#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA8	10351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	66920897	66920897	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr17:66920897A>C	ENST00000269080.2	-	10	1524	c.1387T>G	c.(1387-1389)Ttt>Gtt	p.F463V	ABCA8_ENST00000586539.1_Missense_Mutation_p.F463V|ABCA8_ENST00000430352.2_Missense_Mutation_p.F463V	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	463					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GAGTCATGAAATGAAGGATCG	0.463																																					p.F463V		.											.	ABCA8	93	0			c.T1387G						.						138.0	130.0	133.0					17																	66920897		2203	4300	6503	SO:0001583	missense	10351	exon10			CATGAAATGAAGG	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1387T>G	17.37:g.66920897A>C	ENSP00000269080:p.Phe463Val	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	32.0	NM_007168	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	A	4.381	0.070372	0.08436	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000542396	D;D	0.85702	-2.02;-2.0	4.42	0.988	0.19796	.	0.270264	0.26272	N	0.025322	T	0.58524	0.2128	N	0.03029	-0.43	0.09310	N	1	B;B;B;B;B	0.09022	0.0;0.002;0.0;0.001;0.001	B;B;B;B;B	0.13407	0.002;0.001;0.001;0.009;0.001	T	0.47071	-0.9145	10	0.10902	T	0.67	.	4.0875	0.09953	0.4553:0.0:0.3786:0.1661	.	402;463;463;463;463	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	V	463;463;402;94	ENSP00000269080:F463V;ENSP00000402814:F463V	ENSP00000269080:F463V	F	-	1	0	ABCA8	64432492	0.000000	0.05858	0.003000	0.11579	0.017000	0.09413	0.451000	0.21779	0.041000	0.15688	0.482000	0.46254	TTT	.		0.463	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
ADI1	55256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	3504718	3504718	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:3504718C>A	ENST00000327435.6	-	3	535	c.287G>T	c.(286-288)cGc>cTc	p.R96L	ADI1_ENST00000382093.5_Missense_Mutation_p.R90L	NM_018269.3	NP_060739.2			acireductone dioxygenase 1											breast(2)|large_intestine(2)|lung(4)|ovary(1)|stomach(1)	10	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		CAGGATGTAGCGGATCTCATC	0.532																																					p.R96L		.											.	ADI1	91	0			c.G287T						.						223.0	166.0	185.0					2																	3504718		2203	4300	6503	SO:0001583	missense	55256	exon3			ATGTAGCGGATCT		CCDS1653.1	2p25.2	2013-05-29			ENSG00000182551	ENSG00000182551	1.13.11.54		30576	protein-coding gene	gene with protein product	"""membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1"""	613400				14718544, 15938715	Standard	NM_018269		Approved	SIPL, MTCBP-1, ARD, APL1, FLJ10913, HMFT1638, mtnD	uc002qxp.4	Q9BV57	OTTHUMG00000112441	ENST00000327435.6:c.287G>T	2.37:g.3504718C>A	ENSP00000333666:p.Arg96Leu	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	32.0	NM_018269		Missense_Mutation	SNP	ENST00000327435.6	37	CCDS1653.1	.	.	.	.	.	.	.	.	.	.	C	35	5.487324	0.96323	.	.	ENSG00000182551	ENST00000327435;ENST00000382093	.	.	.	4.73	4.73	0.59995	Cupin, RmlC-type (1);RmlC-like jelly roll fold (1);	0.049866	0.85682	D	0.000000	D	0.85952	0.5817	H	0.95114	3.625	0.80722	D	1	D	0.71674	0.998	D	0.63381	0.914	D	0.90661	0.4590	9	0.87932	D	0	-24.4714	16.6473	0.85179	0.0:1.0:0.0:0.0	.	96	Q9BV57	MTND_HUMAN	L	96;90	.	ENSP00000333666:R96L	R	-	2	0	ADI1	3483725	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.609000	0.67661	2.339000	0.79563	0.655000	0.94253	CGC	.		0.532	ADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000231914.6	NM_018269	
AHNAK2	113146	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105414676	105414676	+	Missense_Mutation	SNP	G	G	A	rs528075601	byFrequency	TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr14:105414676G>A	ENST00000333244.5	-	7	7231	c.7112C>T	c.(7111-7113)cCt>cTt	p.P2371L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2371						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTCAGCGGAAGGGGGCTGAAC	0.662													.|||	13	0.00259585	0.0083	0.0014	5008	,	,		5052	0.001		0.0	False		,,,				2504	0.0				p.P2371L		.											.	AHNAK2	47	0			c.C7112T						.						125.0	138.0	134.0					14																	105414676		1960	4148	6108	SO:0001583	missense	113146	exon7			GCGGAAGGGGGCT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7112C>T	14.37:g.105414676G>A	ENSP00000353114:p.Pro2371Leu	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	34.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	11.96	1.793434	0.31685	.	.	ENSG00000185567	ENST00000333244	T	0.03004	4.08	3.79	2.89	0.33648	.	.	.	.	.	T	0.20292	0.0488	M	0.93328	3.405	0.09310	N	1	D	0.76494	0.999	D	0.72982	0.979	T	0.10497	-1.0627	9	0.66056	D	0.02	.	4.8614	0.13585	0.1144:0.0:0.6724:0.2132	.	2371	Q8IVF2	AHNK2_HUMAN	L	2371	ENSP00000353114:P2371L	ENSP00000353114:P2371L	P	-	2	0	AHNAK2	104485721	0.311000	0.24536	0.003000	0.11579	0.001000	0.01503	3.547000	0.53663	0.571000	0.29365	-0.471000	0.05019	CCT	.		0.662	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ANKIB1	54467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	91936908	91936908	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr7:91936908G>C	ENST00000265742.3	+	3	800	c.424G>C	c.(424-426)Gat>Cat	p.D142H		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	142							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGATGCTGTTGATAACAAAAA	0.368																																					p.D142H		.											.	ANKIB1	432	0			c.G424C						.						64.0	63.0	63.0					7																	91936908		1891	4115	6006	SO:0001583	missense	54467	exon3			GCTGTTGATAACA	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.424G>C	7.37:g.91936908G>C	ENSP00000265742:p.Asp142His	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	22.0	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	ENST00000265742.3	37	CCDS47639.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744459	0.89663	.	.	ENSG00000001629	ENST00000265742	T	0.62105	0.05	5.71	5.71	0.89125	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.87164	0.6109	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90914	0.4778	10	0.87932	D	0	.	19.8516	0.96743	0.0:0.0:1.0:0.0	.	142	Q9P2G1	AKIB1_HUMAN	H	142	ENSP00000265742:D142H	ENSP00000265742:D142H	D	+	1	0	ANKIB1	91774844	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.476000	0.97823	2.685000	0.91497	0.585000	0.79938	GAT	.		0.368	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
ANKRD17	26057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	73990739	73990739	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:73990739T>C	ENST00000358602.4	-	18	3499	c.3383A>G	c.(3382-3384)cAt>cGt	p.H1128R	ANKRD17_ENST00000330838.6_Missense_Mutation_p.H877R|ANKRD17_ENST00000509867.2_Missense_Mutation_p.H1015R|ANKRD17_ENST00000514252.1_5'UTR	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1128					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AACACCAACATGACCAGCTGT	0.448																																					p.H1128R		.											.	ANKRD17	234	0			c.A3383G						.						124.0	116.0	119.0					4																	73990739		2203	4300	6503	SO:0001583	missense	26057	exon18			CCAACATGACCAG	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.3383A>G	4.37:g.73990739T>C	ENSP00000351416:p.His1128Arg	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	43.0	NM_032217	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.667967	0.88348	.	.	ENSG00000132466	ENST00000358602;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.64803	-0.12;-0.12;-0.12	5.65	5.65	0.86999	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000001	T	0.64034	0.2562	N	0.11131	0.1	0.53688	D	0.999976	D;D;D;D;D	0.67145	0.996;0.981;0.989;0.985;0.993	D;P;D;P;P	0.75020	0.979;0.854;0.985;0.657;0.867	T	0.72121	-0.4386	10	0.72032	D	0.01	.	15.8728	0.79136	0.0:0.0:0.0:1.0	.	649;1127;877;1128;1015	B4DR08;O75179-2;G5E964;O75179;E7EUV3	.;.;.;ANR17_HUMAN;.	R	1128;877;1015;1128	ENSP00000351416:H1128R;ENSP00000332265:H877R;ENSP00000427151:H1015R	ENSP00000332265:H877R	H	-	2	0	ANKRD17	74209603	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	2.143000	0.66587	0.477000	0.44152	CAT	.		0.448	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
ANKRD18B	441459	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33548483	33548483	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr9:33548483A>G	ENST00000290943.6	+	9	1607	c.1511A>G	c.(1510-1512)gAt>gGt	p.D504G		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	504										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						GAGACAAGAGATGCTCTCAGG	0.423																																					p.D503G		.											.	.	.	0			c.A1508G						.																																			SO:0001583	missense	441459	exon9			CAAGAGATGCTCT			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.1511A>G	9.37:g.33548483A>G	ENSP00000290943:p.Asp504Gly	Somatic	162.0	1.0		WXS	Illumina HiSeq	Phase_I	170.0	36.0	NM_001244752		Missense_Mutation	SNP	ENST00000290943.6	37		.	.	.	.	.	.	.	.	.	.	a	14.65	2.599721	0.46318	.	.	ENSG00000230453	ENST00000290943	T	0.19250	2.16	1.47	1.47	0.22746	.	.	.	.	.	T	0.20414	0.0491	.	.	.	0.22112	N	0.999359	.	.	.	.	.	.	T	0.24048	-1.0171	5	0.52906	T	0.07	.	4.3935	0.11351	0.6465:0.3535:0.0:0.0	.	.	.	.	G	504	ENSP00000290943:D504G	ENSP00000290943:D504G	D	+	2	0	ANKRD18B	33538483	0.655000	0.27376	0.953000	0.39169	0.314000	0.28054	2.562000	0.45914	0.925000	0.37094	0.248000	0.18094	GAT	.		0.423	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000313729.2	XM_001718334	
APC	324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	112111380	112111380	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr5:112111380C>G	ENST00000457016.1	+	5	857	c.477C>G	c.(475-477)taC>taG	p.Y159*	RNU6-482P_ENST00000391068.1_RNA|APC_ENST00000257430.4_Nonsense_Mutation_p.Y159*|APC_ENST00000508376.2_Nonsense_Mutation_p.Y159*			P25054	APC_HUMAN	adenomatous polyposis coli	159	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)			NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACTGGTATTACGCTCAACTTC	0.289		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Y169X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	12026	0			c.C507G	GRCh37	CM960066	APC	M		.						91.0	98.0	95.0					5																	112111380		2202	4295	6497	SO:0001587	stop_gained	324	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	GTATTACGCTCAA	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.477C>G	5.37:g.112111380C>G	ENSP00000413133:p.Tyr159*	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	61.0	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	32	5.141345	0.94560	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.45	4.28	0.50868	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.5197	11.1583	0.48501	0.0:0.0723:0.0:0.9277	.	.	.	.	X	159;169;159;159;159	.	ENSP00000257430:Y159X	Y	+	3	2	APC	112139279	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.763000	0.26517	0.912000	0.36772	-0.238000	0.12139	TAC	.		0.289	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ARHGEF10L	55160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17942680	17942680	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:17942680A>G	ENST00000361221.3	+	9	977	c.818A>G	c.(817-819)cAc>cGc	p.H273R	ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.H234R|ARHGEF10L_ENST00000375420.3_Missense_Mutation_p.H31R|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.H273R|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.H234R|ARHGEF10L_ENST00000167825.4_5'Flank|ARHGEF10L_ENST00000375408.3_5'Flank	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	273						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		TCCTTCCTGCACAGGAAGGAC	0.627																																					p.H273R		.											.	ARHGEF10L	292	0			c.A818G						.						93.0	79.0	84.0					1																	17942680		2203	4300	6503	SO:0001583	missense	55160	exon9			TCCTGCACAGGAA	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.818A>G	1.37:g.17942680A>G	ENSP00000355060:p.His273Arg	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	51.0	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	CCDS182.1	.	.	.	.	.	.	.	.	.	.	A	5.613	0.297845	0.10622	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420	T;T;T;T;T	0.59224	0.63;0.64;0.44;0.64;0.28	5.19	5.19	0.71726	.	0.204857	0.43110	D	0.000612	T	0.37404	0.1002	N	0.15975	0.35	0.80722	D	1	B;B;B;B;B;B	0.33413	0.0;0.002;0.0;0.002;0.404;0.411	B;B;B;B;B;B	0.36845	0.001;0.007;0.002;0.007;0.234;0.118	T	0.32134	-0.9918	10	0.02654	T	1	-30.851	12.411	0.55468	1.0:0.0:0.0:0.0	.	31;273;39;234;234;273	B4DTE2;Q9HCE6-5;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;ARGAL_HUMAN	R	273;234;273;234;31	ENSP00000355060:H273R;ENSP00000399401:H234R;ENSP00000394621:H273R;ENSP00000364564:H234R;ENSP00000364569:H31R	ENSP00000355060:H273R	H	+	2	0	ARHGEF10L	17815267	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	6.527000	0.73803	1.951000	0.56629	0.460000	0.39030	CAC	.		0.627	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
ASMT	438	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	1752180	1752180	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chrX:1752180G>A	ENST00000381229.4	+	6	736	c.700G>A	c.(700-702)Gaa>Aaa	p.E234K	ASMT_ENST00000381233.3_Intron|ASMT_ENST00000381241.3_Missense_Mutation_p.E262K|ASMT_ENST00000509780.1_Intron			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	234					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	TGACTTCCAGGAAGGTGTGTT	0.498																																					p.E262K		.											.	ASMT	40	0			c.G784A						.						387.0	302.0	331.0					X																	1752180		2203	4296	6499	SO:0001583	missense	438	exon7			TTCCAGGAAGGTG	M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.700G>A	X.37:g.1752180G>A	ENSP00000370627:p.Glu234Lys	Somatic	425.0	2.0		WXS	Illumina HiSeq	Phase_I	483.0	106.0	NM_001171038	B2RC33|Q16598|Q5JQ72|Q5JQ73	Missense_Mutation	SNP	ENST00000381229.4	37		.	.	.	.	.	.	.	.	.	.	g	7.883	0.730727	0.15507	.	.	ENSG00000196433	ENST00000381241;ENST00000381229	T;T	0.25749	1.78;1.78	1.1	1.1	0.20463	.	0.435241	0.21650	U	0.071192	T	0.26521	0.0648	M	0.66939	2.045	0.53005	D	0.999965	P	0.46457	0.878	B	0.44108	0.441	T	0.08576	-1.0715	10	0.22109	T	0.4	.	9.6509	0.39897	0.0:0.0:1.0:0.0	.	262	P46597-3	.	K	262;234	ENSP00000370639:E262K;ENSP00000370627:E234K	ENSP00000370627:E234K	E	+	1	0	ASMT	1712180	0.985000	0.35326	0.094000	0.20943	0.148000	0.21650	2.085000	0.41634	0.466000	0.27193	0.275000	0.19346	GAA	.		0.498	ASMT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055612.1	NM_004043	
ATAD2	29028	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	124382175	124382175	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr8:124382175C>G	ENST00000287394.5	-	7	924	c.817G>C	c.(817-819)Gat>Cat	p.D273H	ATAD2_ENST00000534257.1_5'Flank|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	273	Asp-rich.				ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			tcatcatcatcatcatcatcg	0.363																																					p.D273H		.											.	ATAD2	92	0			c.G817C						.						251.0	191.0	212.0					8																	124382175		2203	4300	6503	SO:0001583	missense	29028	exon7			CATCATCATCATC	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.817G>C	8.37:g.124382175C>G	ENSP00000287394:p.Asp273His	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	315.0	18.0	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	C	2.448	-0.327057	0.05350	.	.	ENSG00000156802	ENST00000287394	T	0.13307	2.6	0.755	0.755	0.18415	.	0.699459	0.15113	N	0.279857	T	0.11324	0.0276	L	0.29908	0.895	0.80722	D	1	P;B	0.44946	0.846;0.0	P;B	0.44946	0.465;0.001	T	0.17561	-1.0365	10	0.49607	T	0.09	.	7.5002	0.27513	0.0:1.0:0.0:0.0	.	103;273	Q6PL18-2;Q6PL18	.;ATAD2_HUMAN	H	273	ENSP00000287394:D273H	ENSP00000287394:D273H	D	-	1	0	ATAD2	124451356	1.000000	0.71417	0.113000	0.21522	0.063000	0.16089	2.695000	0.47043	0.731000	0.32448	0.549000	0.68633	GAT	.		0.363	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
ATP10A	57194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	26026303	26026303	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr15:26026303A>G	ENST00000356865.6	-	2	628	c.517T>C	c.(517-519)Tgc>Cgc	p.C173R		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	173					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ATTTCGTTGCAGCGAAGACGC	0.498																																					p.C173R		.											.	ATP10A	139	0			c.T517C						.						107.0	106.0	106.0					15																	26026303		2203	4300	6503	SO:0001583	missense	57194	exon2			CGTTGCAGCGAAG	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.517T>C	15.37:g.26026303A>G	ENSP00000349325:p.Cys173Arg	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	11.0	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.057409	0.55325	.	.	ENSG00000206190	ENST00000356865	T	0.73047	-0.71	4.67	4.67	0.58626	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.048092	0.85682	D	0.000000	T	0.64450	0.2599	L	0.31752	0.955	0.80722	D	1	B	0.24043	0.096	B	0.36464	0.225	T	0.63139	-0.6704	10	0.40728	T	0.16	-28.913	13.4539	0.61187	1.0:0.0:0.0:0.0	.	173	O60312	AT10A_HUMAN	R	173	ENSP00000349325:C173R	ENSP00000349325:C173R	C	-	1	0	ATP10A	23577396	1.000000	0.71417	0.953000	0.39169	0.310000	0.27922	8.778000	0.91785	1.967000	0.57214	0.459000	0.35465	TGC	.		0.498	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	142275233	142275233	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:142275233C>G	ENST00000350721.4	-	9	2191	c.2070G>C	c.(2068-2070)aaG>aaC	p.K690N	ATR_ENST00000383101.3_Missense_Mutation_p.K626N	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	690					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.K690K(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ACATAAGAATCTTGGGAACTC	0.368								Other conserved DNA damage response genes																													p.K690N		.											.	ATR	1139	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.G2070C						.						55.0	61.0	59.0					3																	142275233		2203	4300	6503	SO:0001583	missense	545	exon9			AAGAATCTTGGGA	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.2070G>C	3.37:g.142275233C>G	ENSP00000343741:p.Lys690Asn	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	43.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.715878	0.30413	.	.	ENSG00000175054	ENST00000350721;ENST00000383101;ENST00000515149	T;T	0.67171	-0.25;-0.25	5.31	4.44	0.53790	Armadillo-like helical (1);Armadillo-type fold (1);	0.175884	0.49305	D	0.000143	T	0.49287	0.1548	L	0.27053	0.805	0.27898	N	0.939099	P	0.38922	0.651	B	0.32677	0.15	T	0.50013	-0.8877	10	0.49607	T	0.09	-3.9732	10.891	0.46996	0.0:0.7998:0.0:0.2002	.	690	Q13535	ATR_HUMAN	N	690;626;307	ENSP00000343741:K690N;ENSP00000372581:K626N	ENSP00000343741:K690N	K	-	3	2	ATR	143757923	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	0.970000	0.29383	1.382000	0.46385	0.585000	0.79938	AAG	.		0.368	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
ATXN2	6311	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	111951212	111951212	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr12:111951212C>T	ENST00000377617.3	-	11	2148	c.1987G>A	c.(1987-1989)Gta>Ata	p.V663I	ATXN2_ENST00000389153.4_Missense_Mutation_p.V398I|ATXN2_ENST00000550104.1_Missense_Mutation_p.V663I|ATXN2_ENST00000608853.1_Missense_Mutation_p.V503I|ATXN2_ENST00000535949.1_Missense_Mutation_p.V374I|ATXN2_ENST00000542287.2_Missense_Mutation_p.V398I	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	663	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						GTCCTTGCTACTGGAGGAGTA	0.507																																					p.V663I		.											.	ATXN2	136	0			c.G1987A						.						109.0	93.0	98.0					12																	111951212		2203	4300	6503	SO:0001583	missense	6311	exon11			TTGCTACTGGAGG	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.1987G>A	12.37:g.111951212C>T	ENSP00000366843:p.Val663Ile	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	6.0	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	37	CCDS31902.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.105245	0.77096	.	.	ENSG00000204842	ENST00000389153;ENST00000377617;ENST00000550104;ENST00000542287;ENST00000535949;ENST00000492467;ENST00000550236	T;T	0.64803	-0.1;-0.12	5.07	3.25	0.37280	.	0.309004	0.34986	N	0.003532	T	0.43411	0.1246	N	0.24115	0.695	0.30602	N	0.760433	B;B;B;B	0.25486	0.127;0.006;0.127;0.012	B;B;B;B	0.24006	0.05;0.005;0.034;0.01	T	0.40098	-0.9581	10	0.37606	T	0.19	-0.8977	7.2842	0.26328	0.1369:0.7164:0.0:0.1467	.	398;663;374;398	B3KT59;Q99700;Q24JQ7;F8VQP2	.;ATX2_HUMAN;.;.	I	398;663;663;398;374;53;78	ENSP00000366843:V663I;ENSP00000446576:V663I	ENSP00000366843:V663I	V	-	1	0	ATXN2	110435595	0.998000	0.40836	0.996000	0.52242	0.994000	0.84299	2.667000	0.46808	0.647000	0.30713	0.650000	0.86243	GTA	.		0.507	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
BDP1	55814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	70766253	70766253	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr5:70766253G>T	ENST00000358731.4	+	7	1214	c.951G>T	c.(949-951)atG>atT	p.M317I	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	317	Myb-like.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		CCATCAGCATGGTAGGAACTG	0.299																																					p.M317I		.											.	BDP1	92	0			c.G951T						.						93.0	85.0	88.0					5																	70766253		1811	4073	5884	SO:0001583	missense	55814	exon7			CAGCATGGTAGGA	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.951G>T	5.37:g.70766253G>T	ENSP00000351575:p.Met317Ile	Somatic	427.0	0.0		WXS	Illumina HiSeq	Phase_I	302.0	66.0	NM_018429	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629902	0.87660	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000444711	T	0.05081	3.5	5.26	5.26	0.73747	SANT domain, DNA binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.20007	0.0481	L	0.46670	1.46	0.80722	D	1	D;D;P	0.59767	0.986;0.982;0.864	D;D;P	0.70935	0.971;0.961;0.706	T	0.00175	-1.1954	10	0.72032	D	0.01	.	17.6188	0.88075	0.0:0.0:1.0:0.0	.	317;317;317	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	I	317	ENSP00000351575:M317I	ENSP00000351575:M317I	M	+	3	0	BDP1	70802009	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.111000	0.94308	2.438000	0.82558	0.563000	0.77884	ATG	.		0.299	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
BMP2K	55589	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	79832589	79832589	+	Missense_Mutation	SNP	C	C	T	rs370861712		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:79832589C>T	ENST00000335016.5	+	16	3054	c.2888C>T	c.(2887-2889)aCg>aTg	p.T963M	PAQR3_ENST00000295462.3_Intron	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	963					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.T963M(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						GATGAAATAACGGGGAGCCAG	0.473													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20763	0.0		0.0	False		,,,				2504	0.0				p.T963M		.											.	BMP2K	383	1	Substitution - Missense(1)	large_intestine(1)	c.C2888T						.	C	MET/THR	2,3784		0,2,1891	60.0	57.0	58.0		2888	5.4	1.0	4		58	0,8216		0,0,4108	no	missense	BMP2K	NM_198892.1	81	0,2,5999	TT,TC,CC		0.0,0.0528,0.0167	probably-damaging	963/1162	79832589	2,12000	1893	4108	6001	SO:0001583	missense	55589	exon16			AAATAACGGGGAG	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.2888C>T	4.37:g.79832589C>T	ENSP00000334836:p.Thr963Met	Somatic	239.0	0.0		WXS	Illumina HiSeq	Phase_I	289.0	27.0	NM_198892	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	ENST00000335016.5	37	CCDS47083.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744393	0.30865	5.28E-4	0.0	ENSG00000138756	ENST00000335016	T	0.74526	-0.85	5.41	5.41	0.78517	.	0.491893	0.18079	N	0.152346	D	0.82742	0.5103	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	P	0.57720	0.826	D	0.84158	0.0427	10	0.87932	D	0	-9.8261	19.1973	0.93695	0.0:1.0:0.0:0.0	.	963	Q9NSY1	BMP2K_HUMAN	M	963	ENSP00000334836:T963M	ENSP00000334836:T963M	T	+	2	0	BMP2K	80051613	0.786000	0.28738	0.978000	0.43139	0.556000	0.35491	3.212000	0.51145	2.538000	0.85594	0.484000	0.47621	ACG	.		0.473	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593	
BTRC	8945	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	103310572	103310573	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr10:103310572_103310573insC	ENST00000370187.3	+	14	1891_1892	c.1773_1774insC	c.(1774-1776)cccfs	p.P592fs	BTRC_ENST00000393441.4_Frame_Shift_Ins_p.P551fs|BTRC_ENST00000493877.1_3'UTR|BTRC_ENST00000408038.2_Frame_Shift_Ins_p.P556fs	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	592			P -> H (in dbSNP:rs2270439).		anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CCCAAGCTGAACCCCCCCGTTC	0.431																																					p.E591fs		.											.	BTRC	659	0			c.1773_1774insC						.																																			SO:0001589	frameshift_variant	8945	exon14			AGCTGAACCCCCC	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1780dupC	10.37:g.103310579_103310579dupC	ENSP00000359206:p.Pro592fs	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	58.0	NM_033637	B5MD49|Q5W141|Q5W142|Q9Y213	Frame_Shift_Ins	INS	ENST00000370187.3	37	CCDS7512.1																																																																																			.		0.431	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
C2orf48	348738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	10350626	10350626	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:10350626C>T	ENST00000381786.3	+	4	672	c.383C>T	c.(382-384)gCg>gTg	p.A128V		NM_182626.2	NP_872432.1	Q96LS8	CB048_HUMAN	chromosome 2 open reading frame 48	128								p.A128V(1)		endometrium(1)|lung(7)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)		GCACAGAGGGCGCTGGGCTCC	0.582																																					p.A128V		.											.	C2orf48	90	1	Substitution - Missense(1)	endometrium(1)	c.C383T						.						63.0	68.0	66.0					2																	10350626		2203	4300	6503	SO:0001583	missense	348738	exon3			AGAGGGCGCTGGG	AK057831	CCDS1670.1	2p25.1	2006-09-01			ENSG00000163009	ENSG00000163009			26322	protein-coding gene	gene with protein product						12477932	Standard	NM_182626		Approved	FLJ25102	uc021vds.1	Q96LS8	OTTHUMG00000119017	ENST00000381786.3:c.383C>T	2.37:g.10350626C>T	ENSP00000371205:p.Ala128Val	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	58.0	NM_182626		Missense_Mutation	SNP	ENST00000381786.3	37	CCDS1670.1	.	.	.	.	.	.	.	.	.	.	c	8.382	0.837748	0.16891	.	.	ENSG00000163009	ENST00000381786	T	0.38401	1.14	1.51	-1.87	0.07737	.	.	.	.	.	T	0.16599	0.0399	N	0.08118	0	0.09310	N	1	B	0.18863	0.031	B	0.06405	0.002	T	0.17440	-1.0369	9	0.87932	D	0	.	5.813	0.18477	0.0:0.5828:0.0:0.4172	.	128	Q96LS8	CB048_HUMAN	V	128	ENSP00000371205:A128V	ENSP00000371205:A128V	A	+	2	0	C2orf48	10268077	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.740000	0.04861	-0.689000	0.05149	-1.197000	0.01672	GCG	.		0.582	C2orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239217.1	NM_182626	
CA4	762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	58233977	58233977	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr17:58233977G>A	ENST00000300900.4	+	3	268	c.169G>A	c.(169-171)Gtc>Atc	p.V57I		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	57					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	CATCAACATCGTCACCACCAA	0.557																																					p.V57I		.											.	CA4	226	0			c.G169A						.						108.0	94.0	99.0					17																	58233977		2203	4300	6503	SO:0001583	missense	762	exon3			AACATCGTCACCA	L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.169G>A	17.37:g.58233977G>A	ENSP00000300900:p.Val57Ile	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	20.0	NM_000717	B4DQA4|Q6FHI7	Missense_Mutation	SNP	ENST00000300900.4	37	CCDS11624.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.565366	0.27915	.	.	ENSG00000167434	ENST00000300900	T	0.66995	-0.24	5.27	4.29	0.51040	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.479266	0.23204	N	0.050749	T	0.53061	0.1773	L	0.48877	1.53	0.09310	N	1	B	0.29835	0.258	B	0.21546	0.035	T	0.34279	-0.9835	10	0.18710	T	0.47	.	9.933	0.41534	0.0932:0.0:0.9068:0.0	.	57	P22748	CAH4_HUMAN	I	57	ENSP00000300900:V57I	ENSP00000300900:V57I	V	+	1	0	CA4	55588759	0.004000	0.15560	0.059000	0.19551	0.305000	0.27757	1.313000	0.33585	2.735000	0.93741	0.655000	0.94253	GTC	.		0.557	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449189.1	NM_000717	
CACNA1F	778	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	49062154	49062154	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chrX:49062154G>T	ENST00000376265.2	-	47	5686	c.5625C>A	c.(5623-5625)ttC>ttA	p.F1875L	CACNA1F_ENST00000376251.1_Missense_Mutation_p.F1810L|AF196779.1_ENST00000583131.1_RNA|CACNA1F_ENST00000323022.5_Missense_Mutation_p.F1864L	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1875					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GCAGACAGGTGAAGGTGCGCA	0.652																																					p.F1875L		.											.	CACNA1F	176	0			c.C5625A						.						51.0	37.0	42.0					X																	49062154		2203	4300	6503	SO:0001583	missense	778	exon47			ACAGGTGAAGGTG	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5625C>A	X.37:g.49062154G>T	ENSP00000365441:p.Phe1875Leu	Somatic	64.0	1.0		WXS	Illumina HiSeq	Phase_I	78.0	43.0	NM_005183	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526852	0.44969	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	T;T;T	0.69561	-0.41;-0.41;-0.41	5.38	2.04	0.26737	.	0.713741	0.14059	N	0.344166	T	0.54224	0.1845	L	0.43152	1.355	0.32866	D	0.508628	B;B	0.24920	0.114;0.07	B;B	0.24394	0.053;0.024	T	0.53563	-0.8421	10	0.11794	T	0.64	.	11.2682	0.49122	0.2078:0.0:0.7922:0.0	.	1864;1875	F5CIQ9;O60840	.;CAC1F_HUMAN	L	1810;1864;1875	ENSP00000365427:F1810L;ENSP00000321618:F1864L;ENSP00000365441:F1875L	ENSP00000321618:F1864L	F	-	3	2	CACNA1F	48949098	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	3.280000	0.51677	0.366000	0.24427	0.594000	0.82650	TTC	.		0.652	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
CDH1	999	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	68845609	68845609	+	Silent	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr16:68845609A>G	ENST00000261769.5	+	7	1046	c.855A>G	c.(853-855)acA>acG	p.T285T	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Silent_p.T285T	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	285	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.E283fs*4(1)|p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGGAGGTCACAGCCACAGACG	0.493			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.T285T		.	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	.	CDH1	3377	2	Unknown(1)|Deletion - Frameshift(1)	breast(2)	c.A855G						.						106.0	93.0	98.0					16																	68845609		2198	4300	6498	SO:0001819	synonymous_variant	999	exon7	Familial Cancer Database	HDGC	GGTCACAGCCACA	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.855A>G	16.37:g.68845609A>G		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	9.0	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Silent	SNP	ENST00000261769.5	37	CCDS10869.1																																																																																			.		0.493	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
CDHR1	92211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	85970872	85970872	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr10:85970872C>A	ENST00000372117.3	+	13	1539	c.1436C>A	c.(1435-1437)gCc>gAc	p.A479D	CDHR1_ENST00000440770.2_Intron|CDHR1_ENST00000332904.3_Missense_Mutation_p.A479D	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	479	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						TACTACGTTGCCAGGATTCCT	0.587																																					p.A479D		.											.	CDHR1	91	0			c.C1436A						.						90.0	87.0	88.0					10																	85970872		2203	4300	6503	SO:0001583	missense	92211	exon13			ACGTTGCCAGGAT	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1436C>A	10.37:g.85970872C>A	ENSP00000361189:p.Ala479Asp	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	20.0	NM_001171971	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725952	0.89298	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.56444	0.46;0.46	5.79	5.79	0.91817	Cadherin (3);Cadherin-like (1);	0.050379	0.85682	D	0.000000	T	0.74906	0.3778	M	0.77616	2.38	0.80722	D	1	P;D	0.89917	0.909;1.0	P;D	0.85130	0.61;0.997	T	0.76966	-0.2763	10	0.87932	D	0	-41.2947	18.8083	0.92047	0.0:1.0:0.0:0.0	.	479;479	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	D	479	ENSP00000331063:A479D;ENSP00000361189:A479D	ENSP00000331063:A479D	A	+	2	0	CDHR1	85960852	1.000000	0.71417	0.999000	0.59377	0.922000	0.55478	5.665000	0.68052	2.735000	0.93741	0.563000	0.77884	GCC	.		0.587	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
CEP135	9662	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	56831901	56831901	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:56831901A>C	ENST00000257287.4	+	8	1044	c.920A>C	c.(919-921)aAt>aCt	p.N307T		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	307					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GAAGTCGTTAATTTAAGTAAC	0.373																																					p.N307T		.											.	CEP135	94	0			c.A920C						.						61.0	61.0	61.0					4																	56831901		2203	4300	6503	SO:0001583	missense	9662	exon8			TCGTTAATTTAAG	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.920A>C	4.37:g.56831901A>C	ENSP00000257287:p.Asn307Thr	Somatic	139.0	1.0		WXS	Illumina HiSeq	Phase_I	157.0	12.0	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	A	12.62	1.993638	0.35131	.	.	ENSG00000174799	ENST00000257287	T	0.44482	0.92	5.67	1.93	0.25924	.	0.275202	0.45126	D	0.000387	T	0.26412	0.0645	L	0.38531	1.155	0.30442	N	0.776076	B	0.16166	0.016	B	0.11329	0.006	T	0.16748	-1.0392	10	0.13853	T	0.58	.	7.4332	0.27139	0.7259:0.1322:0.1419:0.0	.	307	Q66GS9	CP135_HUMAN	T	307	ENSP00000257287:N307T	ENSP00000257287:N307T	N	+	2	0	CEP135	56526658	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	4.080000	0.57620	0.997000	0.38969	0.377000	0.23210	AAT	.		0.373	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
CEP97	79598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	101445524	101445524	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:101445524G>T	ENST00000341893.3	+	2	882	c.130G>T	c.(130-132)Gat>Tat	p.D44Y	CEP97_ENST00000494050.1_Missense_Mutation_p.D44Y|CEP97_ENST00000327230.4_Missense_Mutation_p.D44Y			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	44					cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						TTTGATTCTGGATAAAAATCA	0.353																																					p.D44Y		.											.	CEP97	70	0			c.G130T						.						67.0	69.0	68.0					3																	101445524		2203	4300	6503	SO:0001583	missense	79598	exon2			ATTCTGGATAAAA	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.130G>T	3.37:g.101445524G>T	ENSP00000342510:p.Asp44Tyr	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	18.0	NM_024548	B5MDY8|Q8NA71|Q9H5T9	Missense_Mutation	SNP	ENST00000341893.3	37	CCDS2944.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.094659	0.76870	.	.	ENSG00000182504	ENST00000341893;ENST00000327230;ENST00000494050	T;T;T	0.25579	1.79;1.79;2.22	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.39489	0.1080	N	0.21617	0.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.997	T	0.41592	-0.9500	10	0.87932	D	0	-20.1694	18.2947	0.90141	0.0:0.0:1.0:0.0	.	44;44;44	E9PG22;Q8IW35-2;Q8IW35	.;.;CEP97_HUMAN	Y	44	ENSP00000342510:D44Y;ENSP00000325881:D44Y;ENSP00000418185:D44Y	ENSP00000325881:D44Y	D	+	1	0	CEP97	102928214	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.514000	0.90545	2.379000	0.81126	0.655000	0.94253	GAT	.		0.353	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	NM_024548	
CHD6	84181	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	40049297	40049297	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr20:40049297T>A	ENST00000373233.3	-	31	6155	c.5978A>T	c.(5977-5979)cAt>cTt	p.H1993L		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1993					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TAAAAGCTCATGCTTCACTTT	0.433																																					p.H1993L		.											.	CHD6	238	0			c.A5978T						.						109.0	110.0	109.0					20																	40049297		2203	4300	6503	SO:0001583	missense	84181	exon31			AGCTCATGCTTCA	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.5978A>T	20.37:g.40049297T>A	ENSP00000362330:p.His1993Leu	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	12.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	T	5.046	0.194205	0.09599	.	.	ENSG00000124177	ENST00000373233	D	0.85339	-1.97	5.86	-7.08	0.01558	.	0.773311	0.12065	N	0.502733	T	0.68348	0.2991	L	0.41236	1.265	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.58284	-0.7663	10	0.08381	T	0.77	0.0075	5.121	0.14860	0.0919:0.2863:0.4585:0.1633	.	1993	Q8TD26	CHD6_HUMAN	L	1993	ENSP00000362330:H1993L	ENSP00000362330:H1993L	H	-	2	0	CHD6	39482711	0.002000	0.14202	0.008000	0.14137	0.733000	0.41908	-0.156000	0.10100	-1.226000	0.02574	0.533000	0.62120	CAT	.		0.433	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
COL4A5	1287	broad.mit.edu;bcgsc.ca	37	X	107910381	107910381	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chrX:107910381A>G	ENST00000361603.2	+	40	3816	c.3572A>G	c.(3571-3573)aAc>aGc	p.N1191S	COL4A5_ENST00000328300.6_Missense_Mutation_p.N1191S	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1191	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGCTTTGGAAACCCAGGACCC	0.333									Alport syndrome with Diffuse Leiomyomatosis																												p.N1191S		.											.	COL4A5	133	0			c.A3572G						.						68.0	71.0	70.0					X																	107910381		2203	4300	6503	SO:0001583	missense	1287	exon40	Familial Cancer Database		TTGGAAACCCAGG	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3572A>G	X.37:g.107910381A>G	ENSP00000354505:p.Asn1191Ser	Somatic	111.0	1.0		WXS	Illumina HiSeq	Phase_I	149.0	6.0	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	A	8.955	0.969136	0.18659	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.96334	-3.21;-3.98	5.78	1.83	0.25207	.	0.628047	0.16193	N	0.225289	D	0.85124	0.5625	N	0.02802	-0.49	0.20196	N	0.999924	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.74847	-0.3525	10	0.17832	T	0.49	.	2.7504	0.05279	0.1191:0.0884:0.343:0.4495	.	1191;1191	E7EVY4;P29400	.;CO4A5_HUMAN	S	1191	ENSP00000331902:N1191S;ENSP00000354505:N1191S	ENSP00000331902:N1191S	N	+	2	0	COL4A5	107797037	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.348000	0.44045	0.285000	0.22329	-2.160000	0.00327	AAC	.		0.333	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
CPZ	8532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	8621092	8621092	+	Silent	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:8621092C>T	ENST00000360986.4	+	11	1881	c.1707C>T	c.(1705-1707)gcC>gcT	p.A569A	CPZ_ENST00000429646.2_Silent_p.A177A|CPZ_ENST00000315782.6_Silent_p.A558A|CPZ_ENST00000382480.2_Silent_p.A432A	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	569					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TCATCCCCGCCCGGATGAAGA	0.577																																					p.A569A		.											.	CPZ	93	0			c.C1707T						.						51.0	45.0	47.0					4																	8621092		2203	4300	6503	SO:0001819	synonymous_variant	8532	exon11			CCCCGCCCGGATG	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1707C>T	4.37:g.8621092C>T		Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	193.0	76.0	NM_001014447	O00520|Q96MX2	Silent	SNP	ENST00000360986.4	37	CCDS33953.1																																																																																			.		0.577	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
CREB3L3	84699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4159733	4159733	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr19:4159733A>G	ENST00000078445.2	+	4	677	c.530A>G	c.(529-531)aAt>aGt	p.N177S	CREB3L3_ENST00000602147.1_Missense_Mutation_p.N177S|CREB3L3_ENST00000595923.1_Missense_Mutation_p.N176S|CREB3L3_ENST00000602257.1_Missense_Mutation_p.N177S|CREB3L3_ENST00000252587.3_Intron	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	177					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACGATGCAATCTCACCGTG	0.642																																					p.N177S		.											.	CREB3L3	92	0			c.A530G						.						91.0	84.0	86.0					19																	4159733		2203	4300	6503	SO:0001583	missense	84699	exon4			GATGCAATCTCAC		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.530A>G	19.37:g.4159733A>G	ENSP00000078445:p.Asn177Ser	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	6.0	NM_001271997	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	ENST00000078445.2	37	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	A	3.354	-0.131960	0.06753	.	.	ENSG00000060566	ENST00000078445;ENST00000381943	D	0.82619	-1.63	4.48	-3.74	0.04385	.	3.583700	0.00797	N	0.001389	T	0.64327	0.2588	N	0.17674	0.51	0.23232	N	0.998075	B;B;B;B	0.13594	0.003;0.005;0.008;0.005	B;B;B;B	0.10450	0.005;0.003;0.004;0.002	T	0.55134	-0.8188	10	0.07990	T	0.79	-25.0446	1.213	0.01908	0.3093:0.2114:0.3327:0.1466	.	177;177;176;177	Q68CJ9-3;B7ZL69;Q68CJ9-2;Q68CJ9	.;.;.;CR3L3_HUMAN	S	177	ENSP00000078445:N177S	ENSP00000078445:N177S	N	+	2	0	CREB3L3	4110733	0.012000	0.17670	0.072000	0.20136	0.018000	0.09664	-0.019000	0.12546	-0.424000	0.07382	0.439000	0.28862	AAT	.		0.642	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607	
CREBBP	1387	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3807292	3807292	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr16:3807292T>C	ENST00000262367.5	-	19	4504	c.3695A>G	c.(3694-3696)aAt>aGt	p.N1232S	CREBBP_ENST00000382070.3_Missense_Mutation_p.N1194S	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1232	Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CGCTTACCTATTCTGATAGCT	0.438			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.N1232S		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	1807	0			c.A3695G						.						64.0	54.0	57.0					16																	3807292		2197	4300	6497	SO:0001583	missense	1387	exon19			TACCTATTCTGAT	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3695A>G	16.37:g.3807292T>C	ENSP00000262367:p.Asn1232Ser	Somatic	163.0	1.0		WXS	Illumina HiSeq	Phase_I	141.0	52.0	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	T	16.38	3.108258	0.56291	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.85258	-1.96;-1.89	6.04	6.04	0.98038	Domain of unknown function DUF902, CREBbp (1);	0.000000	0.85682	D	0.000000	D	0.92176	0.7519	M	0.77616	2.38	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.91532	0.5243	10	0.39692	T	0.17	.	16.5885	0.84745	0.0:0.0:0.0:1.0	.	1262;1232	Q4LE28;Q92793	.;CBP_HUMAN	S	1232;1262;1194	ENSP00000262367:N1232S;ENSP00000371502:N1194S	ENSP00000262367:N1232S	N	-	2	0	CREBBP	3747293	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.997000	0.88414	2.317000	0.78254	0.460000	0.39030	AAT	.		0.438	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
CSPG5	10675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47618819	47618819	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:47618819C>G	ENST00000383738.2	-	2	2795	c.697G>C	c.(697-699)Gga>Cga	p.G233R	CSPG5_ENST00000465441.1_5'Flank|CSPG5_ENST00000264723.4_Missense_Mutation_p.G233R|CSPG5_ENST00000456150.1_Missense_Mutation_p.G95R	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	233					axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TCTGAGGTTCCTGGTGACCCT	0.537																																					p.G233R		.											.	CSPG5	91	0			c.G697C						.						39.0	40.0	40.0					3																	47618819		2203	4300	6503	SO:0001583	missense	10675	exon2			AGGTTCCTGGTGA	AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.697G>C	3.37:g.47618819C>G	ENSP00000373244:p.Gly233Arg	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	26.0	NM_006574	Q71M39|Q71M40	Missense_Mutation	SNP	ENST00000383738.2	37	CCDS56253.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.679601	0.88542	.	.	ENSG00000114646	ENST00000456150;ENST00000383738;ENST00000264723	T;T;T	0.65178	-0.14;-0.14;-0.14	4.24	4.24	0.50183	Chondroitin sulphate attachment (1);	0.448932	0.22705	N	0.056653	T	0.67258	0.2874	L	0.27053	0.805	0.38227	D	0.94092	D;D	0.64830	0.994;0.993	D;P	0.65987	0.94;0.9	T	0.73471	-0.3972	10	0.62326	D	0.03	-8.3803	15.7135	0.77649	0.0:1.0:0.0:0.0	.	233;233	O95196;O95196-2	CSPG5_HUMAN;.	R	95;233;233	ENSP00000392096:G95R;ENSP00000373244:G233R;ENSP00000264723:G233R	ENSP00000264723:G233R	G	-	1	0	CSPG5	47593823	0.745000	0.28261	1.000000	0.80357	0.999000	0.98932	3.081000	0.50120	2.349000	0.79799	0.643000	0.83706	GGA	.		0.537	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257489.1	NM_006574	
CTNNA3	29119	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	69299302	69299302	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr10:69299302C>G	ENST00000433211.2	-	4	592	c.418G>C	c.(418-420)Gac>Cac	p.D140H	CTNNA3_ENST00000545309.1_Missense_Mutation_p.D140H|CTNNA3_ENST00000373744.4_Missense_Mutation_p.D140H	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TCAATCATGTCCGCAAGGATA	0.468																																					p.D140H		.											.	CTNNA3	234	0			c.G418C						.						92.0	81.0	85.0					10																	69299302		2203	4300	6503	SO:0001583	missense	29119	exon4			TCATGTCCGCAAG	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.418G>C	10.37:g.69299302C>G	ENSP00000389714:p.Asp140His	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	18.0	NM_001127384		Missense_Mutation	SNP	ENST00000433211.2	37	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.263334	0.80358	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309;ENST00000330298;ENST00000540598	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.18	5.18	0.71444	.	0.000000	0.50627	D	0.000115	T	0.80879	0.4708	M	0.72479	2.2	0.52501	D	0.999952	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.998	T	0.83121	-0.0118	10	0.87932	D	0	-14.108	15.5958	0.76578	0.0:1.0:0.0:0.0	.	140;140;140	F2Z2R0;Q9UI47-2;Q9UI47	.;.;CTNA3_HUMAN	H	140	ENSP00000389714:D140H;ENSP00000362849:D140H;ENSP00000441444:D140H;ENSP00000330570:D140H	ENSP00000330570:D140H	D	-	1	0	CTNNA3	68969308	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	6.084000	0.71335	2.393000	0.81446	0.585000	0.79938	GAC	.		0.468	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
DAGLA	747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	61496465	61496465	+	Silent	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr11:61496465C>A	ENST00000257215.5	+	8	950	c.834C>A	c.(832-834)ctC>ctA	p.L278L		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	278					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CCAAGTACCTCGACCTCAAGA	0.547																																					p.L278L		.											.	DAGLA	92	0			c.C834A						.						236.0	190.0	206.0					11																	61496465		2202	4299	6501	SO:0001819	synonymous_variant	747	exon8			GTACCTCGACCTC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.834C>A	11.37:g.61496465C>A		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	18.0	NM_006133	A7E233|Q6WQJ0	Silent	SNP	ENST00000257215.5	37	CCDS31578.1																																																																																			.		0.547	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
DCK	1633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71889378	71889378	+	Silent	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:71889378A>G	ENST00000286648.5	+	4	901	c.504A>G	c.(502-504)caA>caG	p.Q168Q	DCK_ENST00000504730.1_Silent_p.Q168Q|DCK_ENST00000504952.1_Silent_p.Q168Q	NM_000788.2	NP_000779.1	P27707	DCK_HUMAN	deoxycytidine kinase	168					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxycytidine kinase activity (GO:0004137)|drug binding (GO:0008144)|nucleoside kinase activity (GO:0019206)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)	9			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Cytarabine(DB00987)|Decitabine(DB01262)|Emtricitabine(DB00879)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Lamivudine(DB00709)|Nelarabine(DB01280)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	AATTTGGCCAAAGCCTTGAAT	0.333																																					p.Q168Q		.											.	DCK	116	0			c.A504G						.						82.0	85.0	84.0					4																	71889378		2203	4300	6503	SO:0001819	synonymous_variant	1633	exon4			TGGCCAAAGCCTT	M60527	CCDS3548.1	4q13.3-q21.1	2008-02-05			ENSG00000156136	ENSG00000156136	2.7.1.74		2704	protein-coding gene	gene with protein product		125450				8406512	Standard	NM_000788		Approved		uc003hfx.3	P27707	OTTHUMG00000129908	ENST00000286648.5:c.504A>G	4.37:g.71889378A>G		Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	229.0	22.0	NM_000788	B2R8V6|Q5TZY7|Q6FI11	Silent	SNP	ENST00000286648.5	37	CCDS3548.1																																																																																			.		0.333	DCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252159.2		
DDX56	54606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44609640	44609640	+	Silent	SNP	A	A	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr7:44609640A>T	ENST00000258772.5	-	8	1204	c.1098T>A	c.(1096-1098)ccT>ccA	p.P366P	DDX56_ENST00000485367.1_5'UTR|DDX56_ENST00000431640.1_Silent_p.P326P	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	366	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						TGTAGGCCTCAGGGGTTGGGG	0.592																																					p.P366P		.											.	DDX56	227	0			c.T1098A						.						92.0	83.0	86.0					7																	44609640		2203	4300	6503	SO:0001819	synonymous_variant	54606	exon8			GGCCTCAGGGGTT	AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.1098T>A	7.37:g.44609640A>T		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	20.0	NM_019082	A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Silent	SNP	ENST00000258772.5	37	CCDS5492.1																																																																																			.		0.592	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251291.1	NM_019082	
DENND2C	163259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115143496	115143496	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:115143496G>T	ENST00000393274.1	-	14	2526	c.1901C>A	c.(1900-1902)cCa>cAa	p.P634Q	DENND2C_ENST00000393276.3_Missense_Mutation_p.P577Q|DENND2C_ENST00000393277.1_Missense_Mutation_p.P634Q|DENND2C_ENST00000481894.1_5'UTR	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	634	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCAGGAGCTGGGAAAGGAGC	0.443																																					p.P634Q		.											.	DENND2C	229	0			c.C1901A						.						128.0	124.0	126.0					1																	115143496		2203	4300	6503	SO:0001583	missense	163259	exon14			GGAGCTGGGAAAG		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.1901C>A	1.37:g.115143496G>T	ENSP00000376955:p.Pro634Gln	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	27.0	NM_001256404	B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	ENST00000393274.1	37	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025505	0.93518	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.67171	-0.25;-0.25;-0.25	5.18	5.18	0.71444	DENN (3);	0.000000	0.85682	D	0.000000	D	0.87669	0.6235	H	0.97415	4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.92072	0.5665	10	0.87932	D	0	.	18.7701	0.91888	0.0:0.0:1.0:0.0	.	634;577	Q68D51;Q68D51-3	DEN2C_HUMAN;.	Q	577;634;634;634	ENSP00000376957:P577Q;ENSP00000376955:P634Q;ENSP00000376958:P634Q	ENSP00000358553:P634Q	P	-	2	0	DENND2C	114945019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.431000	0.82371	0.650000	0.86243	CCA	.		0.443	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84832627	84832627	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:84832627G>A	ENST00000237449.6	+	19	3093	c.3085G>A	c.(3085-3087)Gag>Aag	p.E1029K	DNAH6_ENST00000389394.3_Missense_Mutation_p.E1029K|DNAH6_ENST00000398278.2_Missense_Mutation_p.E1029K			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1029	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TTCTAAGGTGGAGGACTCTTG	0.368																																					p.E1029K		.											.	DNAH6	69	0			c.G3085A						.						202.0	171.0	181.0					2																	84832627		692	1591	2283	SO:0001583	missense	1768	exon20			AAGGTGGAGGACT	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.3085G>A	2.37:g.84832627G>A	ENSP00000237449:p.Glu1029Lys	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	40.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992448	0.93167	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.60672	0.17;0.17;0.17	5.63	5.63	0.86233	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.53626	0.1808	L	0.38733	1.17	0.51767	D	0.99993	P	0.37370	0.592	B	0.40329	0.326	T	0.49380	-0.8946	9	0.31617	T	0.26	.	18.4531	0.90711	0.0:0.0:1.0:0.0	.	1029	Q9C0G6	DYH6_HUMAN	K	1029	ENSP00000374045:E1029K;ENSP00000381326:E1029K;ENSP00000237449:E1029K	ENSP00000237449:E1029K	E	+	1	0	DNAH6	84686138	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.043000	0.71004	2.654000	0.90174	0.655000	0.94253	GAG	.		0.368	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DPYD	1806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	97564053	97564053	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:97564053T>C	ENST00000370192.3	-	21	2858	c.2758A>G	c.(2758-2760)Acc>Gcc	p.T920A	DPYD-AS1_ENST00000422980.1_RNA	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	920					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	ACCTTGATGGTAGGAATAGGC	0.294																																					p.T920A		.											.	DPYD	278	0			c.A2758G						.						148.0	157.0	154.0					1																	97564053		2203	4300	6503	SO:0001583	missense	1806	exon21			TGATGGTAGGAAT	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.2758A>G	1.37:g.97564053T>C	ENSP00000359211:p.Thr920Ala	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	40.0	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	T	2.331	-0.353436	0.05173	.	.	ENSG00000188641	ENST00000370192	D	0.89810	-2.57	5.66	-7.03	0.01584	.	0.591910	0.17496	N	0.172164	T	0.43612	0.1255	N	0.01122	-1.005	0.21579	N	0.999635	B	0.02656	0.0	B	0.04013	0.001	T	0.52946	-0.8507	10	0.22109	T	0.4	0.0	13.2935	0.60284	0.0844:0.7307:0.0:0.1848	.	920	Q12882	DPYD_HUMAN	A	920	ENSP00000359211:T920A	ENSP00000359211:T920A	T	-	1	0	DPYD	97336641	0.000000	0.05858	0.009000	0.14445	0.193000	0.23685	-2.454000	0.01004	-1.291000	0.02368	-0.462000	0.05337	ACC	.		0.294	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
DUSP5	1847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	112262621	112262621	+	Silent	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr10:112262621T>C	ENST00000369583.3	+	2	806	c.522T>C	c.(520-522)taT>taC	p.Y174Y	DUSP5_ENST00000468749.1_3'UTR	NM_004419.3	NP_004410.3	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	174					endoderm formation (GO:0001706)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			kidney(2)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	13		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		GGCCAGCTTATGACCAGGTAC	0.502																																					p.Y174Y		.											.	DUSP5	659	0			c.T522C						.						187.0	154.0	165.0					10																	112262621		2203	4300	6503	SO:0001819	synonymous_variant	1847	exon2			AGCTTATGACCAG	U16996	CCDS7566.1	10q25	2011-06-09			ENSG00000138166	ENSG00000138166		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3071	protein-coding gene	gene with protein product		603069				7806236	Standard	NM_004419		Approved	HVH3	uc001kzd.3	Q16690	OTTHUMG00000019040	ENST00000369583.3:c.522T>C	10.37:g.112262621T>C		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	40.0	NM_004419	Q12997|Q5T603	Silent	SNP	ENST00000369583.3	37	CCDS7566.1																																																																																			.		0.502	DUSP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050333.1	NM_004419	
MICU3	286097	ucsc.edu;bcgsc.ca	37	8	16956032	16956032	+	Silent	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr8:16956032A>G	ENST00000318063.5	+	9	996	c.954A>G	c.(952-954)acA>acG	p.T318T		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	318						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)										GACGTAACACAAGCCAAGCAC	0.383																																					p.T318T		.											.	EFHA2	91	0			c.A954G						.						166.0	156.0	160.0					8																	16956032		2203	4300	6503	SO:0001819	synonymous_variant	286097	exon9			TAACACAAGCCAA	BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.954A>G	8.37:g.16956032A>G		Somatic	53.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_181723	Q8IYZ3	Silent	SNP	ENST00000318063.5	37	CCDS5999.1	.	.	.	.	.	.	.	.	.	.	A	9.080	0.998969	0.19121	.	.	ENSG00000155970	ENST00000519044	.	.	.	5.24	-1.5	0.08691	.	.	.	.	.	T	0.50633	0.1627	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39742	-0.9599	4	.	.	.	-13.6089	6.1545	0.20330	0.6106:0.1223:0.2671:0.0	.	.	.	.	R	163	.	.	Q	+	2	0	EFHA2	17000403	0.987000	0.35691	0.959000	0.39883	0.960000	0.62799	0.358000	0.20216	-0.409000	0.07553	-1.106000	0.02097	CAA	.		0.383	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214031.1	NM_181723	
ESM1	11082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	54281083	54281083	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr5:54281083C>A	ENST00000381405.4	-	1	408	c.263G>T	c.(262-264)gGg>gTg	p.G88V	ESM1_ENST00000598310.1_Intron|ESM1_ENST00000381403.4_Missense_Mutation_p.G88V	NM_007036.4	NP_008967.1	Q9NQ30	ESM1_HUMAN	endothelial cell-specific molecule 1	88	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of hepatocyte growth factor receptor signaling pathway (GO:1902204)|regulation of cell growth (GO:0001558)|sprouting angiogenesis (GO:0002040)	extracellular region (GO:0005576)	hepatocyte growth factor receptor binding (GO:0005171)|integrin binding (GO:0005178)			breast(1)|kidney(1)|large_intestine(4)|lung(4)	10		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.116)	Lung(15;0.23)			AGGATCCTCCCCATTAGAAGG	0.572																																					p.G88V		.											.	ESM1	90	0			c.G263T						.						97.0	98.0	98.0					5																	54281083		2203	4300	6503	SO:0001583	missense	11082	exon1			TCCTCCCCATTAG	X89426	CCDS3963.1, CCDS47206.1	5q11	2008-02-05			ENSG00000164283	ENSG00000164283			3466	protein-coding gene	gene with protein product		601521				8702785	Standard	NM_001135604		Approved		uc003jpk.3	Q9NQ30	OTTHUMG00000097010	ENST00000381405.4:c.263G>T	5.37:g.54281083C>A	ENSP00000370812:p.Gly88Val	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	16.0	NM_001135604	B2R4G3|Q15330|Q3V4E3|Q96ES3	Missense_Mutation	SNP	ENST00000381405.4	37	CCDS3963.1	.	.	.	.	.	.	.	.	.	.	C	11.96	1.793817	0.31777	.	.	ENSG00000164283	ENST00000381405;ENST00000381403	T;T	0.66638	-0.22;-0.22	5.56	3.08	0.35506	Insulin-like growth factor-binding protein, IGFBP (2);	0.392618	0.27563	N	0.018808	T	0.58148	0.2102	M	0.61703	1.905	0.48341	D	0.999633	B;B	0.23442	0.029;0.085	B;B	0.19666	0.016;0.026	T	0.54029	-0.8354	10	0.35671	T	0.21	-11.6547	6.8558	0.24040	0.1337:0.0759:0.0:0.7904	.	88;88	Q3V4E3;Q9NQ30	.;ESM1_HUMAN	V	88	ENSP00000370812:G88V;ENSP00000370810:G88V	ENSP00000370810:G88V	G	-	2	0	ESM1	54316840	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	4.053000	0.57427	0.941000	0.37499	-0.471000	0.05019	GGG	.		0.572	ESM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214099.2	NM_007036	
EIF4E1B	253314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176070692	176070692	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr5:176070692C>G	ENST00000318682.6	+	5	837	c.253C>G	c.(253-255)Ctg>Gtg	p.L85V	EIF4E1B_ENST00000504597.1_Missense_Mutation_p.L85V	NM_001099408.1	NP_001092878.1	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E family member 1B	85					regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)	translation initiation factor activity (GO:0003743)			breast(1)|large_intestine(1)|lung(2)|pancreas(1)	5	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGGACAACCTGCACCTGGT	0.632																																					p.L85V		.											.	.	.	0			c.C253G						.						29.0	33.0	32.0					5																	176070692		2053	4183	6236	SO:0001583	missense	253314	exon5			GACAACCTGCACC		CCDS47345.1	5q35.2	2008-06-12			ENSG00000175766	ENSG00000175766			33179	protein-coding gene	gene with protein product						16191198	Standard	NM_001099408		Approved	FLJ36951	uc010jkf.1	A6NMX2	OTTHUMG00000163227	ENST00000318682.6:c.253C>G	5.37:g.176070692C>G	ENSP00000323714:p.Leu85Val	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	42.0	NM_001099408		Missense_Mutation	SNP	ENST00000318682.6	37	CCDS47345.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.443683	0.63067	.	.	ENSG00000175766	ENST00000318682;ENST00000510660;ENST00000504597	T;T;T	0.53640	0.61;0.61;0.61	5.33	2.58	0.30949	Translation Initiation factor eIF- 4e-like  domain (2);	0.000000	0.64402	D	0.000009	T	0.70325	0.3211	M	0.91249	3.19	0.46131	D	0.998884	P	0.48089	0.905	D	0.66979	0.948	T	0.70310	-0.4907	10	0.72032	D	0.01	.	8.53	0.33329	0.0:0.6221:0.0:0.3779	.	85	A6NMX2	I4E1B_HUMAN	V	85	ENSP00000323714:L85V;ENSP00000421009:L85V;ENSP00000427633:L85V	ENSP00000323714:L85V	L	+	1	2	EIF4E1B	176003298	0.927000	0.31430	0.526000	0.27913	0.835000	0.47333	0.952000	0.29149	0.249000	0.21456	0.491000	0.48974	CTG	.		0.632	EIF4E1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372187.1	NM_001099408	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	64431532	64431532	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr6:64431532G>T	ENST00000370621.3	-	44	8984	c.8458C>A	c.(8458-8460)Cta>Ata	p.L2820I	EYS_ENST00000503581.1_Missense_Mutation_p.L2799I|EYS_ENST00000370616.2_Missense_Mutation_p.L2820I			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2820	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ATCCCATCTAGATCCAGGTAG	0.368																																					p.L2799I		.											.	EYS	660	0			c.C8395A						.						293.0	231.0	250.0					6																	64431532		692	1591	2283	SO:0001583	missense	346007	exon43			CATCTAGATCCAG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.8458C>A	6.37:g.64431532G>T	ENSP00000359655:p.Leu2820Ile	Somatic	229.0	0.0		WXS	Illumina HiSeq	Phase_I	330.0	35.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	G	15.72	2.918076	0.52546	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	T;T;T	0.74947	-0.89;-0.89;-0.89	4.71	-0.644	0.11479	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.50627	U	0.000107	T	0.50735	0.1633	L	0.31845	0.965	0.80722	D	1	D;D	0.62365	0.988;0.991	P;P	0.57283	0.721;0.817	T	0.55321	-0.8159	10	0.10902	T	0.67	.	4.7799	0.13197	0.3567:0.1477:0.4956:0.0	.	2799;2820	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	I	2799;2820;2820	ENSP00000424243:L2799I;ENSP00000359655:L2820I;ENSP00000359650:L2820I	ENSP00000359650:L2820I	L	-	1	2	EYS	64489491	0.977000	0.34250	0.920000	0.36463	0.939000	0.58152	0.919000	0.28692	-0.226000	0.09899	0.650000	0.86243	CTA	.		0.368	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
EYS	346007	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	65767615	65767615	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr6:65767615G>A	ENST00000370621.3	-	13	2555	c.2029C>T	c.(2029-2031)Caa>Taa	p.Q677*	EYS_ENST00000503581.1_Nonsense_Mutation_p.Q677*|EYS_ENST00000370616.2_Nonsense_Mutation_p.Q677*			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	677	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ATTTCACATTGCGTACCTTTG	0.388																																					p.Q677X		.											.	EYS	660	0			c.C2029T						.						171.0	138.0	148.0					6																	65767615		692	1591	2283	SO:0001587	stop_gained	346007	exon13			CACATTGCGTACC		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2029C>T	6.37:g.65767615G>A	ENSP00000359655:p.Gln677*	Somatic	145.0	1.0		WXS	Illumina HiSeq	Phase_I	224.0	61.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Nonsense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	G	35	5.438838	0.96168	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	.	.	.	5.58	0.0333	0.14179	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	4.192	0.10426	0.1183:0.0675:0.3739:0.4403	.	.	.	.	X	677	.	ENSP00000359650:Q677X	Q	-	1	0	EYS	65824336	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.173000	0.16724	0.069000	0.16605	-0.335000	0.08231	CAA	.		0.388	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FAM182A	284800	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	26063603	26063603	+	RNA	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr20:26063603A>G	ENST00000376398.2	+	0	1120					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						AGCAAGGAGCATGATGGTACT	0.458																																					.		.											.	.	.	0			.						.						62.0	44.0	50.0					20																	26063603		692	1575	2267			284800	.			AGGAGCATGATGG	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26063603A>G		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	19.0	.	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	3.936	-0.015216	0.07681	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.329	-0.658	0.11428	.	.	.	.	.	T	0.35970	0.0950	.	.	.	0.09310	N	0.99999	.	.	.	.	.	.	T	0.37174	-0.9717	4	0.87932	D	0	.	.	.	.	.	.	.	.	R	151	.	ENSP00000246000:H151R	H	+	2	0	FAM182A	26011603	0.066000	0.20996	0.253000	0.24343	0.152000	0.21847	0.189000	0.17037	-0.832000	0.04251	0.104000	0.15600	CAT	.		0.458	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
FAM227B	196951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49659729	49659729	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr15:49659729T>C	ENST00000299338.6	-	13	1490	c.1187A>G	c.(1186-1188)tAt>tGt	p.Y396C		NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	396																	CTTAAGATAATATAAAATCAA	0.358																																					p.Y396C		.											.	.	.	0			c.A1187G						.						82.0	88.0	86.0					15																	49659729		2196	4294	6490	SO:0001583	missense	196951	exon13			AGATAATATAAAA		CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.1187A>G	15.37:g.49659729T>C	ENSP00000299338:p.Tyr396Cys	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	42.0	NM_152647	Q86WS2	Missense_Mutation	SNP	ENST00000299338.6	37	CCDS32237.1	.	.	.	.	.	.	.	.	.	.	T	16.80	3.223582	0.58668	.	.	ENSG00000166262	ENST00000299338	.	.	.	5.16	5.16	0.70880	.	0.000000	0.45126	D	0.000388	T	0.76622	0.4013	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.68943	0.961	T	0.79140	-0.1926	9	0.62326	D	0.03	-7.1496	14.1245	0.65210	0.0:0.0:0.0:1.0	.	396	Q96M60	CO033_HUMAN	C	396	.	ENSP00000299338:Y396C	Y	-	2	0	C15orf33	47447021	0.997000	0.39634	0.996000	0.52242	0.589000	0.36550	4.386000	0.59620	2.179000	0.69175	0.528000	0.53228	TAT	.		0.358	FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417872.1	NM_152647	
FAP	2191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	163029733	163029733	+	Splice_Site	SNP	T	T	C	rs566100960		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:163029733T>C	ENST00000188790.4	-	24	2242		c.e24-2		AC007750.5_ENST00000418968.3_RNA|FAP_ENST00000443424.1_Splice_Site	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						AGTTGAATTCTGGAAAAGAGA	0.353																																					.		.											.	FAP	93	0			c.2035-2A>G						.						82.0	84.0	83.0					2																	163029733		2203	4300	6503	SO:0001630	splice_region_variant	2191	exon25			GAATTCTGGAAAA	U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.2035-2A>G	2.37:g.163029733T>C		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	205.0	66.0	NM_004460		Splice_Site	SNP	ENST00000188790.4	37	CCDS33311.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.391949	0.62066	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1172	0.81314	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAP	162737979	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.316000	0.79007	2.266000	0.75297	0.533000	0.62120	.	.		0.353	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2		Intron
FAP	2191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	163044766	163044766	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:163044766C>A	ENST00000188790.4	-	20	1934	c.1727G>T	c.(1726-1728)gGa>gTa	p.G576V	FAP_ENST00000443424.1_Missense_Mutation_p.G551V	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						GAAAGCTGTTCCTCGACCATC	0.458																																					p.G576V		.											.	FAP	93	0			c.G1727T						.						165.0	147.0	153.0					2																	163044766		2203	4300	6503	SO:0001583	missense	2191	exon20			GCTGTTCCTCGAC	U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.1727G>T	2.37:g.163044766C>A	ENSP00000188790:p.Gly576Val	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	61.0	NM_004460		Missense_Mutation	SNP	ENST00000188790.4	37	CCDS33311.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319799	0.81469	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	T;T	0.69175	-0.38;-0.38	6.07	6.07	0.98685	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90349	0.6980	H	0.99026	4.405	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93293	0.6670	10	0.87932	D	0	-16.2334	20.6593	0.99626	0.0:1.0:0.0:0.0	.	551;55;576	B4DLR2;Q12884-2;Q12884	.;.;SEPR_HUMAN	V	576;551	ENSP00000188790:G576V;ENSP00000411391:G551V	ENSP00000188790:G576V	G	-	2	0	FAP	162753012	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.267000	0.78462	2.885000	0.99019	0.655000	0.94253	GGA	.		0.458	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2		
FARP1	10160	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	99099038	99099038	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr13:99099038A>G	ENST00000319562.6	+	26	3288	c.3023A>G	c.(3022-3024)tAc>tGc	p.Y1008C	FARP1_ENST00000376586.2_Missense_Mutation_p.Y1039C|FARP1_ENST00000595437.1_Missense_Mutation_p.Y1039C	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	1008	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CACGTCTACTACTTCAGGGCG	0.557																																					p.Y1008C		.											.	FARP1	290	0			c.A3023G						.						186.0	139.0	155.0					13																	99099038		2203	4300	6503	SO:0001583	missense	10160	exon26			TCTACTACTTCAG	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.3023A>G	13.37:g.99099038A>G	ENSP00000322926:p.Tyr1008Cys	Somatic	74.0	1.0		WXS	Illumina HiSeq	Phase_I	82.0	30.0	NM_005766	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	a	19.84	3.902081	0.72754	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.14766	2.48;2.48	5.45	4.26	0.50523	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.063430	0.64402	D	0.000003	T	0.23532	0.0569	N	0.25485	0.75	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.75484	0.979;0.986	T	0.01440	-1.1354	10	0.87932	D	0	.	11.9357	0.52872	0.8697:0.0:0.0:0.1303	.	1008;1039	Q9Y4F1;C9JME2	FARP1_HUMAN;.	C	1039;1008	ENSP00000365771:Y1039C;ENSP00000322926:Y1008C	ENSP00000322926:Y1008C	Y	+	2	0	FARP1	97897039	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.266000	0.58871	0.905000	0.36596	-0.376000	0.06991	TAC	.		0.557	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
FREM1	158326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	14784488	14784488	+	Missense_Mutation	SNP	T	T	C	rs376519870		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr9:14784488T>C	ENST00000380880.3	-	24	5105	c.4322A>G	c.(4321-4323)cAg>cGg	p.Q1441R	FREM1_ENST00000380881.4_Missense_Mutation_p.Q1442R|FREM1_ENST00000422223.2_Missense_Mutation_p.Q1441R			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1441					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		ATATTCGATCTGGCCATATCG	0.493																																					p.Q1441R		.											.	FREM1	138	0			c.A4322G						.	T	ARG/GLN	1,3983		0,1,1991	106.0	104.0	104.0		4322	3.2	0.6	9		104	0,8288		0,0,4144	no	missense	FREM1	NM_144966.5	43	0,1,6135	CC,CT,TT		0.0,0.0251,0.0081	benign	1441/2180	14784488	1,12271	1992	4144	6136	SO:0001583	missense	158326	exon25			TCGATCTGGCCAT	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.4322A>G	9.37:g.14784488T>C	ENSP00000370262:p.Gln1441Arg	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	28.0	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	T	6.504	0.461183	0.12342	2.51E-4	0.0	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.50001	0.76;0.76;0.76	5.53	3.2	0.36748	.	0.155174	0.64402	N	0.000015	T	0.31918	0.0812	L	0.29908	0.895	0.45452	D	0.998428	B	0.12630	0.006	B	0.12837	0.008	T	0.06197	-1.0840	10	0.16896	T	0.51	-4.7618	10.0584	0.42259	0.0:0.1354:0.0:0.8646	.	1441	Q5H8C1	FREM1_HUMAN	R	1442;1441;1441	ENSP00000370263:Q1442R;ENSP00000412940:Q1441R;ENSP00000370262:Q1441R	ENSP00000370262:Q1441R	Q	-	2	0	FREM1	14774488	1.000000	0.71417	0.550000	0.28217	0.012000	0.07955	2.524000	0.45589	0.478000	0.27488	0.482000	0.46254	CAG	.		0.493	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
GAB4	128954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	17443765	17443765	+	Splice_Site	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr22:17443765G>T	ENST00000400588.1	-	10	1690	c.1583C>A	c.(1582-1584)cCa>cAa	p.P528Q		NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	528										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GCCTATGGATGGCTGAGGGAC	0.577																																					p.P528Q		.											.	GAB4	91	0			c.C1583A						.						41.0	42.0	41.0					22																	17443765		2190	4299	6489	SO:0001630	splice_region_variant	128954	exon10			ATGGATGGCTGAG	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.1582-1C>A	22.37:g.17443765G>T		Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	17.0	NM_001037814		Missense_Mutation	SNP	ENST00000400588.1	37	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587044	0.46110	.	.	ENSG00000215568	ENST00000400588	T	0.22945	1.93	2.55	2.55	0.30701	.	0.055023	0.64402	D	0.000001	T	0.24470	0.0593	L	0.48362	1.52	0.36957	D	0.893157	P	0.47106	0.89	B	0.43413	0.419	T	0.33471	-0.9867	10	0.59425	D	0.04	.	11.2067	0.48773	0.0:0.0:1.0:0.0	.	528	Q2WGN9	GAB4_HUMAN	Q	528	ENSP00000383431:P528Q	ENSP00000383431:P528Q	P	-	2	0	GAB4	15823765	1.000000	0.71417	0.956000	0.39512	0.004000	0.04260	6.907000	0.75724	1.722000	0.51474	0.609000	0.83330	CCA	.		0.577	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882	Missense_Mutation
GBP2	2634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	89583374	89583374	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:89583374T>G	ENST00000370466.3	-	5	779	c.511A>C	c.(511-513)Agc>Cgc	p.S171R	GBP2_ENST00000463660.1_5'UTR	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	171	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		GGAAAAAAGCTCACAAAGTCA	0.453																																					p.S171R		.											.	GBP2	91	0			c.A511C						.						86.0	78.0	81.0					1																	89583374		2203	4300	6503	SO:0001583	missense	2634	exon5			AAAAGCTCACAAA	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.511A>C	1.37:g.89583374T>G	ENSP00000359497:p.Ser171Arg	Somatic	260.0	0.0		WXS	Illumina HiSeq	Phase_I	263.0	109.0	NM_004120	Q6GPH0|Q6IAU2|Q86TB0	Missense_Mutation	SNP	ENST00000370466.3	37	CCDS719.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.218641	0.39201	.	.	ENSG00000162645	ENST00000370466	T	0.75821	-0.97	3.81	0.312	0.15837	Guanylate-binding protein, N-terminal (1);	0.428344	0.21719	U	0.070156	T	0.44435	0.1293	L	0.41824	1.3	0.24361	N	0.994874	P	0.41748	0.761	B	0.42555	0.391	T	0.37686	-0.9695	10	0.29301	T	0.29	-11.2532	6.6733	0.23080	0.0:0.3537:0.0:0.6463	.	171	P32456	GBP2_HUMAN	R	171	ENSP00000359497:S171R	ENSP00000359497:S171R	S	-	1	0	GBP2	89355962	1.000000	0.71417	0.902000	0.35471	0.003000	0.03518	0.457000	0.21875	0.178000	0.19917	-0.250000	0.11733	AGC	.		0.453	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029406.2	NM_004120	
GEM	2669	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	95272587	95272587	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr8:95272587T>C	ENST00000297596.2	-	2	409	c.145A>G	c.(145-147)Acc>Gcc	p.T49A	GEM_ENST00000396194.2_Missense_Mutation_p.T49A	NM_005261.3	NP_005252.1	P55040	GEM_HUMAN	GTP binding protein overexpressed in skeletal muscle	49					cell surface receptor signaling pathway (GO:0007166)|chromosome organization (GO:0051276)|immune response (GO:0006955)|metaphase plate congression (GO:0051310)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic side of plasma membrane (GO:0009898)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle midzone (GO:0051233)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	22	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	BRCA - Breast invasive adenocarcinoma(8;0.00691)			TCCTCAGGGGTAGCAGAATGG	0.602																																					p.T49A	GBM(125;80 1653 28655 32188 47338)|Esophageal Squamous(19;97 579 13602 49091 51766)	.											.	GEM	659	0			c.A145G						.						78.0	76.0	77.0					8																	95272587		2203	4300	6503	SO:0001583	missense	2669	exon2			CAGGGGTAGCAGA		CCDS6261.1	8q13-q21	2014-05-09	2001-11-28		ENSG00000164949	ENSG00000164949			4234	protein-coding gene	gene with protein product	"""kinase-inducible Ras-like protein"""	600164	"""GTP-binding protein overexpressed in skeletal muscle"""			7912851, 11956230	Standard	NM_005261		Approved	KIR	uc003ygj.3	P55040	OTTHUMG00000164392	ENST00000297596.2:c.145A>G	8.37:g.95272587T>C	ENSP00000297596:p.Thr49Ala	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	13.0	NM_181702	B2RA31	Missense_Mutation	SNP	ENST00000297596.2	37	CCDS6261.1	.	.	.	.	.	.	.	.	.	.	T	3.852	-0.031678	0.07543	.	.	ENSG00000164949	ENST00000396194;ENST00000297596;ENST00000523433	T;T;T	0.63744	-0.06;-0.06;1.61	5.48	-4.19	0.03835	.	0.720560	0.14061	N	0.344024	T	0.27933	0.0688	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34625	-0.9821	10	0.06365	T	0.9	.	14.7633	0.69621	0.0:0.1648:0.0:0.8352	.	49	P55040	GEM_HUMAN	A	49	ENSP00000379497:T49A;ENSP00000297596:T49A;ENSP00000428258:T49A	ENSP00000297596:T49A	T	-	1	0	GEM	95341763	0.119000	0.22226	0.000000	0.03702	0.655000	0.38815	0.220000	0.17660	-0.733000	0.04850	-0.132000	0.14878	ACC	.		0.602	GEM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378566.1	NM_181702	
GPR37	2861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	124386785	124386785	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr7:124386785G>C	ENST00000303921.2	-	2	2286	c.1636C>G	c.(1636-1638)Cca>Gca	p.P546A		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	546					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AGGAGGACTGGGGTGACACAG	0.488																																					p.P546A		.											.	GPR37	523	0			c.C1636G						.						111.0	104.0	106.0					7																	124386785		2203	4300	6503	SO:0001583	missense	2861	exon2			GGACTGGGGTGAC		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1636C>G	7.37:g.124386785G>C	ENSP00000306449:p.Pro546Ala	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	12.0	NM_005302	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900135	0.72754	.	.	ENSG00000170775	ENST00000303921	D	0.98807	-5.15	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000023	D	0.98994	0.9657	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99893	1.1139	10	0.87932	D	0	-14.4547	18.0541	0.89358	0.0:0.0:1.0:0.0	.	546	O15354	GPR37_HUMAN	A	546	ENSP00000306449:P546A	ENSP00000306449:P546A	P	-	1	0	GPR37	124174021	1.000000	0.71417	0.931000	0.37212	0.995000	0.86356	9.869000	0.99810	2.489000	0.83994	0.655000	0.94253	CCA	.		0.488	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
GRIP1	23426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	66742812	66742812	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr12:66742812G>T	ENST00000398016.3	-	24	3286	c.3218C>A	c.(3217-3219)aCt>aAt	p.T1073N	GRIP1_ENST00000359742.4_Missense_Mutation_p.T1125N|GRIP1_ENST00000286445.7_Missense_Mutation_p.T1110N	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TAATGTATTAGTGGGTTCTCG	0.403																																					p.T1073N		.											.	GRIP1	494	0			c.C3218A						.						258.0	248.0	251.0					12																	66742812		1885	4113	5998	SO:0001583	missense	23426	exon24			GTATTAGTGGGTT	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.3218C>A	12.37:g.66742812G>T	ENSP00000381098:p.Thr1073Asn	Somatic	275.0	0.0		WXS	Illumina HiSeq	Phase_I	283.0	30.0	NM_021150	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	37	CCDS41807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.452|7.452	0.642881|0.642881	0.14451|0.14451	.|.	.|.	ENSG00000155974|ENSG00000155974	ENST00000538164|ENST00000398016;ENST00000359742;ENST00000286445	.|T;T;T	.|0.21361	.|2.01;2.03;2.03	5.64|5.64	3.75|3.75	0.43078|0.43078	.|.	.|0.185894	.|0.45361	.|D	.|0.000380	T|T	0.22044|0.22044	0.0531|0.0531	L|L	0.29908|0.29908	0.895|0.895	0.44275|0.44275	D|D	0.997131|0.997131	.|P;D	.|0.57571	.|0.95;0.98	.|P;P	.|0.53649	.|0.648;0.731	T|T	0.01621|0.01621	-1.1310|-1.1310	5|9	.|.	.|.	.|.	-7.1406|-7.1406	8.3084|8.3084	0.32055|0.32055	0.0701:0.0:0.6474:0.2826|0.0701:0.0:0.6474:0.2826	.|.	.|1073;1110	.|Q9Y3R0-3;Q9Y3R0-2	.|.;.	I|N	925|1073;1125;1110	.|ENSP00000381098:T1073N;ENSP00000352780:T1125N;ENSP00000286445:T1110N	.|.	L|T	-|-	1|2	2|0	GRIP1|GRIP1	65029079|65029079	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.274000|0.274000	0.26718|0.26718	5.024000|5.024000	0.64090|0.64090	0.693000|0.693000	0.31634|0.31634	0.655000|0.655000	0.94253|0.94253	CTA|ACT	.		0.403	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2		
HDAC8	55869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	71788678	71788678	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chrX:71788678G>C	ENST00000373573.3	-	3	562	c.221C>G	c.(220-222)gCt>gGt	p.A74G	HDAC8_ENST00000373559.4_Intron|HDAC8_ENST00000373554.1_Missense_Mutation_p.A74G|HDAC8_ENST00000373556.3_Missense_Mutation_p.A74G|HDAC8_ENST00000429103.2_5'UTR|HDAC8_ENST00000373583.1_Intron|HDAC8_ENST00000478743.1_5'UTR|HDAC8_ENST00000439122.2_Missense_Mutation_p.A74G|HDAC8_ENST00000373560.2_Missense_Mutation_p.A74G|HDAC8_ENST00000373589.4_Intron|HDAC8_ENST00000373561.4_Missense_Mutation_p.A74G|HDAC8_ENST00000373571.1_Missense_Mutation_p.A74G	NM_018486.2	NP_060956.1	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	74	Histone deacetylase.				chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cohesin localization to chromatin (GO:0071922)|sister chromatid cohesion (GO:0007062)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(3)|cervix(1)|endometrium(1)|lung(4)|prostate(1)	10	Renal(35;0.156)				Vorinostat(DB02546)	CTGCAGATAAGCATCAGTGTG	0.483																																					p.A74G		.											.	HDAC8	226	0			c.C221G						.						111.0	86.0	95.0					X																	71788678		2203	4300	6503	SO:0001583	missense	55869	exon3			AGATAAGCATCAG	AF230097	CCDS14420.1, CCDS55448.1, CCDS55449.1, CCDS55450.1, CCDS55451.1, CCDS55452.1	Xq13	2014-01-29	2002-09-02	2002-09-06	ENSG00000147099	ENSG00000147099			13315	protein-coding gene	gene with protein product		300269	"""histone deacetylase-like 1"", ""Wilson-Turner X-linked mental retardation syndrome"""	HDACL1, WTS, MRXS6		10756090, 10922473, 22889856	Standard	NM_001166448		Approved	RPD3	uc004eau.3	Q9BY41	OTTHUMG00000021814	ENST00000373573.3:c.221C>G	X.37:g.71788678G>C	ENSP00000362674:p.Ala74Gly	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	17.0	NM_018486	A6ND12|A6ND61|A6NET3|A6NJR3|A8MQ62|B4DKN0|B4DV22|Q86VC8|Q9NP76|Q9NYH4	Missense_Mutation	SNP	ENST00000373573.3	37	CCDS14420.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916005	0.52546	.	.	ENSG00000147099	ENST00000373573;ENST00000415409;ENST00000373571;ENST00000439122;ENST00000373560;ENST00000373561;ENST00000421523;ENST00000373556;ENST00000373554	T;T;T;T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8	4.59	3.7	0.42460	Histone deacetylase domain (2);	0.231983	0.45361	D	0.000365	T	0.60508	0.2274	N	0.21194	0.64	0.45822	D	0.99869	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.58364	-0.7649	10	0.87932	D	0	-2.9926	11.1601	0.48509	0.0:0.0:0.8142:0.1858	.	74;74	B4DV22;Q9BY41	.;HDAC8_HUMAN	G	74;74;74;74;74;74;35;74;74	ENSP00000362674:A74G;ENSP00000396424:A74G;ENSP00000362672:A74G;ENSP00000414486:A74G;ENSP00000362661:A74G;ENSP00000362662:A74G;ENSP00000398997:A35G;ENSP00000362657:A74G;ENSP00000362655:A74G	ENSP00000362655:A74G	A	-	2	0	HDAC8	71705403	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	6.236000	0.72339	0.956000	0.37904	0.513000	0.50165	GCT	.		0.483	HDAC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057193.2	NM_018486	
GUCY2F	2986	broad.mit.edu;bcgsc.ca	37	X	108684675	108684675	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chrX:108684675A>G	ENST00000218006.2	-	7	1897	c.1606T>C	c.(1606-1608)Tca>Cca	p.S536P		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	536	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TGGACCTCTGAGGTAATCTGG	0.438																																					p.S536P		.											.	GUCY2F	540	0			c.T1606C						.						186.0	183.0	184.0					X																	108684675		2203	4300	6503	SO:0001583	missense	2986	exon7			CCTCTGAGGTAAT	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.1606T>C	X.37:g.108684675A>G	ENSP00000218006:p.Ser536Pro	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	4.0	NM_001522	Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	A	16.94	3.261801	0.59431	.	.	ENSG00000101890	ENST00000218006	T	0.80909	-1.43	3.83	3.83	0.44106	Protein kinase, catalytic domain (1);	0.191460	0.44285	D	0.000472	T	0.79902	0.4526	M	0.85710	2.77	0.38610	D	0.95088	B	0.17465	0.022	B	0.25140	0.058	T	0.79172	-0.1913	10	0.51188	T	0.08	.	5.7928	0.18369	0.7599:0.0:0.0:0.2401	.	536	P51841	GUC2F_HUMAN	P	536	ENSP00000218006:S536P	ENSP00000218006:S536P	S	-	1	0	GUCY2F	108571331	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	2.870000	0.48451	1.728000	0.51552	0.486000	0.48141	TCA	.		0.438	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522	
HELZ2	85441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62190680	62190680	+	Silent	SNP	G	G	A	rs141769251		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr20:62190680G>A	ENST00000467148.1	-	19	7938	c.7869C>T	c.(7867-7869)ctC>ctT	p.L2623L	HELZ2_ENST00000427522.2_Silent_p.L2054L	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2623	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										AGAAGTCCAGGAGGCTACGCC	0.647																																					p.L2623L		.											.	.	.	0			c.C7869T						.	G	,	1,4385		0,1,2192	20.0	18.0	19.0		7869,6162	1.5	0.9	20	dbSNP_134	19	0,8588		0,0,4294	no	coding-synonymous,coding-synonymous	PRIC285	NM_001037335.2,NM_033405.3	,	0,1,6486	AA,AG,GG		0.0,0.0228,0.0077	,	2623/2650,2054/2081	62190680	1,12973	2193	4294	6487	SO:0001819	synonymous_variant	85441	exon20			GTCCAGGAGGCTA	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7869C>T	20.37:g.62190680G>A		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	19.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			G|1.000;A|0.000		0.647	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
IGF2R	3482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	160491064	160491064	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr6:160491064C>T	ENST00000356956.1	+	31	4565	c.4417C>T	c.(4417-4419)Cga>Tga	p.R1473*		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1473					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AACCACCATCCGATTCACCTG	0.532																																					p.R1473X		.											.	IGF2R	118	0			c.C4417T						.						100.0	81.0	88.0					6																	160491064		2203	4300	6503	SO:0001587	stop_gained	3482	exon31			ACCATCCGATTCA	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.4417C>T	6.37:g.160491064C>T	ENSP00000349437:p.Arg1473*	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	5.0	NM_000876	Q7Z7G9|Q96PT5	Nonsense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	C	46	12.261867	0.99651	.	.	ENSG00000197081	ENST00000356956	.	.	.	5.62	5.62	0.85841	.	0.175470	0.51477	D	0.000087	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.4459	19.6758	0.95932	0.0:1.0:0.0:0.0	.	.	.	.	X	1473	.	ENSP00000349437:R1473X	R	+	1	2	IGF2R	160411054	1.000000	0.71417	0.882000	0.34594	0.810000	0.45777	6.903000	0.75703	2.644000	0.89710	0.561000	0.74099	CGA	.		0.532	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
IL20RB	53833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	136708320	136708320	+	Silent	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:136708320T>C	ENST00000329582.4	+	4	693	c.444T>C	c.(442-444)gaT>gaC	p.D148D	IL20RB_ENST00000484501.1_3'UTR|IL20RB_ENST00000309741.5_Silent_p.D101D	NM_144717.3	NP_653318.2	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta	148	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homeostasis of number of cells within a tissue (GO:0048873)|immune response-inhibiting signal transduction (GO:0002765)|inflammatory response to antigenic stimulus (GO:0002437)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of type IV hypersensitivity (GO:0001808)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-4 production (GO:0032753)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14						TCACCAAAGATGGCTTCCACC	0.577																																					p.D148D		.											.	IL20RB	91	0			c.T444C						.						87.0	82.0	84.0					3																	136708320		2203	4300	6503	SO:0001819	synonymous_variant	53833	exon4			CAAAGATGGCTTC	BC033292	CCDS3093.1	3q22.3	2013-02-11			ENSG00000174564	ENSG00000174564		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	6004	protein-coding gene	gene with protein product		605621	"""fibronectin type III domain containing 6"""	FNDC6		11163236, 16703417	Standard	NM_144717		Approved	DIRS1, IL-20R2, MGC34923	uc003eri.2	Q6UXL0	OTTHUMG00000159779	ENST00000329582.4:c.444T>C	3.37:g.136708320T>C		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	14.0	NM_144717	B4DL40|Q6P438|Q8IYY5|Q8TAJ7	Silent	SNP	ENST00000329582.4	37	CCDS3093.1																																																																																			.		0.577	IL20RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357277.2	NM_144717	
IPO4	79711	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24654742	24654743	+	Frame_Shift_Ins	INS	-	-	ACAC			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr14:24654742_24654743insACAC	ENST00000354464.6	-	13	1376_1377	c.1200_1201insGTGT	c.(1198-1203)tgcaagfs	p.K401fs	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	401					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		TCCAGGCCCTTGCACACAATCT	0.569																																					p.K401_G402delinsVX		.											.	IPO4	226	0			c.1201_1202insGTGT						.																																			SO:0001589	frameshift_variant	79711	exon13			GGCCCTTGCACAC	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.1200_1201insGTGT	14.37:g.24654742_24654743insACAC	ENSP00000346453:p.Lys401fs	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	27.0	NM_024658	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Nonsense_Mutation	INS	ENST00000354464.6	37	CCDS9616.1																																																																																			.		0.569	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
IPO4	79711	hgsc.bcm.edu;bcgsc.ca	37	14	24654743	24654743	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr14:24654743G>A	ENST00000354464.6	-	13	1376	c.1200C>T	c.(1198-1200)tgC>tgT	p.C400C	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	400					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		CCAGGCCCTTGCACACAATCT	0.567																																					p.C400C		.											.	IPO4	226	0			c.C1200T						.						67.0	70.0	69.0					14																	24654743		2021	4187	6208	SO:0001819	synonymous_variant	79711	exon13			GCCCTTGCACACA	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.1200C>T	14.37:g.24654743G>A		Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	29.0	NM_024658	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Silent	SNP	ENST00000354464.6	37	CCDS9616.1																																																																																			.		0.567	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
ITGB1BP1	9270	broad.mit.edu;bcgsc.ca	37	2	9552533	9552533	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:9552533T>C	ENST00000360635.3	-	5	1049	c.153A>G	c.(151-153)ggA>ggG	p.G51G	ITGB1BP1_ENST00000488451.1_Splice_Site_p.G51G|ITGB1BP1_ENST00000456913.2_Splice_Site_p.G51G|ITGB1BP1_ENST00000490426.1_5'UTR|ITGB1BP1_ENST00000359712.3_Splice_Site_p.G51G|ITGB1BP1_ENST00000355346.4_Splice_Site_p.G51G|ITGB1BP1_ENST00000238091.4_Splice_Site_p.G51G			O14713	ITBP1_HUMAN	integrin beta 1 binding protein 1	51	Ser/Thr-rich.				activation of protein kinase B activity (GO:0032148)|biomineral tissue development (GO:0031214)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|myoblast migration (GO:0051451)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|Notch signaling pathway (GO:0007219)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein transport (GO:0015031)|receptor clustering (GO:0043113)|regulation of blood vessel size (GO:0050880)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of integrin-mediated signaling pathway (GO:2001044)|transcription, DNA-templated (GO:0006351)|tube formation (GO:0035148)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GDP-dissociation inhibitor activity (GO:0005092)|integrin binding (GO:0005178)|protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)			kidney(2)|large_intestine(2)|lung(2)|prostate(2)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)		TGTTGCTTTGTCCTGAAGATG	0.388																																					p.G51G		.											.	ITGB1BP1	130	0			c.A153G						.						82.0	83.0	83.0					2																	9552533		2203	4300	6503	SO:0001630	splice_region_variant	9270	exon4			GCTTTGTCCTGAA	AF012023	CCDS1662.1, CCDS1663.1	2p25.2	2008-02-05			ENSG00000119185	ENSG00000119185			23927	protein-coding gene	gene with protein product	"""integrin cytoplasmic domain-associated protein 1"", ""integrin cytoplasmic domain-associated protein 1-beta"", ""integrin cytoplasmic domain-associated protein 1-alpha"", ""bodenin"""	607153				11854171, 9281591	Standard	NM_004763		Approved	ICAP-1A, ICAP-1B, ICAP1, ICAP1A, ICAP1B, ICAP-1alpha	uc002qzj.3	O14713	OTTHUMG00000090414	ENST00000360635.3:c.152-1A>G	2.37:g.9552533T>C		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	4.0	NM_004763	D6W4Y9|O14714|Q53RS0	Silent	SNP	ENST00000360635.3	37	CCDS1662.1																																																																																			.		0.388	ITGB1BP1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314623.2	NM_004763, NM_022334	Silent
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	26568361	26568361	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr12:26568361G>C	ENST00000381340.3	-	51	7597	c.7181C>G	c.(7180-7182)tCt>tGt	p.S2394C	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2394					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TAGAATAATAGAGCGGCCATT	0.383																																					p.S2394C		.											.	ITPR2	542	0			c.C7181G						.						141.0	141.0	141.0					12																	26568361		1866	4105	5971	SO:0001583	missense	3709	exon51			ATAATAGAGCGGC	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7181C>G	12.37:g.26568361G>C	ENSP00000370744:p.Ser2394Cys	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	37.0	NM_002223	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725769	0.89298	.	.	ENSG00000123104	ENST00000381340	D	0.98684	-5.07	5.08	5.08	0.68730	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99327	0.9764	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98985	1.0806	10	0.87932	D	0	.	18.6686	0.91501	0.0:0.0:1.0:0.0	.	2394	Q14571	ITPR2_HUMAN	C	2394	ENSP00000370744:S2394C	ENSP00000370744:S2394C	S	-	2	0	ITPR2	26459628	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.640000	0.98453	2.636000	0.89361	0.591000	0.81541	TCT	.		0.383	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
JPH1	56704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	75233175	75233175	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr8:75233175G>T	ENST00000342232.4	-	1	388	c.348C>A	c.(346-348)gaC>gaA	p.D116E		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	116	Gly-rich.				calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			CGCCGTACCCGTCTTGCAGCC	0.711																																					p.D116E		.											.	JPH1	91	0			c.C348A						.						46.0	35.0	39.0					8																	75233175		2203	4300	6503	SO:0001583	missense	56704	exon1			GTACCCGTCTTGC	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.348C>A	8.37:g.75233175G>T	ENSP00000344488:p.Asp116Glu	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	9.0	NM_020647	B2RTZ0	Missense_Mutation	SNP	ENST00000342232.4	37	CCDS6217.1	.	.	.	.	.	.	.	.	.	.	g	25.3	4.625667	0.87560	.	.	ENSG00000104369	ENST00000342232	T	0.54071	0.59	4.14	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.45377	0.1339	N	0.05608	-0.01	0.58432	D	0.999992	D	0.56746	0.977	P	0.54174	0.744	T	0.51560	-0.8690	10	0.37606	T	0.19	.	16.2109	0.82158	0.0:0.0:1.0:0.0	.	116	Q9HDC5	JPH1_HUMAN	E	116	ENSP00000344488:D116E	ENSP00000344488:D116E	D	-	3	2	JPH1	75395730	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.420000	0.44679	2.120000	0.65058	0.401000	0.26515	GAC	.		0.711	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
KCNAB2	8514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	6145274	6145274	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:6145274G>A	ENST00000164247.1	+	7	856	c.292G>A	c.(292-294)Gta>Ata	p.V98I	KCNAB2_ENST00000378087.3_Missense_Mutation_p.V98I|KCNAB2_ENST00000378092.1_Missense_Mutation_p.V84I|KCNAB2_ENST00000378111.1_Missense_Mutation_p.V98I|KCNAB2_ENST00000352527.1_Missense_Mutation_p.V84I|KCNAB2_ENST00000602612.1_Missense_Mutation_p.V98I|KCNAB2_ENST00000378097.1_Missense_Mutation_p.V98I|KCNAB2_ENST00000378083.3_Missense_Mutation_p.V131I|KCNAB2_ENST00000458166.2_Missense_Mutation_p.V31I|KCNAB2_ENST00000341524.1_Missense_Mutation_p.V98I	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2	98					hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		GGCTGAAGTGGTACTGGGAAA	0.562																																					p.V131I		.											.	KCNAB2	514	0			c.G391A						.						204.0	196.0	198.0					1																	6145274		2203	4300	6503	SO:0001583	missense	8514	exon6			GAAGTGGTACTGG	U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.292G>A	1.37:g.6145274G>A	ENSP00000164247:p.Val98Ile	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	52.0	NM_001199862	A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Missense_Mutation	SNP	ENST00000164247.1	37	CCDS55.1	.	.	.	.	.	.	.	.	.	.	G	10.63	1.405294	0.25378	.	.	ENSG00000069424	ENST00000378111;ENST00000378097;ENST00000378092;ENST00000428161;ENST00000389632;ENST00000378087;ENST00000341524;ENST00000352527;ENST00000435937;ENST00000164247;ENST00000378083;ENST00000458166	T;T;T;T;T;T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78	4.93	4.93	0.64822	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.11367	0.0277	N	0.02736	-0.51	0.51767	D	0.99993	B;B;B;B	0.16166	0.001;0.001;0.002;0.016	B;B;B;B	0.15870	0.014;0.002;0.006;0.013	T	0.12502	-1.0545	10	0.06891	T	0.86	-42.1504	17.4755	0.87658	0.0:0.0:1.0:0.0	.	131;84;98;98	Q13303-3;Q13303-2;Q13303;Q2YD85	.;.;KCAB2_HUMAN;.	I	98;98;84;84;98;98;98;84;84;98;131;31	ENSP00000367351:V98I;ENSP00000367337:V98I;ENSP00000367332:V84I;ENSP00000400285:V84I;ENSP00000374283:V98I;ENSP00000367327:V98I;ENSP00000340824:V98I;ENSP00000318772:V84I;ENSP00000389151:V84I;ENSP00000164247:V98I;ENSP00000367323:V131I;ENSP00000396167:V31I	ENSP00000164247:V98I	V	+	1	0	KCNAB2	6067861	1.000000	0.71417	0.972000	0.41901	0.522000	0.34438	3.131000	0.50515	2.416000	0.81992	0.591000	0.81541	GTA	.		0.562	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002114.3	NM_172130	
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	21464744	21464744	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr18:21464744A>G	ENST00000313654.9	+	41	5471	c.5230A>G	c.(5230-5232)Act>Gct	p.T1744A	LAMA3_ENST00000399516.3_Missense_Mutation_p.T1744A|LAMA3_ENST00000587184.1_Missense_Mutation_p.T135A|LAMA3_ENST00000269217.6_Missense_Mutation_p.T135A	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1744	Domain III A.|Laminin EGF-like 14. {ECO:0000255|PROSITE-ProRule:PRU00460}.			ATG -> GMC (in Ref. 5; CAA59428/ CAA59429). {ECO:0000305}.	cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AAGCTTTGCCACTGGCTGTGT	0.498																																					p.T1744A		.											.	LAMA3	100	0			c.A5230G						.						186.0	177.0	180.0					18																	21464744		2203	4300	6503	SO:0001583	missense	3909	exon41			TTTGCCACTGGCT	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.5230A>G	18.37:g.21464744A>G	ENSP00000324532:p.Thr1744Ala	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	204.0	30.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.757797	0.49468	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.62941	-0.01;-0.01;-0.01	6.06	4.89	0.63831	EGF-like, laminin (3);Growth factor, receptor (1);	.	.	.	.	T	0.53433	0.1796	L	0.38838	1.175	0.45594	D	0.998533	P;P;B;P	0.45283	0.822;0.855;0.211;0.65	B;P;B;P	0.44946	0.376;0.456;0.166;0.465	T	0.46359	-0.9197	9	0.22706	T	0.39	.	10.1581	0.42836	0.7197:0.0:0.0:0.2803	.	135;135;1744;1744	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	A	1744;1744;135	ENSP00000324532:T1744A;ENSP00000382432:T1744A;ENSP00000269217:T135A	ENSP00000269217:T135A	T	+	1	0	LAMA3	19718742	0.974000	0.33945	0.993000	0.49108	0.588000	0.36517	1.840000	0.39230	1.088000	0.41272	0.533000	0.62120	ACT	.		0.498	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
LIMK2	3985	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	31655931	31655931	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr22:31655931A>G	ENST00000331728.4	+	5	533	c.419A>G	c.(418-420)gAg>gGg	p.E140G	LIMK2_ENST00000406516.1_Missense_Mutation_p.E62G|LIMK2_ENST00000333611.4_Missense_Mutation_p.E119G|LIMK2_ENST00000340552.4_Missense_Mutation_p.E119G|LIMK2_ENST00000444929.2_Intron	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	140					phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						CTCTCCACAGAGTCTGTTCAG	0.602																																					p.E140G		.											.	LIMK2	548	0			c.A419G						.						61.0	54.0	56.0					22																	31655931		2203	4300	6503	SO:0001583	missense	3985	exon5			CCACAGAGTCTGT	D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.419A>G	22.37:g.31655931A>G	ENSP00000332687:p.Glu140Gly	Somatic	22.0	1.0		WXS	Illumina HiSeq	Phase_I	29.0	10.0	NM_005569	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	ENST00000331728.4	37	CCDS13891.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.854033	0.71719	.	.	ENSG00000182541	ENST00000406516;ENST00000331728;ENST00000436394;ENST00000333611;ENST00000340552	T;T;T;T	0.75260	-0.92;-0.74;-0.8;-0.88	5.63	5.63	0.86233	.	0.104155	0.64402	D	0.000004	T	0.73241	0.3562	L	0.47716	1.5	0.80722	D	1	P;P;P;P	0.52463	0.73;0.61;0.749;0.953	B;B;B;P	0.47603	0.391;0.297;0.269;0.551	T	0.73142	-0.4076	10	0.36615	T	0.2	-34.7983	15.0232	0.71647	1.0:0.0:0.0:0.0	.	172;119;140;62	F5GY29;Q7L3H5;P53671;B5MC51	.;.;LIMK2_HUMAN;.	G	62;140;172;119;119	ENSP00000384602:E62G;ENSP00000332687:E140G;ENSP00000330470:E119G;ENSP00000339916:E119G	ENSP00000332687:E140G	E	+	2	0	LIMK2	29985931	1.000000	0.71417	0.376000	0.26042	0.930000	0.56654	7.005000	0.76323	2.144000	0.66660	0.459000	0.35465	GAG	.		0.602	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733	
LOXHD1	125336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	44109166	44109166	+	Silent	SNP	G	G	T	rs200819355		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr18:44109166G>T	ENST00000398722.4	-	22	3669	c.3670C>A	c.(3670-3672)Cgg>Agg	p.R1224R	LOXHD1_ENST00000582408.1_Silent_p.R391R|LOXHD1_ENST00000300591.6_Silent_p.R391R|LOXHD1_ENST00000536736.1_Silent_p.R1502R|LOXHD1_ENST00000441551.2_Silent_p.R1296R|LOXHD1_ENST00000579038.1_Silent_p.R295R|LOXHD1_ENST00000441893.2_Silent_p.R435R			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1224	PLAT 9. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TTGTTGGTCCGGTTCTCTGAC	0.577																																					p.R1502R		.											.	.	.	0			c.C4504A						.						160.0	154.0	156.0					18																	44109166		692	1591	2283	SO:0001819	synonymous_variant	125336	exon29			TGGTCCGGTTCTC	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.3670C>A	18.37:g.44109166G>T		Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	227.0	18.0	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	ENST00000398722.4	37																																																																																				.		0.577	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	39906750	39906750	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:39906750G>A	ENST00000372915.3	+	72	18307	c.18220G>A	c.(18220-18222)Gcc>Acc	p.A6074T	MACF1_ENST00000564288.1_Missense_Mutation_p.A6175T|MACF1_ENST00000539005.1_Missense_Mutation_p.A3986T|MACF1_ENST00000289893.4_Missense_Mutation_p.A4618T|MACF1_ENST00000545844.1_Missense_Mutation_p.A4116T|MACF1_ENST00000567887.1_Missense_Mutation_p.A6212T|MACF1_ENST00000317713.7_Missense_Mutation_p.A4116T|MACF1_ENST00000361689.2_Missense_Mutation_p.A4116T			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6074					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTTGATTTTTGCCTGTGGAGA	0.428																																					p.A4116T		.											.	MACF1	165	0			c.G12346A						.						96.0	99.0	98.0					1																	39906750		2203	4300	6503	SO:0001583	missense	23499	exon70			ATTTTTGCCTGTG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18220G>A	1.37:g.39906750G>A	ENSP00000362006:p.Ala6074Thr	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	11.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.862234|5.862234	0.97036|0.97036	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.51071|.	0.72;0.72;0.72;0.72;0.72;0.72|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	0.000000|.	0.64402|.	D|.	0.000017|.	T|T	0.77837|0.77837	0.4190|0.4190	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	T|T	0.75569|0.75569	-0.3272|-0.3272	10|5	0.72032|.	D|.	0.01|.	.|.	20.2191|20.2191	0.98319|0.98319	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	6074;4116|.	Q9UPN3;F8W8Q1|.	MACF1_HUMAN;.|.	T|Y	4116;6074;4116;4116;3986;4618|3119	ENSP00000439537:A4116T;ENSP00000362006:A6074T;ENSP00000354573:A4116T;ENSP00000313438:A4116T;ENSP00000444364:A3986T;ENSP00000289893:A4618T|.	ENSP00000289893:A4618T|.	A|C	+|+	1|2	0|0	MACF1|MACF1	39679337|39679337	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.869000|9.869000	0.99810|0.99810	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	GCC|TGC	.		0.428	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
MEF2A	4205	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	100211575	100211575	+	Missense_Mutation	SNP	C	C	A	rs1135561		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr15:100211575C>A	ENST00000557785.1	+	5	655	c.306C>A	c.(304-306)gaC>gaA	p.D102E	MEF2A_ENST00000558812.1_Missense_Mutation_p.D34E|MEF2A_ENST00000453228.2_Missense_Mutation_p.D102E|MEF2A_ENST00000338042.6_Missense_Mutation_p.D102E|MEF2A_ENST00000449277.2_Missense_Mutation_p.D34E|MEF2A_ENST00000557942.1_Missense_Mutation_p.D102E|MEF2A_ENST00000354410.5_Intron	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	102					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			CTGATGCTGACGATTACTTTG	0.378																																					p.D102E		.											.	MEF2A	455	0			c.C306A						.						181.0	170.0	173.0					15																	100211575		1568	3582	5150	SO:0001583	missense	4205	exon4			TGCTGACGATTAC		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.306C>A	15.37:g.100211575C>A	ENSP00000453441:p.Asp102Glu	Somatic	188.0	1.0		WXS	Illumina HiSeq	Phase_I	181.0	66.0	NM_001130926	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000557785.1	37	CCDS53978.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.203472	0.38905	.	.	ENSG00000068305	ENST00000453228;ENST00000338042;ENST00000449277	T;T;T	0.64438	-0.1;-0.1;-0.1	5.54	5.54	0.83059	.	.	.	.	.	T	0.71434	0.3339	L	0.38733	1.17	0.26035	N	0.981682	B;D;D;B	0.89917	0.417;1.0;0.966;0.375	B;D;P;B	0.87578	0.312;0.998;0.792;0.331	T	0.63310	-0.6666	9	0.39692	T	0.17	.	15.3311	0.74212	0.0:0.8607:0.1393:0.0	.	34;23;102;102	B4DFQ7;Q7Z6C9;Q02078-6;Q02078-2	.;.;.;.	E	102;102;34	ENSP00000404110:D102E;ENSP00000337202:D102E;ENSP00000399460:D34E	ENSP00000337202:D102E	D	+	3	2	MEF2A	98029098	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.794000	0.47853	2.763000	0.94921	0.655000	0.94253	GAC	.		0.378	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1		
MEGF8	1954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42866314	42866314	+	Silent	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr19:42866314C>T	ENST00000251268.6	+	33	5793	c.5793C>T	c.(5791-5793)tgC>tgT	p.C1931C	MEGF8_ENST00000334370.4_Silent_p.C1864C	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1931	PSI 5.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TCCGGACCTGCAGTGAGTGCC	0.657																																					p.C1931C		.											.	MEGF8	23	0			c.C5793T						.						26.0	22.0	24.0					19																	42866314		2203	4299	6502	SO:0001819	synonymous_variant	1954	exon33			GACCTGCAGTGAG	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.5793C>T	19.37:g.42866314C>T		Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	15.0	NM_001271938	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	37																																																																																				.		0.657	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
MTMR1	8776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	149905792	149905792	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chrX:149905792G>T	ENST00000370390.3	+	11	1478	c.1321G>T	c.(1321-1323)Ggt>Tgt	p.G441C	MTMR1_ENST00000445323.2_Missense_Mutation_p.G449C|MTMR1_ENST00000544228.1_Missense_Mutation_p.G441C|MTMR1_ENST00000451863.2_Missense_Mutation_p.G441C|MTMR1_ENST00000541925.1_Missense_Mutation_p.G347C|MTMR1_ENST00000538506.1_Missense_Mutation_p.G266C	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	441	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.|Substrate binding. {ECO:0000250}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TTGCAGCGACGGTTGGGACCG	0.448																																					p.G441C		.											.	MTMR1	131	0			c.G1321T						.						148.0	127.0	134.0					X																	149905792		2203	4300	6503	SO:0001583	missense	8776	exon11			AGCGACGGTTGGG	U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.1321G>T	X.37:g.149905792G>T	ENSP00000359417:p.Gly441Cys	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	57.0	NM_003828	A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Missense_Mutation	SNP	ENST00000370390.3	37	CCDS14695.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140982	0.77775	.	.	ENSG00000063601	ENST00000541925;ENST00000370390;ENST00000445323;ENST00000544228;ENST00000451863;ENST00000538506	D;D;D;D;D;D	0.99121	-5.45;-5.45;-5.45;-5.45;-5.45;-5.45	4.88	4.88	0.63580	Myotubularin phosphatase domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.99635	0.9866	H	0.98883	4.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97274	0.9913	10	0.87932	D	0	.	17.332	0.87267	0.0:0.0:1.0:0.0	.	441;449	Q13613;F8WA39	MTMR1_HUMAN;.	C	347;441;449;441;441;266	ENSP00000441879:G347C;ENSP00000359417:G441C;ENSP00000414178:G449C;ENSP00000440534:G441C;ENSP00000387446:G441C;ENSP00000443444:G266C	ENSP00000359417:G441C	G	+	1	0	MTMR1	149656450	1.000000	0.71417	0.165000	0.22776	0.832000	0.47134	9.869000	0.99810	2.015000	0.59207	0.544000	0.68410	GGT	.		0.448	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9057572	9057572	+	Silent	SNP	G	G	T	rs367564649		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr19:9057572G>T	ENST00000397910.4	-	3	30077	c.29874C>A	c.(29872-29874)acC>acA	p.T9958T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9960	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACTTTTTTGGGTGGTGATGG	0.488																																					p.T9958T		.											.	MUC16	566	0			c.C29874A						.						256.0	249.0	251.0					19																	9057572		1970	4167	6137	SO:0001819	synonymous_variant	94025	exon3			TTTTTGGGTGGTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29874C>A	19.37:g.9057572G>T		Somatic	280.0	0.0		WXS	Illumina HiSeq	Phase_I	266.0	108.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYH2	4620	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	10429161	10429161	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr17:10429161T>A	ENST00000245503.5	-	31	4604	c.4220A>T	c.(4219-4221)gAg>gTg	p.E1407V	MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.E1407V|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1407					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TACATGTTCCTCAGCTGCCTG	0.483																																					p.E1407V		.											.	MYH2	194	0			c.A4220T						.						57.0	54.0	55.0					17																	10429161		2203	4300	6503	SO:0001583	missense	4620	exon31			TGTTCCTCAGCTG		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4220A>T	17.37:g.10429161T>A	ENSP00000245503:p.Glu1407Val	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	9.0	NM_017534	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.639573	0.87760	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.82344	-1.6;-1.6	5.03	5.03	0.67393	Myosin tail (1);	0.000000	0.39687	U	0.001290	D	0.93792	0.8015	H	0.95884	3.735	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.95626	0.8685	10	0.87932	D	0	.	14.9212	0.70838	0.0:0.0:0.0:1.0	.	1407	Q9UKX2	MYH2_HUMAN	V	1407	ENSP00000245503:E1407V;ENSP00000380367:E1407V	ENSP00000245503:E1407V	E	-	2	0	MYH2	10369886	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.868000	0.87116	2.119000	0.64992	0.379000	0.24179	GAG	.		0.483	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
MYT1L	23040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1926593	1926593	+	Silent	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:1926593C>T	ENST00000399161.2	-	10	1695	c.948G>A	c.(946-948)gaG>gaA	p.E316E	MYT1L_ENST00000428368.2_Silent_p.E316E	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	316					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CATCGCTCTCCTCCACCATCT	0.507																																					p.E316E		.											.	MYT1L	95	0			c.G948A						.						120.0	126.0	124.0					2																	1926593		2150	4248	6398	SO:0001819	synonymous_variant	23040	exon10			GCTCTCCTCCACC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.948G>A	2.37:g.1926593C>T		Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	45.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37																																																																																				.		0.507	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
NBEAL2	23218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47037989	47037989	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:47037989G>T	ENST00000450053.3	+	16	2559	c.2380G>T	c.(2380-2382)Ggc>Tgc	p.G794C	NBEAL2_ENST00000292309.5_Missense_Mutation_p.G794C|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	794					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CACTCGGTGGGGCAGCCCCAC	0.692																																					p.G794C		.											.	NBEAL2	69	0			c.G2380T						.						10.0	13.0	12.0					3																	47037989		2009	4180	6189	SO:0001583	missense	23218	exon16			CGGTGGGGCAGCC	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.2380G>T	3.37:g.47037989G>T	ENSP00000415034:p.Gly794Cys	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	21.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526663	0.85706	.	.	ENSG00000160796	ENST00000292309;ENST00000450053	T;T	0.76839	-1.05;-1.05	4.58	4.58	0.56647	Concanavalin A-like lectin/glucanase (1);	0.000000	0.85682	D	0.000000	D	0.87873	0.6287	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89621	0.3848	10	0.87932	D	0	.	16.1281	0.81408	0.0:0.0:1.0:0.0	.	794	Q6ZNJ1	NBEL2_HUMAN	C	794	ENSP00000292309:G794C;ENSP00000415034:G794C	ENSP00000292309:G794C	G	+	1	0	NBEAL2	47012993	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.713000	0.84693	2.367000	0.80283	0.462000	0.41574	GGC	.		0.692	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
NCKAP5L	57701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	50186244	50186244	+	Silent	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr12:50186244C>A	ENST00000335999.6	-	12	3978	c.3777G>T	c.(3775-3777)ctG>ctT	p.L1259L		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	1255	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						GGGTCCTGGGCAGCCCCTCCA	0.612																																					p.L1259L		.											.	NCKAP5L	68	0			c.G3777T						.						30.0	34.0	33.0					12																	50186244		1931	4124	6055	SO:0001819	synonymous_variant	57701	exon12			CCTGGGCAGCCCC	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.3777G>T	12.37:g.50186244C>A		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	21.0	NM_001037806	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Silent	SNP	ENST00000335999.6	37	CCDS41781.2	.	.	.	.	.	.	.	.	.	.	C	8.064	0.768752	0.15983	.	.	ENSG00000167566	ENST00000433948	.	.	.	5.15	0.902	0.19290	.	.	.	.	.	T	0.44582	0.1300	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28004	-1.0057	4	.	.	.	-11.7817	3.7532	0.08575	0.5004:0.288:0.1278:0.0839	.	.	.	.	S	974	.	.	A	-	1	0	NCKAP5L	48472511	0.980000	0.34600	1.000000	0.80357	0.969000	0.65631	-0.086000	0.11233	0.654000	0.30846	0.561000	0.74099	GCC	.		0.612	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2	XM_035497	
NDST4	64579	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	4	115792014	115792014	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:115792014C>T	ENST00000264363.2	-	7	2307	c.1629G>A	c.(1627-1629)tgG>tgA	p.W543*		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	543	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TCAGGTTGGTCCAGCTCTGCA	0.443																																					p.W543X		.											.	NDST4	94	0			c.G1629A						.						103.0	112.0	109.0					4																	115792014		2203	4299	6502	SO:0001587	stop_gained	64579	exon7			GTTGGTCCAGCTC	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1629G>A	4.37:g.115792014C>T	ENSP00000264363:p.Trp543*	Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	234.0	22.0	NM_022569	Q2KHM8	Nonsense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	39	7.604733	0.98384	.	.	ENSG00000138653	ENST00000264363	.	.	.	5.1	4.25	0.50352	.	0.124042	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1467	0.42769	0.0:0.7858:0.1381:0.0761	.	.	.	.	X	543	.	ENSP00000264363:W543X	W	-	3	0	NDST4	116011463	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.168000	0.50801	2.362000	0.80069	0.561000	0.74099	TGG	.		0.443	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
NDUFS8	4728	broad.mit.edu;bcgsc.ca	37	11	67799630	67799630	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr11:67799630G>A	ENST00000313468.5	+	2	119	c.12G>A	c.(10-12)ctG>ctA	p.L4L	NDUFS8_ENST00000528492.1_Intron|MIR4691_ENST00000583764.1_RNA|RP5-901A4.1_ENST00000532296.1_RNA	NM_002496.3	NP_002487.1	O00217	NDUS8_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)	4					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|lung(5)|skin(1)	8						TGCGCTGCCTGACCACGCCTA	0.602																																					p.L4L	Colon(116;1205 2770 20054)	.											.	NDUFS8	91	0			c.G12A						.						111.0	103.0	106.0					11																	67799630		2200	4294	6494	SO:0001819	synonymous_variant	4728	exon2			CTGCCTGACCACG	U65579	CCDS8176.1	11q13.2	2011-07-04	2002-08-29		ENSG00000110717	ENSG00000110717	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7715	protein-coding gene	gene with protein product	"""complex I 23kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial"""	602141	"""NADH dehydrogenase (ubiquinone) Fe-S protein 8 (23kD) (NADH-coenzyme Q reductase)"""			9666055, 9116042	Standard	NM_002496		Approved	TYKY, CI-23k	uc001onc.3	O00217	OTTHUMG00000167331	ENST00000313468.5:c.12G>A	11.37:g.67799630G>A		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	5.0	NM_002496	B2RB86|Q0VDA8	Silent	SNP	ENST00000313468.5	37	CCDS8176.1																																																																																			.		0.602	NDUFS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394193.1	NM_002496	
NES	10763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156641759	156641759	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:156641759G>T	ENST00000368223.3	-	4	2353	c.2221C>A	c.(2221-2223)Cac>Aac	p.H741N		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	741	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGTGATTTGTGATTCTCTGTT	0.443																																					p.H741N		.											.	NES	520	0			c.C2221A						.						121.0	122.0	121.0					1																	156641759		2203	4300	6503	SO:0001583	missense	10763	exon4			ATTTGTGATTCTC	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2221C>A	1.37:g.156641759G>T	ENSP00000357206:p.His741Asn	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	267.0	144.0	NM_006617	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.605578	0.28623	.	.	ENSG00000132688	ENST00000368223	D	0.84660	-1.88	5.12	4.14	0.48551	.	.	.	.	.	T	0.65428	0.2690	L	0.36672	1.1	0.09310	N	1	B	0.25609	0.13	B	0.20184	0.028	T	0.60459	-0.7259	9	0.66056	D	0.02	.	7.9351	0.29925	0.0:0.1742:0.6457:0.1801	.	741	P48681	NEST_HUMAN	N	741	ENSP00000357206:H741N	ENSP00000357206:H741N	H	-	1	0	NES	154908383	0.000000	0.05858	0.014000	0.15608	0.020000	0.10135	0.447000	0.21710	2.356000	0.79943	0.563000	0.77884	CAC	.		0.443	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
NHSL1	57224	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	138752749	138752749	+	Silent	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr6:138752749A>G	ENST00000427025.2	-	5	3373	c.2745T>C	c.(2743-2745)acT>acC	p.T915T	NHSL1_ENST00000343505.5_Silent_p.T911T	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	915	Ser-rich.									breast(2)|endometrium(4)|kidney(1)	7						CACTTCCTTCAGTAGAAGTAC	0.532																																					p.T915T		.											.	NHSL1	68	0			c.T2745C						.						37.0	34.0	35.0					6																	138752749		692	1591	2283	SO:0001819	synonymous_variant	57224	exon5			TCCTTCAGTAGAA	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.2745T>C	6.37:g.138752749A>G		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	10.0	NM_020464	Q3ZCS5|Q5SYE8|Q9P2J0	Silent	SNP	ENST00000427025.2	37	CCDS55063.1																																																																																			.		0.532	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2	XM_050421	
NMUR1	10316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	232392880	232392880	+	Silent	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:232392880C>T	ENST00000305141.4	-	2	985	c.852G>A	c.(850-852)agG>agA	p.R284R		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	284					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GCTGCTGGAGCCTGCAGGTGT	0.632																																					p.R284R		.											.	NMUR1	523	0			c.G852A						.						49.0	48.0	49.0					2																	232392880		2203	4300	6503	SO:0001819	synonymous_variant	10316	exon2			CTGGAGCCTGCAG	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.852G>A	2.37:g.232392880C>T		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	29.0	NM_006056	O43664|Q7LDP6|Q8NE20	Silent	SNP	ENST00000305141.4	37	CCDS2486.1																																																																																			.		0.632	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
NR3C2	4306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	149002507	149002507	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:149002507G>C	ENST00000358102.3	-	9	3305	c.2943C>G	c.(2941-2943)ttC>ttG	p.F981L	NR3C2_ENST00000511528.1_Missense_Mutation_p.F985L|NR3C2_ENST00000344721.4_Missense_Mutation_p.F981L|NR3C2_ENST00000512865.1_Missense_Mutation_p.F864L|NR3C2_ENST00000355292.3_Missense_Mutation_p.F985L	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	981	Steroid-binding.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	ACTTCCGGTGGAAGTAGAGCG	0.547																																					p.F981L	Melanoma(27;428 957 40335 51025 51111)	.											.	NR3C2	154	0			c.C2943G						.						58.0	55.0	56.0					4																	149002507		2203	4300	6503	SO:0001583	missense	4306	exon9			CCGGTGGAAGTAG	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2943C>G	4.37:g.149002507G>C	ENSP00000350815:p.Phe981Leu	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	15.0	NM_000901	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	37	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889536	0.52014	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000511528	D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71	5.63	-7.81	0.01210	.	0.000000	0.85682	D	0.000000	D	0.97005	0.9022	M	0.86651	2.83	0.46241	D	0.998942	D;D	0.69078	0.988;0.997	D;D	0.68943	0.936;0.961	D	0.96159	0.9114	9	.	.	.	.	18.4928	0.90853	0.3945:0.0:0.6055:0.0	.	864;981	B0ZBF5;B0ZBF6	.;.	L	981;985;981;864;985	ENSP00000341390:F981L;ENSP00000347441:F985L;ENSP00000350815:F981L;ENSP00000423510:F864L;ENSP00000421481:F985L	.	F	-	3	2	NR3C2	149221957	0.998000	0.40836	0.861000	0.33841	0.170000	0.22686	0.746000	0.26275	-1.513000	0.01789	-0.157000	0.13467	TTC	.		0.547	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
OGN	4969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	95147921	95147921	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr9:95147921G>C	ENST00000262551.4	-	7	1298	c.878C>G	c.(877-879)cCg>cGg	p.P293R	OGN_ENST00000375561.5_Missense_Mutation_p.P293R|CENPP_ENST00000375587.3_Intron	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	293					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						TGACCCTATCGGTAATCTTTT	0.388																																					p.P293R		.											.	OGN	492	0			c.C878G						.						120.0	118.0	119.0					9																	95147921		2203	4300	6503	SO:0001583	missense	4969	exon7			CCTATCGGTAATC	AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.878C>G	9.37:g.95147921G>C	ENSP00000262551:p.Pro293Arg	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	61.0	NM_033014	Q6FIB0|Q9UF90|Q9UNK5	Missense_Mutation	SNP	ENST00000262551.4	37	CCDS6695.1	.	.	.	.	.	.	.	.	.	.	G	19.50	3.839473	0.71488	.	.	ENSG00000106809	ENST00000262551;ENST00000375561	T;T	0.63744	-0.06;-0.06	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.71542	0.3352	L	0.31752	0.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.75175	-0.3410	10	0.87932	D	0	.	18.9675	0.92702	0.0:0.0:1.0:0.0	.	351;293	B4DI63;P20774	.;MIME_HUMAN	R	293	ENSP00000262551:P293R;ENSP00000364711:P293R	ENSP00000262551:P293R	P	-	2	0	OGN	94187742	1.000000	0.71417	0.936000	0.37596	0.490000	0.33462	9.589000	0.98235	2.555000	0.86185	0.650000	0.86243	CCG	.		0.388	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1	NM_024416	
OR2M5	127059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248308490	248308490	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:248308490T>C	ENST00000366476.1	+	1	41	c.41T>C	c.(40-42)cTc>cCc	p.L14P		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L14P(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GACTTCATCCTCCTGGGAATC	0.438																																					p.L14P		.											.	OR2M5	71	1	Substitution - Missense(1)	lung(1)	c.T41C						.						225.0	223.0	223.0					1																	248308490		2203	4300	6503	SO:0001583	missense	127059	exon1			TCATCCTCCTGGG		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.41T>C	1.37:g.248308490T>C	ENSP00000355432:p.Leu14Pro	Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	329.0	177.0	NM_001004690		Missense_Mutation	SNP	ENST00000366476.1	37	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	t	13.25	2.182311	0.38511	.	.	ENSG00000162727	ENST00000366476	T	0.01215	5.16	3.14	1.93	0.25924	.	0.000000	0.28042	U	0.016823	T	0.11623	0.0283	H	0.98965	4.385	0.19775	N	0.999954	D	0.89917	1.0	D	0.83275	0.996	T	0.15350	-1.0440	10	0.87932	D	0	.	8.1369	0.31061	0.1808:0.0:0.0:0.8192	.	14	A3KFT3	OR2M5_HUMAN	P	14	ENSP00000355432:L14P	ENSP00000355432:L14P	L	+	2	0	OR2M5	246375113	0.052000	0.20516	0.344000	0.25628	0.741000	0.42261	3.154000	0.50693	0.190000	0.20209	0.403000	0.27427	CTC	.		0.438	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690	
OR2Y1	134083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180166444	180166444	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr5:180166444G>A	ENST00000307832.2	-	1	655	c.615C>T	c.(613-615)gtC>gtT	p.V205V		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAACAGCCACGACTATGACTC	0.512																																					p.V205V		.											.	OR2Y1	68	0			c.C615T						.						102.0	92.0	96.0					5																	180166444		2203	4300	6503	SO:0001819	synonymous_variant	134083	exon1			AGCCACGACTATG	AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.615C>T	5.37:g.180166444G>A		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	21.0	NM_001001657	B9EIP1|Q6IFB1|Q96R16	Silent	SNP	ENST00000307832.2	37	CCDS34323.1																																																																																			.		0.512	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368059.2	XM_068682	
OR5D18	219438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55587787	55587787	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr11:55587787A>G	ENST00000333976.4	+	1	702	c.682A>G	c.(682-684)Aag>Gag	p.K228E		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				AACCATCCTCAAGATGCGTTC	0.493																																					p.K228E		.											.	OR5D18	71	0			c.A682G						.						156.0	130.0	139.0					11																	55587787		2200	4296	6496	SO:0001583	missense	219438	exon1			ATCCTCAAGATGC	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.682A>G	11.37:g.55587787A>G	ENSP00000335025:p.Lys228Glu	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	62.0	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	37	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	12.29	1.892631	0.33442	.	.	ENSG00000186119	ENST00000333976	T	0.00169	8.63	4.73	3.59	0.41128	GPCR, rhodopsin-like superfamily (1);	0.177783	0.27302	N	0.019982	T	0.00580	0.0019	M	0.91249	3.19	0.09310	N	1	D	0.63046	0.992	D	0.67900	0.954	T	0.23583	-1.0184	10	0.72032	D	0.01	-20.3675	8.1633	0.31211	0.9029:0.0:0.0971:0.0	.	228	Q8NGL1	OR5DI_HUMAN	E	228	ENSP00000335025:K228E	ENSP00000335025:K228E	K	+	1	0	OR5D18	55344363	0.011000	0.17503	0.866000	0.34008	0.205000	0.24178	2.697000	0.47060	1.945000	0.56424	0.462000	0.41574	AAG	.		0.493	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
OR5L2	26338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55595156	55595156	+	Silent	SNP	G	G	T	rs144734181	byFrequency	TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr11:55595156G>T	ENST00000378397.1	+	1	462	c.462G>T	c.(460-462)gtG>gtT	p.V154V		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				GTGGGACGGTGTGTTCTCTGA	0.493										HNSCC(27;0.073)																											p.V154V		.											.	OR5L2	69	0			c.G462T						.						222.0	190.0	201.0					11																	55595156		2200	4296	6496	SO:0001819	synonymous_variant	26338	exon1			GACGGTGTGTTCT	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.462G>T	11.37:g.55595156G>T		Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	87.0	NM_001004739	Q6IF66|Q96RB2	Silent	SNP	ENST00000378397.1	37	CCDS31511.1																																																																																			G|0.999;C|0.001		0.493	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739	
OR9I1	219954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57886305	57886305	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr11:57886305A>T	ENST00000302610.1	-	1	611	c.612T>A	c.(610-612)aaT>aaA	p.N204K	OR9Q1_ENST00000335397.3_Intron	NM_001005211.1	NP_001005211.1	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I, member 1	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|liver(1)|lung(15)|pancreas(1)|skin(1)|urinary_tract(1)	23		Breast(21;0.0589)				AAATCACAAAATTGCCAAAGA	0.448																																					p.N204K		.											.	OR9I1	69	0			c.T612A						.						104.0	94.0	97.0					11																	57886305		2201	4296	6497	SO:0001583	missense	219954	exon1			CACAAAATTGCCA	AB065733	CCDS31542.1	11q12.1	2012-08-09			ENSG00000172377	ENSG00000172377		"""GPCR / Class A : Olfactory receptors"""	14718	protein-coding gene	gene with protein product							Standard	NM_001005211		Approved		uc021qjl.1	Q8NGQ6	OTTHUMG00000167404	ENST00000302610.1:c.612T>A	11.37:g.57886305A>T	ENSP00000302606:p.Asn204Lys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	20.0	NM_001005211	Q6IFH0|Q96RA8	Missense_Mutation	SNP	ENST00000302610.1	37	CCDS31542.1	.	.	.	.	.	.	.	.	.	.	A	7.410	0.634607	0.14322	.	.	ENSG00000172377	ENST00000302610	T	0.36878	1.23	4.87	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	0.118515	0.37761	N	0.001948	T	0.21145	0.0509	N	0.24115	0.695	0.21802	N	0.999533	B	0.09022	0.002	B	0.15052	0.012	T	0.18023	-1.0350	10	0.87932	D	0	-16.8461	4.1634	0.10295	0.2151:0.0:0.6063:0.1787	.	204	Q8NGQ6	OR9I1_HUMAN	K	204	ENSP00000302606:N204K	ENSP00000302606:N204K	N	-	3	2	OR9I1	57642881	0.000000	0.05858	1.000000	0.80357	0.195000	0.23768	0.147000	0.16202	0.660000	0.30964	0.383000	0.25322	AAT	.		0.448	OR9I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394539.1	NM_001005211	
ORC2	4999	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	201790570	201790570	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:201790570T>C	ENST00000234296.2	-	13	1385	c.1136A>G	c.(1135-1137)aAa>aGa	p.K379R	RN7SL694P_ENST00000584245.1_RNA	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	379					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						TTCTTTAAATTTGTTTACTAT	0.318																																					p.K379R		.											.	ORC2	209	0			c.A1136G						.						141.0	135.0	137.0					2																	201790570		2203	4300	6503	SO:0001583	missense	4999	exon13			TTAAATTTGTTTA		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1136A>G	2.37:g.201790570T>C	ENSP00000234296:p.Lys379Arg	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	9.0	NM_006190	Q13204|Q53TX5	Missense_Mutation	SNP	ENST00000234296.2	37	CCDS2334.1	.	.	.	.	.	.	.	.	.	.	T	0.060	-1.226235	0.01518	.	.	ENSG00000115942	ENST00000234296	T	0.41758	0.99	5.34	-4.27	0.03744	.	0.461449	0.26677	N	0.023077	T	0.15003	0.0362	N	0.02315	-0.6	0.20764	N	0.999851	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.003	T	0.18366	-1.0339	10	0.10377	T	0.69	-4.9688	15.9636	0.79950	0.0:0.6347:0.0:0.3653	.	379;379	B4DYU9;Q13416	.;ORC2_HUMAN	R	379	ENSP00000234296:K379R	ENSP00000234296:K379R	K	-	2	0	ORC2	201498815	0.673000	0.27539	0.393000	0.26258	0.249000	0.25844	-0.375000	0.07475	-1.049000	0.03234	-1.964000	0.00472	AAA	.		0.318	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190	
PAQR5	54852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	69695986	69695986	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr15:69695986T>A	ENST00000340965.3	+	9	1486	c.818T>A	c.(817-819)cTt>cAt	p.L273H	PAQR5_ENST00000395407.2_Missense_Mutation_p.L273H|Y_RNA_ENST00000384665.1_RNA|PAQR5_ENST00000561153.1_Missense_Mutation_p.L273H|RP11-253M7.1_ENST00000558107.1_RNA|RP11-253M7.1_ENST00000560539.1_RNA|RP11-253M7.1_ENST00000558617.1_RNA	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	273					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						GAAGCCATACTTCTGGACAAG	0.517																																					p.L273H		.											.	PAQR5	70	0			c.T818A						.						88.0	77.0	81.0					15																	69695986		2199	4298	6497	SO:0001583	missense	54852	exon9			CCATACTTCTGGA		CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.818T>A	15.37:g.69695986T>A	ENSP00000343877:p.Leu273His	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	26.0	NM_001104554	Q8IXU2	Missense_Mutation	SNP	ENST00000340965.3	37	CCDS10232.1	.	.	.	.	.	.	.	.	.	.	T	19.56	3.851145	0.71719	.	.	ENSG00000137819	ENST00000395407;ENST00000340965	T;T	0.27557	1.66;1.66	5.45	4.33	0.51752	.	0.646270	0.16636	N	0.205839	T	0.43678	0.1258	M	0.70275	2.135	0.09310	N	0.99999	D	0.67145	0.996	P	0.54965	0.765	T	0.30001	-0.9993	10	0.44086	T	0.13	-11.9089	7.9719	0.30132	0.0:0.0925:0.0:0.9075	.	273	Q9NXK6	MPRG_HUMAN	H	273	ENSP00000378803:L273H;ENSP00000343877:L273H	ENSP00000343877:L273H	L	+	2	0	PAQR5	67483040	0.220000	0.23631	0.847000	0.33407	0.972000	0.66771	1.982000	0.40638	1.024000	0.39682	0.533000	0.62120	CTT	.		0.517	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416671.1	NM_017705	
PCDH7	5099	ucsc.edu;bcgsc.ca;mdanderson.org	37	4	30921951	30921951	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:30921951G>A	ENST00000543491.1	+	2	3351	c.3351G>A	c.(3349-3351)acG>acA	p.T1117T	PCDH7_ENST00000509925.1_3'UTR			O60245	PCDH7_HUMAN	protocadherin 7	0					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AAAGGACCACGCCGGATGGCA	0.517																																					p.T1117T		.											.	PCDH7	229	0			c.G3351A						.						72.0	78.0	76.0					4																	30921951		2185	4291	6476	SO:0001819	synonymous_variant	5099	exon2			GACCACGCCGGAT	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000543491.1:c.3351G>A	4.37:g.30921951G>A		Somatic	72.0	2.0		WXS	Illumina HiSeq	.	95.0	41.0	NM_032457	O60246|O60247|Q4W5C4	Silent	SNP	ENST00000543491.1	37	CCDS54753.1	.	.	.	.	.	.	.	.	.	.	G	8.558	0.877128	0.17395	.	.	ENSG00000169851	ENST00000511884	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	T	0.77011	0.4068	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74150	-0.3758	4	.	.	.	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	.	.	.	T	807	.	.	A	+	1	0	PCDH7	30531049	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.359000	0.73060	2.788000	0.95919	0.650000	0.86243	GCC	.		0.517	PCDH7-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032457, NM_002589	
PCDHAC2	56134	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140347883	140347883	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr5:140347883G>A	ENST00000289269.5	+	1	2064	c.1532G>A	c.(1531-1533)aGg>aAg	p.R511K	PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA13_ENST00000289272.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	511	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTCTGGAGAGGGAGATTCAA	0.498																																					p.R511K	Melanoma(190;638 2083 3390 11909 52360)	.											.	PCDHAC2	26	0			c.G1532A						.						95.0	90.0	92.0					5																	140347883		2203	4300	6503	SO:0001583	missense	56134	exon1			TGGAGAGGGAGAT	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1532G>A	5.37:g.140347883G>A	ENSP00000289269:p.Arg511Lys	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	204.0	18.0	NM_031883	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	ENST00000289269.5	37	CCDS4242.1	.	.	.	.	.	.	.	.	.	.	G	2.067	-0.413866	0.04799	.	.	ENSG00000243232	ENST00000289269	T	0.50001	0.76	6.02	2.1	0.27182	Cadherin (4);Cadherin-like (1);	0.304188	0.23795	N	0.044490	T	0.25606	0.0623	N	0.20881	0.62	0.24886	N	0.9922	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.002	T	0.21861	-1.0233	10	0.05959	T	0.93	.	8.2555	0.31754	0.1891:0.0:0.6974:0.1134	.	511;511	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	K	511	ENSP00000289269:R511K	ENSP00000289269:R511K	R	+	2	0	PCDHAC2	140328067	0.621000	0.27077	1.000000	0.80357	0.996000	0.88848	1.266000	0.33039	0.879000	0.35944	0.655000	0.94253	AGG	.		0.498	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82508658	82508658	+	Missense_Mutation	SNP	A	A	G	rs556966262		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr7:82508658A>G	ENST00000333891.9	-	10	13986	c.13649T>C	c.(13648-13650)aTg>aCg	p.M4550T	PCLO_ENST00000423517.2_Missense_Mutation_p.M4550T|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTTACCTTCCATAAGCTTCCC	0.373													A|||	1	0.000199681	0.0	0.0	5008	,	,		14898	0.0		0.0	False		,,,				2504	0.001				p.M4550T		.											.	PCLO	29	0			c.T13649C						.						71.0	64.0	67.0					7																	82508658		1826	4065	5891	SO:0001583	missense	27445	exon10			CCTTCCATAAGCT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13649T>C	7.37:g.82508658A>G	ENSP00000334319:p.Met4550Thr	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	67.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	A	8.233	0.805025	0.16467	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.26373	1.74;1.74	4.8	2.41	0.29592	.	.	.	.	.	T	0.16128	0.0388	N	0.24115	0.695	0.46798	D	0.999205	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.05131	-1.0904	9	0.87932	D	0	.	7.3962	0.26938	0.7486:0.0:0.2514:0.0	.	4550;4550;47	Q9Y6V0-5;Q9Y6V0-6;Q32P40	.;.;.	T	4550;4550;46	ENSP00000334319:M4550T;ENSP00000388393:M4550T	ENSP00000334319:M4550T	M	-	2	0	PCLO	82346594	0.039000	0.19947	0.326000	0.25389	0.893000	0.52053	3.122000	0.50446	0.289000	0.22422	0.482000	0.46254	ATG	.		0.373	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82582751	82582751	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr7:82582751G>T	ENST00000333891.9	-	5	7855	c.7518C>A	c.(7516-7518)agC>agA	p.S2506R	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.S2506R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTGGAGGTTTGCTTGGCTCAG	0.453																																					p.S2506R		.											.	PCLO	29	0			c.C7518A						.						133.0	132.0	132.0					7																	82582751		1955	4138	6093	SO:0001583	missense	27445	exon5			AGGTTTGCTTGGC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7518C>A	7.37:g.82582751G>T	ENSP00000334319:p.Ser2506Arg	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	13.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	3.030	-0.199928	0.06219	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.19806	2.12;2.12	4.52	1.69	0.24217	.	.	.	.	.	T	0.13157	0.0319	L	0.29908	0.895	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.09443	-1.0674	9	0.87932	D	0	.	4.1576	0.10268	0.3449:0.0:0.4963:0.1588	.	2506;2506	Q9Y6V0-5;Q9Y6V0-6	.;.	R	2437;2506;2506	ENSP00000334319:S2506R;ENSP00000388393:S2506R	ENSP00000334319:S2506R	S	-	3	2	PCLO	82420687	0.962000	0.33011	1.000000	0.80357	0.662000	0.39071	0.096000	0.15147	0.355000	0.24131	0.484000	0.47621	AGC	.		0.453	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PEX2	5828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	77895811	77895811	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr8:77895811C>T	ENST00000419564.2	-	4	1068	c.604G>A	c.(604-606)Gaa>Aaa	p.E202K	PEX2_ENST00000522527.1_Missense_Mutation_p.E202K|PEX2_ENST00000520103.1_Missense_Mutation_p.E202K|PEX2_ENST00000357039.4_Missense_Mutation_p.E202K	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	202					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						ATCAGAAATTCAGCAAAACCA	0.388																																					p.E202K		.											.	PEX2	91	0			c.G604A						.						88.0	91.0	90.0					8																	77895811		2203	4300	6503	SO:0001583	missense	5828	exon4			GAAATTCAGCAAA	M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.604G>A	8.37:g.77895811C>T	ENSP00000400984:p.Glu202Lys	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	16.0	NM_000318	Q567S6|Q9BW41	Missense_Mutation	SNP	ENST00000419564.2	37	CCDS6221.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.044970	0.93685	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	5.09	5.09	0.68999	Pex, N-terminal (1);	0.051798	0.85682	D	0.000000	D	0.91945	0.7449	M	0.87456	2.885	0.80722	D	1	D	0.67145	0.996	D	0.66602	0.945	D	0.93017	0.6437	10	0.72032	D	0.01	-23.1997	18.6882	0.91573	0.0:1.0:0.0:0.0	.	202	P28328	PEX2_HUMAN	K	202	ENSP00000349543:E202K;ENSP00000400984:E202K;ENSP00000428590:E202K;ENSP00000428638:E202K	ENSP00000349543:E202K	E	-	1	0	PEX2	78058366	1.000000	0.71417	0.957000	0.39632	0.993000	0.82548	5.545000	0.67237	2.663000	0.90544	0.557000	0.71058	GAA	.		0.388	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379122.1	NM_000318	
PHGDH	26227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	120266059	120266059	+	Silent	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:120266059G>C	ENST00000369409.4	+	3	487	c.351G>C	c.(349-351)ctG>ctC	p.L117L	PHGDH_ENST00000369407.3_Silent_p.L83L	NM_006623.3	NP_006614.2	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	117					brain development (GO:0007420)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|G1 to G0 transition (GO:0070314)|gamma-aminobutyric acid metabolic process (GO:0009448)|glial cell development (GO:0021782)|glutamine metabolic process (GO:0006541)|glycine metabolic process (GO:0006544)|L-serine biosynthetic process (GO:0006564)|neural tube development (GO:0021915)|neuron projection development (GO:0031175)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|taurine metabolic process (GO:0019530)|threonine metabolic process (GO:0006566)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|phosphoglycerate dehydrogenase activity (GO:0004617)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	18	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)		TCATGTGCCTGGCCAGGTAAG	0.473																																					p.L117L		.											.	PHGDH	91	0			c.G351C						.						164.0	147.0	153.0					1																	120266059		2203	4300	6503	SO:0001819	synonymous_variant	26227	exon3			GTGCCTGGCCAGG	BC011262	CCDS904.1	1p12	2008-02-05			ENSG00000092621	ENSG00000092621	1.1.1.95		8923	protein-coding gene	gene with protein product		606879					Standard	NM_006623		Approved	SERA, PGDH, PDG	uc001ehz.3	O43175	OTTHUMG00000012100	ENST00000369409.4:c.351G>C	1.37:g.120266059G>C		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	50.0	NM_006623	B2RD08|Q5SZU3|Q9BQ01	Silent	SNP	ENST00000369409.4	37	CCDS904.1																																																																																			.		0.473	PHGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033464.1	NM_006623	
PIGR	5284	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207103702	207103702	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:207103702G>A	ENST00000356495.4	-	11	2439	c.2256C>T	c.(2254-2256)acC>acT	p.T752T	PIGR_ENST00000487208.1_5'Flank	NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	752					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CGGCGGCCACGGTGCTGGACT	0.617																																					p.T752T		.											.	PIGR	92	0			c.C2256T						.						50.0	51.0	51.0					1																	207103702		2203	4300	6503	SO:0001819	synonymous_variant	5284	exon11			GGCCACGGTGCTG		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.2256C>T	1.37:g.207103702G>A		Somatic	43.0	1.0		WXS	Illumina HiSeq	Phase_I	82.0	43.0	NM_002644	Q68D81|Q8IZY7	Silent	SNP	ENST00000356495.4	37	CCDS1474.1																																																																																			.		0.617	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
PIK3R5	23533	ucsc.edu;bcgsc.ca	37	17	8812422	8812422	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr17:8812422A>G	ENST00000447110.1	-	3	297	c.173T>C	c.(172-174)cTc>cCc	p.L58P	PIK3R5_ENST00000581552.1_Missense_Mutation_p.L58P|PIK3R5_ENST00000584803.1_Missense_Mutation_p.L58P	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	58	Heterodimerization. {ECO:0000250}.				blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						CTGCTCAAGGAGGATAAGGAA	0.592																																					p.L58P	NSCLC(18;589 615 7696 20311 50332)	.											.	PIK3R5	1146	0			c.T173C						.						38.0	32.0	34.0					17																	8812422		2203	4300	6503	SO:0001583	missense	23533	exon3			TCAAGGAGGATAA	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.173T>C	17.37:g.8812422A>G	ENSP00000392812:p.Leu58Pro	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001142633	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	37	CCDS11147.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.350363	0.41599	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	D;D	0.85955	-2.05;-2.05	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.88040	0.6330	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89359	0.3666	10	0.87932	D	0	-24.1752	13.6276	0.62176	1.0:0.0:0.0:0.0	.	58	Q8WYR1	PI3R5_HUMAN	P	58	ENSP00000269300:L58P;ENSP00000392812:L58P	ENSP00000269300:L58P	L	-	2	0	PIK3R5	8753147	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.181000	0.77682	2.100000	0.63781	0.528000	0.53228	CTC	.		0.592	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	NM_014308	
POLR2G	5436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62533971	62533971	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr11:62533971G>T	ENST00000301788.7	+	8	616	c.511G>T	c.(511-513)Gta>Tta	p.V171L		NM_002696.2	NP_002687.1	P62487	RPB7_HUMAN	polymerase (RNA) II (DNA directed) polypeptide G	171					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, exonucleolytic (GO:0000291)|nucleotide-excision repair (GO:0006289)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translational initiation (GO:0045948)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)|translation initiation factor binding (GO:0031369)			lung(3)	3						CGCAGGGCTTGTAAGCTGAGC	0.493																																					p.V171L		.											.	POLR2G	90	0			c.G511T						.						186.0	156.0	166.0					11																	62533971		2201	4299	6500	SO:0001583	missense	5436	exon8			GGGCTTGTAAGCT	U20659	CCDS31585.1	11q13.1	2013-01-21			ENSG00000168002	ENSG00000168002		"""RNA polymerase subunits"""	9194	protein-coding gene	gene with protein product		602013				7579693, 9256063	Standard	NM_002696		Approved	hRPB19, hsRPB7, RPB7	uc001nva.3	P62487	OTTHUMG00000167609	ENST00000301788.7:c.511G>T	11.37:g.62533971G>T	ENSP00000301788:p.Val171Leu	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	7.0	NM_002696	B2R5C0|P52433|Q2M1Z4	Missense_Mutation	SNP	ENST00000301788.7	37	CCDS31585.1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.509114	0.44660	.	.	ENSG00000168002	ENST00000301788	.	.	.	5.94	5.94	0.96194	Nucleic acid-binding, OB-fold-like (1);	0.200778	0.41938	D	0.000789	T	0.49098	0.1537	L	0.37897	1.145	0.54753	D	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.44251	-0.9340	9	0.02654	T	1	-22.5135	15.8594	0.79009	0.0:0.0:1.0:0.0	.	171	P62487	RPB7_HUMAN	L	171	.	ENSP00000301788:V171L	V	+	1	0	POLR2G	62290547	1.000000	0.71417	1.000000	0.80357	0.339000	0.28857	4.387000	0.59626	2.822000	0.97130	0.557000	0.71058	GTA	.		0.493	POLR2G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395344.1	NM_002696	
PPIL1	51645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	36839559	36839559	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr6:36839559T>C	ENST00000373699.5	-	2	397	c.146A>G	c.(145-147)aAt>aGt	p.N49S	C6orf89_ENST00000510325.2_5'Flank|C6orf89_ENST00000359359.2_5'Flank	NM_016059.4	NP_057143.1	Q9Y3C6	PPIL1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 1	49	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			lung(1)|ovary(1)	2						TTTTGTGCCATTGTAGTAACC	0.443																																					p.N49S		.											.	PPIL1	91	0			c.A146G						.						181.0	169.0	173.0					6																	36839559		2203	4300	6503	SO:0001583	missense	51645	exon2			GTGCCATTGTAGT	AF090992	CCDS4826.1	6p21.1	2008-08-29			ENSG00000137168	ENSG00000137168			9260	protein-coding gene	gene with protein product		601301				10072585, 8978786	Standard	NM_016059		Approved	CYPL1	uc003omu.2	Q9Y3C6	OTTHUMG00000014612	ENST00000373699.5:c.146A>G	6.37:g.36839559T>C	ENSP00000362803:p.Asn49Ser	Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	292.0	153.0	NM_016059	O15001|Q5TDC9	Missense_Mutation	SNP	ENST00000373699.5	37	CCDS4826.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.179993	0.57800	.	.	ENSG00000137168	ENST00000373699	T	0.23348	1.91	5.4	5.4	0.78164	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);Peptidyl-prolyl cis-trans isomerase, cyclophilin-type, conserved site (1);	0.048145	0.85682	D	0.000000	T	0.21718	0.0523	M	0.81112	2.525	0.58432	D	0.999997	B	0.25743	0.133	B	0.24848	0.056	T	0.09997	-1.0649	10	0.72032	D	0.01	.	13.6739	0.62443	0.0:0.0:0.0:1.0	.	49	Q9Y3C6	PPIL1_HUMAN	S	49	ENSP00000362803:N49S	ENSP00000362803:N49S	N	-	2	0	PPIL1	36947537	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.852000	0.55934	2.159000	0.67721	0.533000	0.62120	AAT	.		0.443	PPIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040382.1		
PPP1R15B	84919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	204378958	204378958	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:204378958T>G	ENST00000367188.4	-	1	1961	c.1582A>C	c.(1582-1584)Agc>Cgc	p.S528R	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	528					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TCAGGAAGGCTTCCAGACTGG	0.468																																					p.S528R		.											.	PPP1R15B	652	0			c.A1582C						.						53.0	54.0	54.0					1																	204378958		2203	4300	6503	SO:0001583	missense	84919	exon1			GAAGGCTTCCAGA	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1582A>C	1.37:g.204378958T>G	ENSP00000356156:p.Ser528Arg	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	69.0	NM_032833	Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	ENST00000367188.4	37	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.326953	0.24080	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.27720	1.65	5.17	1.35	0.21983	Protein phosphatase 1, regulatory subunit 15A/B, C-terminal (1);	0.961662	0.08634	N	0.916658	T	0.31513	0.0799	M	0.64997	1.995	0.09310	N	1	D	0.54397	0.966	P	0.46629	0.522	T	0.22068	-1.0227	10	0.54805	T	0.06	0.0164	1.4786	0.02432	0.2833:0.0847:0.1565:0.4754	.	528	Q5SWA1	PR15B_HUMAN	R	528;438	ENSP00000356156:S528R	ENSP00000356156:S528R	S	-	1	0	PPP1R15B	202645581	0.000000	0.05858	0.038000	0.18304	0.400000	0.30750	0.521000	0.22893	-0.027000	0.13873	-0.327000	0.08410	AGC	.		0.468	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
PRUNE2	158471	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	79320970	79320970	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr9:79320970C>T	ENST00000376718.3	-	8	6343	c.6220G>A	c.(6220-6222)Gct>Act	p.A2074T	PRUNE2_ENST00000428286.1_Missense_Mutation_p.A1715T	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2074					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GGCTTCTTAGCATCTATCCAC	0.507																																					p.A2074T		.											.	PRUNE2	157	0			c.G6220A						.						166.0	156.0	159.0					9																	79320970		1568	3582	5150	SO:0001583	missense	158471	exon8			TCTTAGCATCTAT	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.6220G>A	9.37:g.79320970C>T	ENSP00000365908:p.Ala2074Thr	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	22.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.534|5.534	0.283500|0.283500	0.10458|0.10458	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.49432|.	0.78;0.79|.	6.03|6.03	2.81|2.81	0.32909|0.32909	.|.	0.463760|.	0.20212|.	N|.	0.096878|.	T|T	0.22742|0.22742	0.0549|0.0549	N|N	0.17474|0.17474	0.49|0.49	0.09310|0.09310	N|N	0.999998|0.999998	B|.	0.15141|.	0.012|.	B|.	0.14023|.	0.01|.	T|T	0.20806|0.20806	-1.0264|-1.0264	10|5	0.38643|.	T|.	0.18|.	-1.6323|-1.6323	7.7343|7.7343	0.28804|0.28804	0.1183:0.674:0.0:0.2077|0.1183:0.674:0.0:0.2077	.|.	2074|.	Q8WUY3|.	PRUN2_HUMAN|.	T|Y	2074;1715;2073|1395	ENSP00000365908:A2074T;ENSP00000397425:A1715T|.	ENSP00000365908:A2074T|.	A|C	-|-	1|2	0|0	PRUNE2|PRUNE2	78510790|78510790	0.005000|0.005000	0.15991|0.15991	0.659000|0.659000	0.29680|0.29680	0.144000|0.144000	0.21451|0.21451	0.430000|0.430000	0.21428|0.21428	0.889000|0.889000	0.36185|0.36185	0.655000|0.655000	0.94253|0.94253	GCT|TGC	.		0.507	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
PSMB7	5695	broad.mit.edu;bcgsc.ca	37	9	127115964	127115964	+	Silent	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr9:127115964T>C	ENST00000259457.3	-	8	760	c.747A>G	c.(745-747)aaA>aaG	p.K249K	PSMB7_ENST00000498485.1_5'UTR	NM_002799.3	NP_002790.1	Q99436	PSB7_HUMAN	proteasome (prosome, macropain) subunit, beta type, 7	249					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			breast(1)|endometrium(1)|kidney(1)|lung(1)|pancreas(1)	5						CAGTAGTCCCTTTCTCACACC	0.468																																					p.K249K		.											.	PSMB7	90	0			c.A747G						.						124.0	106.0	112.0					9																	127115964		2203	4300	6503	SO:0001819	synonymous_variant	5695	exon8			AGTCCCTTTCTCA	AJ420455	CCDS6855.1	9q34.11-q34.12	2008-02-05			ENSG00000136930	ENSG00000136930		"""Proteasome (prosome, macropain) subunits"""	9544	protein-coding gene	gene with protein product		604030				8811196	Standard	NM_002799		Approved	Z	uc004boj.4	Q99436	OTTHUMG00000021042	ENST00000259457.3:c.747A>G	9.37:g.127115964T>C		Somatic	67.0	1.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_002799	B4E0P1|Q5TBG6|Q96AG8|Q9BWA7	Silent	SNP	ENST00000259457.3	37	CCDS6855.1																																																																																			.		0.468	PSMB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055525.1	NM_002799	
PSMD8	5714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38867031	38867031	+	Missense_Mutation	SNP	G	G	A	rs200403794		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr19:38867031G>A	ENST00000215071.4	+	3	539	c.473G>A	c.(472-474)cGc>cAc	p.R158H	PSMD8_ENST00000602911.1_Missense_Mutation_p.R95H|PSMD8_ENST00000592035.1_5'UTR	NM_002812.4	NP_002803.2	P48556	PSMD8_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 8	158					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(1)	6	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGCATCCTACGCAAGGACATC	0.572																																					p.R158H		.											.	PSMD8	68	0			c.G473A						.	G	HIS/ARG	0,4318		0,0,2159	56.0	47.0	50.0		473	4.4	1.0	19		50	2,8384		0,2,4191	yes	missense	PSMD8	NM_002812.4	29	0,2,6350	AA,AG,GG		0.0238,0.0,0.0157	benign	158/351	38867031	2,12702	2159	4193	6352	SO:0001583	missense	5714	exon3			TCCTACGCAAGGA	D38047	CCDS12515.2	19q13.2	2009-05-07			ENSG00000099341	ENSG00000099341		"""Proteasome (prosome, macropain) subunits"""	9566	protein-coding gene	gene with protein product						7621825	Standard	NM_002812		Approved	S14, Nin1p, p31, HIP6, HYPF, Rpn12	uc002oii.4	P48556	OTTHUMG00000150691	ENST00000215071.4:c.473G>A	19.37:g.38867031G>A	ENSP00000215071:p.Arg158His	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	30.0	NM_002812	B4DX18|Q6P1L7	Missense_Mutation	SNP	ENST00000215071.4	37	CCDS12515.2	.	.	.	.	.	.	.	.	.	.	G	14.30	2.492809	0.44352	0.0	2.38E-4	ENSG00000099341	ENST00000215071	.	.	.	4.44	4.44	0.53790	.	0.118100	0.56097	D	0.000023	T	0.39036	0.1063	N	0.19112	0.55	0.80722	D	1	B	0.17038	0.02	B	0.04013	0.001	T	0.29305	-1.0016	9	0.45353	T	0.12	-7.3068	8.3919	0.32533	0.1041:0.0:0.8959:0.0	.	158	P48556	PSMD8_HUMAN	H	158	.	ENSP00000215071:R158H	R	+	2	0	PSMD8	43558871	1.000000	0.71417	0.975000	0.42487	0.970000	0.65996	5.746000	0.68681	2.342000	0.79632	0.449000	0.29647	CGC	.		0.572	PSMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319627.1	NM_002812	
PTP4A3	11156	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	142441034	142441034	+	Missense_Mutation	SNP	C	C	A	rs145157893		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr8:142441034C>A	ENST00000521578.1	+	6	1357	c.412C>A	c.(412-414)Cgc>Agc	p.R138S	PTP4A3_ENST00000524028.1_Missense_Mutation_p.R52S|PTP4A3_ENST00000329397.1_Missense_Mutation_p.R138S|PTP4A3_ENST00000349124.1_Missense_Mutation_p.R113S|PTP4A3_ENST00000520105.1_Missense_Mutation_p.R113S|MROH5_ENST00000430863.1_RNA			O75365	TP4A3_HUMAN	protein tyrosine phosphatase type IVA, member 3	138	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	endosome (GO:0005768)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			endometrium(2)|large_intestine(1)|lung(3)	6	all_cancers(97;2.55e-15)|all_epithelial(106;1.39e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0474)			CAGGAAGCGCCGCGGAGCCAT	0.602																																					p.R138S		.											.	PTP4A3	226	0			c.C412A						.						97.0	83.0	87.0					8																	142441034		2201	4300	6501	SO:0001583	missense	11156	exon5			AAGCGCCGCGGAG	AF041434	CCDS6382.1, CCDS6383.1	8q24.3	2011-06-09				ENSG00000184489		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9636	protein-coding gene	gene with protein product		606449					Standard	NM_032611		Approved	PRL-3, PRL-R, PRL3	uc003ywg.1	O75365		ENST00000521578.1:c.412C>A	8.37:g.142441034C>A	ENSP00000428976:p.Arg138Ser	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	14.0	NM_032611	Q8IVN5|Q99849|Q9BTW5	Missense_Mutation	SNP	ENST00000521578.1	37	CCDS6383.1	.	.	.	.	.	.	.	.	.	.	C	17.97	3.518142	0.64634	.	.	ENSG00000184489	ENST00000521578;ENST00000520105;ENST00000329397;ENST00000349124;ENST00000524028	D;T;D;T	0.83335	-1.71;0.75;-1.71;0.75	4.49	2.53	0.30540	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.056513	0.64402	D	0.000002	D	0.82788	0.5113	M	0.75264	2.295	0.80722	D	1	P;B	0.47191	0.891;0.137	P;B	0.47044	0.535;0.224	T	0.83015	-0.0170	10	0.87932	D	0	-13.2554	7.2761	0.26286	0.2121:0.6933:0.0:0.0947	.	113;138	O75365-2;O75365	.;TP4A3_HUMAN	S	138;113;138;113;52	ENSP00000428976:R138S;ENSP00000428758:R113S;ENSP00000332274:R138S;ENSP00000331730:R113S	ENSP00000332274:R138S	R	+	1	0	PTP4A3	142510216	0.433000	0.25562	0.816000	0.32577	0.708000	0.40852	1.341000	0.33907	1.245000	0.43885	0.555000	0.69702	CGC	C|1.000;T|0.000		0.602	PTP4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378977.1	NM_032611	
RAB20	55647	broad.mit.edu;mdanderson.org	37	13	111213727	111213727	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr13:111213727C>A	ENST00000267328.3	-	1	353	c.140G>T	c.(139-141)cGc>cTc	p.R47L		NM_017817.1	NP_060287.1	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family	47					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)	GTP binding (GO:0005525)			endometrium(2)|large_intestine(2)|lung(3)	7	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			GTTGTAGGAGCGCCACTGCTT	0.697																																					p.R47L		.											.	RAB20	227	0			c.G140T						.						35.0	33.0	33.0					13																	111213727		2203	4300	6503	SO:0001583	missense	55647	exon1			TAGGAGCGCCACT	AK000436	CCDS9512.1	13q34	2008-07-18			ENSG00000139832	ENSG00000139832		"""RAB, member RAS oncogene"""	18260	protein-coding gene	gene with protein product						11697911	Standard	NM_017817		Approved	FLJ20429	uc001vqy.3	Q9NX57	OTTHUMG00000017343	ENST00000267328.3:c.140G>T	13.37:g.111213727C>A	ENSP00000267328:p.Arg47Leu	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	7.0	NM_017817	Q5T9X5|Q9NX49	Missense_Mutation	SNP	ENST00000267328.3	37	CCDS9512.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657611	0.88154	.	.	ENSG00000139832	ENST00000267328	T	0.77620	-1.11	4.06	4.06	0.47325	Small GTP-binding protein domain (1);	0.120124	0.56097	D	0.000036	T	0.71213	0.3313	L	0.31752	0.955	0.40992	D	0.984867	P	0.34684	0.463	B	0.38712	0.28	T	0.75434	-0.3319	10	0.52906	T	0.07	-23.629	16.4344	0.83871	0.0:1.0:0.0:0.0	.	47	Q9NX57	RAB20_HUMAN	L	47	ENSP00000267328:R47L	ENSP00000267328:R47L	R	-	2	0	RAB20	110011728	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.192000	0.65115	2.104000	0.64026	0.561000	0.74099	CGC	.		0.697	RAB20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045760.2	NM_017817	
RAPGEF3	10411	ucsc.edu;bcgsc.ca	37	12	48141580	48141580	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr12:48141580T>C	ENST00000449771.2	-	14	1476	c.1388A>G	c.(1387-1389)cAg>cGg	p.Q463R	RAPGEF3_ENST00000548919.1_Missense_Mutation_p.Q421R|RAPGEF3_ENST00000171000.4_Missense_Mutation_p.Q421R|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.Q421R|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.Q421R|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.Q463R|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.Q463R			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	463	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		CAAGATCTGCTGCCTCTTGTT	0.622																																					p.Q463R		.											.	RAPGEF3	660	0			c.A1388G						.						42.0	42.0	42.0					12																	48141580		2203	4300	6503	SO:0001583	missense	10411	exon14			ATCTGCTGCCTCT	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.1388A>G	12.37:g.48141580T>C	ENSP00000395708:p.Gln463Arg	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_001098531	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	T	3.759	-0.049913	0.07407	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000541821;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919;ENST00000395358	T;T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63;1.63	4.99	3.83	0.44106	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.124546	0.53938	D	0.000045	T	0.14313	0.0346	N	0.13003	0.285	0.44462	D	0.997399	P	0.42375	0.778	B	0.42245	0.381	T	0.21690	-1.0238	10	0.02654	T	1	.	5.7911	0.18361	0.1511:0.0819:0.0:0.7669	.	463	O95398	RPGF3_HUMAN	R	421;463;110;421;421;421;463;475;421;463	ENSP00000384521:Q421R;ENSP00000395708:Q463R;ENSP00000448619:Q421R;ENSP00000171000:Q421R;ENSP00000373864:Q463R;ENSP00000448480:Q421R;ENSP00000378764:Q463R	ENSP00000171000:Q421R	Q	-	2	0	RAPGEF3	46427847	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.603000	0.54074	1.017000	0.39495	0.533000	0.62120	CAG	.		0.622	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	NM_006105	
RBM25	58517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	73576174	73576174	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr14:73576174C>G	ENST00000261973.7	+	14	1951	c.1666C>G	c.(1666-1668)Cca>Gca	p.P556A	RBM25_ENST00000532483.1_3'UTR|RBM25_ENST00000527432.1_Missense_Mutation_p.P556A	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	556	Glu-rich.|Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		AGAAGGGCATCCAGATCCAGA	0.557																																					p.P556A		.											.	RBM25	91	0			c.C1666G						.						89.0	87.0	88.0					14																	73576174		2203	4300	6503	SO:0001583	missense	58517	exon14			GGGCATCCAGATC	BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.1666C>G	14.37:g.73576174C>G	ENSP00000261973:p.Pro556Ala	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	39.0	NM_021239	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Missense_Mutation	SNP	ENST00000261973.7	37	CCDS32113.1	.	.	.	.	.	.	.	.	.	.	C	33	5.268128	0.95429	.	.	ENSG00000119707	ENST00000261973;ENST00000527432	T;T	0.12569	2.67;2.67	5.97	5.97	0.96955	.	0.046120	0.85682	D	0.000000	T	0.19485	0.0468	M	0.66939	2.045	0.80722	D	1	B	0.22541	0.071	B	0.18871	0.023	T	0.08700	-1.0709	10	0.16896	T	0.51	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	556	P49756	RBM25_HUMAN	A	556	ENSP00000261973:P556A;ENSP00000431150:P556A	ENSP00000261973:P556A	P	+	1	0	RBM25	72645927	1.000000	0.71417	0.995000	0.50966	0.911000	0.54048	7.654000	0.83653	2.836000	0.97738	0.655000	0.94253	CCA	.		0.557	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394966.1	XM_027330	
RECQL5	9400	broad.mit.edu;ucsc.edu	37	17	73624403	73624403	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr17:73624403T>G	ENST00000317905.5	-	18	2859	c.2700A>C	c.(2698-2700)caA>caC	p.Q900H	RECQL5_ENST00000443199.2_5'UTR|RECQL5_ENST00000423245.2_Missense_Mutation_p.Q873H	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	900					chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			GGAAGGGGTCTTGAGCCGTGG	0.602								Other identified genes with known or suspected DNA repair function																													p.Q900H		.											.	RECQL5	538	0			c.A2700C						.						80.0	96.0	90.0					17																	73624403		2083	4212	6295	SO:0001583	missense	9400	exon18			GGGGTCTTGAGCC	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.2700A>C	17.37:g.73624403T>G	ENSP00000317636:p.Gln900His	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	5.0	NM_004259	Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	ENST00000317905.5	37	CCDS42380.1	.	.	.	.	.	.	.	.	.	.	T	12.32	1.901378	0.33535	.	.	ENSG00000108469	ENST00000443199;ENST00000423245;ENST00000317905	T	0.58506	0.33	5.38	-2.69	0.06022	.	1.822580	0.02764	N	0.118883	T	0.48295	0.1492	L	0.59436	1.845	0.20196	N	0.999922	P;P;B	0.38863	0.65;0.65;0.102	B;B;B	0.34824	0.19;0.19;0.051	T	0.40887	-0.9539	10	0.59425	D	0.04	-1.228	2.6639	0.05034	0.1229:0.3682:0.1268:0.382	.	900;873;96	O94762;Q6P4G0;Q6FIC9	RECQ5_HUMAN;.;.	H	495;900;900	ENSP00000317636:Q900H	ENSP00000317636:Q900H	Q	-	3	2	RECQL5	71135998	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.117000	0.10708	-0.584000	0.05913	0.460000	0.39030	CAA	.		0.602	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1	NM_004259	
RECQL	5965	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	21644631	21644631	+	Silent	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr12:21644631A>G	ENST00000444129.2	-	3	504	c.36T>C	c.(34-36)gaT>gaC	p.D12D	RECQL_ENST00000421138.2_Silent_p.D12D	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	12					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TGGTTATAGAATCCAGTTCCT	0.388								Other identified genes with known or suspected DNA repair function																													p.D12D		.											.	RECQL	228	0			c.T36C						.						41.0	39.0	39.0					12																	21644631		2203	4300	6503	SO:0001819	synonymous_variant	5965	exon4			TATAGAATCCAGT	D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.36T>C	12.37:g.21644631A>G		Somatic	103.0	1.0		WXS	Illumina HiSeq	Phase_I	122.0	32.0	NM_032941	A8K6G2	Silent	SNP	ENST00000444129.2	37	CCDS31756.1																																																																																			.		0.388	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907	
REXO4	57109	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	136272149	136272151	+	In_Frame_Del	DEL	CTT	CTT	-	rs587743176	byFrequency	TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr9:136272149_136272151delCTT	ENST00000371942.3	-	8	1394_1396	c.1195_1197delAAG	c.(1195-1197)aagdel	p.K399del	REXO4_ENST00000371935.2_In_Frame_Del_p.K227del	NM_020385.2	NP_065118.2	Q9GZR2	REXO4_HUMAN	REX4, RNA exonuclease 4 homolog (S. cerevisiae)	399					regulation of transcription, DNA-templated (GO:0006355)	nucleolus (GO:0005730)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K399delK(1)		kidney(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	15				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		TCTCCCACTCCTTCTTCACCATG	0.621											OREG0019587	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		7	0.00139776	0.0008	0.0014	5008	,	,		20731	0.0		0.005	False		,,,				2504	0.0				p.399_399del		.											.	REXO4	90	1	Deletion - In frame(1)	stomach(1)	c.1195_1197del						.			5,4259		0,5,2127						3.5	1.0			141	38,8216		0,38,4089	no	coding	REXO4	NM_020385.2		0,43,6216	A1A1,A1R,RR		0.4604,0.1173,0.3435				43,12475				SO:0001651	inframe_deletion	57109	exon8			CCACTCCTTCTTC	AF273304	CCDS6969.1, CCDS65179.1	9q34	2008-02-05	2005-08-22	2005-08-22	ENSG00000148300	ENSG00000148300			12820	protein-coding gene	gene with protein product		602930	"""Xenopus prevents mitotic catatrophe 2 homolog"", ""XPMC2 prevents mitotic catastrophe 2 homolog (Xenopus laevis)"""	XPMC2H		9325058	Standard	NM_020385		Approved		uc004cdm.3	Q9GZR2	OTTHUMG00000020870	ENST00000371942.3:c.1195_1197delAAG	9.37:g.136272152_136272154delCTT	ENSP00000361010:p.Lys399del	Somatic	40.0	0.0	1624	WXS	Illumina HiSeq	Phase_I	52.0	13.0	NM_020385	B2RAT2|Q5T8S4|Q5T8S5|Q5T8S6|Q9GZW3	In_Frame_Del	DEL	ENST00000371942.3	37	CCDS6969.1																																																																																			.		0.621	REXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054899.1		
RNF26	79102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	119206381	119206381	+	Silent	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr11:119206381A>G	ENST00000311413.4	+	1	1145	c.549A>G	c.(547-549)gtA>gtG	p.V183V	RP11-334E6.10_ENST00000501918.2_RNA	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	183						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		TGACGGACGTAGTGGCTGCCT	0.612																																					p.V183V		.											.	RNF26	227	0			c.A549G						.						106.0	90.0	95.0					11																	119206381		2199	4295	6494	SO:0001819	synonymous_variant	79102	exon1			GGACGTAGTGGCT	AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.549A>G	11.37:g.119206381A>G		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	38.0	NM_032015	Q542Y8	Silent	SNP	ENST00000311413.4	37	CCDS8419.1																																																																																			.		0.612	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388220.1	NM_032015	
ROBO1	6091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	78666831	78666831	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:78666831C>A	ENST00000464233.1	-	27	4349	c.4236G>T	c.(4234-4236)gaG>gaT	p.E1412D	ROBO1_ENST00000436010.2_Missense_Mutation_p.E1373D|ROBO1_ENST00000495273.1_Missense_Mutation_p.E1367D|ROBO1_ENST00000467549.1_Missense_Mutation_p.E1312D	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1412					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GACCAGCATACTCTGCCGCTG	0.502																																					p.E1412D		.											.	ROBO1	67	0			c.G4236T						.						65.0	67.0	67.0					3																	78666831		1973	4153	6126	SO:0001583	missense	6091	exon27			AGCATACTCTGCC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4236G>T	3.37:g.78666831C>A	ENSP00000420321:p.Glu1412Asp	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	28.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	5.179	0.218599	0.09810	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.59638	0.32;0.3;0.28;0.25	5.68	2.47	0.30058	.	0.000000	0.85682	D	0.000000	T	0.51975	0.1706	N	0.12746	0.255	0.43777	D	0.996307	D;B;B;B;B	0.61697	0.99;0.013;0.001;0.021;0.023	D;B;B;B;B	0.73380	0.98;0.003;0.001;0.013;0.012	T	0.46034	-0.9220	9	.	.	.	.	7.4685	0.27334	0.0:0.5483:0.0:0.4517	.	1376;1412;1367;1312;1373	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	D	1373;1367;1412;1367;1312;1416	ENSP00000406043:E1373D;ENSP00000420321:E1412D;ENSP00000420637:E1367D;ENSP00000417992:E1312D	.	E	-	3	2	ROBO1	78749521	1.000000	0.71417	1.000000	0.80357	0.065000	0.16274	1.482000	0.35486	0.880000	0.35969	0.591000	0.81541	GAG	.		0.502	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
RPE65	6121	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	68903877	68903877	+	Missense_Mutation	SNP	A	A	G	rs62653013		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:68903877A>G	ENST00000262340.5	-	10	1174	c.1121T>C	c.(1120-1122)aTt>aCt	p.I374T		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	374					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						TACCTTGTCAATATTCAAAGG	0.378																																					p.I374T		.											.	RPE65	91	0			c.T1121C						.						93.0	96.0	95.0					1																	68903877		2203	4300	6503	SO:0001583	missense	6121	exon10			TTGTCAATATTCA	U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.1121T>C	1.37:g.68903877A>G	ENSP00000262340:p.Ile374Thr	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	11.0	NM_000329	A8K1L0|Q5T9U3	Missense_Mutation	SNP	ENST00000262340.5	37	CCDS643.1	.	.	.	.	.	.	.	.	.	.	A	13.56	2.273259	0.40194	.	.	ENSG00000116745	ENST00000262340	D	0.94537	-3.45	5.71	4.57	0.56435	.	0.139429	0.64402	D	0.000006	D	0.86585	0.5968	L	0.51914	1.62	0.53688	D	0.999979	B	0.22146	0.065	B	0.31016	0.123	T	0.81176	-0.1052	10	0.11485	T	0.65	-2.7026	11.8223	0.52245	0.9311:0.0:0.0689:0.0	.	374	Q16518	RPE65_HUMAN	T	374	ENSP00000262340:I374T	ENSP00000262340:I374T	I	-	2	0	RPE65	68676465	1.000000	0.71417	0.811000	0.32455	0.839000	0.47603	5.878000	0.69682	0.984000	0.38629	0.482000	0.46254	ATT	.		0.378	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329	
RSRC1	51319	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	157920990	157920990	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:157920990G>A	ENST00000295930.3	+	4	612	c.450G>A	c.(448-450)gaG>gaA	p.E150E	RSRC1_ENST00000475278.2_Silent_p.E150E|RSRC1_ENST00000464171.1_Intron|RSRC1_ENST00000496268.1_3'UTR|RSRC1_ENST00000312179.6_Intron|RSRC1_ENST00000480820.1_Silent_p.E150E	NM_001271838.1|NM_016625.2	NP_001258767.1|NP_057709.2	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1	150				EK -> GE (in Ref. 3; AAF64267). {ECO:0000305}.	mRNA splicing, via spliceosome (GO:0000398)|nucleocytoplasmic transport (GO:0006913)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	18			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			gagaaaaggagaaggataaag	0.443																																					p.E150E		.											.	RSRC1	90	0			c.G450A						.						116.0	123.0	120.0					3																	157920990		2203	4300	6503	SO:0001819	synonymous_variant	51319	exon4			AAAGGAGAAGGAT	AF208853	CCDS3181.1, CCDS63822.1	3q25.32	2009-09-09			ENSG00000174891	ENSG00000174891			24152	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 21"""	613352				15798186, 19065146	Standard	NM_001271838		Approved	MGC12197, BM-011, SRrp53, SFRS21	uc003fbu.2	Q96IZ7	OTTHUMG00000158758	ENST00000295930.3:c.450G>A	3.37:g.157920990G>A		Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	72.0	NM_016625	A8K2R9|Q96QK2|Q9NZE5	Silent	SNP	ENST00000295930.3	37	CCDS3181.1	.	.	.	.	.	.	.	.	.	.	G	4.038	0.004569	0.07866	.	.	ENSG00000174891	ENST00000482822	.	.	.	4.81	2.9	0.33743	.	0.264345	0.39083	N	0.001461	T	0.63803	0.2542	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63346	-0.6658	6	0.72032	D	0.01	.	8.5618	0.33516	0.2745:0.0:0.7255:0.0	.	.	.	.	K	44	.	ENSP00000420464:E44K	E	+	1	0	RSRC1	159403684	1.000000	0.71417	1.000000	0.80357	0.471000	0.32888	1.315000	0.33608	0.484000	0.27630	-0.229000	0.12294	GAA	.		0.443	RSRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352063.2	NM_016625	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	237586488	237586488	+	Silent	SNP	A	A	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:237586488A>T	ENST00000366574.2	+	12	1262	c.945A>T	c.(943-945)ctA>ctT	p.L315L	RYR2_ENST00000542537.1_Silent_p.L299L|RYR2_ENST00000360064.6_Silent_p.L313L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	315	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAAACCTTCTACTCATGGACA	0.418																																					p.L315L		.											.	RYR2	158	0			c.A945T						.						123.0	117.0	119.0					1																	237586488		1892	4107	5999	SO:0001819	synonymous_variant	6262	exon12			CCTTCTACTCATG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.945A>T	1.37:g.237586488A>T		Somatic	243.0	0.0		WXS	Illumina HiSeq	Phase_I	429.0	27.0	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																			.		0.418	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SCN3A	6328	ucsc.edu;bcgsc.ca	37	2	165947496	165947496	+	Missense_Mutation	SNP	G	G	T	rs200457036|rs386652297		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:165947496G>T	ENST00000360093.3	-	28	5658	c.5167C>A	c.(5167-5169)Cca>Aca	p.P1723T	AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Missense_Mutation_p.P1674T|SCN3A_ENST00000540861.1_Missense_Mutation_p.P206T|SCN3A_ENST00000283254.7_Missense_Mutation_p.P1723T|SCN3A_ENST00000465043.1_5'Flank	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1723					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGTCGGGTGGTGCACTATTA	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		18498	0.001		0.0	False		,,,				2504	0.0				p.P1723T		.											.	SCN3A	141	0			c.C5167A						.						157.0	156.0	156.0					2																	165947496		2203	4300	6503	SO:0001583	missense	6328	exon28			CGGGTGGTGCACT	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5167C>A	2.37:g.165947496G>T	ENSP00000353206:p.Pro1723Thr	Somatic	240.0	2.0		WXS	Illumina HiSeq	.	267.0	90.0	NM_006922	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.52	2.261163	0.39995	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.96940	-4.07;-4.07;-4.01;-4.18	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000006	D	0.95987	0.8693	M	0.85630	2.765	0.33572	D	0.598751	B;P;P	0.43519	0.13;0.546;0.809	B;B;B	0.37780	0.055;0.147;0.258	D	0.99951	1.1551	10	0.87932	D	0	.	15.7239	0.77736	0.0:0.2381:0.7619:0.0	.	1674;1674;1723	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	T	1723;1723;1674;206	ENSP00000353206:P1723T;ENSP00000283254:P1723T;ENSP00000386726:P1674T;ENSP00000439920:P206T	ENSP00000283254:P1723T	P	-	1	0	SCN3A	165655742	0.998000	0.40836	1.000000	0.80357	0.891000	0.51852	3.482000	0.53186	2.836000	0.97738	0.650000	0.86243	CCA	G|0.999;T|0.000		0.463	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
SDHB	6390	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17354296	17354296	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:17354296G>A	ENST00000375499.3	-	5	638	c.488C>T	c.(487-489)tCt>tTt	p.S163F		NM_003000.2	NP_002991.2	P21912	SDHB_HUMAN	succinate dehydrogenase complex, subunit B, iron sulfur (Ip)	163			S -> P (in CWS2; uncertain pathological significance; associated with increased manganese superoxide dismutase function and increased levels of reactive oxygen species; associated with a 2.7-fold change in AKT expression and a 1.7-fold increase in MAPK expression; dbSNP:rs33927012). {ECO:0000269|PubMed:18678321}.		aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)|ubiquinone binding (GO:0048039)	p.S163Y(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	10		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0049)|COAD - Colon adenocarcinoma(227;1.18e-05)|BRCA - Breast invasive adenocarcinoma(304;2.41e-05)|Kidney(64;0.000188)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)	Succinic acid(DB00139)	GCCTTCCTGAGATTCATCCTT	0.388			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																												p.S163F		.	yes	Rec		Familial paraganglioma	1	1p36.1-p35	6390	"""succinate dehydrogenase complex, subunit B, iron sulfur (Ip)"""		O	.	SDHB	658	1	Substitution - Missense(1)	large_intestine(1)	c.C488T						.						160.0	149.0	153.0					1																	17354296		2203	4300	6503	SO:0001583	missense	6390	exon5	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	TCCTGAGATTCAT	U17248	CCDS176.1	1p36.1-p35	2014-09-17			ENSG00000117118	ENSG00000117118	1.3.99.1	"""Mitochondrial respiratory chain complex / Complex II"""	10681	protein-coding gene	gene with protein product		185470		SDH1, SDH			Standard	NM_003000		Approved		uc001bae.3	P21912	OTTHUMG00000002289	ENST00000375499.3:c.488C>T	1.37:g.17354296G>A	ENSP00000364649:p.Ser163Phe	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	35.0	NM_003000	B2R545|Q0QEY7|Q9NQ12	Missense_Mutation	SNP	ENST00000375499.3	37	CCDS176.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796326	0.70567	.	.	ENSG00000117118	ENST00000375499	D	0.96716	-4.1	5.89	5.89	0.94794	Fumarate reductase, C-terminal (1);Alpha-helical ferredoxin (1);	0.052959	0.85682	D	0.000000	D	0.95664	0.8590	M	0.72118	2.19	0.80722	D	1	B	0.26935	0.164	B	0.24269	0.052	D	0.93455	0.6805	10	0.66056	D	0.02	-24.4299	18.8118	0.92061	0.0:0.0:1.0:0.0	.	163	P21912	DHSB_HUMAN	F	163	ENSP00000364649:S163F	ENSP00000364649:S163F	S	-	2	0	SDHB	17226883	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	7.340000	0.79292	2.790000	0.95986	0.655000	0.94253	TCT	.		0.388	SDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006603.1	NM_003000	
SEL1L	6400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	81964803	81964803	+	Silent	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr14:81964803C>T	ENST00000336735.4	-	9	1043	c.927G>A	c.(925-927)caG>caA	p.Q309Q		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	309	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		ATTCACAACTCTGGAGGACGC	0.428																																					p.Q309Q		.											.	SEL1L	227	0			c.G927A						.						101.0	92.0	95.0					14																	81964803		2203	4300	6503	SO:0001819	synonymous_variant	6400	exon9			ACAACTCTGGAGG		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.927G>A	14.37:g.81964803C>T		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	17.0	NM_005065	Q6UWT6|Q9P1T9|Q9UHK7	Silent	SNP	ENST00000336735.4	37	CCDS9876.1																																																																																			.		0.428	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	
SEPSECS	51091	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	25156767	25156767	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:25156767T>G	ENST00000382103.2	-	5	626	c.554A>C	c.(553-555)gAg>gCg	p.E185A	SEPSECS_ENST00000302922.3_Missense_Mutation_p.E106A	NM_016955.3	NP_058651.3	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase	185					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	pyridoxal phosphate binding (GO:0030170)|transferase activity, transferring selenium-containing groups (GO:0016785)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(2)|stomach(1)	8		Breast(46;0.173)				CACCACAGGCTCAAAACCTAA	0.428																																					p.E185A		.											.	SEPSECS	90	0			c.A554C						.						90.0	80.0	84.0					4																	25156767		2203	4300	6503	SO:0001583	missense	51091	exon5			ACAGGCTCAAAAC	AJ238617	CCDS3432.1, CCDS3432.2	4p15.2	2008-10-27			ENSG00000109618	ENSG00000109618			30605	protein-coding gene	gene with protein product	"""soluble liver antigen/liver pancreas antigen"""	613009				16230358, 10931155, 17142313, 17194211	Standard	NM_016955		Approved	SLA/LP, SLA	uc003grg.3	Q9HD40	OTTHUMG00000128563	ENST00000382103.2:c.554A>C	4.37:g.25156767T>G	ENSP00000371535:p.Glu185Ala	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	8.0	NM_016955	A8K8W1|Q0D2P3|Q17RT1|Q9NXZ5|Q9UGM9|Q9Y353	Missense_Mutation	SNP	ENST00000382103.2	37	CCDS3432.2	.	.	.	.	.	.	.	.	.	.	T	21.2	4.110106	0.77210	.	.	ENSG00000109618	ENST00000302922;ENST00000382103	D;D	0.83755	-1.76;-1.76	5.37	5.37	0.77165	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.138001	0.64402	D	0.000004	D	0.88840	0.6546	M	0.82517	2.595	0.80722	D	1	D;P;P	0.54601	0.967;0.948;0.93	P;P;P	0.54706	0.759;0.674;0.669	D	0.88000	0.2755	10	0.29301	T	0.29	-10.4458	15.7032	0.77558	0.0:0.0:0.0:1.0	.	184;125;185	Q9HD40-3;A1A4F3;Q9HD40	.;.;SPCS_HUMAN	A	106;185	ENSP00000305956:E106A;ENSP00000371535:E185A	ENSP00000305956:E106A	E	-	2	0	SEPSECS	24765865	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.609000	0.82925	2.178000	0.69098	0.473000	0.43528	GAG	.		0.428	SEPSECS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250414.2	NM_016955	
SIRPB2	284759	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	1471995	1471995	+	De_novo_Start_OutOfFrame	SNP	G	G	A	rs372457994		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr20:1471995G>A	ENST00000537284.1	-	0	64				SIRPB2_ENST00000359801.3_Missense_Mutation_p.T4M|AL109658.1_ENST00000580848.1_RNA|SIRPB2_ENST00000444444.2_Missense_Mutation_p.T4M			Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGCCGACATCGTGGAGCACAT	0.612																																					p.T4M		.											.	SIRPB2	226	0			c.C11T						.	G	MET/THR,MET/THR	0,3136		0,0,1568	39.0	48.0	45.0		11,11	-5.0	0.0	20		45	2,7162		0,2,3580	no	missense,missense	SIRPB2	NM_001122962.1,NM_001134836.1	81,81	0,2,5148	AA,AG,GG		0.0279,0.0,0.0194	probably-damaging,probably-damaging	4/343,4/245	1471995	2,10298	1568	3582	5150			284759	exon1			GACATCGTGGAGC	AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000537284.1:c.-273C>T	20.37:g.1471995G>A		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	8.0	NM_001122962	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000537284.1	37		.	.	.	.	.	.	.	.	.	.	G	0.534	-0.856574	0.02630	0.0	2.79E-4	ENSG00000196209	ENST00000359801;ENST00000444444;ENST00000381630;ENST00000381628	T;T;T	0.02763	4.52;4.2;4.17	3.39	-4.98	0.03019	.	3.530630	0.00870	N	0.002017	T	0.01353	0.0044	N	0.02539	-0.55	0.18873	N	0.999985	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.46205	-0.9208	10	0.30078	T	0.28	0.0053	5.0559	0.14533	0.459:0.0:0.4007:0.1403	.	4;4	E9PCW6;Q5JXA9	.;SIRB2_HUMAN	M	4	ENSP00000352849:T4M;ENSP00000402438:T4M;ENSP00000371043:T4M	ENSP00000352849:T4M	T	-	2	0	SIRPB2	1419995	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.780000	0.04654	-1.061000	0.03185	-1.130000	0.01982	ACG	.		0.612	SIRPB2-201	KNOWN	basic	protein_coding	protein_coding		NM_178459	
SLC22A1	6580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	160543147	160543147	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr6:160543147G>A	ENST00000366963.4	+	1	327	c.180G>A	c.(178-180)caG>caA	p.Q60Q	SLC22A1_ENST00000324965.4_Silent_p.Q60Q|SLC22A1_ENST00000457470.2_Silent_p.Q60Q	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	60					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)		SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	AGCTGAGCCAGCGCTGTGGCT	0.652																																					p.Q60Q		.											.	SLC22A1	90	0			c.G180A						.						63.0	72.0	69.0					6																	160543147		2203	4300	6503	SO:0001819	synonymous_variant	6580	exon1			GAGCCAGCGCTGT	U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.180G>A	6.37:g.160543147G>A		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	13.0	NM_153187	A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Silent	SNP	ENST00000366963.4	37	CCDS5274.1																																																																																			.		0.652	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042938.2		
SLC2A1	6513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	43394606	43394606	+	Silent	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:43394606C>A	ENST00000426263.3	-	8	1249	c.1071G>T	c.(1069-1071)ctG>ctT	p.L357L	SLC2A1_ENST00000475162.1_Intron	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	357					carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	AACTCACCAGCAGTGCTAGCG	0.602																																					p.L357L		.											.	SLC2A1	94	0			c.G1071T						.						113.0	111.0	112.0					1																	43394606		2203	4300	6503	SO:0001819	synonymous_variant	6513	exon8			CACCAGCAGTGCT	K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.1071G>T	1.37:g.43394606C>A		Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	19.0	NM_006516	A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Silent	SNP	ENST00000426263.3	37	CCDS477.1																																																																																			.		0.602	SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020358.2	NM_006516	
SLFN14	342618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33875781	33875781	+	Missense_Mutation	SNP	G	G	A	rs548942825		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr17:33875781G>A	ENST00000415846.3	-	4	2251	c.2216C>T	c.(2215-2217)gCg>gTg	p.A739V		NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	739							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						CATAACCTTCGCTATTTCCAG	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		22092	0.001		0.0	False		,,,				2504	0.0				p.A739V		.											.	SLFN14	1	0			c.C2216T						.						49.0	43.0	45.0					17																	33875781		692	1591	2283	SO:0001583	missense	342618	exon4			ACCTTCGCTATTT		CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.2216C>T	17.37:g.33875781G>A	ENSP00000391101:p.Ala739Val	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	50.0	NM_001129820	B2RTW9	Missense_Mutation	SNP	ENST00000415846.3	37	CCDS45650.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064626	0.55432	.	.	ENSG00000236320	ENST00000415846	T	0.02323	4.34	5.37	5.37	0.77165	.	.	.	.	.	T	0.16257	0.0391	M	0.79693	2.465	0.27906	N	0.938783	D	0.89917	1.0	D	0.80764	0.994	T	0.01004	-1.1484	9	0.66056	D	0.02	.	14.4925	0.67660	0.0:0.0:1.0:0.0	.	739	P0C7P3	SLN14_HUMAN	V	739	ENSP00000391101:A739V	ENSP00000391101:A739V	A	-	2	0	SLFN14	30899894	0.976000	0.34144	0.998000	0.56505	0.116000	0.19942	1.863000	0.39459	2.788000	0.95919	0.650000	0.86243	GCG	.		0.453	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448928.1	NM_001129820	
SLIT2	9353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	20535249	20535249	+	Silent	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:20535249A>G	ENST00000504154.1	+	18	1995	c.1743A>G	c.(1741-1743)gcA>gcG	p.A581A	SLIT2_ENST00000503823.1_Silent_p.A573A|SLIT2_ENST00000503837.1_Silent_p.A577A|SLIT2_ENST00000273739.5_Silent_p.A585A	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	581					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TTGAAGGAGCATCTGGTGTAA	0.323																																					p.A581A		.											.	SLIT2	521	0			c.A1743G						.						129.0	130.0	130.0					4																	20535249		2203	4300	6503	SO:0001819	synonymous_variant	9353	exon18			AGGAGCATCTGGT	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1743A>G	4.37:g.20535249A>G		Somatic	449.0	0.0		WXS	Illumina HiSeq	Phase_I	505.0	188.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	CCDS3426.1																																																																																			.		0.323	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
RIBC2	26150	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	22	45809347	45809347	+	5'Flank	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr22:45809347G>T	ENST00000342894.3	+	0	0				RIBC2_ENST00000538017.1_5'Flank|SMC1B_ENST00000404354.3_Missense_Mutation_p.N34K|SMC1B_ENST00000357450.4_Missense_Mutation_p.N34K			Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2							nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|skin(2)|urinary_tract(1)	10		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TACCAGAGCCGTTGGGGCCGA	0.682																																					p.N34K		.											.	SMC1B	229	0			c.C102A						.						21.0	27.0	25.0					22																	45809347		1931	4134	6065	SO:0001631	upstream_gene_variant	27127	exon1			AGAGCCGTTGGGG	AK098586		22q13.3	2004-08-18	2004-08-18	2004-08-18	ENSG00000128408	ENSG00000128408			13241	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 11"""	C22orf11		12477932	Standard	NM_015653		Approved	DKFZp566F0546, FLJ25720	uc011aqs.3	Q9H4K1	OTTHUMG00000151332		22.37:g.45809347G>T	Exception_encountered	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	15.0	NM_148674	Q6ICD0|Q9Y413	Missense_Mutation	SNP	ENST00000342894.3	37		.	.	.	.	.	.	.	.	.	.	G	12.68	2.011813	0.35511	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	D;T	0.84660	-1.88;1.87	3.58	1.42	0.22433	.	0.000000	0.47455	U	0.000221	D	0.91862	0.7424	M	0.89601	3.045	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89566	0.3810	10	0.87932	D	0	.	7.7074	0.28659	0.4515:0.0:0.5485:0.0	.	34;34	Q8NDV3-2;Q8NDV3-3	.;.	K	34	ENSP00000350036:N34K;ENSP00000385902:N34K	ENSP00000350036:N34K	N	-	3	2	SMC1B	44188011	0.653000	0.27358	0.999000	0.59377	0.136000	0.21042	-0.133000	0.10451	0.010000	0.14839	-1.595000	0.00837	AAC	.		0.682	RIBC2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000322250.1	NM_015653	
SMYD1	150572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	88396264	88396264	+	Silent	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:88396264G>C	ENST00000419482.2	+	6	934	c.849G>C	c.(847-849)ctG>ctC	p.L283L	SMYD1_ENST00000438570.1_Intron|SMYD1_ENST00000444564.2_Silent_p.L270L	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	283					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						AGAAAAAACTGAAGGATGACC	0.498																																					p.L283L		.											.	SMYD1	229	0			c.G849C						.						92.0	86.0	88.0					2																	88396264		2203	4300	6503	SO:0001819	synonymous_variant	150572	exon6			AAAACTGAAGGAT	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.849G>C	2.37:g.88396264G>C		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	32.0	NM_198274	A0AV30|A6NE13	Silent	SNP	ENST00000419482.2	37	CCDS33240.1																																																																																			.		0.498	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
SPEN	23013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	16255449	16255449	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:16255449A>G	ENST00000375759.3	+	11	2918	c.2714A>G	c.(2713-2715)aAt>aGt	p.N905S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	905					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAGCTTGATAATGACACTGTC	0.448																																					p.N905S		.											.	SPEN	298	0			c.A2714G						.						150.0	164.0	159.0					1																	16255449		2203	4300	6503	SO:0001583	missense	23013	exon11			TTGATAATGACAC		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2714A>G	1.37:g.16255449A>G	ENSP00000364912:p.Asn905Ser	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	25.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.572244	0.00887	.	.	ENSG00000065526	ENST00000375759	T	0.51325	0.71	5.38	-1.33	0.09172	.	.	.	.	.	T	0.31482	0.0798	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32798	-0.9893	9	0.09084	T	0.74	-9.8138	6.9472	0.24526	0.5567:0.1165:0.3269:0.0	.	905	Q96T58	MINT_HUMAN	S	905	ENSP00000364912:N905S	ENSP00000364912:N905S	N	+	2	0	SPEN	16128036	0.997000	0.39634	0.014000	0.15608	0.014000	0.08584	2.374000	0.44274	-0.391000	0.07763	-0.912000	0.02778	AAT	.		0.448	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
TARSL2	123283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	102215816	102215816	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr15:102215816T>C	ENST00000335968.3	-	13	1991	c.1775A>G	c.(1774-1776)aAt>aGt	p.N592S		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	592					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CTCAGCCTCATTCCACATCTC	0.433																																					p.N592S		.											.	TARSL2	92	0			c.A1775G						.						157.0	148.0	151.0					15																	102215816		2203	4300	6503	SO:0001583	missense	123283	exon13			GCCTCATTCCACA	AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1775A>G	15.37:g.102215816T>C	ENSP00000338093:p.Asn592Ser	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	23.0	NM_152334	B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Missense_Mutation	SNP	ENST00000335968.3	37	CCDS10394.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.988934	0.53934	.	.	ENSG00000185418	ENST00000335968;ENST00000333018;ENST00000539112	T;T	0.67171	-0.25;-0.25	5.37	4.24	0.50183	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.397221	0.30762	N	0.008932	T	0.74283	0.3696	M	0.91196	3.185	0.30076	N	0.809608	B;B	0.30605	0.287;0.125	B;B	0.36092	0.217;0.138	T	0.75074	-0.3446	10	0.87932	D	0	-9.2185	10.4461	0.44495	0.0:0.0:0.1806:0.8194	.	592;497	A2RTX5;A2RTX5-2	SYTC2_HUMAN;.	S	592;497;592	ENSP00000338093:N592S;ENSP00000439899:N592S	ENSP00000329291:N497S	N	-	2	0	TARSL2	100033339	1.000000	0.71417	0.988000	0.46212	0.823000	0.46562	6.089000	0.71384	0.872000	0.35775	0.533000	0.62120	AAT	.		0.433	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313619.3	NM_152334	
TBCCD1	55171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	186281901	186281901	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:186281901C>A	ENST00000424280.1	-	2	697	c.218G>T	c.(217-219)tGg>tTg	p.W73L	TBCCD1_ENST00000446782.1_Intron|TBCCD1_ENST00000338733.5_Missense_Mutation_p.W73L	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	73					cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		GAAGTAAAGCCACGCCAGGTC	0.527																																					p.W73L		.											.	TBCCD1	108	0			c.G218T						.						68.0	64.0	66.0					3																	186281901		2203	4300	6503	SO:0001583	missense	55171	exon2			TAAAGCCACGCCA	BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.218G>T	3.37:g.186281901C>A	ENSP00000411253:p.Trp73Leu	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	24.0	NM_001134415	B3KW69|D3DNU6|G5E9J4	Missense_Mutation	SNP	ENST00000424280.1	37	CCDS3276.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890300	0.91889	.	.	ENSG00000113838	ENST00000424280;ENST00000338733;ENST00000413695;ENST00000430560	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.66963	0.2843	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69789	-0.5050	10	0.72032	D	0.01	-7.4769	17.2023	0.86909	0.0:1.0:0.0:0.0	.	73	Q9NVR7	TBCC1_HUMAN	L	73	ENSP00000411253:W73L;ENSP00000341652:W73L;ENSP00000391109:W73L;ENSP00000407506:W73L	ENSP00000341652:W73L	W	-	2	0	TBCCD1	187764595	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.336000	0.79245	2.663000	0.90544	0.561000	0.74099	TGG	.		0.527	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344774.1	NM_018138	
TDRD7	23424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	100235830	100235830	+	Silent	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr9:100235830C>T	ENST00000355295.4	+	11	2296	c.2001C>T	c.(1999-2001)ctC>ctT	p.L667L	TDRD7_ENST00000540902.1_Silent_p.L16L|TDRD7_ENST00000422139.2_Silent_p.L593L	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	667					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				ATGGGACACTCTACTGCCAGG	0.438																																					p.L667L		.											.	TDRD7	93	0			c.C2001T						.						184.0	165.0	171.0					9																	100235830		2203	4300	6503	SO:0001819	synonymous_variant	23424	exon11			GACACTCTACTGC	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.2001C>T	9.37:g.100235830C>T		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	36.0	NM_014290	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Silent	SNP	ENST00000355295.4	37	CCDS6725.1																																																																																			.		0.438	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290	
TFAP4	7023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4308230	4308230	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr16:4308230G>A	ENST00000204517.6	-	7	1171	c.843C>T	c.(841-843)ggC>ggT	p.G281G		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	281					cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						TTTCCTGGGTGCCCTCGATGT	0.667																																					p.G281G		.											.	TFAP4	91	0			c.C843T						.						44.0	46.0	46.0					16																	4308230		2197	4300	6497	SO:0001819	synonymous_variant	7023	exon7			CTGGGTGCCCTCG	X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.843C>T	16.37:g.4308230G>A		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	18.0	NM_003223	O60409	Silent	SNP	ENST00000204517.6	37	CCDS10510.1																																																																																			.		0.667	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251595.2	NM_003223	
TJAP1	93643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43471363	43471363	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr6:43471363G>C	ENST00000372445.5	+	10	874	c.498G>C	c.(496-498)gaG>gaC	p.E166D	TJAP1_ENST00000372444.2_Missense_Mutation_p.E156D|TJAP1_ENST00000372449.1_Missense_Mutation_p.E166D|TJAP1_ENST00000436109.2_Missense_Mutation_p.E156D|TJAP1_ENST00000372452.1_Missense_Mutation_p.E156D|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000259751.1_Missense_Mutation_p.E156D|TJAP1_ENST00000438588.2_Missense_Mutation_p.E166D	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	166					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GTCTGTAGGAGCGGTACCGGC	0.592																																					p.E166D		.											.	TJAP1	90	0			c.G498C						.						69.0	68.0	68.0					6																	43471363		2203	4300	6503	SO:0001583	missense	93643	exon10			GTAGGAGCGGTAC	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.498G>C	6.37:g.43471363G>C	ENSP00000361522:p.Glu166Asp	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	42.0	NM_001146016	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Missense_Mutation	SNP	ENST00000372445.5	37	CCDS55004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.41|18.41	3.618169|3.618169	0.66787|0.66787	.|.	.|.	ENSG00000137221|ENSG00000137221	ENST00000454762|ENST00000372444;ENST00000372445;ENST00000436109;ENST00000442878;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588	.|T;T;T;T;T;T;T;T	.|0.50548	.|0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.65|5.65	1.76|1.76	0.24704|0.24704	.|.	.|0.045264	.|0.85682	.|D	.|0.000000	T|T	0.40767|0.40767	0.1130|0.1130	L|L	0.35414|0.35414	1.06|1.06	0.42677|0.42677	D|D	0.99353|0.99353	.|D;D	.|0.76494	.|0.996;0.999	.|D;D	.|0.76071	.|0.987;0.945	T|T	0.32481|0.32481	-0.9905|-0.9905	5|10	.|0.46703	.|T	.|0.11	-30.4801|-30.4801	9.6221|9.6221	0.39727|0.39727	0.3573:0.0:0.6427:0.0|0.3573:0.0:0.6427:0.0	.|.	.|166;156	.|Q5JTD0;Q5JTD0-2	.|TJAP1_HUMAN;.	P|D	114|156;166;156;166;156;156;156;166;166	.|ENSP00000361521:E156D;ENSP00000361522:E166D;ENSP00000407080:E156D;ENSP00000390981:E166D;ENSP00000259751:E156D;ENSP00000361530:E156D;ENSP00000361527:E166D;ENSP00000408769:E166D	.|ENSP00000259751:E156D	A|E	+|+	1|3	0|2	TJAP1|TJAP1	43579341|43579341	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.807000|0.807000	0.45602|0.45602	0.733000|0.733000	0.26087|0.26087	0.705000|0.705000	0.31890|0.31890	0.462000|0.462000	0.41574|0.41574	GCG|GAG	.		0.592	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	
TMEM128	85013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	4248025	4248025	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:4248025A>C	ENST00000382753.4	-	2	152	c.143T>G	c.(142-144)cTt>cGt	p.L48R	TMEM128_ENST00000540397.1_Missense_Mutation_p.L48R|TMEM128_ENST00000538516.1_Missense_Mutation_p.L48R|TMEM128_ENST00000254742.2_Missense_Mutation_p.L24R			Q5BJH2	TM128_HUMAN	transmembrane protein 128	48						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		ATGGATATTAAGTCTTGGAAG	0.363																																					p.L24R		.											.	TMEM128	90	0			c.T71G						.						126.0	135.0	132.0					4																	4248025		2203	4300	6503	SO:0001583	missense	85013	exon2			ATATTAAGTCTTG	BC007729	CCDS3373.1, CCDS75099.1	4p16.3	2008-02-05			ENSG00000132406	ENSG00000132406			28201	protein-coding gene	gene with protein product							Standard	XM_005248034		Approved	MGC13159	uc003ghq.1	Q5BJH2	OTTHUMG00000125475	ENST00000382753.4:c.143T>G	4.37:g.4248025A>C	ENSP00000372201:p.Leu48Arg	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	40.0	NM_032927	B4DHS7|D3DVS3|Q5H9U6|Q96I94	Missense_Mutation	SNP	ENST00000382753.4	37		.	.	.	.	.	.	.	.	.	.	A	21.7	4.184129	0.78677	.	.	ENSG00000132406	ENST00000254742;ENST00000382753;ENST00000538516;ENST00000540397	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	5.83	4.65	0.58169	.	0.118143	0.56097	D	0.000022	D	0.88481	0.6448	M	0.64997	1.995	0.43527	D	0.995809	D;D;D;D	0.76494	0.999;0.999;0.999;0.998	D;D;D;D	0.73380	0.98;0.961;0.961;0.93	D	0.88548	0.3114	10	0.87932	D	0	-32.5488	10.9313	0.47220	0.9258:0.0:0.0742:0.0	.	48;48;48;24	B7Z3K1;Q5BJH2;D3DVS1;Q5BJH2-2	.;TM128_HUMAN;.;.	R	24;48;48;48	ENSP00000254742:L24R;ENSP00000372201:L48R;ENSP00000442300:L48R;ENSP00000439174:L48R	ENSP00000254742:L24R	L	-	2	0	TMEM128	4298926	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.348000	0.79366	1.043000	0.40175	0.533000	0.62120	CTT	.		0.363	TMEM128-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000246798.2	NM_032927	
TMEM241	85019	ucsc.edu;bcgsc.ca	37	18	20953716	20953716	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr18:20953716A>G	ENST00000383233.3	-	7	447	c.395T>C	c.(394-396)cTc>cCc	p.L132P	TMEM241_ENST00000450466.2_Missense_Mutation_p.L11P|TMEM241_ENST00000542162.1_Missense_Mutation_p.L132P	NM_032933.4	NP_116322.3	Q24JQ0	TM241_HUMAN	transmembrane protein 241	132						integral component of membrane (GO:0016021)											TGCGGCCAGGAGGAGGAGGGC	0.498																																					p.L132P		.											.	.	.	0			c.T395C						.						99.0	95.0	96.0					18																	20953716		2203	4300	6503	SO:0001583	missense	85019	exon7			GCCAGGAGGAGGA	BC082984	CCDS11876.2	18q11.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134490	ENSG00000134490			31723	protein-coding gene	gene with protein product		615430	"""chromosome 18 open reading frame 45"""	C18orf45		12477932	Standard	NM_032933		Approved	MGC11386, FLJ44259	uc002kuf.3	Q24JQ0	OTTHUMG00000131771	ENST00000383233.3:c.395T>C	18.37:g.20953716A>G	ENSP00000372720:p.Leu132Pro	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_032933	I0J130|Q6ZTS7|Q6ZW41	Missense_Mutation	SNP	ENST00000383233.3	37	CCDS11876.2	.	.	.	.	.	.	.	.	.	.	A	12.55	1.971615	0.34754	.	.	ENSG00000134490	ENST00000450466;ENST00000383233;ENST00000542162	T;T;T	0.70282	0.84;0.84;-0.47	6.17	6.17	0.99709	.	0.104769	0.42964	D	0.000637	T	0.80844	0.4701	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	D	0.66196	0.942	T	0.82587	-0.0383	10	0.87932	D	0	-9.2831	13.214	0.59844	1.0:0.0:0.0:0.0	.	132	Q24JQ0	CR045_HUMAN	P	11;132;132	ENSP00000414899:L11P;ENSP00000372720:L132P;ENSP00000440152:L132P	ENSP00000372720:L132P	L	-	2	0	C18orf45	19207714	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	4.815000	0.62634	2.371000	0.80710	0.533000	0.62120	CTC	.		0.498	TMEM241-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254702.3	NM_032933	
TOP2B	7155	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	25668097	25668097	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:25668097G>A	ENST00000264331.4	-	18	2177	c.2178C>T	c.(2176-2178)ctC>ctT	p.L726L	TOP2B_ENST00000435706.2_Silent_p.L721L	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	726					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	AGTTTGAGAAGAGAATCAATT	0.259																																					p.L721L		.											.	TOP2B	273	0			c.C2163T						.						39.0	39.0	39.0					3																	25668097		1912	4135	6047	SO:0001819	synonymous_variant	7155	exon18			TGAGAAGAGAATC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.2178C>T	3.37:g.25668097G>A		Somatic	141.0	1.0		WXS	Illumina HiSeq	Phase_I	142.0	29.0	NM_001068	Q13600|Q9UMG8|Q9UQP8	Silent	SNP	ENST00000264331.4	37																																																																																				.		0.259	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
TRIM37	4591	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	57138433	57138433	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr17:57138433C>A	ENST00000262294.7	-	12	1238	c.979G>T	c.(979-981)Gtg>Ttg	p.V327L	RN7SL716P_ENST00000580539.1_RNA|TRIM37_ENST00000393065.2_Missense_Mutation_p.V293L|TRIM37_ENST00000376149.3_Missense_Mutation_p.V205L|TRIM37_ENST00000393066.3_Missense_Mutation_p.V327L	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	327	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TCCAGAAACACAGATAAGTAG	0.353									Mulibrey Nanism																												p.V327L		.											.	TRIM37	660	0			c.G979T						.						86.0	82.0	83.0					17																	57138433		2203	4300	6503	SO:0001583	missense	4591	exon12	Familial Cancer Database	Perheentupa syndrome	GAAACACAGATAA	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.979G>T	17.37:g.57138433C>A	ENSP00000262294:p.Val327Leu	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	17.0	NM_015294	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	37	CCDS32694.1	.	.	.	.	.	.	.	.	.	.	C	35	5.508139	0.96386	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.61274	0.12;0.12;0.12;0.12	5.7	5.7	0.88788	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.64402	D	0.000001	T	0.71484	0.3345	L	0.42487	1.325	0.80722	D	1	D;D;P	0.71674	0.998;0.996;0.861	D;D;P	0.76071	0.972;0.987;0.627	T	0.71590	-0.4547	10	0.59425	D	0.04	-45.3867	19.8478	0.96722	0.0:1.0:0.0:0.0	.	293;205;327	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	L	327;327;205;293	ENSP00000376785:V327L;ENSP00000262294:V327L;ENSP00000365319:V205L;ENSP00000376784:V293L	ENSP00000262294:V327L	V	-	1	0	TRIM37	54493215	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.503000	0.81632	2.698000	0.92095	0.655000	0.94253	GTG	.		0.353	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	NM_015294	
TRIM68	55128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4621894	4621894	+	Missense_Mutation	SNP	C	C	T	rs139399398		TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr11:4621894C>T	ENST00000300747.5	-	7	1359	c.1070G>A	c.(1069-1071)cGg>cAg	p.R357Q		NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68	357	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCAGTAGTGCCGGCCTGAGGA	0.542																																					p.R357Q		.											.	TRIM68	91	0			c.G1070A						.	C	GLN/ARG	1,4401	2.1+/-5.4	0,1,2200	48.0	50.0	50.0		1070	0.8	1.0	11	dbSNP_134	50	0,8596		0,0,4298	no	missense	TRIM68	NM_018073.5	43	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	357/486	4621894	1,12997	2201	4298	6499	SO:0001583	missense	55128	exon7			TAGTGCCGGCCTG	AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1		ENST00000300747.5:c.1070G>A	11.37:g.4621894C>T	ENSP00000300747:p.Arg357Gln	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	53.0	NM_018073	A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Missense_Mutation	SNP	ENST00000300747.5	37	CCDS31356.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179112	0.57800	2.27E-4	0.0	ENSG00000167333	ENST00000300747;ENST00000544055;ENST00000526337	T;T	0.70631	-0.5;-0.13	5.52	0.837	0.18896	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.48286	D	0.000193	T	0.66577	0.2803	M	0.80616	2.505	0.30926	N	0.727454	D	0.59357	0.985	B	0.43386	0.418	T	0.68534	-0.5383	10	0.87932	D	0	.	4.214	0.10526	0.1499:0.4915:0.0:0.3586	.	357	Q6AZZ1	TRI68_HUMAN	Q	357;78;134	ENSP00000300747:R357Q;ENSP00000434681:R134Q	ENSP00000300747:R357Q	R	-	2	0	TRIM68	4578470	0.776000	0.28616	0.996000	0.52242	0.994000	0.84299	1.357000	0.34090	0.281000	0.22233	0.561000	0.74099	CGG	C|1.000;T|0.000		0.542	TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	NM_018073	
TTC19	54902	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	15928399	15928399	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr17:15928399T>C	ENST00000261647.5	+	8	1214	c.745T>C	c.(745-747)Ttc>Ctc	p.F249L	TTC19_ENST00000486880.2_Missense_Mutation_p.F370L|TTC19_ENST00000497842.2_3'UTR	NM_001271420.1|NM_017775.3	NP_001258349.1|NP_060245.3	Q6DKK2	TTC19_HUMAN	tetratricopeptide repeat domain 19	249					cytokinesis (GO:0000910)|mitochondrial respiratory chain complex III assembly (GO:0034551)	centrosome (GO:0005813)|midbody (GO:0030496)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				central_nervous_system(1)|lung(2)|skin(1)|stomach(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CTACCTTCTGTTCTCCAAGCA	0.473																																					p.F249L		.											.	TTC19	91	0			c.T745C						.						74.0	69.0	71.0					17																	15928399		2203	4300	6503	SO:0001583	missense	54902	exon8			CTTCTGTTCTCCA	AK094819	CCDS11174.1, CCDS11174.2	17p11.2	2013-01-11			ENSG00000011295	ENSG00000011295		"""Tetratricopeptide (TTC) repeat domain containing"""	26006	protein-coding gene	gene with protein product		613814					Standard	NM_017775		Approved	FLJ20343, MGC19520	uc002gph.3	Q6DKK2	OTTHUMG00000059306	ENST00000261647.5:c.745T>C	17.37:g.15928399T>C	ENSP00000261647:p.Phe249Leu	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	21.0	NM_017775	A8MZ52|B3KP62|B4DN65|Q2M248|Q7L3U8|Q9H6G3|Q9NXB2	Missense_Mutation	SNP	ENST00000261647.5	37	CCDS11174.2	.	.	.	.	.	.	.	.	.	.	T	12.01	1.808586	0.31961	.	.	ENSG00000011295	ENST00000261647;ENST00000555605;ENST00000395886	D	0.93859	-3.3	5.88	2.36	0.29203	Tetratricopeptide-like helical (1);	0.896652	0.09962	N	0.733342	D	0.82747	0.5104	N	0.05230	-0.09	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.12156	0.007;0.002	T	0.71388	-0.4608	10	0.27785	T	0.31	0.807	5.8147	0.18486	0.3111:0.0:0.353:0.3359	.	249;12	Q6DKK2;B3KT23	TTC19_HUMAN;.	L	249;370;249	ENSP00000261647:F249L	ENSP00000261647:F370L	F	+	1	0	TTC19	15869124	0.004000	0.15560	0.997000	0.53966	0.998000	0.95712	0.666000	0.25097	1.029000	0.39812	0.482000	0.46254	TTC	.		0.473	TTC19-001	NOVEL	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000131725.6	NM_017775	
TTLL10	254173	ucsc.edu;bcgsc.ca	37	1	1118288	1118288	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:1118288T>C	ENST00000379290.1	+	11	1122	c.949T>C	c.(949-951)Tcc>Ccc	p.S317P	TTLL10_ENST00000379288.3_Missense_Mutation_p.S244P|TTLL10_ENST00000379289.1_Missense_Mutation_p.S317P			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	317	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GCCCACAGCCTCCAACCAGGG	0.657																																					p.S317P		.											.	TTLL10	153	0			c.T949C						.						32.0	23.0	26.0					1																	1118288		2194	4296	6490	SO:0001583	missense	254173	exon11			ACAGCCTCCAACC	AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.949T>C	1.37:g.1118288T>C	ENSP00000368592:p.Ser317Pro	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_001130045	B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	Missense_Mutation	SNP	ENST00000379290.1	37	CCDS44036.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.694963	0.48202	.	.	ENSG00000162571	ENST00000379290;ENST00000379289;ENST00000379288	T;T;T	0.08896	3.04;3.04;3.04	3.53	3.53	0.40419	.	0.590344	0.16492	U	0.212058	T	0.30103	0.0754	M	0.91872	3.25	0.27456	N	0.953305	D;D	0.69078	0.996;0.997	P;D	0.65874	0.899;0.939	T	0.11251	-1.0595	10	0.35671	T	0.21	.	8.6265	0.33892	0.0:0.0:0.0:1.0	.	244;317	Q6ZVT0-3;Q6ZVT0	.;TTL10_HUMAN	P	317;317;244	ENSP00000368592:S317P;ENSP00000368591:S317P;ENSP00000368590:S244P	ENSP00000368590:S244P	S	+	1	0	TTLL10	1108151	0.998000	0.40836	1.000000	0.80357	0.843000	0.47879	1.325000	0.33724	1.602000	0.50124	0.353000	0.21931	TCC	.		0.657	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002421.3	NM_153254	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179415808	179415808	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:179415808T>A	ENST00000591111.1	-	286	86751	c.86527A>T	c.(86527-86529)Aca>Tca	p.T28843S	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T21611S|TTN_ENST00000460472.2_Missense_Mutation_p.T21419S|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T27916S|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T30484S|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T21544S|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28843	Fibronectin type-III 110. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGAGTCCTGTAACTGTGTAC	0.453																																					p.T30484S		.											.	TTN	636	0			c.A91450T						.						89.0	86.0	87.0					2																	179415808		1947	4152	6099	SO:0001583	missense	7273	exon336			GTCCTGTAACTGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.86527A>T	2.37:g.179415808T>A	ENSP00000465570:p.Thr28843Ser	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	43.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	16.37	3.103035	0.56183	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.9	4.73	0.59995	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.48114	0.1482	L	0.51422	1.61	0.50632	D	0.999882	B;B;B;B	0.27166	0.17;0.17;0.17;0.099	B;B;B;B	0.26310	0.068;0.068;0.068;0.047	T	0.47315	-0.9127	9	0.87932	D	0	.	12.6321	0.56663	0.1239:0.0:0.0:0.8761	.	21419;21544;21611;28843	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	27916;21419;21611;21544;21416	ENSP00000343764:T27916S;ENSP00000434586:T21419S;ENSP00000340554:T21611S;ENSP00000352154:T21544S	ENSP00000340554:T21611S	T	-	1	0	TTN	179124054	1.000000	0.71417	0.989000	0.46669	0.976000	0.68499	3.275000	0.51639	1.023000	0.39654	0.528000	0.53228	ACA	.		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179544137	179544137	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:179544137T>A	ENST00000591111.1	-	140	32944	c.32720A>T	c.(32719-32721)gAg>gTg	p.E10907V	TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E9980V|TTN_ENST00000589042.1_Missense_Mutation_p.E11224V|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11678	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTAGGAACCTCAGGCACTTT	0.373																																					p.E11224V		.											.	TTN	636	0			c.A33671T						.						92.0	86.0	88.0					2																	179544137		1829	4086	5915	SO:0001583	missense	7273	exon142			GGAACCTCAGGCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.32720A>T	2.37:g.179544137T>A	ENSP00000465570:p.Glu10907Val	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	216.0	27.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	13.07	2.127887	0.37533	.	.	ENSG00000155657	ENST00000342992	T	0.69175	-0.38	5.82	5.82	0.92795	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.74733	0.3755	M	0.90650	3.135	0.80722	D	1	P	0.48911	0.917	P	0.46049	0.502	T	0.80562	-0.1327	9	0.87932	D	0	.	9.7862	0.40677	0.0:0.0763:0.0:0.9237	.	10907	Q8WZ42	TITIN_HUMAN	V	9980	ENSP00000343764:E9980V	ENSP00000343764:E9980V	E	-	2	0	TTN	179252382	0.994000	0.37717	1.000000	0.80357	0.988000	0.76386	2.716000	0.47219	2.207000	0.71202	0.533000	0.62120	GAG	.		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ALG3	10195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	183959774	183959774	+	IGR	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr3:183959774G>A	ENST00000397676.3	-	0	1528				VWA5B2_ENST00000426955.2_Nonsense_Mutation_p.W1226*|ALG3_ENST00000463495.1_5'Flank|VWA5B2_ENST00000273794.5_Nonsense_Mutation_p.W1008*|EIF2B5_ENST00000444495.1_Intron|MIR1224_ENST00000408193.1_RNA	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGCGCCACTGGGACCAAAAC	0.657																																					p.W1226X		.											.	.	.	0			c.G3677A						.						23.0	24.0	24.0					3																	183959774		692	1591	2283	SO:0001628	intergenic_variant	90113	exon19			GCCACTGGGACCA	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183959774G>A		Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	15.0	NM_138345	A8JZZ6|Q9BT71	Nonsense_Mutation	SNP	ENST00000397676.3	37	CCDS46968.1	.	.	.	.	.	.	.	.	.	.	G	41	8.549731	0.98859	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	.	.	.	4.73	3.85	0.44370	.	0.000000	0.46758	D	0.000263	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.8108	12.1447	0.54016	0.0828:0.0:0.9172:0.0	.	.	.	.	X	1226;1008	.	ENSP00000273794:W1008X	W	+	2	0	VWA5B2	185442468	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.263000	0.95617	1.348000	0.45733	0.462000	0.41574	TGG	.		0.657	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
WDR7	23335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	54358487	54358487	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr18:54358487C>G	ENST00000254442.3	+	8	969	c.758C>G	c.(757-759)cCt>cGt	p.P253R	WDR7_ENST00000357574.3_Missense_Mutation_p.P253R|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	253					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TGTTCAGGTCCTAGTGAAAAT	0.403																																					p.P253R		.											.	WDR7	93	0			c.C758G						.						117.0	125.0	123.0					18																	54358487		2203	4300	6503	SO:0001583	missense	23335	exon8			CAGGTCCTAGTGA	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.758C>G	18.37:g.54358487C>G	ENSP00000254442:p.Pro253Arg	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	18.0	NM_052834	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.504678	0.26949	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.04654	3.58;3.58	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.165847	0.56097	D	0.000034	T	0.04998	0.0134	L	0.33485	1.01	0.53005	D	0.999966	B;P	0.41265	0.228;0.744	B;B	0.36030	0.054;0.216	T	0.53351	-0.8451	10	0.11485	T	0.65	.	19.2552	0.93943	0.0:1.0:0.0:0.0	.	253;253	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	R	253	ENSP00000254442:P253R;ENSP00000350187:P253R	ENSP00000254442:P253R	P	+	2	0	WDR7	52509485	0.997000	0.39634	0.995000	0.50966	0.996000	0.88848	4.749000	0.62155	2.729000	0.93468	0.460000	0.39030	CCT	.		0.403	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
YIPF1	54432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	54332448	54332448	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:54332448T>C	ENST00000072644.1	-	8	967	c.631A>G	c.(631-633)Att>Gtt	p.I211V	YIPF1_ENST00000469457.1_5'UTR|YIPF1_ENST00000371399.1_Missense_Mutation_p.I28V|YIPF1_ENST00000539954.1_Missense_Mutation_p.I236V	NM_018982.4	NP_061855.1	Q9Y548	YIPF1_HUMAN	Yip1 domain family, member 1	211						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|skin(1)|urinary_tract(2)	19						GGGATATAAATGAAGAGGGAA	0.418																																					p.I211V		.											.	YIPF1	154	0			c.A631G						.						99.0	92.0	94.0					1																	54332448		2203	4300	6503	SO:0001583	missense	54432	exon8			TATAAATGAAGAG	BC009674	CCDS584.1	1p33-p32.1	2008-02-05			ENSG00000058799	ENSG00000058799		"""Yip1 domain family"""	25231	protein-coding gene	gene with protein product						12477932	Standard	NM_018982		Approved	DJ167A19.1, FinGER1	uc001cvu.3	Q9Y548	OTTHUMG00000008074	ENST00000072644.1:c.631A>G	1.37:g.54332448T>C	ENSP00000072644:p.Ile211Val	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	14.0	NM_018982	B2RCM7|D3DQ40|Q9NWJ1	Missense_Mutation	SNP	ENST00000072644.1	37	CCDS584.1	.	.	.	.	.	.	.	.	.	.	T	11.63	1.694805	0.30052	.	.	ENSG00000058799	ENST00000371399;ENST00000072644;ENST00000539954;ENST00000412288	T	0.39787	1.06	6.01	4.88	0.63580	Yip1 domain (1);	0.185182	0.56097	D	0.000031	T	0.27349	0.0671	L	0.31752	0.955	0.58432	D	0.999999	B	0.14805	0.011	B	0.20184	0.028	T	0.06826	-1.0805	10	0.07482	T	0.82	-7.5382	10.453	0.44533	0.0:0.1574:0.0:0.8426	.	211	Q9Y548	YIPF1_HUMAN	V	28;211;236;211	ENSP00000416507:I211V	ENSP00000072644:I211V	I	-	1	0	YIPF1	54105036	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.347000	0.44036	2.307000	0.77673	0.528000	0.53228	ATT	.		0.418	YIPF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022103.5	NM_018982	
WDR78	79819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67356850	67356850	+	Silent	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr1:67356850C>T	ENST00000371026.3	-	4	685	c.630G>A	c.(628-630)ttG>ttA	p.L210L	WDR78_ENST00000371022.3_Silent_p.L210L|WDR78_ENST00000371023.3_Silent_p.L210L|WDR78_ENST00000431318.1_5'UTR	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	210					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						TGAAACTAGTCAATCTTTCCC	0.343																																					p.L210L		.											.	WDR78	92	0			c.G630A						.						169.0	170.0	170.0					1																	67356850		2203	4300	6503	SO:0001819	synonymous_variant	79819	exon4			ACTAGTCAATCTT	BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.630G>A	1.37:g.67356850C>T		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	43.0	NM_207014	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Silent	SNP	ENST00000371026.3	37	CCDS635.1																																																																																			.		0.343	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025404.1	NM_024763	
YIPF7	285525	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	44637980	44637980	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr4:44637980G>A	ENST00000332990.5	-	3	327	c.311C>T	c.(310-312)cCt>cTt	p.P104L	YIPF7_ENST00000415895.4_Missense_Mutation_p.P80L	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	104						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						GTCAATGTAAGGAGATTGTGA	0.388																																					p.P104L		.											.	.	.	0			c.C311T						.						91.0	91.0	91.0					4																	44637980		1891	4129	6020	SO:0001583	missense	285525	exon3			ATGTAAGGAGATT	AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.311C>T	4.37:g.44637980G>A	ENSP00000332772:p.Pro104Leu	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	8.0	NM_182592	Q3SY21|Q3SY22	Missense_Mutation	SNP	ENST00000332990.5	37	CCDS54766.1	.	.	.	.	.	.	.	.	.	.	G	10.46	1.356240	0.24598	.	.	ENSG00000177752	ENST00000332990	T	0.29397	1.57	5.02	5.02	0.67125	.	1.160480	0.06060	N	0.658135	T	0.26955	0.0660	L	0.38175	1.15	0.29390	N	0.862661	B;B	0.09022	0.002;0.001	B;B	0.10450	0.005;0.002	T	0.09079	-1.0691	10	0.27082	T	0.32	-9.1028	8.7405	0.34554	0.0:0.1741:0.6682:0.1576	.	104;104	Q8N8F6-4;Q8N8F6	.;YIPF7_HUMAN	L	104	ENSP00000332772:P104L	ENSP00000332772:P104L	P	-	2	0	YIPF7	44332737	0.990000	0.36364	0.751000	0.31187	0.868000	0.49771	2.478000	0.45189	2.636000	0.89361	0.650000	0.86243	CCT	.		0.388	YIPF7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_182592	
ZMYM5	9205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	20426199	20426199	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr13:20426199G>C	ENST00000337963.4	-	3	386	c.122C>G	c.(121-123)cCt>cGt	p.P41R	ZMYM5_ENST00000382905.4_Missense_Mutation_p.P41R|ZMYM5_ENST00000382907.4_Missense_Mutation_p.P41R	NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	41						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		ACTGACTAAAGGACAAGCTGG	0.413																																					p.P41R		.											.	ZMYM5	90	0			c.C122G						.						152.0	147.0	148.0					13																	20426199		2203	4300	6503	SO:0001583	missense	9205	exon3			ACTAAAGGACAAG	AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.122C>G	13.37:g.20426199G>C	ENSP00000337034:p.Pro41Arg	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	34.0	NM_001039650	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Missense_Mutation	SNP	ENST00000337963.4	37		.	.	.	.	.	.	.	.	.	.	G	7.356	0.623830	0.14193	.	.	ENSG00000132950	ENST00000337963;ENST00000502168;ENST00000382907;ENST00000382905	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	4.25	1.51	0.23008	.	.	.	.	.	T	0.28797	0.0714	L	0.57536	1.79	0.20307	N	0.999916	B;B;B	0.21821	0.061;0.02;0.009	B;B;B	0.19391	0.021;0.025;0.01	T	0.28933	-1.0028	9	0.87932	D	0	-0.4603	7.5323	0.27689	0.1541:0.1363:0.7096:0.0	.	41;41;41	Q9UJ78;Q9UJ78-2;Q9UJ78-1	ZMYM5_HUMAN;.;.	R	41;31;41;41	ENSP00000337034:P41R;ENSP00000445779:P31R;ENSP00000372364:P41R;ENSP00000372361:P41R	ENSP00000337034:P41R	P	-	2	0	ZMYM5	19324199	0.173000	0.23056	0.021000	0.16686	0.002000	0.02628	0.507000	0.22675	0.182000	0.20032	-1.099000	0.02127	CCT	.		0.413	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242	
ZNF185	7739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152085856	152085856	+	Silent	SNP	C	C	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chrX:152085856C>T	ENST00000370268.4	+	5	328	c.291C>T	c.(289-291)agC>agT	p.S97S	ZNF185_ENST00000535861.1_Silent_p.S97S|ZNF185_ENST00000324823.6_5'UTR|ZNF185_ENST00000318529.8_5'Flank|ZNF185_ENST00000539731.1_Silent_p.S97S|ZNF185_ENST00000318504.7_Silent_p.S97S|ZNF185_ENST00000449285.2_Silent_p.S97S|ZNF185_ENST00000370270.2_Silent_p.S97S			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	97						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CCATAGACAGCTCTTCCCAGC	0.617																																					p.S97S		.											.	ZNF185	133	0			c.C291T						.						62.0	67.0	65.0					X																	152085856		2023	4149	6172	SO:0001819	synonymous_variant	7739	exon5			AGACAGCTCTTCC	AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.291C>T	X.37:g.152085856C>T		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	27.0	NM_001178109	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Silent	SNP	ENST00000370268.4	37	CCDS48184.1																																																																																			.		0.617	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150	
ZNF211	10520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58152126	58152126	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr19:58152126G>T	ENST00000347302.3	+	3	451	c.272G>T	c.(271-273)gGa>gTa	p.G91V	ZNF211_ENST00000420680.1_Missense_Mutation_p.G95V|ZNF211_ENST00000391703.3_Missense_Mutation_p.G30V|ZNF211_ENST00000541801.1_Missense_Mutation_p.G82V|ZNF211_ENST00000299871.5_Missense_Mutation_p.G156V|ZNF211_ENST00000544273.1_Missense_Mutation_p.G103V|ZNF211_ENST00000240731.4_Missense_Mutation_p.G104V|ZNF211_ENST00000254182.7_Missense_Mutation_p.G82V	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	91	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGAATTTCTGGAGAAAGAGTG	0.423																																					p.G156V		.											.	ZNF211	92	0			c.G467T						.						94.0	96.0	95.0					19																	58152126		2203	4300	6503	SO:0001583	missense	10520	exon5			TTTCTGGAGAAAG	U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.272G>T	19.37:g.58152126G>T	ENSP00000339562:p.Gly91Val	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	18.0	NM_001265597	B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Missense_Mutation	SNP	ENST00000347302.3	37	CCDS12957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.006|0.006	-2.039764|-2.039764	0.00402|0.00402	.|.	.|.	ENSG00000121417|ENSG00000121417	ENST00000420680;ENST00000347302;ENST00000254182;ENST00000391703;ENST00000541801;ENST00000299871;ENST00000544273;ENST00000240731|ENST00000407202	T;T;T;T;T;T;T;T|.	0.05996|.	3.36;3.38;3.57;3.5;3.57;3.61;3.39;3.41|.	3.42|3.42	-1.64|-1.64	0.08318|0.08318	Krueppel-associated box (1);|.	.|.	.|.	.|.	.|.	T|T	0.07999|0.07999	0.0200|0.0200	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0;0.0;0.0|.	B;B;B;B;B;B|.	0.04013|.	0.0;0.0;0.001;0.0;0.0;0.0|.	T|T	0.30416|0.30416	-0.9979|-0.9979	9|5	0.02654|.	T|.	1|.	.|.	0.8611|0.8611	0.01193|0.01193	0.1582:0.2145:0.3266:0.3007|0.1582:0.2145:0.3266:0.3007	.|.	95;103;156;82;91;104|.	Q13398-4;Q13398-3;F8WDV2;Q13398-2;Q13398;B9ZVW1|.	.;.;.;.;ZN211_HUMAN;.|.	V|C	95;91;82;30;82;156;103;104|94	ENSP00000399193:G95V;ENSP00000339562:G91V;ENSP00000254182:G82V;ENSP00000375584:G30V;ENSP00000442601:G82V;ENSP00000299871:G156V;ENSP00000441386:G103V;ENSP00000240731:G104V|.	ENSP00000240731:G104V|.	G|W	+|+	2|3	0|0	ZNF211|ZNF211	62843938|62843938	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.291000|-0.291000	0.08343|0.08343	-0.182000|-0.182000	0.10602|0.10602	-1.214000|-1.214000	0.01621|0.01621	GGA|TGG	.		0.423	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1		
ZNF292	23036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	87967391	87967391	+	Silent	SNP	G	G	A			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr6:87967391G>A	ENST00000369577.3	+	8	4087	c.4044G>A	c.(4042-4044)ggG>ggA	p.G1348G	ZNF292_ENST00000339907.4_Silent_p.G1343G	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1348						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AAGACCGTGGGCGGGGCCCAA	0.423																																					p.G1348G		.											.	ZNF292	72	0			c.G4044A						.						31.0	31.0	31.0					6																	87967391		1815	4082	5897	SO:0001819	synonymous_variant	23036	exon8			CCGTGGGCGGGGC	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.4044G>A	6.37:g.87967391G>A		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	52.0	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Silent	SNP	ENST00000369577.3	37	CCDS47457.1																																																																																			.		0.423	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
ZNF564	163050	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	12637749	12637749	+	Silent	SNP	T	T	C			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr19:12637749T>C	ENST00000339282.7	-	4	1369	c.1173A>G	c.(1171-1173)ggA>ggG	p.G391G	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.20_ENST00000593682.1_3'UTR|CTD-2192J16.21_ENST00000601420.1_RNA	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ATTTATAAGGTCCATCTCCAG	0.448																																					p.G391G		.											.	ZNF564	91	0			c.A1173G						.						138.0	142.0	141.0					19																	12637749		2203	4300	6503	SO:0001819	synonymous_variant	163050	exon4			ATAAGGTCCATCT	BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.1173A>G	19.37:g.12637749T>C		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	8.0	NM_144976	B9EGT4|Q6P1K6	Silent	SNP	ENST00000339282.7	37	CCDS42505.1																																																																																			.		0.448	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344120.2	NM_144976	
ZNF606	80095	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	58489764	58489767	+	Frame_Shift_Del	DEL	TCTC	TCTC	-			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	TCTC	TCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr19:58489764_58489767delTCTC	ENST00000341164.4	-	7	2901_2904	c.2281_2284delGAGA	c.(2281-2286)gagaaafs	p.EK761fs	ZNF606_ENST00000536132.1_Frame_Shift_Del_p.EK671fs	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	761					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		ATAAAGCGTTTCTCTCCACTATGC	0.363																																					p.761_762del		.											.	ZNF606	92	0			c.2281_2284del						.																																			SO:0001589	frameshift_variant	80095	exon7			AGCGTTTCTCTCC	AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.2281_2284delGAGA	19.37:g.58489764_58489767delTCTC	ENSP00000343617:p.Glu761fs	Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	45.0	NM_025027	A8KAN2|Q8NE04|Q96JH5	Frame_Shift_Del	DEL	ENST00000341164.4	37	CCDS12968.1																																																																																			.		0.363	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405961.1	NM_025027	
ZNF638	27332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71591324	71591324	+	Silent	SNP	A	A	G			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr2:71591324A>G	ENST00000409544.1	+	5	2289	c.1659A>G	c.(1657-1659)ccA>ccG	p.P553P	ZNF638_ENST00000264447.4_Silent_p.P553P|ZNF638_ENST00000355812.3_Silent_p.P553P|ZNF638_ENST00000377802.2_Silent_p.P553P|ZNF638_ENST00000410075.1_3'UTR	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	553	Arg-rich.				regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						GAGGTAGTCCAAAATGCTTTC	0.408																																					p.P553P		.											.	ZNF638	94	0			c.A1659G						.						96.0	91.0	93.0					2																	71591324		2203	4300	6503	SO:0001819	synonymous_variant	27332	exon5			TAGTCCAAAATGC	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1659A>G	2.37:g.71591324A>G		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	58.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	ENST00000409544.1	37	CCDS1917.1																																																																																			.		0.408	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
LCP1	3936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	46730648	46730649	+	Missense_Mutation	DNP	TC	TC	CA			TCGA-DD-A3A8-01A-11D-A22F-10	TCGA-DD-A3A8-11A-11D-A22F-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4cff8590-559e-4204-8635-96e11bfeda68	20e24e02-0caa-4e55-812b-b081b3bb03d8	g.chr13:46730648_46730649TC>CA	ENST00000398576.2	-	8	803_804	c.415_416GA>TG	c.(415-417)GAt>TGt	p.D139C	LCP1_ENST00000460190.1_5'Flank|LCP1_ENST00000323076.2_Missense_Mutation_p.D139C			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	139	Actin-binding 1.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		ATGCCGACAATCAGGATCATTT	0.381			T	BCL6	NHL																																p.D139C		.		Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	.	.	.	0			.						.																																			SO:0001583	missense	3936	.			CGACAATCAGGAT	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.415_416delinsCA	13.37:g.46730648_46730649delinsCA	ENSP00000381581:p.Asp139Cys	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	23.0	.	B2R613|B4DUA0|Q5TBN4	Missense_Mutation	DNP	ENST00000398576.2	37	CCDS9403.1																																																																																			.		0.381	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	NM_002298	
