0.907000	0.30839	0.858000	0.33744	0.547000	0.35210	1.616000	0.36933	0.768000	0.33290	0.379000	0.24179	TCT	.		0.587	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027674.1	NM_152607	
C20orf96	140680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	257508	257508	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr20:257508G>A	ENST00000360321.2	-	9	976	c.838C>T	c.(838-840)Ccc>Tcc	p.P280S	C20orf96_ENST00000382369.5_Missense_Mutation_p.P245S|C20orf96_ENST00000400269.3_Missense_Mutation_p.P222S	NM_080571.1|NM_153269.2	NP_542138.1|NP_695001.2	Q9NUD7	CT096_HUMAN	chromosome 20 open reading frame 96	280										endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			TCTTCATAGGGACGCTGGGTT	0.577																																					p.P280S		.											.	C20orf96	90	0			c.C838T						.						92.0	82.0	85.0					20																	257508		2203	4300	6503	SO:0001583	missense	140680	exon9			CATAGGGACGCTG	AL034548	CCDS12994.1, CCDS74685.1	20p13	2012-10-30			ENSG00000196476	ENSG00000196476			16227	protein-coding gene	gene with protein product							Standard	NM_153269		Approved	dJ1103G7.2	uc002wde.2	Q9NUD7	OTTHUMG00000031626	ENST00000360321.2:c.838C>T	20.37:g.257508G>A	ENSP00000353470:p.Pro280Ser	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	10.0	NM_153269	A3KPE0|B2RPH9|Q8N840|Q8NAX5	Missense_Mutation	SNP	ENST00000360321.2	37	CCDS12994.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249955	0.39797	.	.	ENSG00000196476	ENST00000382369;ENST00000360321;ENST00000400269	T;T;T	0.43294	0.95;0.95;0.95	4.52	3.57	0.40892	.	0.440036	0.22871	N	0.054623	T	0.50718	0.1632	L	0.55481	1.735	0.09310	N	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.64595	0.927;0.927;0.927;0.927	T	0.39187	-0.9626	10	0.13108	T	0.6	-13.5247	10.2593	0.43416	0.0:0.2154:0.7846:0.0	.	222;245;280;245	F5GZA9;B7Z971;Q9NUD7;Q5JYC3	.;.;CT096_HUMAN;.	S	245;280;222	ENSP00000371806:P245S;ENSP00000353470:P280S;ENSP00000383128:P222S	ENSP00000353470:P280S	P	-	1	0	C20orf96	205508	0.883000	0.30277	0.008000	0.14137	0.106000	0.19336	2.705000	0.47127	1.129000	0.42072	0.313000	0.20887	CCC	.		0.577	C20orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077439.2	NM_153269	
C6orf118	168090	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	165715587	165715587	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr6:165715587G>A	ENST00000230301.8	-	2	244	c.224C>T	c.(223-225)aCg>aTg	p.T75M	C6orf118_ENST00000543069.1_De_novo_Start_InFrame	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	75										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		CTGTAAGATCGTCTCCGGAGG	0.612																																					p.T75M		.											.	C6orf118	90	0			c.C224T						.						96.0	107.0	103.0					6																	165715587		2203	4300	6503	SO:0001583	missense	168090	exon2			AAGATCGTCTCCG		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.224C>T	6.37:g.165715587G>A	ENSP00000230301:p.Thr75Met	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	7.0	NM_144980	Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	37	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584057	0.46110	.	.	ENSG00000112539	ENST00000230301	T	0.12361	2.69	5.31	-1.32	0.09201	.	0.763645	0.11964	N	0.512482	T	0.03520	0.0101	L	0.61218	1.895	0.09310	N	1	B	0.24675	0.109	B	0.18263	0.021	T	0.40079	-0.9582	10	0.49607	T	0.09	-12.8169	0.4604	0.00515	0.2248:0.2465:0.2763:0.2524	.	75	Q5T5N4	CF118_HUMAN	M	75	ENSP00000230301:T75M	ENSP00000230301:T75M	T	-	2	0	C6orf118	165635577	0.000000	0.05858	0.010000	0.14722	0.006000	0.05464	-1.112000	0.03299	-0.278000	0.09180	-0.753000	0.03488	ACG	.		0.612	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980	
CCNA1	8900	ucsc.edu;bcgsc.ca	37	13	37007267	37007267	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr13:37007267T>C	ENST00000255465.4	+	2	470	c.206T>C	c.(205-207)cTc>cCc	p.L69P	CCNA1_ENST00000463403.1_3'UTR|CCNA1_ENST00000418263.1_Missense_Mutation_p.L68P|CCNA1_ENST00000440264.1_Missense_Mutation_p.L25P|CCNA1_ENST00000449823.1_Missense_Mutation_p.L25P			P78396	CCNA1_HUMAN	cyclin A1	69					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		TGTCAGATACTCACCAGAGCC	0.597																																					p.L69P		.											.	CCNA1	418	0			c.T206C						.						85.0	83.0	84.0					13																	37007267		2203	4300	6503	SO:0001583	missense	8900	exon2			AGATACTCACCAG	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.206T>C	13.37:g.37007267T>C	ENSP00000255465:p.Leu69Pro	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	36.0	6.0	NM_003914	B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	ENST00000255465.4	37	CCDS9357.1	.	.	.	.	.	.	.	.	.	.	T	15.77	2.932656	0.52866	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.17370	2.34;2.34;2.28;2.28	4.63	3.45	0.39498	.	1.634660	0.03195	N	0.173956	T	0.18759	0.0450	L	0.43152	1.355	0.42919	D	0.994285	P;P	0.44946	0.846;0.761	B;B	0.41813	0.367;0.202	T	0.33420	-0.9869	10	0.30854	T	0.27	.	7.5985	0.28063	0.0:0.1001:0.0:0.8999	.	68;69	P78396-2;P78396	.;CCNA1_HUMAN	P	25;25;68;69	ENSP00000400666:L25P;ENSP00000409873:L25P;ENSP00000396479:L68P;ENSP00000255465:L69P	ENSP00000255465:L69P	L	+	2	0	CCNA1	35905267	0.224000	0.23674	0.859000	0.33776	0.981000	0.71138	0.966000	0.29331	1.841000	0.53522	0.454000	0.30748	CTC	.		0.597	CCNA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044514.2	NM_003914	
CER1	9350	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	14720318	14720318	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr9:14720318A>G	ENST00000380911.3	-	2	618	c.574T>C	c.(574-576)Tct>Cct	p.S192P		NM_005454.2	NP_005445.1	O95813	CER1_HUMAN	cerberus 1, DAN family BMP antagonist	192	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|bone mineralization (GO:0030282)|cell migration involved in gastrulation (GO:0042074)|cellular response to BMP stimulus (GO:0071773)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|growth plate cartilage chondrocyte proliferation (GO:0003419)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mesoderm development (GO:2000381)|nervous system development (GO:0007399)|sequestering of BMP in extracellular matrix (GO:0035582)|signal transduction involved in regulation of gene expression (GO:0023019)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(6)	11				GBM - Glioblastoma multiforme(50;3.16e-06)		AAATGAACAGACCCGCATTTC	0.463																																					p.S192P		.											.	CER1	226	0			c.T574C						.						93.0	79.0	84.0					9																	14720318		2203	4300	6503	SO:0001583	missense	9350	exon2			GAACAGACCCGCA	AF090189	CCDS6476.1	9p23-p22	2013-02-26	2013-02-26		ENSG00000147869	ENSG00000147869			1862	protein-coding gene	gene with protein product		603777	"""cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)"", ""cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"""			10049596	Standard	NM_005454		Approved	DAND4	uc003zlj.3	O95813	OTTHUMG00000021022	ENST00000380911.3:c.574T>C	9.37:g.14720318A>G	ENSP00000370297:p.Ser192Pro	Somatic	106.0	1.0		WXS	Illumina HiSeq	Phase_I	81.0	10.0	NM_005454	Q6ISJ1|Q6ISJ6|Q6ISQ2|Q6ISS1	Missense_Mutation	SNP	ENST00000380911.3	37	CCDS6476.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.302878	0.60195	.	.	ENSG00000147869	ENST00000380911	T	0.59083	0.29	4.99	3.83	0.44106	DAN (1);Cystine knot, C-terminal (2);	0.093479	0.47852	D	0.000204	T	0.77491	0.4138	M	0.88906	2.99	0.50039	D	0.999842	D	0.69078	0.997	D	0.70016	0.967	T	0.81302	-0.0994	10	0.87932	D	0	-15.8559	12.1746	0.54178	0.8569:0.1431:0.0:0.0	.	192	O95813	CER1_HUMAN	P	192	ENSP00000370297:S192P	ENSP00000370297:S192P	S	-	1	0	CER1	14710318	0.964000	0.33143	0.209000	0.23619	0.692000	0.40212	2.147000	0.42226	1.011000	0.39340	0.533000	0.62120	TCT	.		0.463	CER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055453.1	NM_005454	
CFHR1	3078	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	196800931	196800931	+	Silent	SNP	G	G	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr1:196800931G>A	ENST00000320493.5	+	6	883	c.795G>A	c.(793-795)ccG>ccA	p.P265P	CFHR1_ENST00000367424.4_Silent_p.P206P|CFHR2_ENST00000367421.3_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	265					complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						TTTCAGATCCGTGTGTAATAT	0.323																																					p.P265P		.											.	CFHR1	90	0			c.G795A						.						49.0	58.0	55.0					1																	196800931		1856	4107	5963	SO:0001819	synonymous_variant	3078	exon6			AGATCCGTGTGTA	M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.795G>A	1.37:g.196800931G>A		Somatic	642.0	1.0		WXS	Illumina HiSeq	Phase_I	494.0	43.0	NM_002113	A8K465|Q3B774|Q9UJ17	Silent	SNP	ENST00000320493.5	37	CCDS1386.1																																																																																			.		0.323	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2	NM_002113	
CPEB3	22849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	93902837	93902837	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr10:93902837C>T	ENST00000265997.4	-	6	1574	c.1402G>A	c.(1402-1404)Gta>Ata	p.V468I	CPEB3_ENST00000412050.4_Missense_Mutation_p.V454I	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	468	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				CAGTCTACTACGAGAGGTCCA	0.393																																					p.V468I		.											.	CPEB3	90	0			c.G1402A						.						89.0	88.0	88.0					10																	93902837		2203	4300	6503	SO:0001583	missense	22849	exon6			CTACTACGAGAGG	AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.1402G>A	10.37:g.93902837C>T	ENSP00000265997:p.Val468Ile	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	5.0	NM_014912	Q5T389|Q9NQJ7|Q9Y2E9	Missense_Mutation	SNP	ENST00000265997.4	37	CCDS31246.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181730	0.57800	.	.	ENSG00000107864	ENST00000394210;ENST00000412050;ENST00000265997	T;T	0.15718	2.4;2.4	5.86	5.86	0.93980	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.32133	0.0819	L	0.37897	1.145	0.80722	D	1	B;P;D	0.53885	0.026;0.927;0.963	B;D;D	0.66196	0.017;0.942;0.933	T	0.00804	-1.1559	10	0.19147	T	0.46	-12.1909	20.1823	0.98208	0.0:1.0:0.0:0.0	.	468;454;454	Q8NE35;Q5QP71;Q8NE35-2	CPEB3_HUMAN;.;.	I	454;454;468	ENSP00000398310:V454I;ENSP00000265997:V468I	ENSP00000265997:V468I	V	-	1	0	CPEB3	93892817	1.000000	0.71417	0.870000	0.34147	0.948000	0.59901	5.975000	0.70475	2.771000	0.95319	0.650000	0.86243	GTA	.		0.393	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2	NM_014912	
DPF2	5977	hgsc.bcm.edu;broad.mit.edu	37	11	65111286	65111286	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr11:65111286G>A	ENST00000528416.1	+	5	669	c.536G>A	c.(535-537)cGt>cAt	p.R179H	DPF2_ENST00000532264.1_3'UTR|DPF2_ENST00000415073.2_Intron|DPF2_ENST00000252268.4_Missense_Mutation_p.R179H	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	179					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						ACTCCCAAGCGTCGGGGAAAG	0.512																																					p.R179H		.											.	DPF2	91	0			c.G536A						.						43.0	40.0	41.0					11																	65111286		2201	4297	6498	SO:0001583	missense	5977	exon5			CCAAGCGTCGGGG	U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.536G>A	11.37:g.65111286G>A	ENSP00000436901:p.Arg179His	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	4.0	NM_006268	A8K7C9|B4DT58	Missense_Mutation	SNP	ENST00000528416.1	37	CCDS8100.1	.	.	.	.	.	.	.	.	.	.	G	35	5.458962	0.96240	.	.	ENSG00000133884	ENST00000528416;ENST00000252268	D;D	0.91464	-2.84;-2.85	5.71	5.71	0.89125	.	0.000000	0.37715	N	0.001967	D	0.91523	0.7323	M	0.82323	2.585	0.54753	D	0.999987	P	0.47604	0.898	B	0.40782	0.34	D	0.92889	0.6329	10	0.72032	D	0.01	-16.6516	17.3563	0.87336	0.0:0.0:1.0:0.0	.	179	Q92785	REQU_HUMAN	H	179	ENSP00000436901:R179H;ENSP00000252268:R179H	ENSP00000252268:R179H	R	+	2	0	DPF2	64867862	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	7.759000	0.85235	2.689000	0.91719	0.655000	0.94253	CGT	.		0.512	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
EPHA3	2042	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	89480486	89480486	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr3:89480486C>T	ENST00000336596.2	+	13	2548	c.2323C>T	c.(2323-2325)Cca>Tca	p.P775S	EPHA3_ENST00000494014.1_Missense_Mutation_p.P775S	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	775	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GGAGGATGACCCAGAAGCTGC	0.393										TSP Lung(6;0.00050)																											p.P775S		.											.	EPHA3	1500	0			c.C2323T						.						112.0	106.0	108.0					3																	89480486		2203	4300	6503	SO:0001583	missense	2042	exon13			GATGACCCAGAAG	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2323C>T	3.37:g.89480486C>T	ENSP00000337451:p.Pro775Ser	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	8.0	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566782	0.65651	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.81163	-1.46;-1.46	5.33	5.33	0.75918	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79015	0.4375	N	0.04655	-0.195	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.79725	-0.1683	9	.	.	.	.	19.3726	0.94495	0.0:1.0:0.0:0.0	.	775	P29320	EPHA3_HUMAN	S	775	ENSP00000337451:P775S;ENSP00000419190:P775S	.	P	+	1	0	EPHA3	89563176	1.000000	0.71417	1.000000	0.80357	0.522000	0.34438	7.776000	0.85560	2.648000	0.89879	0.585000	0.79938	CCA	.		0.393	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
FAM184A	79632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	119327610	119327610	+	Splice_Site	SNP	A	A	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr6:119327610A>G	ENST00000338891.7	-	7	2259		c.e7+1		FAM184A_ENST00000522284.1_Splice_Site|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000368475.4_Splice_Site|FAM184A_ENST00000521531.1_Splice_Site|FAM184A_ENST00000352896.5_Splice_Site	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A							extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TTATGAAATTACCTCCACATT	0.363																																					.		.											.	FAM184A	519	0			c.1455+2T>C						.						92.0	88.0	89.0					6																	119327610		1837	4080	5917	SO:0001630	splice_region_variant	79632	exon8			GAAATTACCTCCA	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.1815+1T>C	6.37:g.119327610A>G		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	13.0	NM_001100411	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Splice_Site	SNP	ENST00000338891.7	37	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	A	12.96	2.093737	0.36952	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2421	0.82418	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM184A	119369309	1.000000	0.71417	0.997000	0.53966	0.124000	0.20399	6.603000	0.74145	2.234000	0.73211	0.533000	0.62120	.	.		0.363	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	Intron
FUT8	2530	hgsc.bcm.edu;bcgsc.ca	37	14	66188664	66188665	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr14:66188664_66188665insA	ENST00000360689.5	+	8	2734_2735	c.1007_1008insA	c.(1006-1011)atccgcfs	p.R337fs	FUT8_ENST00000394586.2_Frame_Shift_Ins_p.R337fs|FUT8_ENST00000417683.1_Intron|FUT8_ENST00000358307.2_Frame_Shift_Ins_p.R208fs|FUT8_ENST00000394585.1_Frame_Shift_Ins_p.R337fs|FUT8_ENST00000557164.1_Frame_Shift_Ins_p.R174fs	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	337	GT23. {ECO:0000255|PROSITE- ProRule:PRU00992}.				cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		AAATACTTGATCCGCCCACAGC	0.455																																					p.I336fs		.											.	FUT8	91	0			c.1007_1008insA						.																																			SO:0001589	frameshift_variant	2530	exon8			ACTTGATCCGCCC	AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	Exception_encountered	14.37:g.66188664_66188665insA	ENSP00000353910:p.Arg337fs	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	11.0	NM_178155	B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Frame_Shift_Ins	INS	ENST00000360689.5	37	CCDS9775.1																																																																																			.		0.455	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286406.1	NM_004480	
LBR	3930	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225599103	225599103	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr1:225599103T>C	ENST00000338179.2	-	9	1249	c.1124A>G	c.(1123-1125)aAc>aGc	p.N375S	LBR_ENST00000272163.4_Missense_Mutation_p.N375S|AC092811.1_ENST00000366845.2_5'Flank	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	375					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AATTCGAGGGTTTAATTCACG	0.388																																					p.N375S		.											.	LBR	228	0			c.A1124G						.						110.0	118.0	115.0					1																	225599103		2203	4300	6503	SO:0001583	missense	3930	exon9			CGAGGGTTTAATT	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.1124A>G	1.37:g.225599103T>C	ENSP00000339883:p.Asn375Ser	Somatic	217.0	1.0		WXS	Illumina HiSeq	Phase_I	148.0	17.0	NM_194442	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	T	31	5.094051	0.94149	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000424022	D;D;D	0.99080	-5.4;-5.4;-5.4	6.16	6.16	0.99307	Sterol reductase, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99551	0.9839	H	0.96269	3.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98027	1.0374	10	0.87932	D	0	-35.8933	16.8061	0.85666	0.0:0.0:0.0:1.0	.	375	Q14739	LBR_HUMAN	S	375;375;6	ENSP00000272163:N375S;ENSP00000339883:N375S;ENSP00000397817:N6S	ENSP00000272163:N375S	N	-	2	0	LBR	223665726	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.966000	0.87956	2.367000	0.80283	0.528000	0.53228	AAC	.		0.388	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
LRP2	4036	broad.mit.edu;bcgsc.ca	37	2	170059322	170059322	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr2:170059322T>C	ENST00000263816.3	-	43	8438	c.8153A>G	c.(8152-8154)aAg>aGg	p.K2718R		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2718	LDL-receptor class A 16. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ATTATCACACTTCCACTCTTC	0.507																																					p.K2718R		.											.	LRP2	175	0			c.A8153G						.						267.0	238.0	248.0					2																	170059322		2203	4300	6503	SO:0001583	missense	4036	exon43			TCACACTTCCACT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8153A>G	2.37:g.170059322T>C	ENSP00000263816:p.Lys2718Arg	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	6.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	15.49	2.848667	0.51164	.	.	ENSG00000081479	ENST00000263816	D	0.95035	-3.59	5.56	1.58	0.23477	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.138793	0.64402	D	0.000004	D	0.91449	0.7301	N	0.25426	0.745	0.80722	D	1	P	0.49358	0.923	P	0.51550	0.673	D	0.87448	0.2399	10	0.38643	T	0.18	.	10.5373	0.45011	0.3709:0.0:0.0:0.6291	.	2718	P98164	LRP2_HUMAN	R	2718	ENSP00000263816:K2718R	ENSP00000263816:K2718R	K	-	2	0	LRP2	169767568	1.000000	0.71417	0.980000	0.43619	0.101000	0.19017	1.784000	0.38674	0.019000	0.15079	0.533000	0.62120	AAG	.		0.507	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LRP2	4036	broad.mit.edu;bcgsc.ca	37	2	170062972	170062972	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr2:170062972T>C	ENST00000263816.3	-	39	7543	c.7258A>G	c.(7258-7260)Act>Gct	p.T2420A		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2420					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GACATGACAGTTCTTTCCACA	0.403																																					p.T2420A		.											.	LRP2	175	0			c.A7258G						.						93.0	94.0	94.0					2																	170062972		2203	4300	6503	SO:0001583	missense	4036	exon39			TGACAGTTCTTTC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7258A>G	2.37:g.170062972T>C	ENSP00000263816:p.Thr2420Ala	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	6.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	3.776	-0.046563	0.07407	.	.	ENSG00000081479	ENST00000263816	D	0.90844	-2.74	5.87	-1.43	0.08884	Six-bladed beta-propeller, TolB-like (1);	0.709697	0.14776	N	0.299058	D	0.86037	0.5837	L	0.57536	1.79	0.09310	N	1	B	0.24533	0.105	B	0.21708	0.036	T	0.72818	-0.4178	10	0.34782	T	0.22	.	10.1683	0.42893	0.0:0.0653:0.5011:0.4336	.	2420	P98164	LRP2_HUMAN	A	2420	ENSP00000263816:T2420A	ENSP00000263816:T2420A	T	-	1	0	LRP2	169771218	0.878000	0.30173	0.000000	0.03702	0.003000	0.03518	1.489000	0.35562	-0.467000	0.06932	-0.435000	0.05868	ACT	.		0.403	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
MBD3L2	125997	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	7051578	7051578	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr19:7051578A>T	ENST00000381393.3	+	2	625	c.572A>T	c.(571-573)aAg>aTg	p.K191M		NM_144614.3	NP_653215.2	Q8NHZ7	MB3L2_HUMAN	methyl-CpG binding domain protein 3-like 2	191										endometrium(1)	1	all_hematologic(4;0.166)			Lung(535;0.179)		AGACTGGCCAAGGCCTTGCAG	0.587																																					p.K191M		.											.	MBD3L2	40	0			c.A572T						.						6.0	8.0	7.0					19																	7051578		1715	3815	5530	SO:0001583	missense	125997	exon2			TGGCCAAGGCCTT	AF503919	CCDS42483.1	19p13.3	2011-01-31			ENSG00000230522	ENSG00000230522			18532	protein-coding gene	gene with protein product		607964					Standard	NM_144614		Approved		uc010dvf.1	Q8NHZ7		ENST00000381393.3:c.572A>T	19.37:g.7051578A>T	ENSP00000370800:p.Lys191Met	Somatic	123.0	1.0		WXS	Illumina HiSeq	Phase_I	103.0	8.0	NM_144614		Missense_Mutation	SNP	ENST00000381393.3	37	CCDS42483.1	.	.	.	.	.	.	.	.	.	.	.	0.826	-0.747038	0.03065	.	.	ENSG00000230522	ENST00000412046;ENST00000381393	.	.	.	0.791	-1.58	0.08479	.	2.640840	0.02386	N	0.079265	T	0.18215	0.0437	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.08472	-1.0720	9	0.45353	T	0.12	-8.6192	1.5649	0.02602	0.4574:0.0:0.2452:0.2974	.	191	Q8NHZ7	MB3L2_HUMAN	M	191	.	ENSP00000370800:K191M	K	+	2	0	MBD3L2	7002578	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.913000	0.04042	-1.620000	0.01564	-1.130000	0.01982	AAG	.		0.587	MBD3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458499.1	NM_144614	
MYO1H	283446	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	109838904	109838904	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr12:109838904C>A	ENST00000431443.2	+	5	529	c.529C>A	c.(529-531)Ccc>Acc	p.P177T	MYO1H_ENST00000310903.5_Missense_Mutation_p.P177T	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	177	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						GAAGGGCATTCCCGTAGGTGG	0.463																																					p.P177T		.											.	.	.	0			c.C529A						.						61.0	63.0	62.0					12																	109838904		1944	4147	6091	SO:0001583	missense	283446	exon5			GGCATTCCCGTAG		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.529C>A	12.37:g.109838904C>A	ENSP00000444076:p.Pro177Thr	Somatic	81.0	1.0		WXS	Illumina HiSeq	Phase_I	66.0	8.0	NM_001101421	F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	37		.	.	.	.	.	.	.	.	.	.	C	16.50	3.141578	0.57044	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	T;T	0.71934	-0.61;-0.61	4.49	4.49	0.54785	.	.	.	.	.	T	0.80959	0.4724	M	0.90252	3.1	0.45676	D	0.998594	P	0.52061	0.95	P	0.48334	0.574	D	0.86707	0.1933	9	0.87932	D	0	.	16.5898	0.84762	0.0:1.0:0.0:0.0	.	177	F5H3C6	.	T	177	ENSP00000439182:P177T;ENSP00000444076:P177T	ENSP00000439182:P177T	P	+	1	0	MYO1H	108323287	1.000000	0.71417	0.921000	0.36526	0.504000	0.33889	3.798000	0.55522	2.212000	0.71576	0.644000	0.83932	CCC	.		0.463	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
MYOM2	9172	broad.mit.edu;bcgsc.ca	37	8	2071191	2071191	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr8:2071191A>G	ENST00000262113.4	+	29	3661	c.3520A>G	c.(3520-3522)Aca>Gca	p.T1174A	MYOM2_ENST00000523438.1_Missense_Mutation_p.T599A	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1174	Ig-like C2-type 4.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TGAAACGGAGACACTGCCTAA	0.418																																					p.T1174A		.											.	MYOM2	95	0			c.A3520G						.						113.0	101.0	105.0					8																	2071191		2203	4300	6503	SO:0001583	missense	9172	exon29			ACGGAGACACTGC		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3520A>G	8.37:g.2071191A>G	ENSP00000262113:p.Thr1174Ala	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	A	2.511	-0.312921	0.05422	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.71817	-0.6;-0.6	5.26	2.57	0.30868	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.745999	0.13306	N	0.397853	T	0.32971	0.0847	N	0.00823	-1.155	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.28038	-1.0056	10	0.13108	T	0.6	.	4.7934	0.13259	0.5464:0.0:0.4536:0.0	.	1174	P54296	MYOM2_HUMAN	A	1174;599	ENSP00000262113:T1174A;ENSP00000428396:T599A	ENSP00000262113:T1174A	T	+	1	0	MYOM2	2058598	0.010000	0.17322	0.003000	0.11579	0.002000	0.02628	1.004000	0.29822	0.919000	0.36945	0.460000	0.39030	ACA	.		0.418	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
NCR1	9437	ucsc.edu;bcgsc.ca	37	19	55418067	55418067	+	Missense_Mutation	SNP	C	C	T	rs377608629		TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr19:55418067C>T	ENST00000291890.4	+	3	295	c.257C>T	c.(256-258)cCg>cTg	p.P86L	NCR1_ENST00000594765.1_Missense_Mutation_p.P86L|NCR1_ENST00000357397.5_Intron|NCR1_ENST00000598576.1_Missense_Mutation_p.P74L|NCR1_ENST00000338835.5_Missense_Mutation_p.P86L|NCR1_ENST00000350790.5_Intron|NCR1_ENST00000447255.1_Missense_Mutation_p.P86L	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	86	Ig-like 1.				cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		TTCTACATCCCGGACATGAAC	0.522																																					p.P86L		.											.	NCR1	154	0			c.C257T						.	C	LEU/PRO,LEU/PRO,,,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	73.0	77.0	76.0		257,257,,,257	0.3	0.0	19		76	0,8600		0,0,4300	no	missense,missense,intron,intron,missense	NCR1	NM_001145457.1,NM_001145458.1,NM_001242356.1,NM_001242357.1,NM_004829.5	98,98,,,98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,,,possibly-damaging	86/304,86/288,,,86/305	55418067	1,13005	2203	4300	6503	SO:0001583	missense	9437	exon3			ACATCCCGGACAT	AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.257C>T	19.37:g.55418067C>T	ENSP00000291890:p.Pro86Leu	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001145458	B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Missense_Mutation	SNP	ENST00000291890.4	37	CCDS12911.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.526242	0.27299	2.27E-4	0.0	ENSG00000189430	ENST00000291890;ENST00000447255;ENST00000338835	T;T;T	0.13778	2.56;2.56;2.56	3.74	0.274	0.15654	Immunoglobulin-like fold (1);	1.580720	0.03750	N	0.256417	T	0.11922	0.0290	M	0.72894	2.215	0.09310	N	1	D;B;B	0.58268	0.982;0.017;0.039	B;B;B	0.31245	0.126;0.008;0.009	T	0.40232	-0.9574	10	0.52906	T	0.07	.	1.879	0.03224	0.2038:0.4744:0.1981:0.1237	.	86;86;86	B0V3L5;O76036-6;O76036	.;.;NCTR1_HUMAN	L	86	ENSP00000291890:P86L;ENSP00000404434:P86L;ENSP00000339515:P86L	ENSP00000291890:P86L	P	+	2	0	NCR1	60109879	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.809000	0.04510	0.149000	0.19098	0.555000	0.69702	CCG	.		0.522	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465680.1		
NEB	4703	broad.mit.edu;bcgsc.ca	37	2	152420154	152420154	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr2:152420154A>G	ENST00000172853.10	-	91	13703	c.13556T>C	c.(13555-13557)gTt>gCt	p.V4519A	NEB_ENST00000603639.1_Missense_Mutation_p.V6220A|NEB_ENST00000409198.1_Missense_Mutation_p.V4519A|NEB_ENST00000397345.3_Missense_Mutation_p.V6220A|NEB_ENST00000604864.1_Missense_Mutation_p.V6220A|NEB_ENST00000427231.2_Missense_Mutation_p.V6220A			P20929	NEBU_HUMAN	nebulin	4519					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.V4519A(1)|p.V6220A(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CAGACAGTGAACCACACCAGG	0.443																																					p.V6220A		.											.	NEB	145	2	Substitution - Missense(2)	lung(2)	c.T18659C						.						312.0	293.0	299.0					2																	152420154		1939	4142	6081	SO:0001583	missense	4703	exon119			CAGTGAACCACAC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.13556T>C	2.37:g.152420154A>G	ENSP00000172853:p.Val4519Ala	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	4.0	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	A	16.69	3.192948	0.58017	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	5.54	5.54	0.83059	.	0.304245	0.35585	N	0.003113	T	0.38532	0.1044	N	0.21448	0.665	0.80722	D	1	B;D	0.54047	0.012;0.964	B;D	0.69824	0.097;0.966	T	0.12785	-1.0534	10	0.32370	T	0.25	.	11.8535	0.52425	0.9295:0.0:0.0705:0.0	.	4519;950	P20929;Q14215	NEBU_HUMAN;.	A	4519;6220;6220;568;950;4519	ENSP00000386259:V4519A;ENSP00000380505:V6220A;ENSP00000416578:V6220A;ENSP00000410961:V950A;ENSP00000172853:V4519A	ENSP00000172853:V4519A	V	-	2	0	NEB	152128400	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.362000	0.66098	2.231000	0.72958	0.455000	0.32223	GTT	.		0.443	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NF2	4771	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	30038257	30038258	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr22:30038257_30038258insA	ENST00000338641.4	+	4	871_872	c.430_431insA	c.(430-432)tacfs	p.Y144fs	NF2_ENST00000347330.5_Frame_Shift_Ins_p.Y61fs|NF2_ENST00000361166.4_Frame_Shift_Ins_p.Y144fs|NF2_ENST00000361452.4_Frame_Shift_Ins_p.Y103fs|NF2_ENST00000403999.3_Frame_Shift_Ins_p.Y144fs|NF2_ENST00000361676.4_Frame_Shift_Ins_p.Y102fs|NF2_ENST00000334961.7_Frame_Shift_Ins_p.Y61fs|NF2_ENST00000403435.1_Frame_Shift_Ins_p.Y144fs|NF2_ENST00000397789.3_Frame_Shift_Ins_p.Y144fs|NF2_ENST00000413209.2_Frame_Shift_Ins_p.Y144fs|NF2_ENST00000353887.4_Frame_Shift_Ins_p.Y61fs	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	144	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.Y144fs*1(5)|p.V122_K149del(5)|p.?(2)|p.Y144fs*5(1)|p.Y144fs*29(1)|p.K123fs*2(1)|p.A142fs*8(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CCTGGCTTCTTACGCCGTCCAG	0.45			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.Y144_A145delinsX		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	NF2,NS,meningioma,-2	NF2	4696	16	Deletion - In frame(5)|Insertion - Frameshift(5)|Deletion - Frameshift(4)|Unknown(2)	soft_tissue(8)|meninges(6)|large_intestine(1)|stomach(1)	c.430_431insA	GRCh37	CI045510|CI983522	NF2	I		.																																			SO:0001589	frameshift_variant	4771	exon4	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	GCTTCTTACGCCG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.431dupA	22.37:g.30038258_30038258dupA	ENSP00000344666:p.Tyr144fs	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	9.0	NM_181832	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Nonsense_Mutation	INS	ENST00000338641.4	37	CCDS13861.1																																																																																			.		0.450	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
OR5T2	219464	broad.mit.edu;bcgsc.ca	37	11	56000370	56000370	+	Missense_Mutation	SNP	T	T	C	rs573100944		TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr11:56000370T>C	ENST00000313264.4	-	1	367	c.292A>G	c.(292-294)Atg>Gtg	p.M98V		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					AAATAGTACATGGGTTTGTGG	0.378													t|||	1	0.000199681	0.0	0.0	5008	,	,		22290	0.0		0.0	False		,,,				2504	0.001				p.M98V		.											.	OR5T2	70	0			c.A292G						.						81.0	78.0	79.0					11																	56000370		2201	4296	6497	SO:0001583	missense	219464	exon1			AGTACATGGGTTT	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.292A>G	11.37:g.56000370T>C	ENSP00000323688:p.Met98Val	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_001004746	B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	T	12.28	1.891645	0.33442	.	.	ENSG00000181718	ENST00000313264	T	0.09350	2.99	4.83	4.83	0.62350	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42964	U	0.000638	T	0.24353	0.0590	M	0.88377	2.95	0.40866	D	0.983877	P	0.35714	0.517	B	0.40228	0.323	T	0.11397	-1.0589	10	0.87932	D	0	.	13.7326	0.62797	0.0:0.0:0.0:1.0	.	98	Q8NGG2	OR5T2_HUMAN	V	98	ENSP00000323688:M98V	ENSP00000323688:M98V	M	-	1	0	OR5T2	55756946	1.000000	0.71417	0.915000	0.36163	0.063000	0.16089	6.990000	0.76225	1.950000	0.56595	0.381000	0.24937	ATG	.		0.378	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
PARP16	54956	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	65563339	65563339	+	Silent	SNP	G	G	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr15:65563339G>A	ENST00000261888.6	-	2	691	c.246C>T	c.(244-246)gcC>gcT	p.A82A	PARP16_ENST00000558873.1_5'UTR|PARP16_ENST00000444347.2_Intron	NM_017851.4	NP_060321.3	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16	82	PARP alpha-helical.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell death (GO:0060548)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum tubular network (GO:0071782)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	kinase binding (GO:0019900)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|protein serine/threonine kinase activator activity (GO:0043539)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	9						CCAGGTCCCAGGCCCGTTTGT	0.507																																					p.A82A	NSCLC(50;885 1163 13509 21242 41978)	.											.	PARP16	522	0			c.C246T						.						173.0	169.0	170.0					15																	65563339		2201	4299	6500	SO:0001819	synonymous_variant	54956	exon2			GTCCCAGGCCCGT	AK000516	CCDS10204.1	15q22.2	2010-02-16	2004-08-25	2004-08-25	ENSG00000138617	ENSG00000138617		"""Poly (ADP-ribose) polymerases"""	26040	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 30"""	C15orf30		15273990	Standard	NM_017851		Approved	FLJ20509, FLJ25281, pART15	uc002aoq.3	Q8N5Y8	OTTHUMG00000133138	ENST00000261888.6:c.246C>T	15.37:g.65563339G>A		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	8.0	NM_017851	Q6PK64|Q9NX03	Silent	SNP	ENST00000261888.6	37	CCDS10204.1																																																																																			.		0.507	PARP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256827.2	NM_017851	
PCCB	5096	ucsc.edu;bcgsc.ca	37	3	136012601	136012601	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr3:136012601A>G	ENST00000251654.4	+	7	728	c.658A>G	c.(658-660)Acc>Gcc	p.T220A	PCCB_ENST00000466072.1_Missense_Mutation_p.T220A|PCCB_ENST00000462637.1_Missense_Mutation_p.T197A|PCCB_ENST00000483687.1_Missense_Mutation_p.T201A|PCCB_ENST00000482086.1_Missense_Mutation_p.T104A|PCCB_ENST00000468777.1_Missense_Mutation_p.T251A|PCCB_ENST00000490504.1_Missense_Mutation_p.T163A|PCCB_ENST00000469217.1_Missense_Mutation_p.T240A|PCCB_ENST00000474833.1_3'UTR|PCCB_ENST00000478469.1_Missense_Mutation_p.T220A|PCCB_ENST00000471595.1_Missense_Mutation_p.T220A	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	220	Carboxyltransferase.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	ATTTCAGGACACCTCCTACCT	0.493																																					p.T240A		.											.	PCCB	90	0			c.A718G						.						205.0	197.0	200.0					3																	136012601		2203	4300	6503	SO:0001583	missense	5096	exon8			CAGGACACCTCCT		CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.658A>G	3.37:g.136012601A>G	ENSP00000251654:p.Thr220Ala	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_001178014	B7Z2Z4|Q16813|Q96CX0	Missense_Mutation	SNP	ENST00000251654.4	37	CCDS3089.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.743870	0.89663	.	.	ENSG00000114054	ENST00000251654;ENST00000490504;ENST00000483687;ENST00000468777;ENST00000462637;ENST00000466072;ENST00000482086;ENST00000471595;ENST00000469217;ENST00000478469	D;D;D;D;D;D;D;D;D;D	0.98221	-4.8;-4.5;-4.8;-4.8;-4.5;-4.8;-4.8;-4.8;-4.8;-4.8	5.02	5.02	0.67125	Carboxyl transferase (1);Acetyl-coenzyme A carboxyltransferase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98686	0.9559	M	0.82193	2.58	0.80722	D	1	P;D;P;P	0.55385	0.578;0.971;0.769;0.769	B;P;P;P	0.60068	0.401;0.868;0.469;0.469	D	0.99624	1.0984	10	0.87932	D	0	.	14.7115	0.69235	1.0:0.0:0.0:0.0	.	137;240;220;220	B7Z7U9;B7Z2Z4;E9PDR0;P05166	.;.;.;PCCB_HUMAN	A	220;163;201;251;197;220;104;220;240;220	ENSP00000251654:T220A;ENSP00000418307:T163A;ENSP00000420639:T201A;ENSP00000419129:T251A;ENSP00000420391:T197A;ENSP00000420158:T220A;ENSP00000417253:T104A;ENSP00000417549:T220A;ENSP00000419027:T240A;ENSP00000420759:T220A	ENSP00000251654:T220A	T	+	1	0	PCCB	137495291	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	8.520000	0.90566	2.009000	0.58944	0.528000	0.53228	ACC	.		0.493	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357335.1		
PPP1R3A	5506	broad.mit.edu;bcgsc.ca	37	7	113518454	113518454	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr7:113518454A>G	ENST00000284601.3	-	4	2761	c.2693T>C	c.(2692-2694)gTg>gCg	p.V898A		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	898					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						AGCAGAATGCACAATGGCATC	0.383																																					p.V898A		.											.	PPP1R3A	832	0			c.T2693C						.						88.0	84.0	85.0					7																	113518454		2203	4299	6502	SO:0001583	missense	5506	exon4			GAATGCACAATGG	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2693T>C	7.37:g.113518454A>G	ENSP00000284601:p.Val898Ala	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	5.0	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.733678	0.00687	.	.	ENSG00000154415	ENST00000284601	T	0.15834	2.39	5.44	0.275	0.15659	.	1.567500	0.03495	N	0.217206	T	0.12987	0.0315	L	0.33485	1.01	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.26430	-1.0103	10	0.26408	T	0.33	2.2276	4.1456	0.10214	0.2679:0.0:0.5238:0.2083	.	898	Q16821	PPR3A_HUMAN	A	898	ENSP00000284601:V898A	ENSP00000284601:V898A	V	-	2	0	PPP1R3A	113305690	0.002000	0.14202	0.002000	0.10522	0.007000	0.05969	0.814000	0.27239	0.033000	0.15463	-0.263000	0.10527	GTG	.		0.383	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
RGN	9104	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	46951499	46951499	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chrX:46951499C>A	ENST00000352078.4	+	6	1079	c.734C>A	c.(733-735)aCa>aAa	p.T245K	RGN_ENST00000397180.1_Missense_Mutation_p.T245K|RGN_ENST00000336169.3_Missense_Mutation_p.T245K|RGN_ENST00000457380.1_Missense_Mutation_p.T173K	NM_004683.4	NP_004674.1	Q15493	RGN_HUMAN	regucalcin	245					cellular calcium ion homeostasis (GO:0006874)|L-ascorbic acid biosynthetic process (GO:0019853)|positive regulation of ATPase activity (GO:0032781)|regulation of calcium-mediated signaling (GO:0050848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|enzyme regulator activity (GO:0030234)|gluconolactonase activity (GO:0004341)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	9						GTTGATAAAACAACTTCATGC	0.423																																					p.T245K		.											.	RGN	130	0			c.C734A						.						75.0	69.0	71.0					X																	46951499		2203	4300	6503	SO:0001583	missense	9104	exon6			ATAAAACAACTTC	D31815	CCDS14272.1, CCDS75968.1	Xp11.3	2014-03-14	2013-04-26		ENSG00000130988	ENSG00000130988	3.1.1.17		9989	protein-coding gene	gene with protein product	"""senescence marker protein-30"", ""gluconolactonase"""	300212	"""regucalcin (senescence marker protein-30)"""			7548213	Standard	NM_152869		Approved	SMP30, RC	uc004dha.1	Q15493	OTTHUMG00000021435	ENST00000352078.4:c.734C>A	X.37:g.46951499C>A	ENSP00000253303:p.Thr245Lys	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	11.0	NM_004683	A4FTW1|A8K271|Q53FC9|Q5JRR5	Missense_Mutation	SNP	ENST00000352078.4	37	CCDS14272.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998807	0.74818	.	.	ENSG00000130988	ENST00000397180;ENST00000457380;ENST00000352078;ENST00000336169	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.56	4.69	0.59074	SMP-30/Gluconolaconase/LRE-like region (1);Six-bladed beta-propeller, TolB-like (1);	0.255560	0.44688	D	0.000430	T	0.55784	0.1942	M	0.81112	2.525	0.44807	D	0.997812	D;D	0.89917	1.0;1.0	D;D	0.79784	0.981;0.993	T	0.59043	-0.7528	10	0.51188	T	0.08	-6.6494	13.0624	0.59014	0.0:0.9212:0.0:0.0788	.	173;245	Q15493-2;Q15493	.;RGN_HUMAN	K	245;173;245;245	ENSP00000380365:T245K;ENSP00000406568:T173K;ENSP00000253303:T245K;ENSP00000338400:T245K	ENSP00000338400:T245K	T	+	2	0	RGN	46836443	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	1.650000	0.37292	2.353000	0.79882	0.519000	0.50382	ACA	.		0.423	RGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056385.1	NM_004683	
SERGEF	26297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18010209	18010209	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr11:18010209T>G	ENST00000265965.5	-	8	930	c.779A>C	c.(778-780)cAt>cCt	p.H260P	SERGEF_ENST00000532265.1_Missense_Mutation_p.H146P|SERGEF_ENST00000528200.1_Missense_Mutation_p.H260P	NM_012139.2	NP_036271.1	Q9UGK8	SRGEF_HUMAN	secretion regulating guanine nucleotide exchange factor	260					negative regulation of protein secretion (GO:0050709)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			autonomic_ganglia(1)|central_nervous_system(1)|large_intestine(5)|lung(5)	12						CTGGAAACAATGTGCTTCTAT	0.483																																					p.H260P		.											.	SERGEF	227	0			c.A779C						.						154.0	136.0	142.0					11																	18010209		2200	4293	6493	SO:0001583	missense	26297	exon8			AAACAATGTGCTT	AJ243950	CCDS7828.1	11p14.3	2006-03-09			ENSG00000129158	ENSG00000129158			17499	protein-coding gene	gene with protein product		606051				10571079, 12459492	Standard	NM_012139		Approved	DelGEF, Gnefr	uc001mnm.3	Q9UGK8	OTTHUMG00000166420	ENST00000265965.5:c.779A>C	11.37:g.18010209T>G	ENSP00000265965:p.His260Pro	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	9.0	NM_012139	Q9UGK9	Missense_Mutation	SNP	ENST00000265965.5	37	CCDS7828.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.543|9.543	1.113965|1.113965	0.20795|0.20795	.|.	.|.	ENSG00000129158|ENSG00000129158	ENST00000265965;ENST00000528200;ENST00000532265;ENST00000529728;ENST00000530613|ENST00000529151	T;T;T;T;T|.	0.79454|.	-1.27;-1.27;-1.27;-1.27;-1.27|.	5.63|5.63	-5.82|-5.82	0.02333|0.02333	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);|.	0.695780|.	0.15383|.	N|.	0.265232|.	T|T	0.45696|0.45696	0.1355|0.1355	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	1|1	B;P;B;B|.	0.41748|.	0.001;0.761;0.001;0.011|.	B;B;B;B|.	0.38562|.	0.001;0.276;0.002;0.002|.	T|T	0.52823|0.52823	-0.8524|-0.8524	10|5	0.30854|.	T|.	0.27|.	0.6702|0.6702	10.0267|10.0267	0.42076|0.42076	0.0:0.4495:0.1007:0.4499|0.0:0.4495:0.1007:0.4499	.|.	146;146;260;260|.	B4DFC0;E9PMV6;Q9UGK8-2;Q9UGK8|.	.;.;.;SRGEF_HUMAN|.	P|L	260;260;146;146;146|124	ENSP00000265965:H260P;ENSP00000434188:H260P;ENSP00000431314:H146P;ENSP00000437297:H146P;ENSP00000436080:H146P|.	ENSP00000265965:H260P|.	H|I	-|-	2|1	0|0	SERGEF|SERGEF	17966785|17966785	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.820000|0.820000	0.46376|0.46376	-0.306000|-0.306000	0.08178|0.08178	-0.690000|-0.690000	0.05142|0.05142	-0.353000|-0.353000	0.07706|0.07706	CAT|ATT	.		0.483	SERGEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389538.1	NM_012139	
SLC51A	200931	broad.mit.edu;bcgsc.ca	37	3	195959961	195959961	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr3:195959961A>G	ENST00000296327.5	+	9	1123	c.914A>G	c.(913-915)gAg>gGg	p.E305G	PCYT1A_ENST00000419333.1_Intron	NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	305					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)									Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	CTCATACTGGAGACTTTTCTA	0.468																																					p.E305G		.											.	.	.	0			c.A914G						.						183.0	162.0	169.0					3																	195959961		2203	4300	6503	SO:0001583	missense	200931	exon9			TACTGGAGACTTT		CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.914A>G	3.37:g.195959961A>G	ENSP00000296327:p.Glu305Gly	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_152672	Q6ZMC7	Missense_Mutation	SNP	ENST00000296327.5	37	CCDS3314.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.235512	0.79800	.	.	ENSG00000163959	ENST00000296327	T	0.74209	-0.82	6.03	6.03	0.97812	.	0.000000	0.50627	D	0.000118	D	0.85813	0.5784	M	0.79475	2.455	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.87482	0.2421	10	0.87932	D	0	.	15.3932	0.74767	1.0:0.0:0.0:0.0	.	305	Q86UW1	OSTA_HUMAN	G	305	ENSP00000296327:E305G	ENSP00000296327:E305G	E	+	2	0	AC069257.9	197444358	1.000000	0.71417	0.992000	0.48379	0.684000	0.39900	5.876000	0.69667	2.308000	0.77769	0.533000	0.62120	GAG	.		0.468	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341253.1	NM_152672	
SPRR1B	6699	broad.mit.edu;bcgsc.ca	37	1	153004891	153004891	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr1:153004891C>T	ENST00000307098.4	+	2	135	c.70C>T	c.(70-72)Cct>Tct	p.P24S	SPRR1B_ENST00000392661.3_Missense_Mutation_p.P24S	NM_003125.2	NP_003116.2	P22528	SPR1B_HUMAN	small proline-rich protein 1B	24	2 X 12 AA approximate repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|ovary(2)|skin(2)	9	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGTGAAACAGCCTTGCCAGCC	0.617																																					p.P24S		.											.	SPRR1B	69	0			c.C70T						.						150.0	145.0	147.0					1																	153004891		2203	4300	6503	SO:0001583	missense	6699	exon2			AAACAGCCTTGCC	M84757	CCDS30863.1	1q21-q22	2010-06-25	2010-06-25		ENSG00000169469	ENSG00000169469			11260	protein-coding gene	gene with protein product	"""cornifin"""	182266		SPRR1		8325635, 1438308	Standard	NM_003125		Approved	GADD33	uc001fba.3	P22528	OTTHUMG00000013869	ENST00000307098.4:c.70C>T	1.37:g.153004891C>T	ENSP00000306461:p.Pro24Ser	Somatic	136.0	1.0		WXS	Illumina HiSeq	Phase_I	111.0	6.0	NM_003125	B2R5H7|P22529|P22530|Q5T524	Missense_Mutation	SNP	ENST00000307098.4	37	CCDS30863.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528021	0.64860	.	.	ENSG00000169469	ENST00000307098;ENST00000392661	T;T	0.26810	1.71;1.71	4.12	3.1	0.35709	.	.	.	.	.	T	0.18299	0.0439	.	.	.	0.25060	N	0.991079	P	0.52170	0.951	P	0.49683	0.619	T	0.03175	-1.1064	8	0.87932	D	0	-1.3389	9.041	0.36319	0.0:0.7738:0.2262:0.0	.	24	P22528	SPR1B_HUMAN	S	24	ENSP00000306461:P24S;ENSP00000376429:P24S	ENSP00000306461:P24S	P	+	1	0	SPRR1B	151271515	0.916000	0.31088	1.000000	0.80357	0.998000	0.95712	0.872000	0.28037	2.244000	0.73946	0.655000	0.94253	CCT	.		0.617	SPRR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038906.1	NM_003125	
STRIP2	57464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	129110535	129110535	+	Silent	SNP	G	G	C	rs139413732	byFrequency	TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr7:129110535G>C	ENST00000249344.2	+	18	1963	c.1923G>C	c.(1921-1923)ccG>ccC	p.P641P	STRIP2_ENST00000435494.2_Silent_p.P641P	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	641					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											AGGATTTGCCGGAGCTTACTA	0.448																																					p.P641P		.											.	.	.	0			c.G1923C						.						148.0	125.0	133.0					7																	129110535		2203	4300	6503	SO:0001819	synonymous_variant	57464	exon18			TTTGCCGGAGCTT	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.1923G>C	7.37:g.129110535G>C		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	18.0	NM_020704	Q8WUZ4	Silent	SNP	ENST00000249344.2	37	CCDS34752.1																																																																																			G|0.999;A|0.001		0.448	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336	
TAF1L	138474	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	32631815	32631815	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr9:32631815G>A	ENST00000242310.4	-	1	3852	c.3763C>T	c.(3763-3765)Cgg>Tgg	p.R1255W	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1255					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCCTGGTTCCGCTTAAGCCGC	0.463																																					p.R1255W		.											.	TAF1L	870	0			c.C3763T						.						90.0	89.0	89.0					9																	32631815		2203	4300	6503	SO:0001583	missense	138474	exon1			GGTTCCGCTTAAG	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3763C>T	9.37:g.32631815G>A	ENSP00000418379:p.Arg1255Trp	Somatic	310.0	1.0		WXS	Illumina HiSeq	Phase_I	208.0	28.0	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.803603	0.50315	.	.	ENSG00000122728	ENST00000242310	T	0.66995	-0.24	1.04	-0.675	0.11364	.	0.050642	0.85682	D	0.000000	T	0.71048	0.3294	L	0.54323	1.7	0.48762	D	0.999707	D	0.89917	1.0	D	0.87578	0.998	T	0.69266	-0.5190	10	0.87932	D	0	.	5.5189	0.16921	0.0:0.0:0.6856:0.3144	.	1255	Q8IZX4	TAF1L_HUMAN	W	1255	ENSP00000418379:R1255W	ENSP00000418379:R1255W	R	-	1	2	TAF1L	32621815	1.000000	0.71417	0.991000	0.47740	0.363000	0.29612	2.176000	0.42500	0.507000	0.28148	0.195000	0.17529	CGG	.		0.463	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
TENM3	55714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	183694627	183694627	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr4:183694627A>G	ENST00000511685.1	+	23	5018	c.4895A>G	c.(4894-4896)tAt>tGt	p.Y1632C	RP11-18D7.2_ENST00000513255.1_RNA|TENM3_ENST00000406950.2_Missense_Mutation_p.Y1632C			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1632					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GTATTTAGCTATGACAGTGAA	0.393																																					p.Y1632C		.											.	.	.	0			c.A4895G						.						131.0	120.0	123.0					4																	183694627		1928	4141	6069	SO:0001583	missense	55714	exon22			TTAGCTATGACAG	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.4895A>G	4.37:g.183694627A>G	ENSP00000424226:p.Tyr1632Cys	Somatic	278.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	22.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	A	19.75	3.886486	0.72410	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.16897	2.31;2.31	5.26	5.26	0.73747	.	.	.	.	.	T	0.48537	0.1505	M	0.88906	2.99	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.58476	-0.7630	9	0.87932	D	0	.	15.3531	0.74405	1.0:0.0:0.0:0.0	.	1632	Q9P273	TEN3_HUMAN	C	1632	ENSP00000424226:Y1632C;ENSP00000385276:Y1632C	ENSP00000385276:Y1632C	Y	+	2	0	ODZ3	183931621	1.000000	0.71417	0.999000	0.59377	0.896000	0.52359	8.761000	0.91691	2.207000	0.71202	0.533000	0.62120	TAT	.		0.393	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
TSC2	7249	broad.mit.edu;bcgsc.ca	37	16	2130279	2130279	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr16:2130279delG	ENST00000219476.3	+	30	4141	c.3511delG	c.(3511-3513)gctfs	p.A1171fs	TSC2_ENST00000382538.6_Frame_Shift_Del_p.A1079fs|TSC2_ENST00000439673.2_Frame_Shift_Del_p.A1091fs|TSC2_ENST00000350773.4_Frame_Shift_Del_p.A1171fs|TSC2_ENST00000568454.1_Frame_Shift_Del_p.A1138fs|TSC2_ENST00000401874.2_Frame_Shift_Del_p.A1127fs|TSC2_ENST00000353929.4_Frame_Shift_Del_p.A1128fs	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1171					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GAAGGCCTCAGCTGGCACCCG	0.677			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.A1171fs		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	1908	0			c.3511delG						.						61.0	68.0	66.0					16																	2130279		2198	4298	6496	SO:0001589	frameshift_variant	7249	exon30	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GCCTCAGCTGGCA	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.3511delG	16.37:g.2130279delG	ENSP00000219476:p.Ala1171fs	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	9.0	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Frame_Shift_Del	DEL	ENST00000219476.3	37	CCDS10458.1																																																																																			.		0.677	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
TTC4	7268	ucsc.edu;bcgsc.ca	37	1	55186890	55186890	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr1:55186890G>A	ENST00000371281.3	+	4	533	c.446G>A	c.(445-447)tGc>tAc	p.C149Y	MROH7-TTC4_ENST00000414150.2_3'UTR|TTC4_ENST00000371284.5_3'UTR	NM_004623.4	NP_004614.3	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	149										breast(2)|endometrium(3)|kidney(1)|lung(2)|stomach(1)	9						CTAAAACCCTGCCACCTCAAA	0.363																																					p.C149Y		.											.	TTC4	90	0			c.G446A						.						82.0	75.0	78.0					1																	55186890		2203	4300	6503	SO:0001583	missense	7268	exon4			AACCCTGCCACCT		CCDS596.1	1p32	2013-01-11			ENSG00000243725	ENSG00000243725		"""Tetratricopeptide (TTC) repeat domain containing"""	12394	protein-coding gene	gene with protein product		606753				9933562	Standard	NM_004623		Approved	MGC5097, FLJ41930	uc001cxx.4	O95801	OTTHUMG00000009914	ENST00000371281.3:c.446G>A	1.37:g.55186890G>A	ENSP00000360329:p.Cys149Tyr	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_004623	Q53Y95|Q5TA96|Q9H3I2	Missense_Mutation	SNP	ENST00000371281.3	37	CCDS596.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.458297	0.26248	.	.	ENSG00000243725	ENST00000371281;ENST00000371284	T	0.13420	2.59	5.07	-0.0142	0.13981	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.	.	.	.	T	0.09686	0.0238	L	0.47716	1.5	0.19300	N	0.999976	B;B	0.32862	0.022;0.387	B;B	0.24006	0.008;0.05	T	0.25984	-1.0116	9	0.62326	D	0.03	-0.0224	3.826	0.08855	0.4619:0.0:0.3715:0.1666	.	149;160	O95801;Q5TA95	TTC4_HUMAN;.	Y	149;160	ENSP00000360329:C149Y	ENSP00000360329:C149Y	C	+	2	0	TTC4	54959478	0.314000	0.24563	0.462000	0.27118	0.993000	0.82548	0.708000	0.25719	0.112000	0.17975	-0.224000	0.12420	TGC	.		0.363	TTC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027432.1	NM_004623	
TTN	7273	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179463630	179463630	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A6-01A-11D-A22F-10	TCGA-DD-A3A6-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f03cb4b-60b1-460c-b761-402e7ca09b0d	a63e3270-347f-4de0-b8f5-494e9b555a9d	g.chr2:179463630C>T	ENST00000591111.1	-	241	52108	c.51884G>A	c.(51883-51885)cGa>cAa	p.R17295Q	TTN_ENST00000342175.6_Missense_Mutation_p.R10063Q|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R9996Q|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R9871Q|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R18936Q|TTN_ENST00000342992.6_Missense_Mutation_p.R16368Q|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17295	Fibronectin type-III 25. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATAGGATCTCGGTTAACTCT	0.443																																					p.R18936Q		.											.	TTN	636	0			c.G56807A						.						115.0	114.0	115.0					2																	179463630		1876	4112	5988	SO:0001583	missense	7273	exon291			GGATCTCGGTTAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51884G>A	2.37:g.179463630C>T	ENSP00000465570:p.Arg17295Gln	Somatic	200.0	1.0		WXS	Illumina HiSeq	Phase_I	134.0	15.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	18.33	3.600237	0.66332	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.98	5.98	0.97165	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65333	0.2681	L	0.39085	1.19	0.52501	D	0.999952	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.65233	0.933;0.933;0.933;0.933	T	0.65763	-0.6089	9	0.87932	D	0	.	20.4561	0.99145	0.0:1.0:0.0:0.0	.	9871;9996;10063;17295	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	16368;9871;10063;9996;9869	ENSP00000343764:R16368Q;ENSP00000434586:R9871Q;ENSP00000340554:R10063Q;ENSP00000352154:R9996Q	ENSP00000340554:R10063Q	R	-	2	0	TTN	179171875	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.083000	0.71326	2.843000	0.97960	0.650000	0.86243	CGA	.		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
