#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA2	20	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139916820	139916820	+	Missense_Mutation	SNP	G	G	A	rs367828133		TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr9:139916820G>A	ENST00000371605.3	-	5	694	c.547C>T	c.(547-549)Cgt>Tgt	p.R183C	ABCA2_ENST00000492260.1_5'UTR|ABCA2_ENST00000341511.6_Missense_Mutation_p.R184C|ABCA2_ENST00000265662.5_Missense_Mutation_p.R184C			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	183					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GGGTCCACACGGGCGGCCAAG	0.657													g|||	1	0.000199681	0.0008	0.0	5008	,	,		13373	0.0		0.0	False		,,,				2504	0.0				p.R214C		.											.	ABCA2	90	0			c.C640T						.						22.0	28.0	26.0					9																	139916820		2022	4145	6167	SO:0001583	missense	20	exon6			CCACACGGGCGGC	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.547C>T	9.37:g.139916820G>A	ENSP00000360666:p.Arg183Cys	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	17.0	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	37		.	.	.	.	.	.	.	.	.	.	g	7.835	0.720645	0.15372	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.87103	-2.21;-2.21;-2.21	4.39	0.992	0.19819	.	416.678000	0.01211	U	0.007859	T	0.72407	0.3456	N	0.08118	0	0.09310	N	1	P;P;B	0.47302	0.893;0.876;0.261	B;B;B	0.34452	0.183;0.183;0.083	T	0.70306	-0.4908	10	0.66056	D	0.02	.	6.0741	0.19905	0.0:0.2529:0.2978:0.4493	.	183;213;214	Q9BZC7;E7EU84;E7ETC3	ABCA2_HUMAN;.;.	C	184;183;214;184	ENSP00000265662:R184C;ENSP00000360666:R183C;ENSP00000344155:R184C	ENSP00000265662:R184C	R	-	1	0	ABCA2	139036641	0.002000	0.14202	0.391000	0.26233	0.024000	0.10985	-0.032000	0.12266	0.754000	0.32968	0.486000	0.48141	CGT	.		0.657	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
ABCG2	9429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	89039368	89039368	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr4:89039368G>C	ENST00000237612.3	-	7	1279	c.734C>G	c.(733-735)cCt>cGt	p.P245R	ABCG2_ENST00000515655.1_Missense_Mutation_p.P245R	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	245	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	GGAATATCGAGGCTGATGAAT	0.413																																					p.P245R		.											.	ABCG2	90	0			c.C734G						.						144.0	128.0	134.0					4																	89039368		2203	4300	6503	SO:0001583	missense	9429	exon7			TATCGAGGCTGAT	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.734C>G	4.37:g.89039368G>C	ENSP00000237612:p.Pro245Arg	Somatic	188.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	49.0	NM_004827	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	ENST00000237612.3	37	CCDS3628.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903431	0.92035	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	T;T	0.56941	0.43;0.43	5.45	5.45	0.79879	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.77116	0.4083	M	0.84846	2.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.80322	-0.1431	10	0.87932	D	0	-35.1969	19.2735	0.94021	0.0:0.0:1.0:0.0	.	245;245;245	Q9UNQ0-2;Q9UNQ0;Q4W5I3	.;ABCG2_HUMAN;.	R	245	ENSP00000426917:P245R;ENSP00000237612:P245R	ENSP00000237612:P245R	P	-	2	0	ABCG2	89258392	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.397000	0.97276	2.716000	0.92895	0.655000	0.94253	CCT	.		0.413	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827	
ADAMTSL5	339366	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	1506875	1506875	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:1506875C>T	ENST00000413997.2	-	10	934	c.935G>A	c.(934-936)cGg>cAg	p.R312Q	ADAMTSL5_ENST00000330475.4_Missense_Mutation_p.R302Q|ADAMTSL5_ENST00000590562.1_5'UTR|CTB-25B13.9_ENST00000590252.1_RNA|ADAMTSL5_ENST00000395467.2_Missense_Mutation_p.R71Q			Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	312						extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTAGCGCTCCCGAGGGAGCCA	0.701																																					p.R302Q		.											.	ADAMTSL5	90	0			c.G905A						.						17.0	22.0	20.0					19																	1506875		1807	3748	5555	SO:0001583	missense	339366	exon10			CGCTCCCGAGGGA	BC040620	CCDS12071.1	19p13.3	2008-02-05	2006-02-07	2006-02-07		ENSG00000185761			27912	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain containing 6"""	THSD6			Standard	NM_213604		Approved		uc002ltd.2	Q6ZMM2		ENST00000413997.2:c.935G>A	19.37:g.1506875C>T	ENSP00000399364:p.Arg312Gln	Somatic	99.0	1.0		WXS	Illumina HiSeq	Phase_I	87.0	34.0	NM_213604	B4DXK7|Q8IW95	Missense_Mutation	SNP	ENST00000413997.2	37		.	.	.	.	.	.	.	.	.	.	C	10.96	1.497844	0.26861	.	.	ENSG00000185761	ENST00000413997;ENST00000330475;ENST00000395467	T;T;T	0.65364	-0.15;-0.14;-0.11	4.05	3.0	0.34707	.	0.238710	0.35838	N	0.002948	T	0.55577	0.1929	M	0.64997	1.995	0.09310	N	1	P;P	0.49447	0.924;0.924	B;B	0.40659	0.336;0.336	T	0.48198	-0.9056	10	0.32370	T	0.25	.	10.5867	0.45286	0.0:0.8949:0.0:0.1051	.	312;302	B4DXK7;Q6ZMM2	.;ATL5_HUMAN	Q	312;302;71	ENSP00000399364:R312Q;ENSP00000327608:R302Q;ENSP00000378850:R71Q	ENSP00000327608:R302Q	R	-	2	0	ADAMTSL5	1457875	0.001000	0.12720	0.176000	0.23000	0.296000	0.27459	0.956000	0.29202	0.379000	0.24794	-1.626000	0.00786	CGG	.		0.701	ADAMTSL5-202	KNOWN	basic	protein_coding	protein_coding		XM_294919	
AHCYL1	10768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	110560140	110560140	+	Silent	SNP	T	T	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:110560140T>A	ENST00000369799.5	+	10	1354	c.987T>A	c.(985-987)gcT>gcA	p.A329A	AHCYL1_ENST00000393614.4_Silent_p.A282A|AHCYL1_ENST00000359172.3_Silent_p.A282A	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	329	NAD binding. {ECO:0000250}.				mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		GCTGTGCTGCTCTCAAAGCTC	0.438																																					p.A329A		.											.	AHCYL1	91	0			c.T987A						.						131.0	123.0	125.0					1																	110560140		2203	4300	6503	SO:0001819	synonymous_variant	10768	exon10			TGCTGCTCTCAAA	U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.987T>A	1.37:g.110560140T>A		Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	28.0	NM_006621	B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Silent	SNP	ENST00000369799.5	37	CCDS818.1																																																																																			.		0.438	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032243.1		
ARHGAP44	9912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12852526	12852526	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr17:12852526G>A	ENST00000379672.5	+	11	1231	c.931G>A	c.(931-933)Gtg>Atg	p.V311M	ARHGAP44_ENST00000340825.3_Missense_Mutation_p.V311M|ARHGAP44_ENST00000262444.9_Missense_Mutation_p.V311M	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	311	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						CTGCTGCGTGGTGGATGTGCA	0.622																																					p.V311M		.											.	ARHGAP44	90	0			c.G931A						.						31.0	33.0	33.0					17																	12852526		2044	4185	6229	SO:0001583	missense	9912	exon11			TGCGTGGTGGATG		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.931G>A	17.37:g.12852526G>A	ENSP00000368994:p.Val311Met	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	25.0	NM_014859	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	SNP	ENST00000379672.5	37	CCDS45616.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.858092	0.32791	.	.	ENSG00000006740	ENST00000379672;ENST00000340825;ENST00000538915	T;T	0.19250	2.16;2.16	6.05	2.79	0.32731	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.398771	0.27442	N	0.019358	T	0.17066	0.0410	L	0.41632	1.29	0.49299	D	0.999775	B;B	0.15473	0.01;0.013	B;B	0.17722	0.019;0.016	T	0.04885	-1.0920	10	0.34782	T	0.22	.	10.7368	0.46130	0.0:0.3087:0.5714:0.12	.	311;311	A6NCP5;Q17R89	.;RHG44_HUMAN	M	311;311;34	ENSP00000368994:V311M;ENSP00000342566:V311M	ENSP00000342566:V311M	V	+	1	0	ARHGAP44	12793251	0.997000	0.39634	1.000000	0.80357	0.976000	0.68499	0.341000	0.19909	0.839000	0.34971	0.637000	0.83480	GTG	.		0.622	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	
ARID3C	138715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	34622422	34622422	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr9:34622422C>G	ENST00000378909.2	-	5	1062	c.970G>C	c.(970-972)Gtg>Ctg	p.V324L	DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000259632.7_5'Flank|DCTN3_ENST00000477738.2_5'Flank|DCTN3_ENST00000341694.2_5'Flank|DCTN3_ENST00000447983.2_5'Flank|DCTN3_ENST00000378913.2_5'Flank	NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	324	Pro-rich.|REKLES. {ECO:0000255|PROSITE- ProRule:PRU00819}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		CCCATCAGCACAGCTCTCTTC	0.617																																					p.V324L		.											.	ARID3C	91	0			c.G970C						.						57.0	58.0	58.0					9																	34622422		2203	4300	6503	SO:0001583	missense	138715	exon5			TCAGCACAGCTCT		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.970G>C	9.37:g.34622422C>G	ENSP00000368189:p.Val324Leu	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	17.0	NM_001017363		Missense_Mutation	SNP	ENST00000378909.2	37	CCDS35006.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026421	0.54683	.	.	ENSG00000205143	ENST00000378909	T	0.43294	0.95	5.02	5.02	0.67125	REKLES domain (1);	0.000000	0.43919	D	0.000514	T	0.35128	0.0921	L	0.43152	1.355	0.30967	N	0.722993	B	0.24823	0.112	B	0.24006	0.05	T	0.24368	-1.0162	10	0.14656	T	0.56	-19.8625	15.6437	0.77029	0.0:1.0:0.0:0.0	.	324	A6NKF2	ARI3C_HUMAN	L	324	ENSP00000368189:V324L	ENSP00000368189:V324L	V	-	1	0	ARID3C	34612422	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	3.934000	0.56553	2.603000	0.88011	0.448000	0.29417	GTG	.		0.617	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	XM_071061	
ASCC3	10973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	101296578	101296578	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr6:101296578T>C	ENST00000369162.2	-	4	591	c.247A>G	c.(247-249)Act>Gct	p.T83A	ASCC3_ENST00000522650.1_Missense_Mutation_p.T83A	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	83					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CCATTATCAGTTCCAACTATT	0.363																																					p.T83A		.											.	ASCC3	96	0			c.A247G						.						67.0	66.0	66.0					6																	101296578		2052	4198	6250	SO:0001583	missense	10973	exon4			TATCAGTTCCAAC	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.247A>G	6.37:g.101296578T>C	ENSP00000358159:p.Thr83Ala	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	16.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	T	7.047	0.563727	0.13498	.	.	ENSG00000112249	ENST00000369162;ENST00000522650;ENST00000324723	T;T;T	0.55413	0.58;0.52;0.97	5.85	5.85	0.93711	.	0.786135	0.11911	N	0.517630	T	0.21881	0.0527	L	0.50333	1.59	0.58432	D	0.999996	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.18053	-1.0349	10	0.06365	T	0.9	.	6.367	0.21461	0.1424:0.0791:0.0:0.7785	.	83;83;83	Q4G1A0;E7EW23;Q8N3C0	.;.;HELC1_HUMAN	A	83	ENSP00000358159:T83A;ENSP00000430769:T83A;ENSP00000320777:T83A	ENSP00000320777:T83A	T	-	1	0	ASCC3	101403299	0.928000	0.31464	0.934000	0.37439	0.892000	0.51952	0.323000	0.19593	2.234000	0.73211	0.533000	0.62120	ACT	.		0.363	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
ATP10A	57194	ucsc.edu;bcgsc.ca	37	15	25924907	25924907	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr15:25924907C>T	ENST00000356865.6	-	21	4192	c.4081G>A	c.(4081-4083)Gtc>Atc	p.V1361I		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1361					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		AGGGAGCAGACCGGCTGCTGT	0.667																																					p.V1361I		.											.	ATP10A	139	0			c.G4081A						.						54.0	53.0	53.0					15																	25924907		2202	4298	6500	SO:0001583	missense	57194	exon21			AGCAGACCGGCTG	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4081G>A	15.37:g.25924907C>T	ENSP00000349325:p.Val1361Ile	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959229	0.34565	.	.	ENSG00000206190	ENST00000356865	T	0.10288	2.89	5.43	-5.34	0.02705	.	2.014890	0.02043	N	0.049417	T	0.04318	0.0119	N	0.08118	0	0.09310	N	1	B	0.18610	0.029	B	0.14023	0.01	T	0.28427	-1.0044	10	0.22706	T	0.39	-1.4655	0.9919	0.01459	0.4056:0.2108:0.1032:0.2805	.	1361	O60312	AT10A_HUMAN	I	1361	ENSP00000349325:V1361I	ENSP00000349325:V1361I	V	-	1	0	ATP10A	23476000	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-0.686000	0.05161	-1.525000	0.01762	0.650000	0.86243	GTC	.		0.667	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
BACE2	25825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	42617961	42617961	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr21:42617961G>A	ENST00000330333.6	+	6	1418	c.955G>A	c.(955-957)Gtg>Atg	p.V319M	BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000347667.5_Missense_Mutation_p.V319M|BACE2_ENST00000328735.6_Missense_Mutation_p.V319M	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	319					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				GTTTGATGCGGTGGTGGAAGC	0.607																																					p.V319M		.											.	BACE2	92	0			c.G955A						.						58.0	43.0	48.0					21																	42617961		2203	4300	6503	SO:0001583	missense	25825	exon6			GATGCGGTGGTGG	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.955G>A	21.37:g.42617961G>A	ENSP00000332979:p.Val319Met	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	51.0	NM_138992	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Missense_Mutation	SNP	ENST00000330333.6	37	CCDS13668.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.522968	0.44866	.	.	ENSG00000182240	ENST00000330333;ENST00000347667;ENST00000328735;ENST00000544566	T;T;T	0.58210	0.35;0.35;0.35	5.31	5.31	0.75309	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.133554	0.50627	D	0.000119	T	0.55016	0.1894	L	0.43152	1.355	0.47341	D	0.999393	D;P;D	0.61080	0.989;0.708;0.977	P;B;P	0.53266	0.722;0.294;0.617	T	0.56177	-0.8022	10	0.52906	T	0.07	.	11.4521	0.50158	0.0821:0.0:0.9179:0.0	.	319;319;319	Q9Y5Z0-3;Q9Y5Z0-2;Q9Y5Z0	.;.;BACE2_HUMAN	M	319;319;319;224	ENSP00000332979:V319M;ENSP00000327528:V319M;ENSP00000333854:V319M	ENSP00000333854:V319M	V	+	1	0	BACE2	41539831	1.000000	0.71417	0.942000	0.38095	0.187000	0.23431	3.951000	0.56684	2.482000	0.83794	0.655000	0.94253	GTG	.		0.607	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
BAHCC1	57597	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	79414175	79414175	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr17:79414175G>T	ENST00000307745.7	+	15	3277	c.3277G>T	c.(3277-3279)Gcc>Tcc	p.A1093S																								CGCCCCGGGGGCCCAGCCTGA	0.677																																					.		.											.	BAHCC1	23	0			.						.						20.0	23.0	22.0					17																	79414175		1836	4044	5880	SO:0001583	missense	57597	.			CCGGGGGCCCAGC																												ENST00000307745.7:c.3277G>T	17.37:g.79414175G>T	ENSP00000303486:p.Ala1093Ser	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	16.0	.		Missense_Mutation	SNP	ENST00000307745.7	37		.	.	.	.	.	.	.	.	.	.	G	11.58	1.682363	0.29872	.	.	ENSG00000171282	ENST00000307745	T	0.26957	1.7	4.03	-0.331	0.12679	.	2.047000	0.03061	N	0.155909	T	0.16428	0.0395	L	0.27053	0.805	0.25382	N	0.988601	B;B	0.32829	0.075;0.386	B;B	0.25405	0.027;0.06	T	0.15925	-1.0420	10	0.36615	T	0.2	.	5.4826	0.16731	0.2527:0.1478:0.5994:0.0	.	1093;1093	Q9P281;F8WBW8	BAHC1_HUMAN;.	S	1093	ENSP00000303486:A1093S	ENSP00000303486:A1093S	A	+	1	0	AC110285.1	77028770	0.167000	0.22975	0.494000	0.27515	0.893000	0.52053	1.787000	0.38704	-0.210000	0.10140	0.655000	0.94253	GCC	.		0.677	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
BDP1	55814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	70751716	70751716	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr5:70751716G>T	ENST00000358731.4	+	1	275	c.12G>T	c.(10-12)agG>agT	p.R4S	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	4	Interaction with ZBTB43.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGTTCCGCAGGGCACGCCTTA	0.706																																					p.R4S		.											.	BDP1	92	0			c.G12T						.						8.0	10.0	9.0					5																	70751716		1921	4128	6049	SO:0001583	missense	55814	exon1			CCGCAGGGCACGC	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.12G>T	5.37:g.70751716G>T	ENSP00000351575:p.Arg4Ser	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	20.0	NM_018429	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941488	0.92526	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000444711	T	0.24151	1.87	5.2	5.2	0.72013	.	0.063724	0.64402	D	0.000013	T	0.50017	0.1591	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.923;0.951;0.997	T	0.50048	-0.8873	10	0.87932	D	0	.	15.7583	0.78054	0.0:0.0:1.0:0.0	.	4;4;4	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	S	4	ENSP00000351575:R4S	ENSP00000351575:R4S	R	+	3	2	BDP1	70787472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.094000	0.41719	2.693000	0.91896	0.655000	0.94253	AGG	.		0.706	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
BLM	641	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	91346865	91346865	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr15:91346865A>G	ENST00000355112.3	+	18	3591	c.3473A>G	c.(3472-3474)gAc>gGc	p.D1158G	BLM_ENST00000560136.1_3'UTR|BLM_ENST00000560509.1_Intron	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	1158					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TTGGATGAAGACTTATATATC	0.353			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.D1158G		.	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	BLM	664	0			c.A3473G						.						98.0	98.0	98.0					15																	91346865		2198	4298	6496	SO:0001583	missense	641	exon18	Familial Cancer Database		ATGAAGACTTATA	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.3473A>G	15.37:g.91346865A>G	ENSP00000347232:p.Asp1158Gly	Somatic	177.0	1.0		WXS	Illumina HiSeq	Phase_I	125.0	38.0	NM_000057	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.616389	0.87359	.	.	ENSG00000197299	ENST00000355112;ENST00000536925;ENST00000543977	T	0.50277	0.75	5.65	5.65	0.86999	RQC domain (2);	0.103731	0.64402	D	0.000005	T	0.55289	0.1911	M	0.82056	2.57	0.80722	D	1	B	0.12013	0.005	B	0.29440	0.102	T	0.57728	-0.7761	10	0.72032	D	0.01	-17.8227	13.8364	0.63413	1.0:0.0:0.0:0.0	.	1158	P54132	BLM_HUMAN	G	1158;788;345	ENSP00000347232:D1158G	ENSP00000347232:D1158G	D	+	2	0	BLM	89147869	1.000000	0.71417	0.972000	0.41901	0.986000	0.74619	6.761000	0.74945	2.163000	0.67991	0.459000	0.35465	GAC	.		0.353	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
BPI	671	ucsc.edu;bcgsc.ca	37	20	36937389	36937389	+	Silent	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr20:36937389G>T	ENST00000262865.4	+	3	404	c.315G>T	c.(313-315)gtG>gtT	p.V105V	CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	105					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				TGCCCAATGTGGGCCTTAAGT	0.458																																					p.V105V		.											.	BPI	94	0			c.G315T						.						174.0	150.0	158.0					20																	36937389		2203	4300	6503	SO:0001819	synonymous_variant	671	exon3			CAATGTGGGCCTT	J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.315G>T	20.37:g.36937389G>T		Somatic	323.0	2.0		WXS	Illumina HiSeq	.	279.0	118.0	NM_001725	B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Silent	SNP	ENST00000262865.4	37	CCDS13303.1																																																																																			.		0.458	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725	
C10orf71	118461	hgsc.bcm.edu;bcgsc.ca	37	10	50533616	50533616	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr10:50533616G>A	ENST00000374144.3	+	3	3314	c.3026G>A	c.(3025-3027)gGt>gAt	p.G1009D	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1009										endometrium(1)	1						TTACCCGAGGGTGACATAGAA	0.572																																					p.G1009D		.											.	C10orf71	90	0			c.G3026A						.						57.0	59.0	58.0					10																	50533616		692	1591	2283	SO:0001583	missense	118461	exon3			CCGAGGGTGACAT	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3026G>A	10.37:g.50533616G>A	ENSP00000363259:p.Gly1009Asp	Somatic	341.0	0.0		WXS	Illumina HiSeq	Phase_I	240.0	98.0	NM_001135196	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	37	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	G	2.999	-0.206535	0.06180	.	.	ENSG00000177354	ENST00000374144	T	0.04015	3.73	4.93	-3.73	0.04398	.	0.777423	0.10556	N	0.660827	T	0.03434	0.0099	L	0.38175	1.15	0.09310	N	1	.	.	.	.	.	.	T	0.47686	-0.9098	8	0.12103	T	0.63	.	4.625	0.12474	0.4586:0.0:0.1799:0.3615	.	.	.	.	D	1009	ENSP00000363259:G1009D	ENSP00000363259:G1009D	G	+	2	0	C10orf71	50203622	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.224000	0.17738	-0.405000	0.07599	0.491000	0.48974	GGT	.		0.572	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
C11orf1	64776	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	111753099	111753099	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr11:111753099A>T	ENST00000260276.3	+	2	390	c.53A>T	c.(52-54)aAc>aTc	p.N18I	C11orf1_ENST00000528125.1_5'UTR|C11orf1_ENST00000529270.1_Missense_Mutation_p.N58I|C11orf1_ENST00000530214.1_Missense_Mutation_p.N18I|ALG9_ENST00000524880.1_5'Flank	NM_022761.2	NP_073598.1	Q9H5F2	CK001_HUMAN	chromosome 11 open reading frame 1	18						nucleus (GO:0005634)				kidney(2)|lung(3)	5		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)		CAGAGACAGAACCTCGCCTGT	0.418																																					p.N18I		.											.	C11orf1	90	0			c.A53T						.						82.0	70.0	74.0					11																	111753099		2201	4297	6498	SO:0001583	missense	64776	exon2			GACAGAACCTCGC	AJ250229	CCDS8350.1	11q23.1	2012-05-30			ENSG00000137720	ENSG00000137720			1163	protein-coding gene	gene with protein product						10873569	Standard	NM_022761		Approved	FLJ23499	uc001pmd.3	Q9H5F2	OTTHUMG00000166884	ENST00000260276.3:c.53A>T	11.37:g.111753099A>T	ENSP00000260276:p.Asn18Ile	Somatic	213.0	1.0		WXS	Illumina HiSeq	Phase_I	119.0	40.0	NM_022761	Q6I9X7|Q9NQC6	Missense_Mutation	SNP	ENST00000260276.3	37	CCDS8350.1	.	.	.	.	.	.	.	.	.	.	A	14.21	2.468666	0.43839	.	.	ENSG00000137720	ENST00000260276;ENST00000530214;ENST00000530799;ENST00000529270	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.33	-0.607	0.11615	.	1.210160	0.05819	N	0.615479	T	0.22003	0.0530	L	0.36672	1.1	0.09310	N	1	B;B	0.23442	0.085;0.009	B;B	0.21917	0.037;0.016	T	0.27806	-1.0063	10	0.44086	T	0.13	4.0914	3.1458	0.06471	0.1565:0.5937:0.0999:0.1499	.	58;18	E9PMC1;Q9H5F2	.;CK001_HUMAN	I	18;18;34;58	ENSP00000260276:N18I;ENSP00000435864:N18I;ENSP00000432128:N34I;ENSP00000431180:N58I	ENSP00000260276:N18I	N	+	2	0	C11orf1	111258309	0.000000	0.05858	0.002000	0.10522	0.482000	0.33219	-0.222000	0.09190	-0.288000	0.09051	0.459000	0.35465	AAC	.		0.418	C11orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391650.1	NM_022761	
C1orf127	148345	hgsc.bcm.edu;broad.mit.edu	37	1	11008624	11008624	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:11008624delG	ENST00000377008.4	-	11	1513	c.1067delC	c.(1066-1068)ccgfs	p.P356fs	C1orf127_ENST00000377004.4_Frame_Shift_Del_p.P523fs			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	356	Pro-rich.									NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		TTCAGGCCTCGGGGCTGGCGG	0.622																																					p.P523fs		.											.	C1orf127	91	0			c.1568delC						.						57.0	54.0	55.0					1																	11008624		2203	4300	6503	SO:0001589	frameshift_variant	148345	exon12			GGCCTCGGGGCTG	AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.1067delC	1.37:g.11008624delG	ENSP00000366207:p.Pro356fs	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	10.0	NM_001170754	A0AVG8|A6NKM7|Q5VXJ2	Frame_Shift_Del	DEL	ENST00000377008.4	37																																																																																				.		0.622	C1orf127-202	KNOWN	basic	protein_coding	protein_coding		NM_173507	
C1orf168	199920	ucsc.edu;bcgsc.ca	37	1	57258345	57258345	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:57258345T>A	ENST00000343433.6	-	2	221	c.141A>T	c.(139-141)caA>caT	p.Q47H	C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	47										NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						TGGCCAAAATTTGAGTTGACT	0.463																																					p.Q47H		.											.	C1orf168	95	0			c.A141T						.						163.0	155.0	158.0					1																	57258345		2203	4300	6503	SO:0001583	missense	199920	exon2			CAAAATTTGAGTT	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.141A>T	1.37:g.57258345T>A	ENSP00000345972:p.Gln47His	Somatic	200.0	2.0		WXS	Illumina HiSeq	.	143.0	48.0	NM_001004303	Q63HM3|Q6ZUY6	Missense_Mutation	SNP	ENST00000343433.6	37	CCDS30729.1	.	.	.	.	.	.	.	.	.	.	T	8.855	0.945446	0.18356	.	.	ENSG00000187889	ENST00000343433	T	0.46063	0.88	4.8	-6.08	0.02151	.	2.430950	0.01564	N	0.020249	T	0.22781	0.0550	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.08806	-1.0704	10	0.52906	T	0.07	8.3098	0.5523	0.00664	0.2251:0.1677:0.2217:0.3855	.	47;47	Q5VWT5-2;Q5VWT5	.;CA168_HUMAN	H	47	ENSP00000345972:Q47H	ENSP00000345972:Q47H	Q	-	3	2	C1orf168	57030933	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.163000	0.03138	-1.182000	0.02727	-1.398000	0.01145	CAA	.		0.463	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303	
C6orf62	81688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	24714570	24714570	+	Silent	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr6:24714570A>G	ENST00000378119.4	-	3	2572	c.405T>C	c.(403-405)tcT>tcC	p.S135S	C6orf62_ENST00000540769.1_Silent_p.S77S|C6orf62_ENST00000378102.3_Silent_p.S106S	NM_030939.4	NP_112201.1	Q9GZU0	CF062_HUMAN	chromosome 6 open reading frame 62	135						intracellular (GO:0005622)				endometrium(2)|kidney(3)|large_intestine(2)|lung(3)	10						AAGGCTCATCAGATTCTTTCC	0.368																																					p.S135S		.											.	C6orf62	90	0			c.T405C						.						78.0	80.0	79.0					6																	24714570		2203	4300	6503	SO:0001819	synonymous_variant	81688	exon3			CTCATCAGATTCT	AL136632	CCDS4559.1	6p22.1	2011-12-13			ENSG00000112308	ENSG00000112308			20998	protein-coding gene	gene with protein product	"""HBV X-transactivated protein 12"""					11230166	Standard	NM_030939		Approved	FLJ12619, DKFZP564G182, XTP12	uc003nel.3	Q9GZU0	OTTHUMG00000014361	ENST00000378119.4:c.405T>C	6.37:g.24714570A>G		Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	27.0	NM_030939	Q3LIB6|Q5JVZ2|Q5JVZ3|Q6IA63|Q9H1Z2	Silent	SNP	ENST00000378119.4	37	CCDS4559.1																																																																																			.		0.368	C6orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040017.1	NM_030939	
C9orf72	203228	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	27566949	27566949	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr9:27566949C>G	ENST00000380003.3	-	2	233	c.170G>C	c.(169-171)gGa>gCa	p.G57A	C9orf72_ENST00000379997.3_Missense_Mutation_p.G57A|C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	57					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		AGTTATTTCTCCATCACTGAG	0.398																																					p.G57A		.											.	C9orf72	517	0			c.G170C						.						114.0	106.0	109.0					9																	27566949		2203	4300	6503	SO:0001583	missense	203228	exon2			ATTTCTCCATCAC	AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.170G>C	9.37:g.27566949C>G	ENSP00000369339:p.Gly57Ala	Somatic	204.0	1.0		WXS	Illumina HiSeq	Phase_I	162.0	66.0	NM_018325	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	37	CCDS6522.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024856	0.75390	.	.	ENSG00000147894	ENST00000380003;ENST00000379997;ENST00000379995	T;T;T	0.45276	0.9;0.9;0.9	5.99	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.49898	0.1584	N	0.24115	0.695	0.80722	D	1	D;P	0.76494	0.999;0.859	D;P	0.83275	0.996;0.547	T	0.47032	-0.9148	9	.	.	.	.	15.2411	0.73471	0.0:0.9331:0.0:0.0669	.	57;57	Q96LT7-2;Q96LT7	.;CI072_HUMAN	A	57	ENSP00000369339:G57A;ENSP00000369333:G57A;ENSP00000369331:G57A	.	G	-	2	0	C9orf72	27556949	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	1.540000	0.49301	0.655000	0.94253	GGA	.		0.398	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325	
CASQ1	844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160165717	160165717	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:160165717G>A	ENST00000368078.3	+	6	878	c.682G>A	c.(682-684)Gag>Aag	p.E228K	CASQ1_ENST00000467691.1_5'Flank|CASQ1_ENST00000368079.3_Missense_Mutation_p.E222K			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	228					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GAAGCTGAATGAGATTGATTT	0.532																																					p.E228K		.											CASQ1,brain,glioma,-1	CASQ1	90	0			c.G682A						.						102.0	102.0	102.0					1																	160165717		2203	4300	6503	SO:0001583	missense	844	exon6			CTGAATGAGATTG	S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.682G>A	1.37:g.160165717G>A	ENSP00000357057:p.Glu228Lys	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	177.0	27.0	NM_001231	B1AKZ2|B2R863|Q8TBW7	Missense_Mutation	SNP	ENST00000368078.3	37	CCDS1198.2	.	.	.	.	.	.	.	.	.	.	G	24.9	4.579380	0.86645	.	.	ENSG00000143318	ENST00000368079;ENST00000368078;ENST00000441151	T;T	0.79033	-1.23;-1.23	5.35	4.37	0.52481	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	D	0.87010	0.6071	M	0.84683	2.71	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.88309	0.2955	10	0.72032	D	0.01	.	14.7545	0.69552	0.0:0.1454:0.8546:0.0	.	228	P31415	CASQ1_HUMAN	K	222;228;143	ENSP00000357058:E222K;ENSP00000357057:E228K	ENSP00000357057:E228K	E	+	1	0	CASQ1	158432341	1.000000	0.71417	0.995000	0.50966	0.656000	0.38851	7.258000	0.78371	2.660000	0.90430	0.555000	0.69702	GAG	.		0.532	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077412.1	NM_001231	
CCDC132	55610	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92935245	92935245	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr7:92935245G>A	ENST00000305866.5	+	18	1686	c.1558G>A	c.(1558-1560)Ggt>Agt	p.G520S	CCDC132_ENST00000544910.1_Missense_Mutation_p.G490S|CCDC132_ENST00000541136.1_Missense_Mutation_p.G331S|CCDC132_ENST00000317751.6_Missense_Mutation_p.G251S|CCDC132_ENST00000535481.1_Missense_Mutation_p.G240S	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	520						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GTACTGTAGTGGTGGGAATCC	0.413																																					p.G520S		.											.	CCDC132	90	0			c.G1558A						.						127.0	118.0	121.0					7																	92935245		1878	4100	5978	SO:0001583	missense	55610	exon18			TGTAGTGGTGGGA	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1558G>A	7.37:g.92935245G>A	ENSP00000307666:p.Gly520Ser	Somatic	239.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	57.0	NM_017667	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.683303	0.68157	.	.	ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481;ENST00000317751	T	0.39592	1.07	5.6	5.6	0.85130	.	0.185421	0.46442	D	0.000283	T	0.33614	0.0869	L	0.27053	0.805	0.58432	D	0.999999	B;B;B	0.25667	0.131;0.122;0.131	B;B;B	0.28305	0.058;0.088;0.058	T	0.11131	-1.0600	10	0.10902	T	0.67	-10.8814	19.9947	0.97381	0.0:0.0:1.0:0.0	.	240;490;520	B4DS55;F5H5U7;Q96JG6	.;.;CC132_HUMAN	S	520;490;331;240;251	ENSP00000325582:G251S	ENSP00000307666:G520S	G	+	1	0	CCDC132	92773181	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.963000	0.70372	2.794000	0.96219	0.650000	0.86243	GGT	.		0.413	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
CCDC63	160762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	111342552	111342552	+	Silent	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr12:111342552C>T	ENST00000308208.5	+	11	1745	c.1503C>T	c.(1501-1503)ccC>ccT	p.P501P	CCDC63_ENST00000545036.1_Silent_p.P461P|CCDC63_ENST00000552694.1_Silent_p.P422P	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	501								p.P501P(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						AAGTCATCCCCCCAGTGCTGG	0.587																																					p.P501P		.											.	CCDC63	134	1	Substitution - coding silent(1)	lung(1)	c.C1503T						.						61.0	60.0	60.0					12																	111342552		2203	4300	6503	SO:0001819	synonymous_variant	160762	exon11			CATCCCCCCAGTG	AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.1503C>T	12.37:g.111342552C>T		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	40.0	NM_152591	B4DY03|Q0P603|Q6P2E1	Silent	SNP	ENST00000308208.5	37	CCDS9151.1																																																																																			.		0.587	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591	
CD46	4179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207940538	207940538	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:207940538A>C	ENST00000358170.2	+	6	1010	c.854A>C	c.(853-855)aAa>aCa	p.K285T	CD46_ENST00000480003.1_Missense_Mutation_p.K285T|CD46_ENST00000354848.1_Missense_Mutation_p.K285T|CD46_ENST00000361067.1_Missense_Mutation_p.K285T|CD46_ENST00000367047.1_Missense_Mutation_p.K222T|CD46_ENST00000322918.5_Missense_Mutation_p.K285T|CD46_ENST00000367042.1_Missense_Mutation_p.K285T|CD46_ENST00000357714.1_Missense_Mutation_p.K285T|CD46_ENST00000360212.2_Missense_Mutation_p.K285T|CD46_ENST00000322875.4_Missense_Mutation_p.K285T|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000367041.1_Missense_Mutation_p.K285T|CD46_ENST00000441839.2_Missense_Mutation_p.K285T	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	285	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						AAGTGTCTTAAAGGTACAAAG	0.353																																					p.K285T		.											.	CD46	963	0			c.A854C						.						86.0	83.0	84.0					1																	207940538		2203	4299	6502	SO:0001583	missense	4179	exon6			GTCTTAAAGGTAC	BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.854A>C	1.37:g.207940538A>C	ENSP00000350893:p.Lys285Thr	Somatic	239.0	0.0		WXS	Illumina HiSeq	Phase_I	325.0	137.0	NM_172352	A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Missense_Mutation	SNP	ENST00000358170.2	37	CCDS1485.1	.	.	.	.	.	.	.	.	.	.	A	12.27	1.886394	0.33348	.	.	ENSG00000117335	ENST00000358170;ENST00000354848;ENST00000322918;ENST00000367042;ENST00000367041;ENST00000357714;ENST00000322875;ENST00000367047;ENST00000441839;ENST00000361067;ENST00000360212;ENST00000480003	T;T;T;T;T;T;T;T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81;-0.81;-0.81;-0.81;-0.81;-0.81;0.6;-0.81	5.05	1.28	0.21552	Complement control module (1);Sushi/SCR/CCP (1);	0.644228	0.13704	N	0.368573	D	0.86843	0.6030	H	0.95004	3.61	0.29160	N	0.877823	D;D;P;D;D;D;D;P;D;P;D;D;D;P	0.64830	0.984;0.988;0.858;0.994;0.988;0.973;0.98;0.944;0.984;0.885;0.984;0.973;0.973;0.954	D;P;P;D;P;D;P;P;D;P;D;D;D;P	0.69479	0.916;0.898;0.472;0.964;0.898;0.957;0.843;0.771;0.916;0.476;0.916;0.957;0.957;0.907	T	0.77905	-0.2413	10	0.87932	D	0	.	5.4453	0.16531	0.5664:0.3432:0.0904:0.0	.	285;285;285;285;285;285;285;285;285;285;285;285;285;285	P15529-4;P15529-5;P15529-14;P15529-3;P15529-12;P15529-13;P15529-2;P15529-11;P15529-7;P15529-9;P15529-15;P15529-6;P15529-8;P15529	.;.;.;.;.;.;.;.;.;.;.;.;.;MCP_HUMAN	T	285;285;285;285;285;285;285;222;285;285;285;285	ENSP00000350893:K285T;ENSP00000346912:K285T;ENSP00000314664:K285T;ENSP00000356009:K285T;ENSP00000356008:K285T;ENSP00000350346:K285T;ENSP00000313875:K285T;ENSP00000356014:K222T;ENSP00000413543:K285T;ENSP00000354358:K285T;ENSP00000353342:K285T;ENSP00000418471:K285T	ENSP00000313875:K285T	K	+	2	0	CD46	206007161	0.798000	0.28890	0.242000	0.24170	0.192000	0.23643	1.167000	0.31847	0.110000	0.17919	0.533000	0.62120	AAA	.		0.353	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088588.3	NM_172361	
CDK5R1	8851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	30814788	30814788	+	Silent	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr17:30814788G>A	ENST00000313401.3	+	2	839	c.150G>A	c.(148-150)ctG>ctA	p.L50L		NM_003885.2	NP_003876.1	Q15078	CD5R1_HUMAN	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	50					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cerebellum development (GO:0021549)|embryo development (GO:0009790)|ephrin receptor signaling pathway (GO:0048013)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|hippocampus development (GO:0021766)|ionotropic glutamate receptor signaling pathway (GO:0035235)|layer formation in cerebral cortex (GO:0021819)|negative regulation of axon extension (GO:0030517)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of neuron differentiation (GO:0045664)|rhythmic process (GO:0048511)|serine phosphorylation of STAT3 protein (GO:0033136)|superior olivary nucleus maturation (GO:0021722)	axon (GO:0030424)|contractile fiber (GO:0043292)|cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|cyclin-dependent protein kinase 5 activator activity (GO:0016534)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)			cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.0938)			TCTCCGTGCTGCCTTGGAAGA	0.562																																					p.L50L		.											.	CDK5R1	651	0			c.G150A						.						108.0	93.0	98.0					17																	30814788		2203	4300	6503	SO:0001819	synonymous_variant	8851	exon2			CGTGCTGCCTTGG	X80343	CCDS11273.1	17q12	2006-03-28			ENSG00000176749	ENSG00000176749			1775	protein-coding gene	gene with protein product		603460				8090221	Standard	NM_003885		Approved	p35nck5a, Nck5a	uc002hhn.3	Q15078	OTTHUMG00000132814	ENST00000313401.3:c.150G>A	17.37:g.30814788G>A		Somatic	337.0	0.0		WXS	Illumina HiSeq	Phase_I	252.0	87.0	NM_003885	E1P664|Q5U0G3	Silent	SNP	ENST00000313401.3	37	CCDS11273.1																																																																																			.		0.562	CDK5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256264.1	NM_003885	
CHAT	1103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	50857589	50857589	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr10:50857589C>A	ENST00000337653.2	+	10	1571	c.1418C>A	c.(1417-1419)tCc>tAc	p.S473Y	CHAT_ENST00000351556.3_Missense_Mutation_p.S355Y|CHAT_ENST00000395562.2_Missense_Mutation_p.S391Y|CHAT_ENST00000395559.2_Missense_Mutation_p.S355Y|CHAT_ENST00000339797.1_Missense_Mutation_p.S355Y|CHAT_ENST00000455728.2_Missense_Mutation_p.S355Y	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	473					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	CGAGCAGACTCCGTCAGCGAG	0.617																																					p.S473Y		.											.	CHAT	514	0			c.C1418A						.						38.0	45.0	42.0					10																	50857589		2203	4300	6503	SO:0001583	missense	1103	exon10			CAGACTCCGTCAG	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1418C>A	10.37:g.50857589C>A	ENSP00000337103:p.Ser473Tyr	Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	79.0	NM_020549	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	ENST00000337653.2	37	CCDS7232.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.288966	0.59976	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.04	5.04	0.67666	.	0.227258	0.45126	D	0.000396	D	0.94414	0.8203	M	0.64170	1.965	0.54753	D	0.999984	D;D	0.89917	0.994;1.0	P;D	0.75020	0.872;0.985	D	0.94451	0.7667	10	0.52906	T	0.07	-17.3729	18.3655	0.90389	0.0:1.0:0.0:0.0	.	355;473	F8W8I2;P28329	.;CLAT_HUMAN	Y	355;355;355;473;391;355	ENSP00000343486:S355Y;ENSP00000345878:S355Y;ENSP00000378926:S355Y;ENSP00000337103:S473Y;ENSP00000378929:S391Y;ENSP00000390521:S355Y	ENSP00000337103:S473Y	S	+	2	0	CHAT	50527595	1.000000	0.71417	0.917000	0.36280	0.389000	0.30415	5.794000	0.69067	2.322000	0.78497	0.462000	0.41574	TCC	.		0.617	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549	
CIRBP	1153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	1271158	1271158	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:1271158G>C	ENST00000588030.1	+	3	383	c.123G>C	c.(121-123)agG>agC	p.R41S	CIRBP_ENST00000444172.2_Intron|CIRBP_ENST00000589710.1_Missense_Mutation_p.R41S|CIRBP_ENST00000588230.1_Missense_Mutation_p.R41S|CIRBP_ENST00000320936.5_Missense_Mutation_p.R41S|CIRBP_ENST00000589686.1_Missense_Mutation_p.R41S|CIRBP_ENST00000589660.1_Missense_Mutation_p.R41S|CIRBP_ENST00000591935.1_Missense_Mutation_p.R41S|CIRBP_ENST00000413636.2_Missense_Mutation_p.R41S|CIRBP_ENST00000586472.1_Missense_Mutation_p.R41S|CIRBP_ENST00000585630.1_Missense_Mutation_p.R41S|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000589235.1_Missense_Mutation_p.R41S|CIRBP_ENST00000586773.1_Missense_Mutation_p.R41S|CIRBP_ENST00000587896.1_Missense_Mutation_p.R41S|CIRBP_ENST00000587323.1_Missense_Mutation_p.R41S|CIRBP_ENST00000588090.1_Missense_Mutation_p.R41S|CIRBP-AS1_ENST00000600215.1_RNA			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein	41	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAAAGACAGGGAGACCCAGA	0.577																																					p.R41S		.											.	CIRBP	226	0			c.G123C						.						103.0	106.0	105.0					19																	1271158		2203	4300	6503	SO:0001583	missense	1153	exon3			AGACAGGGAGACC	D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.123G>C	19.37:g.1271158G>C	ENSP00000468788:p.Arg41Ser	Somatic	396.0	0.0		WXS	Illumina HiSeq	Phase_I	264.0	82.0	NM_001280	B3KT17|B4E2X2	Missense_Mutation	SNP	ENST00000588030.1	37	CCDS12059.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.799404	0.31869	.	.	ENSG00000099622	ENST00000320936;ENST00000413636	D;D	0.85339	-1.97;-1.97	4.12	3.08	0.35506	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.058497	0.64402	U	0.000013	D	0.87466	0.6184	L	0.42686	1.345	0.80722	D	1	D;D;D;D	0.89917	0.981;0.989;1.0;0.989	D;D;D;D	0.85130	0.928;0.971;0.997;0.971	D	0.86241	0.1643	10	0.87932	D	0	-3.1252	8.2397	0.31652	0.1998:0.0:0.8002:0.0	.	41;41;41;41	B4E2X2;Q53XX5;D6W5Y5;Q14011	.;.;.;CIRBP_HUMAN	S	41	ENSP00000322887:R41S;ENSP00000412831:R41S	ENSP00000322887:R41S	R	+	3	2	CIRBP	1222158	1.000000	0.71417	0.996000	0.52242	0.006000	0.05464	1.272000	0.33109	0.723000	0.32274	-0.271000	0.10264	AGG	.		0.577	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449969.1	NM_001280	
CILP2	148113	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	19655986	19655986	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:19655986G>A	ENST00000291495.5	+	8	2717	c.2632G>A	c.(2632-2634)Gtg>Atg	p.V878M	CILP2_ENST00000586018.1_Missense_Mutation_p.V884M	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	878						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CAATGGGCCTGTGTACCCGTG	0.677																																					p.V878M		.											.	CILP2	91	0			c.G2632A						.						24.0	26.0	26.0					19																	19655986		2185	4265	6450	SO:0001583	missense	148113	exon8			GGGCCTGTGTACC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2632G>A	19.37:g.19655986G>A	ENSP00000291495:p.Val878Met	Somatic	15.0	1.0		WXS	Illumina HiSeq	Phase_I	15.0	8.0	NM_153221	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.666108	0.67700	.	.	ENSG00000160161	ENST00000291495	T	0.10573	2.86	5.5	1.78	0.24846	.	0.121838	0.52532	D	0.000065	T	0.12817	0.0311	L	0.38175	1.15	0.36638	D	0.876687	P;P	0.49358	0.923;0.848	P;P	0.53549	0.729;0.66	T	0.09796	-1.0658	10	0.72032	D	0.01	-22.8849	4.8074	0.13326	0.1647:0.399:0.4363:0.0	.	878;878	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	M	878	ENSP00000291495:V878M	ENSP00000291495:V878M	V	+	1	0	CILP2	19516986	0.999000	0.42202	0.955000	0.39395	0.976000	0.68499	3.630000	0.54273	1.292000	0.44672	0.555000	0.69702	GTG	.		0.677	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
COL6A5	256076	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	130098358	130098358	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr3:130098358G>T	ENST00000432398.2	+	4	1259	c.765G>T	c.(763-765)caG>caT	p.Q255H	COL6A5_ENST00000265379.6_Missense_Mutation_p.Q255H	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	255	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GGCATCTTCAGACCTTCCTTG	0.453																																					p.Q255H		.											.	.	.	0			c.G765T						.						97.0	87.0	90.0					3																	130098358		692	1591	2283	SO:0001583	missense	256076	exon4			TCTTCAGACCTTC	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.765G>T	3.37:g.130098358G>T	ENSP00000390895:p.Gln255His	Somatic	143.0	1.0		WXS	Illumina HiSeq	Phase_I	113.0	56.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	G	7.296	0.612073	0.14066	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.83335	-1.71;-1.71	5.06	4.18	0.49190	.	.	.	.	.	D	0.88164	0.6363	M	0.62723	1.935	0.24242	N	0.995354	D	0.71674	0.998	D	0.69479	0.964	T	0.78540	-0.2165	9	0.87932	D	0	.	9.4242	0.38570	0.1733:0.0:0.8267:0.0	.	255	A8TX70-2	.	H	255	ENSP00000390895:Q255H;ENSP00000265379:Q255H	ENSP00000265379:Q255H	Q	+	3	2	COL6A5	131581048	0.164000	0.22935	0.156000	0.22583	0.012000	0.07955	0.704000	0.25661	1.126000	0.42016	0.557000	0.71058	CAG	.		0.453	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
CRB1	23418	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	197316508	197316508	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:197316508C>T	ENST00000367400.3	+	4	1022	c.887C>T	c.(886-888)aCa>aTa	p.T296I	CRB1_ENST00000538660.1_Missense_Mutation_p.T296I|CRB1_ENST00000367399.2_Intron|CRB1_ENST00000535699.1_Missense_Mutation_p.T227I|CRB1_ENST00000543483.1_5'UTR	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	296	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TTCACAGGGACACACTGTGAG	0.398																																					p.T296I		.											.	CRB1	161	0			c.C887T						.						228.0	195.0	206.0					1																	197316508		2203	4300	6503	SO:0001583	missense	23418	exon4			CAGGGACACACTG		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.887C>T	1.37:g.197316508C>T	ENSP00000356370:p.Thr296Ile	Somatic	162.0	2.0		WXS	Illumina HiSeq	Phase_I	243.0	41.0	NM_001257966	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474383	0.26423	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400	D;D;D	0.91792	-2.91;-2.91;-2.91	5.22	2.05	0.26809	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.83885	0.5351	L	0.28504	0.86	0.09310	N	1	B;B;B;B	0.21071	0.031;0.012;0.004;0.051	B;B;B;B	0.17433	0.008;0.015;0.003;0.018	T	0.69960	-0.5003	9	0.29301	T	0.29	.	4.0784	0.09914	0.1529:0.4901:0.0:0.357	.	296;227;296;321	B7Z5T2;F5H0L2;P82279;Q59H36	.;.;CRUM1_HUMAN;.	I	227;296;296	ENSP00000438786:T227I;ENSP00000438091:T296I;ENSP00000356370:T296I	ENSP00000356370:T296I	T	+	2	0	CRB1	195583131	0.000000	0.05858	0.944000	0.38274	0.994000	0.84299	-0.829000	0.04415	0.504000	0.28082	0.585000	0.79938	ACA	.		0.398	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
CRISP3	10321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	49698949	49698949	+	Silent	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr6:49698949A>G	ENST00000393666.1	-	6	543	c.537T>C	c.(535-537)aaT>aaC	p.N179N	CRISP3_ENST00000423399.2_Silent_p.N89N|CRISP3_ENST00000263045.4_Silent_p.N192N|CRISP3_ENST00000433368.2_Silent_p.N202N|CRISP3_ENST00000371159.4_Silent_p.N210N			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	179					defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			CATATAGTCTATTAGCCCAAT	0.338																																					p.N202N		.											.	CRISP3	92	0			c.T606C						.						92.0	85.0	87.0					6																	49698949		2203	4300	6503	SO:0001819	synonymous_variant	10321	exon7			TAGTCTATTAGCC	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.537T>C	6.37:g.49698949A>G		Somatic	258.0	0.0		WXS	Illumina HiSeq	Phase_I	221.0	91.0	NM_001190986	A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Silent	SNP	ENST00000393666.1	37																																																																																				.		0.338	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006061	
CSNK1G1	53944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	64508895	64508895	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr15:64508895C>T	ENST00000303052.7	-	5	733	c.310G>A	c.(310-312)Gtg>Atg	p.V104M	CSNK1G1_ENST00000303032.6_Missense_Mutation_p.V104M|CTD-2116N17.1_ENST00000606793.1_Missense_Mutation_p.V77M|CSNK1G1_ENST00000607537.1_Missense_Mutation_p.V104M	NM_022048.3	NP_071331.2	Q9HCP0	KC1G1_HUMAN	casein kinase 1, gamma 1	104	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	13						AAGTAATACACCTGTGGGAGA	0.453																																					p.V104M		.											.	CSNK1G1	319	0			c.G310A						.						66.0	58.0	61.0					15																	64508895		2203	4300	6503	SO:0001583	missense	53944	exon5			AATACACCTGTGG	AB042562	CCDS10192.2	15q22.1-q22.31	2013-01-17			ENSG00000169118	ENSG00000169118			2454	protein-coding gene	gene with protein product		606274				11124537	Standard	NM_022048		Approved	CK1gamma1	uc002anf.3	Q9HCP0	OTTHUMG00000133019	ENST00000303052.7:c.310G>A	15.37:g.64508895C>T	ENSP00000305777:p.Val104Met	Somatic	237.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	64.0	NM_022048	Q5JPH1|Q96AE9|Q9HCP1	Missense_Mutation	SNP	ENST00000303052.7	37	CCDS10192.2	.	.	.	.	.	.	.	.	.	.	C	31	5.090517	0.94149	.	.	ENSG00000169118	ENST00000303052;ENST00000303032	T;T	0.21361	2.01;2.01	5.51	5.51	0.81932	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.48857	0.1523	M	0.73217	2.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.992;0.995;0.994	T	0.43507	-0.9387	10	0.62326	D	0.03	.	19.7866	0.96442	0.0:1.0:0.0:0.0	.	104;104;104	Q9HCP0-2;Q8IXA3;Q9HCP0	.;.;KC1G1_HUMAN	M	104	ENSP00000305777:V104M;ENSP00000307753:V104M	ENSP00000307753:V104M	V	-	1	0	CSNK1G1	62295948	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.056000	0.71111	2.756000	0.94617	0.655000	0.94253	GTG	.		0.453	CSNK1G1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256605.1	NM_022048	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	41266097	41266097	+	Missense_Mutation	SNP	G	G	T	rs28931588|rs121913416|rs121913417		TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr3:41266097G>T	ENST00000349496.5	+	3	374	c.94G>T	c.(94-96)Gac>Tac	p.D32Y	CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32Y|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32Y|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32Y|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32Y(128)|p.D32N(82)|p.A5_A80del(53)|p.D32H(40)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.Q28fs*20(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.D32fs*9(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GTCTTACCTGGACTCTGGAAT	0.478	D32N(KE39_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32Y	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0	CTNNB1	24361	397	Substitution - Missense(250)|Deletion - In frame(120)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Complex - frameshift(1)	liver(155)|central_nervous_system(55)|endometrium(40)|stomach(36)|pancreas(28)|large_intestine(22)|pituitary(22)|skin(11)|ovary(9)|soft_tissue(4)|prostate(4)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|adrenal_gland(1)|biliary_tract(1)|urinary_tract(1)|lung(1)|NS(1)	c.G94T						.						92.0	77.0	82.0					3																	41266097		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TACCTGGACTCTG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.94G>T	3.37:g.41266097G>T	ENSP00000344456:p.Asp32Tyr	Somatic	355.0	1.0		WXS	Illumina HiSeq	Phase_I	301.0	109.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337485	0.81911	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.68210	0.2976	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.70498	-0.4855	10	0.87932	D	0	0.3843	19.9596	0.97236	0.0:0.0:1.0:0.0	rs28931588	32	P35222	CTNB1_HUMAN	Y	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25Y;ENSP00000385604:D32Y;ENSP00000412219:D32Y;ENSP00000379486:D32Y;ENSP00000344456:D32Y;ENSP00000411226:D25Y;ENSP00000379488:D32Y;ENSP00000409302:D32Y;ENSP00000401599:D32Y	ENSP00000344456:D32Y	D	+	1	0	CTNNB1	41241101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GAC	G|1.000;T|0.000		0.478	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DCAF12L1	139170	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	125685361	125685361	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chrX:125685361G>A	ENST00000371126.1	-	1	1473	c.1231C>T	c.(1231-1233)Ctc>Ttc	p.L411F		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	411										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						TTGTGGTTGAGCCAGCCTCTG	0.557																																					p.L411F		.											.	DCAF12L1	132	0			c.C1231T						.						90.0	84.0	86.0					X																	125685361		2203	4300	6503	SO:0001583	missense	139170	exon1			GGTTGAGCCAGCC	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1231C>T	X.37:g.125685361G>A	ENSP00000360167:p.Leu411Phe	Somatic	218.0	1.0		WXS	Illumina HiSeq	Phase_I	281.0	132.0	NM_178470	Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681043	0.29872	.	.	ENSG00000198889	ENST00000371126	T	0.21734	1.99	4.0	2.16	0.27623	.	0.000000	0.32593	N	0.005885	T	0.28067	0.0692	M	0.71581	2.175	0.30613	N	0.759294	D	0.53619	0.961	P	0.50405	0.64	T	0.20240	-1.0281	10	0.51188	T	0.08	.	5.7817	0.18310	0.1115:0.0:0.691:0.1976	.	411	Q5VU92	DC121_HUMAN	F	411	ENSP00000360167:L411F	ENSP00000360167:L411F	L	-	1	0	DCAF12L1	125513042	1.000000	0.71417	0.830000	0.32933	0.073000	0.16967	2.899000	0.48679	0.439000	0.26476	0.513000	0.50165	CTC	.		0.557	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470	
DCAF5	8816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	69522154	69522154	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr14:69522154C>A	ENST00000341516.5	-	9	1396	c.1249G>T	c.(1249-1251)Gcc>Tcc	p.A417S	DCAF5_ENST00000554215.1_Missense_Mutation_p.A335S|DCAF5_ENST00000556847.1_Missense_Mutation_p.A335S|DCAF5_ENST00000557386.1_Missense_Mutation_p.A416S|DCAF5_ENST00000553293.1_5'UTR	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	417					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						TCAAAGAAGGCCATCATCCGG	0.562																																					p.A417S		.											.	DCAF5	91	0			c.G1249T						.						89.0	85.0	87.0					14																	69522154		2203	4300	6503	SO:0001583	missense	8816	exon9			AGAAGGCCATCAT	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.1249G>T	14.37:g.69522154C>A	ENSP00000341351:p.Ala417Ser	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	54.0	NM_003861	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	ENST00000341516.5	37	CCDS32106.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530871	0.85706	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.75050	-0.9;-0.72;-0.72;-0.21	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.81559	0.4848	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.981	T	0.82460	-0.0446	10	0.62326	D	0.03	-17.0231	19.7989	0.96497	0.0:1.0:0.0:0.0	.	416;417	G3V4J7;Q96JK2	.;DCAF5_HUMAN	S	417;335;335;416	ENSP00000341351:A417S;ENSP00000451551:A335S;ENSP00000452052:A335S;ENSP00000451845:A416S	ENSP00000341351:A417S	A	-	1	0	DCAF5	68591907	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.336000	0.79245	2.683000	0.91414	0.561000	0.74099	GCC	.		0.562	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861	
DENND5B	160518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	31586176	31586176	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr12:31586176C>A	ENST00000389082.5	-	8	2283	c.2019G>T	c.(2017-2019)tgG>tgT	p.W673C	DENND5B_ENST00000306833.6_Missense_Mutation_p.W708C|DENND5B_ENST00000354285.4_Missense_Mutation_p.W695C|DENND5B_ENST00000536562.1_Missense_Mutation_p.W708C	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	673					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TCCGACTTACCCAGCGACTGA	0.423																																					p.W673C		.											.	DENND5B	24	0			c.G2019T						.						140.0	144.0	143.0					12																	31586176		2078	4234	6312	SO:0001583	missense	160518	exon8			ACTTACCCAGCGA	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2019G>T	12.37:g.31586176C>A	ENSP00000373734:p.Trp673Cys	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	33.0	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877434	0.51801	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285	T;T;T;T	0.07567	3.75;3.86;3.86;3.18	4.13	4.13	0.48395	.	0.082869	0.52532	D	0.000080	T	0.26448	0.0646	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;0.988;1.0	D;P;D	0.81914	0.995;0.775;0.992	T	0.01829	-1.1265	10	0.36615	T	0.2	-16.4356	16.6004	0.84815	0.0:1.0:0.0:0.0	.	695;673;708	Q6ZUT9-4;Q6ZUT9;G3V1S3	.;DEN5B_HUMAN;.	C	673;708;708;695	ENSP00000373734:W673C;ENSP00000306482:W708C;ENSP00000444889:W708C;ENSP00000346238:W695C	ENSP00000306482:W708C	W	-	3	0	DENND5B	31477443	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.801000	0.75170	2.131000	0.65755	0.655000	0.94253	TGG	.		0.423	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
DHX34	9704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47861354	47861354	+	Silent	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:47861354C>T	ENST00000328771.4	+	4	1598	c.1249C>T	c.(1249-1251)Ctg>Ttg	p.L417L	DHX34_ENST00000471451.1_3'UTR	NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	417	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GCACAGCGCCCTGTCTGTGGC	0.657																																					p.L417L		.											.	DHX34	231	0			c.C1249T						.						26.0	25.0	26.0					19																	47861354		2203	4298	6501	SO:0001819	synonymous_variant	9704	exon4			AGCGCCCTGTCTG	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1249C>T	19.37:g.47861354C>T		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	16.0	NM_014681	B4DMY8	Silent	SNP	ENST00000328771.4	37	CCDS12700.1																																																																																			.		0.657	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52360896	52360896	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr3:52360896C>G	ENST00000420323.2	+	5	988	c.727C>G	c.(727-729)Ctc>Gtc	p.L243V		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	243	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCCCATCTACCTCCCACTGAA	0.592																																					p.L243V		.											.	DNAH1	67	0			c.C727G						.						88.0	106.0	100.0					3																	52360896		2091	4217	6308	SO:0001583	missense	25981	exon5			ATCTACCTCCCAC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.727C>G	3.37:g.52360896C>G	ENSP00000401514:p.Leu243Val	Somatic	325.0	0.0		WXS	Illumina HiSeq	Phase_I	228.0	60.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173124	0.78452	.	.	ENSG00000114841	ENST00000420323	T	0.35605	1.3	5.51	5.51	0.81932	.	0.308624	0.23243	N	0.050326	T	0.69214	0.3086	M	0.90082	3.085	0.53005	D	0.999964	D;D	0.89917	0.996;1.0	P;D	0.81914	0.8;0.995	T	0.75465	-0.3308	10	0.72032	D	0.01	.	19.4334	0.94781	0.0:1.0:0.0:0.0	.	243;243	C9JXH6;Q9P2D7-3	.;.	V	243	ENSP00000401514:L243V	ENSP00000401514:L243V	L	+	1	0	DNAH1	52335936	1.000000	0.71417	0.974000	0.42286	0.744000	0.42396	4.611000	0.61162	2.591000	0.87537	0.313000	0.20887	CTC	.		0.592	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7726895	7726895	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr17:7726895G>T	ENST00000572933.1	+	74	12738	c.11278G>T	c.(11278-11280)Gac>Tac	p.D3760Y	DNAH2_ENST00000389173.2_Missense_Mutation_p.D3760Y			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3760					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GTACCCTCGTGACTGGCACCT	0.532																																					p.D3760Y		.											.	DNAH2	102	0			c.G11278T						.						156.0	121.0	133.0					17																	7726895		2203	4300	6503	SO:0001583	missense	146754	exon73			CCTCGTGACTGGC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11278G>T	17.37:g.7726895G>T	ENSP00000458355:p.Asp3760Tyr	Somatic	244.0	0.0		WXS	Illumina HiSeq	Phase_I	214.0	83.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997407	0.74818	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.56275	0.47	4.89	4.89	0.63831	Dynein heavy chain (1);	0.177492	0.47852	D	0.000220	T	0.77624	0.4158	M	0.91300	3.195	0.80722	D	1	P;D	0.59357	0.845;0.985	P;D	0.66979	0.802;0.948	T	0.82750	-0.0303	10	0.62326	D	0.03	.	16.9793	0.86323	0.0:0.0:1.0:0.0	.	3721;3760	Q9P225-2;Q9P225	.;DYH2_HUMAN	Y	3721;3760	ENSP00000373825:D3760Y	ENSP00000353818:D3721Y	D	+	1	0	DNAH2	7667620	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.627000	0.74258	2.551000	0.86045	0.609000	0.83330	GAC	.		0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
DNAI2	64446	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	72281284	72281284	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr17:72281284C>T	ENST00000311014.6	+	3	356	c.289C>T	c.(289-291)Cgg>Tgg	p.R97W	DNAI2_ENST00000582036.1_Missense_Mutation_p.R97W|DNAI2_ENST00000446837.2_Missense_Mutation_p.R97W|DNAI2_ENST00000307504.5_5'UTR|DNAI2_ENST00000579490.1_Missense_Mutation_p.R154W			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	97					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CATCCGTTTCCGGAAGAAAGT	0.582									Kartagener syndrome																												p.R97W		.											.	DNAI2	92	0			c.C289T						.						75.0	64.0	68.0					17																	72281284		2203	4300	6503	SO:0001583	missense	64446	exon3	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CGTTTCCGGAAGA	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.289C>T	17.37:g.72281284C>T	ENSP00000308312:p.Arg97Trp	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	7.0	NM_001172810	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	CCDS11697.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621425	0.87460	.	.	ENSG00000171595	ENST00000311014;ENST00000446837	T;T	0.15952	2.38;2.38	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.55862	0.1947	H	0.94385	3.53	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69591	-0.5104	10	0.87932	D	0	-44.4411	18.6962	0.91601	0.0:1.0:0.0:0.0	.	97	Q9GZS0	DNAI2_HUMAN	W	97	ENSP00000308312:R97W;ENSP00000400252:R97W	ENSP00000308312:R97W	R	+	1	2	DNAI2	69792879	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.701000	0.54793	2.640000	0.89533	0.650000	0.86243	CGG	.		0.582	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036	
DOCK4	9732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	111634195	111634195	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr7:111634195A>T	ENST00000437633.1	-	5	566	c.310T>A	c.(310-312)Tat>Aat	p.Y104N	DOCK4_ENST00000428084.1_Missense_Mutation_p.Y104N|DOCK4_ENST00000476846.1_5'UTR	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	104					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TTAACCACATAGAGTTGTTTC	0.338																																					p.Y104N		.											.	DOCK4	26	0			c.T310A						.						147.0	137.0	141.0					7																	111634195		1835	4088	5923	SO:0001583	missense	9732	exon5			CCACATAGAGTTG		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.310T>A	7.37:g.111634195A>T	ENSP00000404179:p.Tyr104Asn	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	17.0	NM_014705	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.603024	0.66445	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	T;T	0.03920	3.76;3.76	5.68	5.68	0.88126	.	0.178935	0.51477	D	0.000093	T	0.18130	0.0435	M	0.87758	2.905	0.80722	D	1	B;B;P;B	0.37985	0.105;0.105;0.613;0.105	B;B;P;B	0.47981	0.028;0.042;0.563;0.042	T	0.00155	-1.1980	10	0.87932	D	0	.	13.6615	0.62370	1.0:0.0:0.0:0.0	.	104;104;104;104	A4D0S8;Q149N6;Q149N5;Q8N1I0	.;.;.;DOCK4_HUMAN	N	92;104;104;92;103	ENSP00000410746:Y104N;ENSP00000404179:Y104N	ENSP00000345432:Y92N	Y	-	1	0	DOCK4	111421431	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.862000	0.92283	2.166000	0.68216	0.533000	0.62120	TAT	.		0.338	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
DUSP1	1843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	172197268	172197268	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr5:172197268T>G	ENST00000239223.3	-	2	651	c.409A>C	c.(409-411)Agc>Cgc	p.S137R	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	137	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		GACTGTTTGCTGCACAGCTCC	0.562																																					p.S137R		.											.	DUSP1	659	0			c.A409C						.						51.0	49.0	50.0					5																	172197268		2203	4300	6503	SO:0001583	missense	1843	exon2			GTTTGCTGCACAG	X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.409A>C	5.37:g.172197268T>G	ENSP00000239223:p.Ser137Arg	Somatic	281.0	1.0		WXS	Illumina HiSeq	Phase_I	202.0	79.0	NM_004417	D3DQL9|Q2V508	Missense_Mutation	SNP	ENST00000239223.3	37	CCDS4380.1	.	.	.	.	.	.	.	.	.	.	T	16.77	3.216220	0.58452	.	.	ENSG00000120129	ENST00000239223;ENST00000457103;ENST00000434080	T	0.44083	0.93	4.76	4.76	0.60689	Rhodanese-like (3);	0.045960	0.85682	D	0.000000	T	0.38983	0.1061	L	0.57536	1.79	0.40495	D	0.980582	B;P	0.36683	0.286;0.565	B;B	0.35353	0.125;0.201	T	0.29305	-1.0016	10	0.24483	T	0.36	.	14.1266	0.65225	0.0:0.0:0.0:1.0	.	137;94	P28562;B4DNT2	DUS1_HUMAN;.	R	137;110;72	ENSP00000239223:S137R	ENSP00000239223:S137R	S	-	1	0	DUSP1	172129874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.297000	0.59061	2.003000	0.58678	0.459000	0.35465	AGC	.		0.562	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252943.3	NM_004417	
ETFB	2109	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51857606	51857606	+	Intron	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:51857606C>T	ENST00000309244.4	-	2	149				ETFB_ENST00000354232.4_Missense_Mutation_p.C96Y|CTD-2616J11.11_ENST00000600067.1_Intron|CTD-2616J11.9_ENST00000600974.1_RNA	NM_001985.2	NP_001976.1	P38117	ETFB_HUMAN	electron-transfer-flavoprotein, beta polypeptide						cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)			kidney(2)|large_intestine(1)|lung(3)	6		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000226)|OV - Ovarian serous cystadenocarcinoma(262;0.00661)		AGGAAACAGGCAAGAAGGTGG	0.637																																					p.C96Y		.											.	ETFB	90	0			c.G287A						.						61.0	57.0	58.0					19																	51857606		2203	4300	6503	SO:0001627	intron_variant	2109	exon1			AACAGGCAAGAAG	X71129	CCDS12828.1, CCDS33085.1	19q13.3-q13.4	2008-02-05				ENSG00000105379			3482	protein-coding gene	gene with protein product		130410					Standard	NM_001014763		Approved		uc002pwg.3	P38117		ENST00000309244.4:c.58-44G>A	19.37:g.51857606C>T		Somatic	99.0	1.0		WXS	Illumina HiSeq	Phase_I	42.0	18.0	NM_001014763	A8K766|B3KNY2|Q6IBH7|Q71RF6|Q9Y3S7	Missense_Mutation	SNP	ENST00000309244.4	37	CCDS12828.1	.	.	.	.	.	.	.	.	.	.	c	10.86	1.470772	0.26423	.	.	ENSG00000105379	ENST00000354232	D	0.83673	-1.75	3.33	-5.37	0.02681	.	.	.	.	.	T	0.63861	0.2547	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47381	-0.9122	7	.	.	.	.	5.7882	0.18345	0.0:0.3292:0.4579:0.2129	.	96	P38117-2	.	Y	96	ENSP00000346173:C96Y	.	C	-	2	0	ETFB	56549418	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	0.115000	0.15540	-0.983000	0.03511	0.651000	0.88453	TGC	.		0.637	ETFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464273.1		
FAM192A	80011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	57197926	57197926	+	Missense_Mutation	SNP	A	A	T	rs372644692		TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr16:57197926A>T	ENST00000309137.8	-	6	792	c.534T>A	c.(532-534)gaT>gaA	p.D178E	FAM192A_ENST00000389447.5_Missense_Mutation_p.D178E|FAM192A_ENST00000569266.1_Missense_Mutation_p.D178E|FAM192A_ENST00000564108.1_Missense_Mutation_p.D178E|FAM192A_ENST00000567439.1_Missense_Mutation_p.D178E|FAM192A_ENST00000566077.1_Missense_Mutation_p.D101E	NM_024946.2	NP_079222.1	Q9GZU8	F192A_HUMAN	family with sequence similarity 192, member A	178						nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|lung(4)|prostate(2)	11						GATTCTTGTCATCTGGCTCAG	0.453																																					p.D178E		.											.	FAM192A	90	0			c.T534A						.						318.0	308.0	311.0					16																	57197926		1969	4157	6126	SO:0001583	missense	80011	exon6			CTTGTCATCTGGC		CCDS42168.1	16q13	2009-08-19	2009-08-19	2009-08-19		ENSG00000172775			29856	protein-coding gene	gene with protein product	"""NEFA interacting nuclear protein NIP30"""		"""chromosome 16 open reading frame 94"""	C16orf94		12477932	Standard	NM_024946		Approved	NIP30	uc021tiy.1	Q9GZU8		ENST00000309137.8:c.534T>A	16.37:g.57197926A>T	ENSP00000335808:p.Asp178Glu	Somatic	228.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	67.0	NM_024946		Missense_Mutation	SNP	ENST00000309137.8	37	CCDS42168.1	.	.	.	.	.	.	.	.	.	.	A	7.186	0.590538	0.13812	.	.	ENSG00000172775	ENST00000309137;ENST00000389447	.	.	.	5.97	2.4	0.29515	.	0.563671	0.22381	N	0.060812	T	0.19046	0.0457	N	0.22421	0.69	0.31940	N	0.611055	B	0.02656	0.0	B	0.04013	0.001	T	0.31447	-0.9943	9	0.02654	T	1	-6.0501	2.6359	0.04957	0.4589:0.1217:0.0672:0.3522	.	178	Q9GZU8	F192A_HUMAN	E	178	.	ENSP00000335808:D178E	D	-	3	2	FAM192A	55755427	0.954000	0.32549	1.000000	0.80357	0.970000	0.65996	0.023000	0.13533	0.116000	0.18110	0.477000	0.44152	GAT	.		0.453	FAM192A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433022.2	NM_024946	
FAM46D	169966	ucsc.edu;bcgsc.ca	37	X	79698052	79698052	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chrX:79698052G>A	ENST00000308293.5	+	3	253	c.14G>A	c.(13-15)aGa>aAa	p.R5K	FAM46D_ENST00000538312.1_Missense_Mutation_p.R5K	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	5										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						TCTGAAATCAGATTCACCAAT	0.363																																					p.R5K		.											.	FAM46D	130	0			c.G14A						.						54.0	42.0	46.0					X																	79698052		2203	4299	6502	SO:0001583	missense	169966	exon5			AAATCAGATTCAC	BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.14G>A	X.37:g.79698052G>A	ENSP00000308575:p.Arg5Lys	Somatic	203.0	2.0		WXS	Illumina HiSeq	.	238.0	212.0	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	37	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271002	0.59540	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.26223	1.75;1.75	4.58	4.58	0.56647	.	0.126247	0.52532	D	0.000072	T	0.50017	0.1591	M	0.74647	2.275	0.48830	D	0.999716	D	0.64830	0.994	D	0.70716	0.97	T	0.52388	-0.8582	10	0.49607	T	0.09	-1.2424	15.0928	0.72207	0.0:0.0:1.0:0.0	.	5	Q8NEK8	FA46D_HUMAN	K	5	ENSP00000443410:R5K;ENSP00000308575:R5K	ENSP00000308575:R5K	R	+	2	0	FAM46D	79584708	1.000000	0.71417	0.983000	0.44433	0.781000	0.44180	6.756000	0.74919	2.113000	0.64589	0.544000	0.68410	AGA	.		0.363	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
FAM76B	143684	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	95522613	95522613	+	Silent	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr11:95522613G>T	ENST00000358780.5	-	1	342	c.30C>A	c.(28-30)acC>acA	p.T10T	CEP57_ENST00000325542.5_5'Flank|CEP57_ENST00000538658.1_5'Flank|CEP57_ENST00000325486.5_5'Flank|FAM76B_ENST00000536839.1_Silent_p.T10T|CEP57_ENST00000537677.1_5'Flank|FAM76B_ENST00000538047.1_5'Flank	NM_144664.4	NP_653265.3	Q5HYJ3	FA76B_HUMAN	family with sequence similarity 76, member B	10						nuclear membrane (GO:0031965)|nucleus (GO:0005634)				breast(1)|kidney(1)|lung(1)	3		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GGGTACACTTGGTGCAGGCGT	0.711																																					p.T10T		.											.	FAM76B	90	0			c.C30A						.						21.0	29.0	27.0					11																	95522613		1959	4176	6135	SO:0001819	synonymous_variant	143684	exon1			ACACTTGGTGCAG		CCDS41700.1	11q21	2008-02-05			ENSG00000077458	ENSG00000077458			28492	protein-coding gene	gene with protein product						12477932	Standard	NM_144664		Approved	MGC33371	uc001pfn.2	Q5HYJ3	OTTHUMG00000167739	ENST00000358780.5:c.30C>A	11.37:g.95522613G>T		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	28.0	NM_144664	Q6PIU3|Q8TC53	Silent	SNP	ENST00000358780.5	37	CCDS41700.1																																																																																			.		0.711	FAM76B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395969.1	NM_144664	
FAT2	2196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150911280	150911280	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr5:150911280C>A	ENST00000261800.5	-	13	9691	c.9679G>T	c.(9679-9681)Gtg>Ttg	p.V3227L		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3227	Cadherin 29. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCTCGGGCACCTGCACGCTG	0.677																																					p.V3227L		.											.	FAT2	96	0			c.G9679T						.						54.0	44.0	47.0					5																	150911280		2203	4300	6503	SO:0001583	missense	2196	exon13			CGGGCACCTGCAC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9679G>T	5.37:g.150911280C>A	ENSP00000261800:p.Val3227Leu	Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	9.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.42|15.42	2.826902|2.826902	0.50739|0.50739	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000520200|ENST00000261800	.|T	.|0.55234	.|0.53	5.23|5.23	5.23|5.23	0.72850|0.72850	.|Cadherin (3);Cadherin-like (1);	.|0.000000	.|0.52532	.|D	.|0.000072	T|T	0.50990|0.50990	0.1648|0.1648	L|L	0.43757|0.43757	1.38|1.38	0.39135|0.39135	D|D	0.961928|0.961928	.|B	.|0.31040	.|0.305	.|B	.|0.37692	.|0.256	T|T	0.57033|0.57033	-0.7880|-0.7880	5|10	.|0.59425	.|D	.|0.04	.|.	14.4286|14.4286	0.67233|0.67233	0.0:0.8528:0.1472:0.0|0.0:0.8528:0.1472:0.0	.|.	.|3227	.|Q9NYQ8	.|FAT2_HUMAN	V|L	85|3227	.|ENSP00000261800:V3227L	.|ENSP00000261800:V3227L	G|V	-|-	2|1	0|0	FAT2|FAT2	150891473|150891473	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.807000|0.807000	0.45602|0.45602	1.983000|1.983000	0.40648|0.40648	2.444000|2.444000	0.82710|0.82710	0.555000|0.555000	0.69702|0.69702	GGT|GTG	.		0.677	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
GAL	51083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	68458398	68458398	+	Silent	SNP	C	C	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr11:68458398C>G	ENST00000265643.3	+	6	573	c.315C>G	c.(313-315)ctC>ctG	p.L105L		NM_015973.3	NP_057057.2	P22466	GALA_HUMAN	galanin/GMAP prepropeptide	105					cAMP-mediated signaling (GO:0019933)|feeding behavior (GO:0007631)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of root hair elongation (GO:1902891)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catagen (GO:0051795)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of large conductance calcium-activated potassium channel activity (GO:1902608)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein kinase A signaling (GO:0010737)|regulation of glucocorticoid metabolic process (GO:0031943)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to insulin (GO:0032868)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|secretory granule (GO:0030141)	neuropeptide hormone activity (GO:0005184)|type 1 galanin receptor binding (GO:0031764)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			lung(4)	4	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		CCGGTGCCCTCGACCGCCTCC	0.562																																					p.L105L		.											.	GAL	90	0			c.C315G						.						50.0	52.0	51.0					11																	68458398		2200	4294	6494	SO:0001819	synonymous_variant	51083	exon6			TGCCCTCGACCGC	L11144	CCDS8183.1	11q13.2	2013-02-26	2012-10-23		ENSG00000069482	ENSG00000069482		"""Endogenous ligands"""	4114	protein-coding gene	gene with protein product	"""galanin-message-associated peptide"", ""galanin/GMAP prepropeptide"""	137035	"""galanin"", ""galanin prepropeptide"""	GALN		7508413	Standard	XM_006718580		Approved	GMAP, GAL-GMAP, GLNN	uc001oob.3	P22466	OTTHUMG00000167890	ENST00000265643.3:c.315C>G	11.37:g.68458398C>G		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	19.0	NM_015973	Q14413	Silent	SNP	ENST00000265643.3	37	CCDS8183.1																																																																																			.		0.562	GAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396843.2	NM_001479	
GLTSCR1L	23506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42832697	42832697	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr6:42832697C>A	ENST00000314073.5	+	13	2929	c.2753C>A	c.(2752-2754)tCt>tAt	p.S918Y	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.S918Y			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	918																	CAGAGCACGTCTGAAGAGAAG	0.522																																					p.S918Y		.											.	.	.	0			c.C2753A						.						46.0	47.0	47.0					6																	42832697		2203	4300	6503	SO:0001583	missense	23506	exon12			GCACGTCTGAAGA	AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.2753C>A	6.37:g.42832697C>A	ENSP00000313933:p.Ser918Tyr	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	32.0	NM_015349	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	37	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723163	0.30503	.	.	ENSG00000112624	ENST00000394167;ENST00000314073;ENST00000394168	T;T	0.48201	0.82;0.82	5.34	3.47	0.39725	.	0.575197	0.17896	N	0.158371	T	0.19327	0.0464	L	0.27053	0.805	0.09310	N	1	P	0.42620	0.785	B	0.44224	0.444	T	0.04650	-1.0936	10	0.72032	D	0.01	-0.0271	6.0454	0.19758	0.1417:0.6502:0.1364:0.0716	.	918	Q6AI39	K0240_HUMAN	Y	918	ENSP00000313933:S918Y;ENSP00000377723:S918Y	ENSP00000313933:S918Y	S	+	2	0	KIAA0240	42940675	0.005000	0.15991	0.004000	0.12327	0.895000	0.52256	1.501000	0.35693	0.662000	0.31006	0.650000	0.86243	TCT	.		0.522	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349	
GLYATL2	219970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58607044	58607044	+	Silent	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr11:58607044A>G	ENST00000287275.1	-	2	432	c.42T>C	c.(40-42)taT>taC	p.Y14Y	GLYATL2_ENST00000532258.1_Silent_p.Y14Y|GLYATL2_ENST00000533636.1_Intron	NM_145016.3	NP_659453.3	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	14						endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	CTAAGGATTTATACAGAATCT	0.413																																					p.Y14Y		.											.	GLYATL2	92	0			c.T42C						.						137.0	125.0	129.0					11																	58607044		1865	4102	5967	SO:0001819	synonymous_variant	219970	exon2			GGATTTATACAGA	AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000287275.1:c.42T>C	11.37:g.58607044A>G		Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	38.0	NM_145016	A5LGC7|Q86WC3|Q96AT2	Silent	SNP	ENST00000287275.1	37	CCDS41649.1																																																																																			.		0.413	GLYATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394599.1	NM_145016	
GPR148	344561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	131486786	131486786	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr2:131486786T>A	ENST00000309926.4	+	1	144	c.62T>A	c.(61-63)cTc>cAc	p.L21H		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					CTGATCCAGCTCATCAGCAAG	0.607																																					p.L21H		.											.	GPR148	91	0			c.T62A						.						99.0	97.0	98.0					2																	131486786		2203	4300	6503	SO:0001583	missense	344561	exon1			TCCAGCTCATCAG	AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.62T>A	2.37:g.131486786T>A	ENSP00000308908:p.Leu21His	Somatic	377.0	0.0		WXS	Illumina HiSeq	Phase_I	317.0	110.0	NM_207364	Q2M369|Q86SP7|Q86U87	Missense_Mutation	SNP	ENST00000309926.4	37	CCDS2163.1	.	.	.	.	.	.	.	.	.	.	.	12.47	1.948813	0.34377	.	.	ENSG00000173302	ENST00000309926	T	0.10288	2.89	2.41	-3.59	0.04583	.	1.579220	0.05003	U	0.469570	T	0.04952	0.0133	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.39251	-0.9623	10	0.56958	D	0.05	1.2623	2.5666	0.04784	0.4262:0.2879:0.0:0.2859	.	21	Q8TDV2	GP148_HUMAN	H	21	ENSP00000308908:L21H	ENSP00000308908:L21H	L	+	2	0	GPR148	131203256	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.112000	0.10791	-0.875000	0.04022	0.379000	0.24179	CTC	.		0.607	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254552.3	XM_293092	
GRXCR1	389207	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	42965023	42965023	+	Missense_Mutation	SNP	C	C	A	rs192948915	byFrequency	TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr4:42965023C>A	ENST00000399770.2	+	2	499	c.499C>A	c.(499-501)Cgc>Agc	p.R167S		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	167	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						CCAAAACCATCGCGTAAAATT	0.428																																					p.R167S		.											.	GRXCR1	23	0			c.C499A						.						199.0	198.0	199.0					4																	42965023		1864	4096	5960	SO:0001583	missense	389207	exon2			AACCATCGCGTAA		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.499C>A	4.37:g.42965023C>A	ENSP00000382670:p.Arg167Ser	Somatic	133.0	2.0		WXS	Illumina HiSeq	Phase_I	90.0	44.0	NM_001080476		Missense_Mutation	SNP	ENST00000399770.2	37	CCDS43225.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.335357	0.60853	.	.	ENSG00000215203	ENST00000399770	T	0.29655	1.56	5.96	5.12	0.69794	Glutaredoxin (2);Thioredoxin-like fold (2);	0.000000	0.64402	U	0.000006	T	0.49729	0.1574	M	0.72576	2.205	0.54753	D	0.99998	D	0.89917	1.0	D	0.91635	0.999	T	0.50725	-0.8794	10	0.09084	T	0.74	-6.8777	13.0018	0.58681	0.4058:0.5942:0.0:0.0	.	167	A8MXD5	GRCR1_HUMAN	S	167	ENSP00000382670:R167S	ENSP00000382670:R167S	R	+	1	0	GRXCR1	42659780	1.000000	0.71417	0.966000	0.40874	0.713000	0.41058	5.172000	0.65003	1.516000	0.48900	-0.169000	0.13324	CGC	C|0.999;T|0.000		0.428	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
HEATR5B	54497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37256043	37256043	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr2:37256043C>T	ENST00000233099.5	-	23	3477	c.3382G>A	c.(3382-3384)Ggg>Agg	p.G1128R	HEATR5B_ENST00000354531.2_Missense_Mutation_p.G1128R	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1128						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				GAACTAACCCCAGGGGCAAAA	0.403																																					p.G1128R		.											.	HEATR5B	142	0			c.G3382A						.						67.0	71.0	69.0					2																	37256043		2203	4300	6503	SO:0001583	missense	54497	exon23			TAACCCCAGGGGC	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.3382G>A	2.37:g.37256043C>T	ENSP00000233099:p.Gly1128Arg	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	53.0	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469107	0.26423	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.42900	0.96;0.96	4.78	4.78	0.61160	Armadillo-like helical (1);Armadillo-type fold (1);	0.135912	0.32120	N	0.006556	T	0.42675	0.1213	N	0.08118	0	0.44976	D	0.997994	D	0.89917	1.0	D	0.87578	0.998	T	0.39099	-0.9630	10	0.18276	T	0.48	-10.3609	15.9995	0.80280	0.0:1.0:0.0:0.0	.	1128	Q9P2D3	HTR5B_HUMAN	R	1128	ENSP00000233099:G1128R;ENSP00000346531:G1128R	ENSP00000233099:G1128R	G	-	1	0	HEATR5B	37109547	0.992000	0.36948	0.997000	0.53966	0.123000	0.20343	5.038000	0.64177	2.191000	0.70037	0.655000	0.94253	GGG	.		0.403	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
HDAC4	9759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	240056082	240056082	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr2:240056082G>A	ENST00000345617.3	-	11	1944	c.1153C>T	c.(1153-1155)Ctc>Ttc	p.L385F	HDAC4_ENST00000543185.1_5'UTR|HDAC4_ENST00000541256.1_Missense_Mutation_p.L354F|HDAC4_ENST00000553145.1_5'UTR	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	385					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		AAAAGGGAGAGCCTCTGCTGG	0.672																																					p.L385F		.											.	HDAC4	291	0			c.C1153T						.						48.0	35.0	39.0					2																	240056082		2203	4300	6503	SO:0001583	missense	9759	exon11			GGGAGAGCCTCTG	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.1153C>T	2.37:g.240056082G>A	ENSP00000264606:p.Leu385Phe	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	11.0	NM_006037	Q9UND6	Missense_Mutation	SNP	ENST00000345617.3	37	CCDS2529.1	.	.	.	.	.	.	.	.	.	.	G	6.898	0.535144	0.13188	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000541256;ENST00000393621	T;T	0.59364	0.27;1.42	4.32	-1.48	0.08745	.	0.278425	0.39341	N	0.001399	T	0.46889	0.1416	L	0.50333	1.59	0.80722	D	1	B;P;B;P;B;P	0.39717	0.314;0.624;0.011;0.56;0.215;0.684	B;B;B;B;B;B	0.35470	0.098;0.203;0.02;0.19;0.043;0.1	T	0.45071	-0.9286	9	.	.	.	.	16.0252	0.80538	0.0:0.0:0.6934:0.3066	.	380;268;354;354;353;385	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	F	385;268;354;268	ENSP00000264606:L385F;ENSP00000443057:L354F	.	L	-	1	0	HDAC4	239721019	0.000000	0.05858	0.729000	0.30791	0.164000	0.22412	-1.220000	0.02971	-0.336000	0.08438	-0.397000	0.06425	CTC	.		0.672	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037	
HERC2	8924	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	28491165	28491165	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr15:28491165T>C	ENST00000261609.7	-	23	3547	c.3439A>G	c.(3439-3441)Aaa>Gaa	p.K1147E		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCAGCATTTTTACTGAGCAGA	0.413																																					p.K1147E		.											.	HERC2	234	0			c.A3439G						.						92.0	83.0	86.0					15																	28491165		2203	4300	6503	SO:0001583	missense	8924	exon23			CATTTTTACTGAG	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.3439A>G	15.37:g.28491165T>C	ENSP00000261609:p.Lys1147Glu	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	46.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.261445	0.23051	.	.	ENSG00000128731	ENST00000261609	T	0.38401	1.14	5.61	5.61	0.85477	.	0.055128	0.85682	D	0.000000	T	0.24547	0.0595	N	0.19112	0.55	0.39329	D	0.965383	B	0.09022	0.002	B	0.06405	0.002	T	0.10543	-1.0625	10	0.12103	T	0.63	.	16.1042	0.81209	0.0:0.0:0.0:1.0	.	1147	O95714	HERC2_HUMAN	E	1147	ENSP00000261609:K1147E	ENSP00000261609:K1147E	K	-	1	0	HERC2	26164760	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.929000	0.63455	2.270000	0.75569	0.528000	0.53228	AAA	.		0.413	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HTRA4	203100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	38831805	38831805	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:38831805C>T	ENST00000302495.4	+	1	123	c.23C>T	c.(22-24)aCc>aTc	p.T8I	CTD-2544N14.3_ENST00000520863.1_RNA	NM_153692.3	NP_710159.1	P83105	HTRA4_HUMAN	HtrA serine peptidase 4	8					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	11		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			CAGCTGCGGACCGCGGGGCTG	0.607																																					p.T8I		.											.	HTRA4	90	0			c.C23T						.						30.0	26.0	27.0					8																	38831805		2198	4295	6493	SO:0001583	missense	203100	exon1			TGCGGACCGCGGG	AK075205	CCDS6110.1	8p11.23	2008-02-05			ENSG00000169495	ENSG00000169495			26909	protein-coding gene	gene with protein product		610700					Standard	NM_153692		Approved	FLJ90724	uc003xmj.3	P83105	OTTHUMG00000164070	ENST00000302495.4:c.23C>T	8.37:g.38831805C>T	ENSP00000305919:p.Thr8Ile	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	32.0	NM_153692	Q542Z4|Q6PF13	Missense_Mutation	SNP	ENST00000302495.4	37	CCDS6110.1	.	.	.	.	.	.	.	.	.	.	C	9.892	1.204503	0.22205	.	.	ENSG00000169495	ENST00000302495	D	0.84442	-1.85	4.02	-3.04	0.05412	.	0.951484	0.08588	N	0.923523	T	0.65575	0.2704	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.52852	-0.8520	10	0.72032	D	0.01	5.2858	2.5787	0.04813	0.1354:0.2529:0.4229:0.1888	.	8	P83105	HTRA4_HUMAN	I	8	ENSP00000305919:T8I	ENSP00000305919:T8I	T	+	2	0	HTRA4	38950962	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.691000	0.05133	-0.520000	0.06435	-0.127000	0.14921	ACC	.		0.607	HTRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377077.1	NM_153692	
HYDIN	54768	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	70896085	70896085	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr16:70896085G>C	ENST00000393567.2	-	69	11793	c.11643C>G	c.(11641-11643)caC>caG	p.H3881Q		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3881					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCTCGGCCCAGTGGTCCATGG	0.562																																					p.H3881Q		.											.	HYDIN	92	0			c.C11643G						.						38.0	40.0	40.0					16																	70896085		1946	4152	6098	SO:0001583	missense	54768	exon69			GGCCCAGTGGTCC	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11643C>G	16.37:g.70896085G>C	ENSP00000377197:p.His3881Gln	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	40.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.763038	0.31228	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00840	5.63	5.97	1.36	0.22044	.	.	.	.	.	T	0.01029	0.0034	L	0.38531	1.155	0.25303	N	0.989268	B	0.27823	0.19	B	0.35550	0.205	T	0.47471	-0.9115	9	0.16420	T	0.52	.	5.3162	0.15856	0.1676:0.0:0.5455:0.2869	.	3880	F8WD23	.	Q	3881;3880	ENSP00000377197:H3881Q	ENSP00000313052:H3880Q	H	-	3	2	HYDIN	69453586	0.933000	0.31639	0.994000	0.49952	0.034000	0.12701	1.479000	0.35453	0.847000	0.35167	0.511000	0.50034	CAC	.		0.562	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
IL1RAPL2	26280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	105011411	105011411	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chrX:105011411C>A	ENST00000372582.1	+	11	2574	c.1818C>A	c.(1816-1818)ttC>ttA	p.F606L	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.F606L	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	606			F -> L (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.F606L(2)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TCCCTGAATTCCACCCTTCAG	0.478																																					p.F606L		.											IL1RAPL2,NS,carcinoma,0	IL1RAPL2	194	2	Substitution - Missense(2)	breast(2)	c.C1818A						.						105.0	92.0	97.0					X																	105011411		2203	4300	6503	SO:0001583	missense	26280	exon11			TGAATTCCACCCT	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1818C>A	X.37:g.105011411C>A	ENSP00000361663:p.Phe606Leu	Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	260.0	225.0	NM_017416	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	37	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	C	11.49	1.653126	0.29425	.	.	ENSG00000189108	ENST00000372582;ENST00000344799;ENST00000538500	T;T;T	0.04194	3.96;3.96;3.68	5.89	5.02	0.67125	.	0.419105	0.25380	N	0.031098	T	0.05686	0.0149	L	0.47716	1.5	0.47123	D	0.999328	B	0.02656	0.0	B	0.04013	0.001	T	0.35101	-0.9802	10	0.17369	T	0.5	.	12.5146	0.56026	0.0:0.9191:0.0:0.0809	.	606	Q9NP60	IRPL2_HUMAN	L	606;606;211	ENSP00000361663:F606L;ENSP00000344976:F606L;ENSP00000445576:F211L	ENSP00000344976:F606L	F	+	3	2	IL1RAPL2	104898067	1.000000	0.71417	1.000000	0.80357	0.295000	0.27426	3.029000	0.49712	2.492000	0.84095	0.597000	0.82753	TTC	.		0.478	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
INSL6	11172	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	5164195	5164195	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr9:5164195C>A	ENST00000381641.3	-	2	425	c.360G>T	c.(358-360)aaG>aaT	p.K120N	INSL6_ENST00000510407.1_5'UTR	NM_007179.2	NP_009110.2	Q9Y581	INSL6_HUMAN	insulin-like 6	120					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(2)	15	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		GTGAATATCCCTTTTTATCCT	0.348																																					p.K120N		.											.	INSL6	90	0			c.G360T						.						89.0	89.0	89.0					9																	5164195		2203	4298	6501	SO:0001583	missense	11172	exon2			ATATCCCTTTTTA	AF156094	CCDS6458.1	9p24	2008-07-21			ENSG00000120210	ENSG00000120210			6089	protein-coding gene	gene with protein product	"""relaxin/insulin-like factor 1"""	606414				10819760	Standard	NM_007179		Approved	RIF1	uc003zix.3	Q9Y581	OTTHUMG00000019489	ENST00000381641.3:c.360G>T	9.37:g.5164195C>A	ENSP00000371054:p.Lys120Asn	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	13.0	NM_007179	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000381641.3	37	CCDS6458.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132240	0.37630	.	.	ENSG00000120210	ENST00000381641	T	0.59502	0.26	4.2	1.33	0.21861	Insulin-like (3);	0.831249	0.10888	N	0.623067	T	0.64371	0.2592	L	0.50333	1.59	0.09310	N	1	D	0.63046	0.992	D	0.63283	0.913	T	0.51513	-0.8696	10	0.72032	D	0.01	-8.6385	6.5047	0.22188	0.0:0.6929:0.0:0.3071	.	120	Q9Y581	INSL6_HUMAN	N	120	ENSP00000371054:K120N	ENSP00000371054:K120N	K	-	3	2	INSL6	5154195	0.053000	0.20554	0.002000	0.10522	0.026000	0.11368	0.904000	0.28491	0.308000	0.22923	0.591000	0.81541	AAG	.		0.348	INSL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051608.3	NM_007179	
INTS8	55656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	95892419	95892419	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:95892419G>A	ENST00000523731.1	+	27	3078	c.2945G>A	c.(2944-2946)aGg>aAg	p.R982K	CCNE2_ENST00000520509.1_3'UTR|INTS8_ENST00000447247.1_Missense_Mutation_p.R965K	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	982					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					GCGCAGAGAAGGAAAAAAAAG	0.338																																					p.R982K		.											.	INTS8	90	0			c.G2945A						.						78.0	78.0	78.0					8																	95892419		2203	4300	6503	SO:0001583	missense	55656	exon27			AGAGAAGGAAAAA	AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.2945G>A	8.37:g.95892419G>A	ENSP00000430338:p.Arg982Lys	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	38.0	NM_017864	B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	ENST00000523731.1	37	CCDS34925.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.8|27.8	4.868439|4.868439	0.91587|0.91587	.|.	.|.	ENSG00000164941|ENSG00000164941	ENST00000520526|ENST00000523731;ENST00000447247	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79269|0.79269	0.4417|0.4417	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	.|D	.|0.61697	.|0.99	.|D	.|0.72982	.|0.979	T|T	0.79764|0.79764	-0.1666|-0.1666	5|9	.|0.87932	.|D	.|0	-16.7756|-16.7756	20.1241|20.1241	0.97973|0.97973	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|982	.|Q75QN2	.|INT8_HUMAN	R|K	787|982;965	.|.	.|ENSP00000398203:R965K	G|R	+|+	1|2	0|0	INTS8|INTS8	95961595|95961595	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.184000|9.184000	0.94893|0.94893	2.760000|2.760000	0.94817|0.94817	0.651000|0.651000	0.88453|0.88453	GGA|AGG	.		0.338	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864	
IPO13	9670	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	44424562	44424562	+	Splice_Site	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:44424562G>A	ENST00000372343.3	+	11	2690		c.e11+1			NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13						protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				ACCCAACCCCGTGGGTGACAT	0.532																																					.		.											.	IPO13	226	0			c.2028+1G>A						.						62.0	59.0	60.0					1																	44424562		2203	4300	6503	SO:0001630	splice_region_variant	9670	exon11			AACCCCGTGGGTG	AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.2028+1G>A	1.37:g.44424562G>A		Somatic	192.0	2.0		WXS	Illumina HiSeq	.	130.0	45.0	NM_014652	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Splice_Site	SNP	ENST00000372343.3	37	CCDS503.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887681	0.91814	.	.	ENSG00000117408	ENST00000372343	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.743	0.96238	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IPO13	44197149	1.000000	0.71417	0.968000	0.41197	0.994000	0.84299	7.399000	0.79935	2.667000	0.90743	0.650000	0.86243	.	.		0.532	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022846.1	NM_014652	Intron
ITSN1	6453	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	35166772	35166772	+	Splice_Site	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr21:35166772G>T	ENST00000381318.3	+	17	2240	c.1952G>T	c.(1951-1953)aGa>aTa	p.R651I	AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399338.4_Splice_Site_p.R651I|ITSN1_ENST00000437442.2_Splice_Site_p.R651I|ITSN1_ENST00000399367.3_Splice_Site_p.R651I|ITSN1_ENST00000381285.4_Splice_Site_p.R651I|ITSN1_ENST00000399326.3_Splice_Site_p.R651I|ITSN1_ENST00000379960.5_Splice_Site_p.R651I|ITSN1_ENST00000399352.1_Splice_Site_p.R651I|ITSN1_ENST00000381291.4_Splice_Site_p.R651I|ITSN1_ENST00000399349.1_Splice_Site_p.R651I|ITSN1_ENST00000399353.1_Splice_Site_p.R614I|ITSN1_ENST00000399355.2_Splice_Site_p.R651I	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	651	KLERQ.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						GAAGCCCAAAGGTGAGTCTTC	0.408																																					p.R651I		.											.	ITSN1	94	0			c.G1952T						.						74.0	81.0	79.0					21																	35166772		2203	4300	6503	SO:0001630	splice_region_variant	6453	exon17			CCCAAAGGTGAGT	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.1952+1G>T	21.37:g.35166772G>T		Somatic	178.0	1.0		WXS	Illumina HiSeq	Phase_I	134.0	46.0	NM_001001132	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792271	0.90453	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	T;T;T;T;T;T;T;T;T;T;T;T	0.29397	2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51;1.57;2.51;2.51;1.57	5.46	5.46	0.80206	.	0.276343	0.41712	D	0.000828	T	0.53594	0.1806	L	0.54323	1.7	0.80722	D	1	P;D;D;D;D;D;D;D;D;D	0.69078	0.539;0.996;0.99;0.994;0.994;0.995;0.997;0.994;0.988;0.997	B;D;D;P;D;D;P;P;P;D	0.75484	0.132;0.926;0.944;0.854;0.975;0.986;0.759;0.759;0.824;0.931	T	0.54384	-0.8302	10	0.87932	D	0	.	19.3109	0.94187	0.0:0.0:1.0:0.0	.	614;614;614;651;651;651;651;651;651;614	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	I	614;651;651;651;651;651;651;651;651;651;651;651;651;651	ENSP00000382290:R614I;ENSP00000370719:R651I;ENSP00000370691:R651I;ENSP00000370685:R651I;ENSP00000382301:R651I;ENSP00000382289:R651I;ENSP00000382292:R651I;ENSP00000382286:R651I;ENSP00000382275:R651I;ENSP00000387377:R651I;ENSP00000382265:R651I;ENSP00000369294:R651I	ENSP00000369294:R651I	R	+	2	0	ITSN1	34088642	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.728000	0.74769	2.555000	0.86185	0.591000	0.81541	AGA	.		0.408	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	Missense_Mutation
KDM7A	80853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139824552	139824552	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr7:139824552G>A	ENST00000397560.2	-	7	1017	c.920C>T	c.(919-921)aCa>aTa	p.T307I	JHDM1D_ENST00000006967.5_Missense_Mutation_p.T307I	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		307	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					ATTTTCATCTGTTGGCTTTAT	0.353																																					p.T307I		.											.	JHDM1D	91	0			c.C920T						.						72.0	65.0	67.0					7																	139824552		1829	4080	5909	SO:0001583	missense	80853	exon7			TCATCTGTTGGCT																												ENST00000397560.2:c.920C>T	7.37:g.139824552G>A	ENSP00000380692:p.Thr307Ile	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	20.0	NM_030647	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Missense_Mutation	SNP	ENST00000397560.2	37	CCDS43658.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808622	0.90707	.	.	ENSG00000006459	ENST00000397560;ENST00000006967	T;T	0.72505	-0.66;-0.66	5.49	5.49	0.81192	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.091347	0.85682	D	0.000000	D	0.88481	0.6448	M	0.93678	3.445	0.80722	D	1	D	0.71674	0.998	D	0.68765	0.96	D	0.90913	0.4777	10	0.87932	D	0	-11.0674	19.7073	0.96079	0.0:0.0:1.0:0.0	.	307	Q6ZMT4	KDM7_HUMAN	I	307	ENSP00000380692:T307I;ENSP00000006967:T307I	ENSP00000006967:T307I	T	-	2	0	JHDM1D	139471021	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.813000	0.99286	2.728000	0.93425	0.655000	0.94253	ACA	.		0.353	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1		
JPH2	57158	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	42788302	42788302	+	Silent	SNP	G	G	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr20:42788302G>C	ENST00000372980.3	-	2	1997	c.1125C>G	c.(1123-1125)cgC>cgG	p.R375R		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	375	Ala-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TAGCAGCGGCGCGCTGGGCAC	0.667																																					p.R375R		.											.	JPH2	91	0			c.C1125G						.						35.0	31.0	33.0					20																	42788302		2202	4300	6502	SO:0001819	synonymous_variant	57158	exon2			AGCGGCGCGCTGG	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.1125C>G	20.37:g.42788302G>C		Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	4.0	NM_020433	E1P5X1|O95913|Q5JY74|Q9UJN4	Silent	SNP	ENST00000372980.3	37	CCDS13325.1																																																																																			.		0.667	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1		
KCNB2	9312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	73480055	73480055	+	Frame_Shift_Del	DEL	G	G	-	rs561571977	byFrequency	TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:73480055delG	ENST00000523207.1	+	2	674	c.86delG	c.(85-87)cggfs	p.R29fs		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	29					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GACATTATCCGGAGCAAAACA	0.552																																					p.R29fs		.											.	KCNB2	158	0			c.86delG						.						81.0	81.0	81.0					8																	73480055		2203	4300	6503	SO:0001589	frameshift_variant	9312	exon2			TTATCCGGAGCAA	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.86delG	8.37:g.73480055delG	ENSP00000430846:p.Arg29fs	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	85.0	NM_004770	Q7Z7D0|Q9BXD3	Frame_Shift_Del	DEL	ENST00000523207.1	37	CCDS6209.1																																																																																			.		0.552	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
KIF18A	81930	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	28116256	28116256	+	Silent	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr11:28116256G>A	ENST00000263181.6	-	3	707	c.417C>T	c.(415-417)caC>caT	p.H139H		NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	139	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						ATTTGTAAAGGTGTAACATTG	0.388																																					p.H139H		.											.	KIF18A	92	0			c.C417T						.						193.0	172.0	179.0					11																	28116256		2202	4299	6501	SO:0001819	synonymous_variant	81930	exon3			GTAAAGGTGTAAC	AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.417C>T	11.37:g.28116256G>A		Somatic	262.0	2.0		WXS	Illumina HiSeq	Phase_I	150.0	51.0	NM_031217	Q4VPE3|Q86VS5|Q9H0F3	Silent	SNP	ENST00000263181.6	37	CCDS7867.1																																																																																			.		0.388	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388328.3	NM_031217	
KLHL6	89857	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183217548	183217548	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr3:183217548C>A	ENST00000341319.3	-	4	1012	c.977G>T	c.(976-978)gGc>gTc	p.G326V		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	326					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CTTCGTGCAGCCGCCAATGAT	0.582																																					p.G326V		.											.	KLHL6	93	0			c.G977T						.						79.0	65.0	70.0					3																	183217548		2203	4300	6503	SO:0001583	missense	89857	exon4			GTGCAGCCGCCAA	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.977G>T	3.37:g.183217548C>A	ENSP00000341342:p.Gly326Val	Somatic	141.0	2.0		WXS	Illumina HiSeq	Phase_I	126.0	46.0	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083681	0.76642	.	.	ENSG00000172578	ENST00000341319	T	0.74947	-0.89	5.13	5.13	0.70059	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.88481	0.6448	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90307	0.4334	10	0.87932	D	0	.	18.9602	0.92674	0.0:1.0:0.0:0.0	.	326	Q8WZ60	KLHL6_HUMAN	V	326	ENSP00000341342:G326V	ENSP00000341342:G326V	G	-	2	0	KLHL6	184700242	1.000000	0.71417	0.998000	0.56505	0.566000	0.35808	7.445000	0.80570	2.561000	0.86390	0.561000	0.74099	GGC	.		0.582	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
L1CAM	3897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153129931	153129931	+	Splice_Site	SNP	T	T	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chrX:153129931T>C	ENST00000370060.1	-	25	3357	c.3168A>G	c.(3166-3168)gaA>gaG	p.E1056E	L1CAM_ENST00000370057.3_Splice_Site_p.E1056E|L1CAM_ENST00000370055.1_Splice_Site_p.E1051E|L1CAM_ENST00000361981.3_Splice_Site_p.E1051E|L1CAM_ENST00000543994.1_Splice_Site_p.E1058E|L1CAM_ENST00000538883.1_Splice_Site_p.E1058E|L1CAM_ENST00000361699.4_Splice_Site_p.E1056E	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1056	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCCTTCTCTTCTGCCAGGG	0.632																																					p.E1056E		.											.	L1CAM	138	0			c.A3168G						.						86.0	79.0	81.0					X																	153129931		2203	4300	6503	SO:0001630	splice_region_variant	3897	exon24			CTTCTCTTCTGCC	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3167-1A>G	X.37:g.153129931T>C		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	44.0	NM_000425	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	CCDS14733.1																																																																																			.		0.632	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	Silent
LBR	3930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225594411	225594411	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:225594411T>A	ENST00000338179.2	-	11	1563	c.1438A>T	c.(1438-1440)Aat>Tat	p.N480Y	LBR_ENST00000272163.4_Missense_Mutation_p.N480Y	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	480					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		GACACTTCATTTGGATGACTG	0.363																																					p.N480Y		.											.	LBR	228	0			c.A1438T						.						75.0	78.0	77.0					1																	225594411		2203	4300	6503	SO:0001583	missense	3930	exon11			CTTCATTTGGATG	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.1438A>T	1.37:g.225594411T>A	ENSP00000339883:p.Asn480Tyr	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	294.0	123.0	NM_194442	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	T	12.49	1.954808	0.34471	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000424022	D;D;D	0.97941	-4.62;-4.62;-4.62	5.21	2.92	0.33932	.	0.419880	0.29106	N	0.013133	D	0.94059	0.8096	N	0.25060	0.705	0.09310	N	1	P	0.34826	0.471	B	0.42738	0.396	D	0.86941	0.2079	10	0.16896	T	0.51	-11.6795	7.2851	0.26333	0.0:0.0757:0.3419:0.5824	.	480	Q14739	LBR_HUMAN	Y	480;480;111	ENSP00000272163:N480Y;ENSP00000339883:N480Y;ENSP00000397817:N111Y	ENSP00000272163:N480Y	N	-	1	0	LBR	223661034	0.007000	0.16637	0.503000	0.27626	0.959000	0.62525	1.208000	0.32345	0.417000	0.25871	0.533000	0.62120	AAT	.		0.363	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
LEF1	51176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	109084858	109084858	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr4:109084858C>T	ENST00000265165.1	-	3	935		c.e3-1		LEF1_ENST00000512172.1_Splice_Site|LEF1_ENST00000438313.2_Splice_Site|LEF1_ENST00000379951.2_Splice_Site|LEF1_ENST00000510624.1_Splice_Site	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1						alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		GGATGCTTTCCTGGGAAGATC	0.393																																					.		.											.	LEF1	721	0			c.281-1G>A						.						105.0	96.0	99.0					4																	109084858		2203	4300	6503	SO:0001630	splice_region_variant	51176	exon4			GCTTTCCTGGGAA		CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.281-1G>A	4.37:g.109084858C>T		Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	26.0	NM_016269	B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Splice_Site	SNP	ENST00000265165.1	37	CCDS3679.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812941	0.70912	.	.	ENSG00000138795	ENST00000265165;ENST00000379951;ENST00000438313;ENST00000510624;ENST00000515500;ENST00000512172	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1374	0.98035	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LEF1	109304307	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.667000	0.68067	2.763000	0.94921	0.563000	0.77884	.	.		0.393	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2		Intron
LNPEP	4012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	96342142	96342142	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr5:96342142A>G	ENST00000231368.5	+	11	2650	c.1958A>G	c.(1957-1959)cAt>cGt	p.H653R	LNPEP_ENST00000395770.3_Missense_Mutation_p.H639R	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	653					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		TACCTGTGGCATATTCCACTA	0.318																																					p.H653R		.											.	LNPEP	229	0			c.A1958G						.						56.0	57.0	57.0					5																	96342142		2202	4295	6497	SO:0001583	missense	4012	exon11			TGTGGCATATTCC	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.1958A>G	5.37:g.96342142A>G	ENSP00000231368:p.His653Arg	Somatic	228.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	59.0	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	37	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.564553	0.65651	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.01252	5.1;5.1	5.33	5.33	0.75918	.	0.293471	0.42053	D	0.000778	T	0.02807	0.0084	M	0.67953	2.075	0.45946	D	0.998776	B	0.27498	0.18	B	0.29942	0.109	T	0.42749	-0.9433	10	0.59425	D	0.04	.	11.6261	0.51147	0.8514:0.1485:0.0:0.0	.	653	Q9UIQ6	LCAP_HUMAN	R	653;639	ENSP00000231368:H653R;ENSP00000379117:H639R	ENSP00000231368:H653R	H	+	2	0	LNPEP	96367898	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.147000	0.71783	2.007000	0.58848	0.459000	0.35465	CAT	.		0.318	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
LTBP4	8425	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	41133674	41133674	+	Silent	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:41133674C>T	ENST00000308370.7	+	33	4629	c.4629C>T	c.(4627-4629)acC>acT	p.T1543T	LTBP4_ENST00000545697.1_3'UTR|LTBP4_ENST00000243562.9_3'UTR|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000204005.9_Silent_p.T1506T|LTBP4_ENST00000396819.3_Silent_p.T1476T	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1544	EGF-like 15. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACGGCTGCACCAACGGCCGCT	0.677																																					.		.											.	LTBP4	93	0			.						.						16.0	22.0	20.0					19																	41133674		2117	4242	6359	SO:0001819	synonymous_variant	8425	.			CTGCACCAACGGC	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.4629C>T	19.37:g.41133674C>T		Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	11.0	.	O00508|O75412|O75413	Silent	SNP	ENST00000308370.7	37																																																																																				.		0.677	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573	
LYAR	55646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	4283593	4283593	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr4:4283593T>C	ENST00000343470.4	-	4	394	c.154A>G	c.(154-156)Ata>Gta	p.I52V	LYAR_ENST00000452476.1_Missense_Mutation_p.I52V	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	52						nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCTTCACTTATGCATTTCACG	0.443																																					p.I52V		.											.	LYAR	90	0			c.A154G						.						364.0	323.0	337.0					4																	4283593		2203	4300	6503	SO:0001583	missense	55646	exon4			CACTTATGCATTT	AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.154A>G	4.37:g.4283593T>C	ENSP00000345917:p.Ile52Val	Somatic	214.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	82.0	NM_017816	D3DVS4|Q6FI78|Q9NYS1	Missense_Mutation	SNP	ENST00000343470.4	37	CCDS3374.1	.	.	.	.	.	.	.	.	.	.	T	11.05	1.523758	0.27299	.	.	ENSG00000145220	ENST00000343470;ENST00000452476;ENST00000513174	T;T	0.39406	1.08;1.08	4.16	2.97	0.34412	Zinc finger, C2H2, LYAR-type (1);	0.156511	0.56097	N	0.000030	T	0.36963	0.0986	L	0.52126	1.63	0.52501	D	0.999954	B	0.19817	0.039	B	0.33960	0.173	T	0.15178	-1.0446	10	0.39692	T	0.17	-14.6164	5.5538	0.17105	0.0:0.0971:0.1731:0.7298	.	52	Q9NX58	LYAR_HUMAN	V	52	ENSP00000345917:I52V;ENSP00000397367:I52V	ENSP00000345917:I52V	I	-	1	0	LYAR	4334494	1.000000	0.71417	0.993000	0.49108	0.599000	0.36880	0.916000	0.28651	0.574000	0.29417	0.172000	0.16884	ATA	.		0.443	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246800.2	NM_017816	
MAST1	22983	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12969450	12969450	+	Silent	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:12969450G>A	ENST00000251472.4	+	12	1302	c.1263G>A	c.(1261-1263)gtG>gtA	p.V421V	MAST1_ENST00000591495.1_Silent_p.V417V	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						AGGCCTTTGTGGAGCGCGATA	0.567																																					p.V421V		.											.	MAST1	523	0			c.G1263A						.						95.0	82.0	86.0					19																	12969450		2203	4300	6503	SO:0001819	synonymous_variant	22983	exon12			CTTTGTGGAGCGC	AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1263G>A	19.37:g.12969450G>A		Somatic	169.0	1.0		WXS	Illumina HiSeq	Phase_I	160.0	62.0	NM_014975		Silent	SNP	ENST00000251472.4	37	CCDS32921.1																																																																																			.		0.567	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975	
MCM4	4173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48874204	48874204	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:48874204G>A	ENST00000262105.2	+	2	408	c.199G>A	c.(199-201)Gtg>Atg	p.V67M	PRKDC_ENST00000523565.1_5'Flank|PRKDC_ENST00000314191.2_5'Flank|PRKDC_ENST00000338368.3_5'Flank|MCM4_ENST00000523944.1_Missense_Mutation_p.V67M	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	67					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				TGCGCAGGACGTGCTGTTTTC	0.567																																					p.V67M		.											.	MCM4	230	0			c.G199A						.						129.0	126.0	127.0					8																	48874204		2203	4300	6503	SO:0001583	missense	4173	exon3			CAGGACGTGCTGT		CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.199G>A	8.37:g.48874204G>A	ENSP00000262105:p.Val67Met	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	55.0	NM_182746	Q8NEH1|Q99658	Missense_Mutation	SNP	ENST00000262105.2	37	CCDS6143.1	.	.	.	.	.	.	.	.	.	.	G	8.912	0.958944	0.18507	.	.	ENSG00000104738	ENST00000518221;ENST00000523944;ENST00000262105;ENST00000396826;ENST00000519170	T;T	0.02916	4.11;4.11	5.55	-6.29	0.02013	.	0.919463	0.09520	N	0.791036	T	0.01627	0.0052	N	0.14661	0.345	0.18873	N	0.999986	B;B	0.30851	0.297;0.297	B;B	0.23574	0.047;0.047	T	0.42916	-0.9423	10	0.30078	T	0.28	-0.2015	10.4414	0.44469	0.2957:0.16:0.5443:0.0	.	67;67	B3KMX0;P33991	.;MCM4_HUMAN	M	67;67;67;67;17	ENSP00000430194:V67M;ENSP00000262105:V67M	ENSP00000262105:V67M	V	+	1	0	MCM4	49036757	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.054000	0.14205	-1.594000	0.01615	-1.020000	0.02445	GTG	.		0.567	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914	
MRAP2	112609	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	84798909	84798909	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr6:84798909C>G	ENST00000257776.4	+	4	462	c.327C>G	c.(325-327)aaC>aaG	p.N109K		NM_138409.2	NP_612418.2	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	109					energy homeostasis (GO:0097009)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|identical protein binding (GO:0042802)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)	p.N109K(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(4)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	19						GCCAAGGCAACGAGGAGTCCA	0.498																																					p.N109K		.											.	MRAP2	92	1	Substitution - Missense(1)	breast(1)	c.C327G						.						115.0	109.0	111.0					6																	84798909		2203	4300	6503	SO:0001583	missense	112609	exon4			AGGCAACGAGGAG	AK090775	CCDS5001.1	6q14.3	2009-10-06	2008-07-16	2008-07-16	ENSG00000135324	ENSG00000135324			21232	protein-coding gene	gene with protein product		615410	"""chromosome 6 open reading frame 117"""	C6orf117			Standard	NM_138409		Approved	bA51G5.2	uc003pkg.4	Q96G30	OTTHUMG00000015121	ENST00000257776.4:c.327C>G	6.37:g.84798909C>G	ENSP00000257776:p.Asn109Lys	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	40.0	NM_138409	A8K9M1|Q8IXM9|Q8N2D1	Missense_Mutation	SNP	ENST00000257776.4	37	CCDS5001.1	.	.	.	.	.	.	.	.	.	.	C	10.00	1.233279	0.22626	.	.	ENSG00000135324	ENST00000257776	D	0.82344	-1.6	5.33	-5.52	0.02560	.	0.507890	0.21382	N	0.075441	T	0.38692	0.1050	N	0.22421	0.69	0.19945	N	0.999949	B	0.30914	0.3	B	0.23275	0.045	T	0.52177	-0.8610	10	0.15499	T	0.54	-14.7234	6.7356	0.23407	0.0945:0.5015:0.0961:0.3078	.	109	Q96G30	MRAP2_HUMAN	K	109	ENSP00000257776:N109K	ENSP00000257776:N109K	N	+	3	2	MRAP2	84855628	0.003000	0.15002	0.837000	0.33122	0.949000	0.60115	-0.913000	0.04042	-0.789000	0.04498	-0.136000	0.14681	AAC	.		0.498	MRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041367.1	NM_138409	
MUC16	94025	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9085930	9085930	+	Missense_Mutation	SNP	A	A	T	rs372101894		TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:9085930A>T	ENST00000397910.4	-	1	6088	c.5885T>A	c.(5884-5886)aTg>aAg	p.M1962K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1962	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGAATGTGTCATGGGTGCTGA	0.443																																					p.M1962K		.											.	MUC16	566	0			c.T5885A						.						219.0	218.0	218.0					19																	9085930		2093	4230	6323	SO:0001583	missense	94025	exon1			TGTGTCATGGGTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5885T>A	19.37:g.9085930A>T	ENSP00000381008:p.Met1962Lys	Somatic	280.0	1.0		WXS	Illumina HiSeq	Phase_I	186.0	62.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	1.607	-0.524929	0.04141	.	.	ENSG00000181143	ENST00000397910	T	0.02258	4.37	0.235	0.235	0.15431	.	.	.	.	.	T	0.01124	0.0037	N	0.08118	0	.	.	.	B	0.34290	0.447	B	0.18871	0.023	T	0.45041	-0.9288	7	0.87932	D	0	.	.	.	.	.	1962	B5ME49	.	K	1962	ENSP00000381008:M1962K	ENSP00000381008:M1962K	M	-	2	0	MUC16	8946930	0.001000	0.12720	0.076000	0.20297	0.077000	0.17291	0.184000	0.16939	0.263000	0.21812	0.260000	0.18958	ATG	.		0.443	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYO6	4646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	76595796	76595796	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr6:76595796G>A	ENST00000369977.3	+	24	2631	c.2492G>A	c.(2491-2493)aGg>aAg	p.R831K	MYO6_ENST00000369985.4_Missense_Mutation_p.R831K|MYO6_ENST00000369981.3_Missense_Mutation_p.R831K|MYO6_ENST00000369975.1_Missense_Mutation_p.R831K	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	831	IQ.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CTTTGCAAGAGGAGACACAAA	0.308																																					p.R831K		.											.	MYO6	92	0			c.G2492A						.						41.0	41.0	41.0					6																	76595796		2203	4298	6501	SO:0001583	missense	4646	exon24			GCAAGAGGAGACA	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2492G>A	6.37:g.76595796G>A	ENSP00000358994:p.Arg831Lys	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	50.0	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	37	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	G	6.782	0.513175	0.12944	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49	5.82	5.82	0.92795	.	0.133760	0.64402	D	0.000002	T	0.22742	0.0549	N	0.03917	-0.325	0.48571	D	0.999673	B;B	0.18461	0.028;0.0	B;B	0.16289	0.015;0.001	T	0.30563	-0.9974	10	0.02654	T	1	.	10.4817	0.44698	0.1433:0.0:0.8567:0.0	.	831;831	Q9UM54-2;Q9UM54-1	.;.	K	831	ENSP00000358998:R831K;ENSP00000359002:R831K;ENSP00000358994:R831K;ENSP00000358992:R831K	ENSP00000358992:R831K	R	+	2	0	MYO6	76652516	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.612000	0.61169	2.745000	0.94114	0.655000	0.94253	AGG	.		0.308	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
MYO9A	4649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	72189982	72189982	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr15:72189982G>C	ENST00000356056.5	-	25	5334	c.4862C>G	c.(4861-4863)tCc>tGc	p.S1621C	MYO9A_ENST00000444904.1_Missense_Mutation_p.S1602C|MYO9A_ENST00000564571.1_Missense_Mutation_p.S1621C|MYO9A_ENST00000424560.1_Missense_Mutation_p.S1621C|MYO9A_ENST00000566885.1_Missense_Mutation_p.S1241C|MYO9A_ENST00000563542.1_5'UTR	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1621	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GTCTGTCTTGGATAATTCCTT	0.448																																					p.S1621C		.											.	MYO9A	93	0			c.C4862G						.						136.0	122.0	127.0					15																	72189982		2199	4297	6496	SO:0001583	missense	4649	exon25			GTCTTGGATAATT	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.4862C>G	15.37:g.72189982G>C	ENSP00000348349:p.Ser1621Cys	Somatic	285.0	1.0		WXS	Illumina HiSeq	Phase_I	264.0	115.0	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.565776	0.27915	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.84800	-1.9;-1.89;-1.9	5.92	3.66	0.41972	.	.	.	.	.	T	0.77219	0.4098	N	0.24115	0.695	0.09310	N	1	P;P;P	0.45348	0.547;0.547;0.856	B;B;B	0.43331	0.416;0.416;0.319	T	0.67803	-0.5576	9	0.54805	T	0.06	.	9.2093	0.37309	0.0867:0.0:0.7635:0.1498	.	1602;1621;1621	B2RTY4-2;B2RTY4-4;B2RTY4	.;.;MYO9A_HUMAN	C	1621;1621;1602	ENSP00000348349:S1621C;ENSP00000399162:S1621C;ENSP00000398250:S1602C	ENSP00000348349:S1621C	S	-	2	0	MYO9A	69977036	0.942000	0.31987	0.147000	0.22382	0.323000	0.28346	1.757000	0.38400	1.441000	0.47550	0.650000	0.86243	TCC	.		0.448	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
NACAD	23148	ucsc.edu;bcgsc.ca;mdanderson.org	37	7	45124284	45124284	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr7:45124284C>G	ENST00000490531.2	-	2	1514	c.1495G>C	c.(1495-1497)Gct>Cct	p.A499P		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	499					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						ACTCTGGTAGCCACCTCCACC	0.602																																					p.A499P		.											.	.	.	0			c.G1495C						.						43.0	46.0	45.0					7																	45124284		692	1591	2283	SO:0001583	missense	23148	exon2			TGGTAGCCACCTC	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.1495G>C	7.37:g.45124284C>G	ENSP00000420477:p.Ala499Pro	Somatic	126.0	2.0		WXS	Illumina HiSeq	.	84.0	27.0	NM_001146334		Missense_Mutation	SNP	ENST00000490531.2	37	CCDS47582.1	.	.	.	.	.	.	.	.	.	.	C	7.883	0.730560	0.15507	.	.	ENSG00000136274	ENST00000490531	T	0.15139	2.45	2.54	-2.57	0.06248	.	.	.	.	.	T	0.08447	0.0210	N	0.19112	0.55	0.09310	N	1	B	0.21905	0.062	B	0.12156	0.007	T	0.34625	-0.9821	9	0.33940	T	0.23	-0.1661	4.4525	0.11628	0.0:0.4581:0.1702:0.3717	.	499	O15069	NACAD_HUMAN	P	499	ENSP00000420477:A499P	ENSP00000420477:A499P	A	-	1	0	NACAD	45090809	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.090000	0.11163	-0.138000	0.11434	-0.362000	0.07510	GCT	.		0.602	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
NCKAP5	344148	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	133540419	133540419	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr2:133540419G>C	ENST00000409261.1	-	14	4338	c.3965C>G	c.(3964-3966)tCt>tGt	p.S1322C	NCKAP5_ENST00000317721.6_Missense_Mutation_p.S1322C|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1322										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTTGTTGGGAGAGCTTTCCGT	0.612																																					p.S1322C		.											.	.	.	0			c.C3965G						.						56.0	54.0	55.0					2																	133540419		1896	4115	6011	SO:0001583	missense	344148	exon14			TTGGGAGAGCTTT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3965C>G	2.37:g.133540419G>C	ENSP00000387128:p.Ser1322Cys	Somatic	198.0	1.0		WXS	Illumina HiSeq	Phase_I	172.0	10.0	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	9.339	1.062653	0.19987	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.11277	2.79;2.79	5.5	3.55	0.40652	.	0.456856	0.16109	U	0.229205	T	0.11580	0.0282	L	0.29908	0.895	0.20074	N	0.999934	D	0.61080	0.989	P	0.53313	0.723	T	0.14868	-1.0457	10	0.37606	T	0.19	.	4.0234	0.09677	0.5295:0.0:0.4705:0.0	.	1322	O14513	NCKP5_HUMAN	C	1322	ENSP00000387128:S1322C;ENSP00000380603:S1322C	ENSP00000380603:S1322C	S	-	2	0	NCKAP5	133256889	0.656000	0.27385	0.006000	0.13384	0.118000	0.20060	1.268000	0.33062	0.794000	0.33899	0.655000	0.94253	TCT	.		0.612	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
NPAP1	23742	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	24923341	24923341	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr15:24923341C>A	ENST00000329468.2	+	1	2801	c.2327C>A	c.(2326-2328)gCc>gAc	p.A776D		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	776					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											AAATTTGGGGCCCCTGATGGG	0.552																																					p.A776D		.											.	.	.	0			c.C2327A						.						109.0	127.0	121.0					15																	24923341		2203	4300	6503	SO:0001583	missense	23742	exon1			TTGGGGCCCCTGA	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2327C>A	15.37:g.24923341C>A	ENSP00000333735:p.Ala776Asp	Somatic	73.0	1.0		WXS	Illumina HiSeq	Phase_I	56.0	22.0	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	12.95	2.092314	0.36952	.	.	ENSG00000185823	ENST00000329468	T	0.10960	2.82	1.98	-1.06	0.10002	.	.	.	.	.	T	0.06781	0.0173	L	0.42245	1.32	0.09310	N	1	P	0.35208	0.49	B	0.30316	0.114	T	0.39099	-0.9630	9	0.16896	T	0.51	.	4.8217	0.13394	0.0:0.4542:0.0:0.5458	.	776	Q9NZP6	CO002_HUMAN	D	776	ENSP00000333735:A776D	ENSP00000333735:A776D	A	+	2	0	C15orf2	22474434	0.002000	0.14202	0.000000	0.03702	0.133000	0.20885	1.248000	0.32827	-0.312000	0.08741	0.195000	0.17529	GCC	.		0.552	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
NRG3	10718	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	83635708	83635708	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr10:83635708C>A	ENST00000404547.1	+	1	612	c.612C>A	c.(610-612)agC>agA	p.S204R	NRG3_ENST00000556918.1_5'Flank|NRG3_ENST00000372141.2_Missense_Mutation_p.S204R|NRG3_ENST00000404576.2_5'Flank|NRG3_ENST00000372142.2_5'Flank			P56975	NRG3_HUMAN	neuregulin 3	204	Ser/Thr-rich.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TCAGTAGCAGCACGCTGGGCT	0.677																																					p.S204R		.											.	NRG3	522	0			c.C612A						.						52.0	53.0	53.0					10																	83635708		2203	4300	6503	SO:0001583	missense	10718	exon1			TAGCAGCACGCTG	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.612C>A	10.37:g.83635708C>A	ENSP00000384796:p.Ser204Arg	Somatic	99.0	1.0		WXS	Illumina HiSeq	Phase_I	75.0	33.0	NM_001165972	A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	37	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.911170	0.33721	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287	T;T	0.31510	1.49;1.49	3.41	2.5	0.30297	.	0.263333	0.26662	U	0.023150	T	0.13670	0.0331	N	0.08118	0	0.80722	D	1	P;P	0.35982	0.531;0.531	B;B	0.32864	0.154;0.154	T	0.09015	-1.0694	10	0.37606	T	0.19	-13.8788	8.8979	0.35476	0.0:0.8839:0.0:0.1161	.	204;204	B9EGV5;P56975-4	.;.	R	204	ENSP00000361214:S204R;ENSP00000384796:S204R	ENSP00000361214:S204R	S	+	3	2	NRG3	83625688	0.999000	0.42202	0.984000	0.44739	0.871000	0.50021	1.540000	0.36115	0.780000	0.33566	-0.455000	0.05494	AGC	.		0.677	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	
NXPH4	11247	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57618996	57618996	+	Silent	SNP	T	T	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr12:57618996T>C	ENST00000349394.5	+	2	568	c.393T>C	c.(391-393)caT>caC	p.H131H	NXPH4_ENST00000555154.1_3'UTR|Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	131	III.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						TCGTGGACCATGTGAACGGTA	0.587																																					p.H131H		.											.	NXPH4	68	0			c.T393C						.						79.0	61.0	67.0					12																	57618996		2203	4300	6503	SO:0001819	synonymous_variant	11247	exon2			GGACCATGTGAAC	AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.393T>C	12.37:g.57618996T>C		Somatic	62.0	1.0		WXS	Illumina HiSeq	Phase_I	59.0	15.0	NM_007224	A8K4I4|Q7Z6L3|Q8N462	Silent	SNP	ENST00000349394.5	37	CCDS8933.1																																																																																			.		0.587	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412474.1	NM_007224	
OBSCN	84033	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228451986	228451986	+	Silent	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:228451986G>T	ENST00000422127.1	+	16	4799	c.4755G>T	c.(4753-4755)gtG>gtT	p.V1585V	OBSCN_ENST00000359599.6_Silent_p.V241V|OBSCN_ENST00000570156.2_Silent_p.V1769V|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.V1585V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1585	Ig-like 16.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGAGGCCGTGGGCTGCACAC	0.667																																					p.V1769V		.											.	OBSCN	403	0			c.G5307T						.						54.0	61.0	59.0					1																	228451986		2116	4226	6342	SO:0001819	synonymous_variant	84033	exon18			GGCCGTGGGCTGC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4755G>T	1.37:g.228451986G>T		Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	86.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			.		0.667	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228467000	228467000	+	Silent	SNP	G	G	T	rs371761770	byFrequency	TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:228467000G>T	ENST00000422127.1	+	27	7295	c.7251G>T	c.(7249-7251)acG>acT	p.T2417T	OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000359599.6_Silent_p.T1264T|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000570156.2_Silent_p.T2846T|OBSCN_ENST00000284548.11_Silent_p.T2417T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2417					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGGGAAGACGGTGTTGCAGG	0.667																																					p.T2846T		.											.	OBSCN	403	0			c.G8538T						.						61.0	72.0	68.0					1																	228467000		2103	4209	6312	SO:0001819	synonymous_variant	84033	exon32			GAAGACGGTGTTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7251G>T	1.37:g.228467000G>T		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	37.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			.		0.667	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2L5	81466	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	248185795	248185795	+	Silent	SNP	T	T	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:248185795T>A	ENST00000355281.1	+	1	546	c.546T>A	c.(544-546)gcT>gcA	p.A182A	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										ATGTTCCAGCTATGTTGACAT	0.438																																					p.A182A		.											.	.	.	0			c.T546A						.																																			SO:0001819	synonymous_variant	81466	exon1			TCCAGCTATGTTG		CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.546T>A	1.37:g.248185795T>A		Somatic	369.0	0.0		WXS	Illumina HiSeq	Phase_I	510.0	112.0	NM_001258284	Q6IF04	Silent	SNP	ENST00000355281.1	37	CCDS58068.1																																																																																			.		0.438	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096851.1		
OR2T6	254879	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	248551789	248551789	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:248551789A>G	ENST00000355728.2	+	1	880	c.880A>G	c.(880-882)Aac>Gac	p.N294D		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGTCTGAGGAACAGGGATGT	0.458																																					p.N294D		.											.	OR2T6	71	0			c.A880G						.						73.0	72.0	72.0					1																	248551789		2203	4300	6503	SO:0001583	missense	254879	exon1			CTGAGGAACAGGG	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.880A>G	1.37:g.248551789A>G	ENSP00000347965:p.Asn294Asp	Somatic	374.0	2.0		WXS	Illumina HiSeq	Phase_I	397.0	76.0	NM_001005471	A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	A	18.94	3.730133	0.69074	.	.	ENSG00000198104	ENST00000355728	T	0.48836	0.8	4.2	4.2	0.49525	.	0.000000	0.49305	D	0.000141	T	0.76040	0.3932	H	0.98701	4.305	0.30118	N	0.805938	P	0.36412	0.552	P	0.49301	0.606	T	0.80020	-0.1557	10	0.87932	D	0	.	13.3949	0.60846	1.0:0.0:0.0:0.0	.	294	Q8NHC8	OR2T6_HUMAN	D	294	ENSP00000347965:N294D	ENSP00000347965:N294D	N	+	1	0	OR2T6	246618412	0.996000	0.38824	0.998000	0.56505	0.926000	0.56050	5.846000	0.69444	1.888000	0.54679	0.523000	0.50628	AAC	.		0.458	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
OR2T34	127068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248737387	248737387	+	Silent	SNP	G	G	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:248737387G>C	ENST00000328782.2	-	1	693	c.672C>G	c.(670-672)acC>acG	p.T224T		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCAGGATGAGGGTGTATGAGC	0.562																																					p.T224T		.											.	OR2T34	69	0			c.C672G						.						140.0	158.0	152.0					1																	248737387		2173	4300	6473	SO:0001819	synonymous_variant	127068	exon1			GATGAGGGTGTAT	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.672C>G	1.37:g.248737387G>C		Somatic	576.0	1.0		WXS	Illumina HiSeq	Phase_I	703.0	164.0	NM_001001821	B2RNJ8|Q6IEY5|Q96R31	Silent	SNP	ENST00000328782.2	37	CCDS31120.1																																																																																			.		0.562	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821	
OR51L1	119682	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5021109	5021109	+	Silent	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr11:5021109G>A	ENST00000321543.1	+	1	897	c.897G>A	c.(895-897)aaG>aaA	p.K299K		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCAGAACAAAGCAGATTCGTC	0.443																																					p.K299K		.											.	OR51L1	69	0			c.G897A						.						97.0	89.0	92.0					11																	5021109		2201	4298	6499	SO:0001819	synonymous_variant	119682	exon1			AACAAAGCAGATT	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.897G>A	11.37:g.5021109G>A		Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	40.0	NM_001004755	Q6IFE5	Silent	SNP	ENST00000321543.1	37	CCDS31369.1																																																																																			.		0.443	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755	
OR6N2	81442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158746653	158746653	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:158746653A>T	ENST00000339258.1	-	1	772	c.773T>A	c.(772-774)aTg>aAg	p.M258K		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					CCGCACATACATGAAGATGAT	0.438																																					p.M258K		.											.	OR6N2	68	0			c.T773A						.						99.0	94.0	96.0					1																	158746653		2203	4300	6503	SO:0001583	missense	81442	exon1			ACATACATGAAGA	BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.773T>A	1.37:g.158746653A>T	ENSP00000344101:p.Met258Lys	Somatic	337.0	0.0		WXS	Illumina HiSeq	Phase_I	507.0	132.0	NM_001005278	Q6IFR2	Missense_Mutation	SNP	ENST00000339258.1	37	CCDS30906.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.084886	0.76642	.	.	ENSG00000188340	ENST00000339258	T	0.00198	8.57	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000274	T	0.00300	0.0009	M	0.83483	2.645	0.44042	D	0.996773	D	0.58970	0.984	P	0.58620	0.842	T	0.75733	-0.3214	10	0.87932	D	0	-19.8763	13.7168	0.62702	1.0:0.0:0.0:0.0	.	258	Q8NGY6	OR6N2_HUMAN	K	258	ENSP00000344101:M258K	ENSP00000344101:M258K	M	-	2	0	OR6N2	157013277	0.340000	0.24792	1.000000	0.80357	0.914000	0.54420	2.807000	0.47955	2.059000	0.61396	0.528000	0.53228	ATG	.		0.438	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1		
PARP11	57097	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	3931251	3931251	+	Splice_Site	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr12:3931251C>A	ENST00000228820.4	-	5	561	c.417G>T	c.(415-417)caG>caT	p.Q139H	PARP11_ENST00000476985.1_5'Flank|PARP11_ENST00000447133.3_Splice_Site_p.Q58H|PARP11_ENST00000397096.2_Splice_Site_p.Q132H|PARP11_ENST00000427057.2_Splice_Site_p.Q58H	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	132	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			CTGCTCTTACCTGATATGGTA	0.383																																					p.Q139H		.											.	PARP11	523	0			c.G417T						.						120.0	110.0	114.0					12																	3931251		2203	4300	6503	SO:0001630	splice_region_variant	57097	exon5			TCTTACCTGATAT	AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.417+1G>T	12.37:g.3931251C>A		Somatic	104.0	1.0		WXS	Illumina HiSeq	Phase_I	82.0	37.0	NM_020367	B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	ENST00000228820.4	37	CCDS8523.2	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595139	0.66219	.	.	ENSG00000111224	ENST00000397096;ENST00000427057;ENST00000228820;ENST00000447133	T;T;T;T	0.14144	2.53;2.53;2.53;2.53	5.42	5.42	0.78866	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.29256	0.0728	L	0.41710	1.295	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	P;D;D	0.87578	0.881;0.997;0.998	T	0.00223	-1.1903	9	.	.	.	.	16.7564	0.85501	0.0:1.0:0.0:0.0	.	58;139;132	Q9NR21-2;Q9NR21-4;Q9NR21	.;.;PAR11_HUMAN	H	132;58;139;58	ENSP00000380284:Q132H;ENSP00000397058:Q58H;ENSP00000228820:Q139H;ENSP00000405385:Q58H	.	Q	-	3	2	PARP11	3801512	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	5.203000	0.65174	2.809000	0.96659	0.650000	0.86243	CAG	.		0.383	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1		Missense_Mutation
PCDH17	27253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	58298754	58298754	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr13:58298754G>T	ENST00000377918.3	+	4	2832	c.2806G>T	c.(2806-2808)Gag>Tag	p.E936*		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	936					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AGAACCAGAAGAGTGTGTTAA	0.428																																					p.E936X	Melanoma(72;952 1291 1619 12849 33676)	.											.	PCDH17	97	0			c.G2806T						.						48.0	49.0	49.0					13																	58298754		2203	4300	6503	SO:0001587	stop_gained	27253	exon4			CCAGAAGAGTGTG	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2806G>T	13.37:g.58298754G>T	ENSP00000367151:p.Glu936*	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	40.0	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Nonsense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	39	7.732918	0.98459	.	.	ENSG00000118946	ENST00000377918	.	.	.	6.07	6.07	0.98685	.	0.143793	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	.	.	.	X	936	.	.	E	+	1	0	PCDH17	57196755	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.472000	0.97709	2.885000	0.99019	0.655000	0.94253	GAG	.		0.428	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
PCDHA5	56143	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140201921	140201921	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr5:140201921A>C	ENST00000529859.1	+	1	561	c.561A>C	c.(559-561)gaA>gaC	p.E187D	PCDHA5_ENST00000378126.3_Missense_Mutation_p.E187D|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.E187D|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	187	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGAAGAAGAAACGAACTTTT	0.373																																					p.E187D		.											.	PCDHA5	137	0			c.A561C						.						68.0	75.0	72.0					5																	140201921		2200	4298	6498	SO:0001583	missense	56143	exon1			AGAAGAAACGAAC	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.561A>C	5.37:g.140201921A>C	ENSP00000436557:p.Glu187Asp	Somatic	91.0	1.0		WXS	Illumina HiSeq	Phase_I	66.0	28.0	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	A	0.059	-1.227631	0.01518	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.15952	2.38;2.38;2.38	4.02	-1.84	0.07809	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.05593	0.0147	N	0.04705	-0.18	0.09310	N	1	B;B;B	0.14805	0.003;0.006;0.011	B;B;B	0.12837	0.008;0.005;0.007	T	0.41716	-0.9493	9	0.14656	T	0.56	.	1.7602	0.02990	0.4942:0.1363:0.2501:0.1194	.	187;187;187	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	D	187	ENSP00000433416:E187D;ENSP00000436557:E187D;ENSP00000367366:E187D	ENSP00000367366:E187D	E	+	3	2	PCDHA5	140182105	0.000000	0.05858	0.021000	0.16686	0.243000	0.25628	-7.080000	0.00045	-0.156000	0.11079	0.482000	0.46254	GAA	.		0.373	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
PCDHA13	56136	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	5	140264081	140264081	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr5:140264081G>T	ENST00000289272.2	+	1	2228	c.2228G>T	c.(2227-2229)aGc>aTc	p.S743I	PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.S743I|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	743	6 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGTGCTCCAGCGCGGCAGGG	0.677																																					p.S743I	Melanoma(147;1739 1852 5500 27947 37288)	.											.	PCDHA13	75	0			c.G2228T						.						52.0	57.0	55.0					5																	140264081		2203	4299	6502	SO:0001583	missense	56136	exon1			GCTCCAGCGCGGC	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.2228G>T	5.37:g.140264081G>T	ENSP00000289272:p.Ser743Ile	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	14.0	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518889	0.44763	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.17213	2.29;2.29	4.61	2.37	0.29283	.	.	.	.	.	T	0.48040	0.1478	H	0.95470	3.675	0.26094	N	0.980912	D;P;D	0.69078	0.992;0.956;0.997	D;P;D	0.72982	0.933;0.771;0.979	T	0.35624	-0.9781	9	0.37606	T	0.19	.	7.5405	0.27735	0.1637:0.1475:0.6888:0.0	.	743;743;743	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	I	743	ENSP00000386821:S743I;ENSP00000289272:S743I	ENSP00000289272:S743I	S	+	2	0	PCDHA13	140244265	0.982000	0.34865	0.999000	0.59377	0.107000	0.19398	2.310000	0.43708	0.886000	0.36113	0.655000	0.94253	AGC	.		0.677	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
PDIA4	9601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	148703056	148703056	+	Silent	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr7:148703056C>T	ENST00000286091.4	-	8	1453	c.1221G>A	c.(1219-1221)aaG>aaA	p.K407K		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	407					cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			TGGTGTAGCGCTTAGCATCGT	0.607											OREG0018420	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K407K		.											.	PDIA4	524	0			c.G1221A						.						58.0	59.0	59.0					7																	148703056		2203	4300	6503	SO:0001819	synonymous_variant	9601	exon8			GTAGCGCTTAGCA	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1221G>A	7.37:g.148703056C>T		Somatic	99.0	0.0	1719	WXS	Illumina HiSeq	Phase_I	65.0	21.0	NM_004911	A8K4K6|Q549T6	Silent	SNP	ENST00000286091.4	37	CCDS5893.1																																																																																			.		0.607	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911	
PHEX	5251	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	22117127	22117127	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chrX:22117127G>A	ENST00000379374.4	+	9	1502	c.937G>A	c.(937-939)Gac>Aac	p.D313N	PHEX_ENST00000537599.1_Missense_Mutation_p.D313N|PHEX_ENST00000535894.1_Missense_Mutation_p.D216N|PHEX_ENST00000418858.3_Missense_Mutation_p.D16N|PHEX_ENST00000475778.1_3'UTR	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	313					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						CCCTCAGTTCGACTGGCTGGG	0.483																																					p.D313N		.											.	PHEX	132	0			c.G937A	GRCh37	CI001586	PHEX	I		.						133.0	115.0	121.0					X																	22117127		2203	4300	6503	SO:0001583	missense	5251	exon9			CAGTTCGACTGGC	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.937G>A	X.37:g.22117127G>A	ENSP00000368682:p.Asp313Asn	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	21.0	NM_000444	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	37	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	G	7.793	0.711926	0.15306	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	5.46	5.46	0.80206	Peptidase M13 (1);	0.043010	0.85682	D	0.000000	T	0.69593	0.3128	N	0.12663	0.25	0.47476	D	0.99943	P;P	0.39624	0.631;0.681	B;B	0.36766	0.149;0.232	T	0.69416	-0.5151	10	0.13470	T	0.59	.	18.3838	0.90459	0.0:0.0:1.0:0.0	.	313;313	F5GXU4;P78562	.;PHEX_HUMAN	N	313;313;216;16	ENSP00000368682:D313N;ENSP00000440362:D313N;ENSP00000439418:D216N;ENSP00000443531:D16N	ENSP00000368682:D313N	D	+	1	0	PHEX	22027048	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	5.567000	0.67378	2.282000	0.76494	0.529000	0.55759	GAC	.		0.483	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	
PHF8	23133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54022132	54022132	+	Silent	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chrX:54022132C>T	ENST00000357988.5	-	12	1783	c.1425G>A	c.(1423-1425)ctG>ctA	p.L475L	PHF8_ENST00000338946.6_Silent_p.L439L|PHF8_ENST00000338154.6_Silent_p.L439L|PHF8_ENST00000322659.8_Silent_p.L439L	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	475					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						TTACTTCCACCAGGCGGATCT	0.552																																					p.L475L		.											.	PHF8	133	0			c.G1425A						.						110.0	79.0	89.0					X																	54022132		2203	4300	6503	SO:0001819	synonymous_variant	23133	exon12			TTCCACCAGGCGG	AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.1425G>A	X.37:g.54022132C>T		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	24.0	NM_001184896	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Silent	SNP	ENST00000357988.5	37	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.122|9.122	1.009126|1.009126	0.19199|0.19199	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000443302|ENST00000396282;ENST00000448003	.|.	.|.	.|.	5.62|5.62	3.82|3.82	0.43975|0.43975	.|.	.|.	.|.	.|.	.|.	T|.	0.55178|.	0.1904|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.51132|.	-0.8744|.	4|.	.|.	.|.	.|.	-3.5455|-3.5455	6.0766|6.0766	0.19919|0.19919	0.4705:0.44:0.0:0.0894|0.4705:0.44:0.0:0.0894	.|.	.|.	.|.	.|.	S|X	203|343;120	.|.	.|.	G|W	-|-	1|2	0|0	PHF8|PHF8	54038857|54038857	0.978000|0.978000	0.34361|0.34361	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	0.044000|0.044000	0.13992|0.13992	1.121000|1.121000	0.41925|0.41925	0.468000|0.468000	0.43344|0.43344	GGT|TGG	.		0.552	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	47930177	47930177	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr7:47930177G>A	ENST00000289672.2	-	16	2688	c.2638C>T	c.(2638-2640)Cgg>Tgg	p.R880W		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	880	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGGAACACCCGGGTCTCAGAA	0.562																																					p.R880W		.											.	PKD1L1	145	0			c.C2638T						.						86.0	78.0	81.0					7																	47930177		2203	4300	6503	SO:0001583	missense	168507	exon16			ACACCCGGGTCTC	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2638C>T	7.37:g.47930177G>A	ENSP00000289672:p.Arg880Trp	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	34.0	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.619851	0.28801	.	.	ENSG00000158683	ENST00000289672	T	0.70045	-0.45	5.44	2.57	0.30868	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.630546	0.13935	N	0.352617	T	0.54127	0.1839	N	0.22421	0.69	0.09310	N	1	P	0.51791	0.948	P	0.47376	0.545	T	0.45338	-0.9268	10	0.66056	D	0.02	-7.5742	5.1808	0.15160	0.1885:0.1706:0.6409:0.0	.	880	Q8TDX9	PK1L1_HUMAN	W	880	ENSP00000289672:R880W	ENSP00000289672:R880W	R	-	1	2	PKD1L1	47896702	0.007000	0.16637	0.008000	0.14137	0.045000	0.14185	1.102000	0.31050	0.245000	0.21373	0.643000	0.83706	CGG	.		0.562	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110393732	110393732	+	Silent	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:110393732A>G	ENST00000378402.5	+	3	401	c.297A>G	c.(295-297)acA>acG	p.T99T		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	99	IPT/TIG 1.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTCAAATTACATGCTATACTA	0.284										HNSCC(38;0.096)																											p.T99T		.											.	PKHD1L1	145	0			c.A297G						.						43.0	42.0	43.0					8																	110393732		1807	4060	5867	SO:0001819	synonymous_variant	93035	exon3			AATTACATGCTAT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.297A>G	8.37:g.110393732A>G		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	18.0	NM_177531	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1																																																																																			.		0.284	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PKP1	5317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201282409	201282409	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:201282409G>T	ENST00000352845.3	+	3	422	c.422G>T	c.(421-423)gGc>gTc	p.G141V	PKP1_ENST00000263946.3_Missense_Mutation_p.G141V|PKP1_ENST00000367324.3_Missense_Mutation_p.G141V			Q13835	PKP1_HUMAN	plakophilin 1	141					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						ACCGGCGCAGGCAGCGACATC	0.647																																					p.G141V		.											.	PKP1	92	0			c.G422T						.						20.0	23.0	22.0					1																	201282409		2203	4300	6503	SO:0001583	missense	5317	exon3			GCGCAGGCAGCGA	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.422G>T	1.37:g.201282409G>T	ENSP00000295597:p.Gly141Val	Somatic	265.0	1.0		WXS	Illumina HiSeq	Phase_I	328.0	137.0	NM_001005337	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398373	0.62177	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.73789	-0.78;-0.68;-0.68	4.25	4.25	0.50352	.	0.000000	0.64402	D	0.000019	T	0.77638	0.4160	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.74674	0.974;0.984	T	0.75566	-0.3273	10	0.27785	T	0.31	-24.1646	17.1769	0.86844	0.0:0.0:1.0:0.0	.	141;141	Q13835-2;Q13835	.;PKP1_HUMAN	V	141	ENSP00000356293:G141V;ENSP00000263946:G141V;ENSP00000295597:G141V	ENSP00000263946:G141V	G	+	2	0	PKP1	199549032	1.000000	0.71417	0.997000	0.53966	0.626000	0.37791	4.666000	0.61554	2.373000	0.80994	0.491000	0.48974	GGC	.		0.647	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	
PLCG2	5336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	81925146	81925146	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr16:81925146G>A	ENST00000359376.3	+	11	1151	c.937G>A	c.(937-939)Gac>Aac	p.D313N		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	313	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GGACATGCAGGACATGAACAA	0.493																																					p.D313N		.											.	PLCG2	892	0			c.G937A						.						107.0	110.0	109.0					16																	81925146		2111	4226	6337	SO:0001583	missense	5336	exon11			ATGCAGGACATGA		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.937G>A	16.37:g.81925146G>A	ENSP00000352336:p.Asp313Asn	Somatic	335.0	0.0		WXS	Illumina HiSeq	Phase_I	239.0	81.0	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	37	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.952333	0.34471	.	.	ENSG00000197943	ENST00000359376	T	0.64085	-0.08	5.61	3.66	0.41972	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);Phospholipase C, phosphatidylinositol-specific , X domain (2);	0.130613	0.64402	N	0.000002	T	0.63022	0.2476	M	0.85630	2.765	0.53688	D	0.999978	B;B	0.22211	0.022;0.066	B;B	0.18263	0.021;0.015	T	0.60576	-0.7236	10	0.38643	T	0.18	.	10.0304	0.42096	0.2057:0.0:0.7943:0.0	.	180;313	B4E3H3;P16885	.;PLCG2_HUMAN	N	313	ENSP00000352336:D313N	ENSP00000352336:D313N	D	+	1	0	PLCG2	80482647	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.107000	0.57811	0.845000	0.35118	-0.880000	0.02959	GAC	.		0.493	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
PLEKHH2	130271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	43980783	43980783	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr2:43980783G>A	ENST00000282406.4	+	25	3789	c.3679G>A	c.(3679-3681)Gga>Aga	p.G1227R		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1227	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GCAAGCTCGTGGAGAGACTGA	0.313																																					p.G1227R		.											.	PLEKHH2	92	0			c.G3679A						.						69.0	76.0	74.0					2																	43980783		2202	4299	6501	SO:0001583	missense	130271	exon25			GCTCGTGGAGAGA	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.3679G>A	2.37:g.43980783G>A	ENSP00000282406:p.Gly1227Arg	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	49.0	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183855	0.78677	.	.	ENSG00000152527	ENST00000282406	T	0.71341	-0.56	5.42	5.42	0.78866	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);	0.047839	0.85682	D	0.000000	D	0.84365	0.5456	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.82625	-0.0365	10	0.33141	T	0.24	-23.0345	19.2521	0.93929	0.0:0.0:1.0:0.0	.	1227	Q8IVE3	PKHH2_HUMAN	R	1227	ENSP00000282406:G1227R	ENSP00000282406:G1227R	G	+	1	0	PLEKHH2	43834287	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.585000	0.82584	2.542000	0.85734	0.655000	0.94253	GGA	.		0.313	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
POM121L12	285877	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	7	53103689	53103689	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr7:53103689G>T	ENST00000408890.4	+	1	341	c.325G>T	c.(325-327)Ggg>Tgg	p.G109W		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	109										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						GACCGCTCTGGGGCGAGACCT	0.711																																					p.G109W		.											.	.	.	0			c.G325T						.						23.0	27.0	26.0					7																	53103689		1971	4132	6103	SO:0001583	missense	285877	exon1			GCTCTGGGGCGAG		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.325G>T	7.37:g.53103689G>T	ENSP00000386133:p.Gly109Trp	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	6.0	NM_182595	Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660537	0.29515	.	.	ENSG00000221900	ENST00000408890	T	0.58940	0.3	1.84	0.907	0.19321	.	.	.	.	.	T	0.64789	0.2630	L	0.46157	1.445	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51419	-0.8708	9	0.87932	D	0	.	6.1016	0.20051	0.0:0.3237:0.6763:0.0	.	109	Q8N7R1	P1L12_HUMAN	W	109	ENSP00000386133:G109W	ENSP00000386133:G109W	G	+	1	0	POM121L12	53071183	0.001000	0.12720	0.004000	0.12327	0.007000	0.05969	0.147000	0.16202	0.336000	0.23639	0.462000	0.41574	GGG	.		0.711	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595	
POR	5447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	75615486	75615486	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr7:75615486C>G	ENST00000461988.1	+	15	1930	c.1825C>G	c.(1825-1827)Cag>Gag	p.Q609E	POR_ENST00000450476.1_Missense_Mutation_p.Q508E|POR_ENST00000545601.1_Missense_Mutation_p.Q417E|TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA|POR_ENST00000439269.1_Missense_Mutation_p.Q347E|POR_ENST00000419840.1_Intron|POR_ENST00000394893.1_Missense_Mutation_p.Q609E	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	606			LKQDREHLW -> R (in ABS1).		carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	GGTCTACGTCCAGCACCTGCT	0.632																																					p.Q609E		.											.	POR	23	0			c.C1825G						.						47.0	59.0	55.0					7																	75615486		2106	4222	6328	SO:0001583	missense	5447	exon15			TACGTCCAGCACC	AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000461988.1:c.1825C>G	7.37:g.75615486C>G	ENSP00000419970:p.Gln609Glu	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	55.0	NM_000941	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Missense_Mutation	SNP	ENST00000461988.1	37	CCDS5579.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.95|11.95	1.790798|1.790798	0.31685|0.31685	.|.	.|.	ENSG00000127948|ENSG00000127948	ENST00000447222|ENST00000461988;ENST00000394893;ENST00000545601;ENST00000450476;ENST00000439269	.|D;D;D;D;D	.|0.81499	.|-1.5;-1.5;-1.5;-1.5;-1.5	3.59|3.59	2.69|2.69	0.31865|0.31865	.|Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	.|0.058333	.|0.64402	.|D	.|0.000001	D|D	0.93429|0.93429	0.7904|0.7904	H|H	0.99249|0.99249	4.485|4.485	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.999;0.997;0.999	.|D;D;D;D	.|0.91635	.|0.999;0.972;0.942;0.975	D|D	0.94576|0.94576	0.7775|0.7775	5|10	.|0.72032	.|D	.|0.01	-24.618|-24.618	12.1931|12.1931	0.54282|0.54282	0.1726:0.8273:0.0:0.0|0.1726:0.8273:0.0:0.0	.|.	.|606;508;417;615	.|P16435;E7EVY7;F5H468;Q59ED7	.|NCPR_HUMAN;.;.;.	R|E	659|609;609;417;508;347	.|ENSP00000419970:Q609E;ENSP00000378355:Q609E;ENSP00000446149:Q417E;ENSP00000416572:Q508E;ENSP00000412490:Q347E	.|ENSP00000378355:Q609E	P|Q	+|+	2|1	0|0	POR|POR	75453422|75453422	1.000000|1.000000	0.71417|0.71417	0.943000|0.943000	0.38184|0.38184	0.149000|0.149000	0.21700|0.21700	6.572000|6.572000	0.74005|0.74005	1.062000|1.062000	0.40625|0.40625	-0.314000|-0.314000	0.08810|0.08810	CCA|CAG	.		0.632	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7	NM_000941	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48697806	48697806	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:48697806A>C	ENST00000314191.2	-	78	11028	c.10972T>G	c.(10972-10974)Ttc>Gtc	p.F3658V	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.F3658V	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3659					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ATGTCGTTGAAGTCACTGAGC	0.358								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			.						.						81.0	77.0	78.0					8																	48697806		1824	4082	5906	SO:0001583	missense	5591	.			CGTTGAAGTCACT		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.10972T>G	8.37:g.48697806A>C	ENSP00000313420:p.Phe3658Val	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	34.0	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	A	13.91	2.377355	0.42105	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.80304	-1.36;-1.36	5.8	5.8	0.92144	Protein kinase-like domain (1);	0.051271	0.85682	D	0.000000	T	0.82125	0.4969	M	0.77103	2.36	0.80722	D	1	B;B	0.30146	0.27;0.136	B;B	0.31495	0.131;0.046	T	0.81737	-0.0796	10	0.56958	D	0.05	.	16.1549	0.81657	1.0:0.0:0.0:0.0	.	3658;3659	E7EUY0;P78527	.;PRKDC_HUMAN	V	3658	ENSP00000313420:F3658V;ENSP00000345182:F3658V	ENSP00000313420:F3658V	F	-	1	0	PRKDC	48860359	1.000000	0.71417	0.837000	0.33122	0.004000	0.04260	5.910000	0.69931	2.209000	0.71365	0.533000	0.62120	TTC	.		0.358	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	69032483	69032483	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:69032483A>G	ENST00000288368.4	+	29	3834	c.3557A>G	c.(3556-3558)gAc>gGc	p.D1186G		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1186					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGGGCCTTTGACCAAACCAAG	0.398																																					p.D1186G		.											.	PREX2	390	0			c.A3557G						.						119.0	119.0	119.0					8																	69032483		2203	4300	6503	SO:0001583	missense	80243	exon29			CCTTTGACCAAAC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3557A>G	8.37:g.69032483A>G	ENSP00000288368:p.Asp1186Gly	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	51.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.526954	0.64860	.	.	ENSG00000046889	ENST00000288368	T	0.36520	1.25	5.29	5.29	0.74685	.	0.056952	0.64402	D	0.000002	T	0.23965	0.0580	N	0.08118	0	0.43745	D	0.99624	B	0.14438	0.01	B	0.22152	0.038	T	0.07986	-1.0744	10	0.87932	D	0	.	15.5312	0.75964	1.0:0.0:0.0:0.0	.	1186	Q70Z35	PREX2_HUMAN	G	1186	ENSP00000288368:D1186G	ENSP00000288368:D1186G	D	+	2	0	PREX2	69195037	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	8.678000	0.91211	2.120000	0.65058	0.528000	0.53228	GAC	.		0.398	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
PRRC2B	84726	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	134351321	134351322	+	Frame_Shift_Ins	INS	-	-	G	rs370454900		TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr9:134351321_134351322insG	ENST00000357304.4	+	15	3860_3861	c.3805_3806insG	c.(3805-3807)cggfs	p.R1269fs	PRRC2B_ENST00000458550.1_Intron|PRRC2B_ENST00000405995.1_Intron|PRRC2B_ENST00000372249.1_5'UTR	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1269							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						ATTTGGTGGCCGGGGCTTTGAG	0.559											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1269fs		.											.	PRRC2B	24	0			c.3805_3806insG						.																																			SO:0001589	frameshift_variant	84726	exon15			GGTGGCCGGGGCT	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.3809dupG	9.37:g.134351325_134351325dupG	ENSP00000349856:p.Arg1269fs	Somatic	95.0	0.0	1610	WXS	Illumina HiSeq	Phase_I	73.0	25.0	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Frame_Shift_Ins	INS	ENST00000357304.4	37	CCDS48044.1																																																																																			.		0.559	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
RBFOX1	54715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	7568314	7568314	+	Silent	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr16:7568314C>T	ENST00000550418.1	+	5	1181	c.193C>T	c.(193-195)Ctg>Ttg	p.L65L	RBFOX1_ENST00000535565.2_Silent_p.L101L|RBFOX1_ENST00000547372.1_Silent_p.L108L|RBFOX1_ENST00000436368.2_Silent_p.L85L|RBFOX1_ENST00000422070.4_Silent_p.L108L|RBFOX1_ENST00000553186.1_Silent_p.L65L|RBFOX1_ENST00000355637.4_Silent_p.L85L|RBFOX1_ENST00000547338.1_Silent_p.L65L|RBFOX1_ENST00000311745.5_Silent_p.L85L|RBFOX1_ENST00000340209.4_Silent_p.L70L|RBFOX1_ENST00000552089.1_Silent_p.L101L	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	65					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CACATTAAACCTGTACCCTCC	0.652																																					p.L85L	Ovarian(157;934 2567 15163 39509)	.											.	RBFOX1	92	0			c.C253T						.						124.0	117.0	120.0					16																	7568314		2197	4300	6497	SO:0001819	synonymous_variant	54715	exon2			TTAAACCTGTACC	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.193C>T	16.37:g.7568314C>T		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	39.0	NM_145891	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	ENST00000550418.1	37	CCDS55983.1																																																																																			.		0.652	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
ROBO1	6091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	78688976	78688976	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr3:78688976G>T	ENST00000464233.1	-	22	3068	c.2955C>A	c.(2953-2955)aaC>aaA	p.N985K	ROBO1_ENST00000467549.1_Missense_Mutation_p.N940K|ROBO1_ENST00000436010.2_Missense_Mutation_p.N946K|ROBO1_ENST00000495273.1_Missense_Mutation_p.N940K	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	985					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CATTGTGGTTGTTGCCAGTAT	0.502																																					p.N985K		.											.	ROBO1	67	0			c.C2955A						.						73.0	73.0	73.0					3																	78688976		2012	4190	6202	SO:0001583	missense	6091	exon22			GTGGTTGTTGCCA	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2955C>A	3.37:g.78688976G>T	ENSP00000420321:p.Asn985Lys	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	48.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	9.202	1.028688	0.19512	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.59502	0.29;0.26;0.27;0.31	5.78	3.97	0.46021	.	0.140197	0.64402	D	0.000004	T	0.44519	0.1297	L	0.36672	1.1	0.46798	D	0.999205	B;B;B;B;B	0.22909	0.069;0.077;0.025;0.019;0.003	B;B;B;B;B	0.22386	0.037;0.028;0.036;0.028;0.039	T	0.27434	-1.0074	9	.	.	.	.	11.5399	0.50661	0.1656:0.0:0.8344:0.0	.	949;985;940;940;946	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	K	946;940;985;940;940;989	ENSP00000406043:N946K;ENSP00000420321:N985K;ENSP00000420637:N940K;ENSP00000417992:N940K	.	N	-	3	2	ROBO1	78771666	1.000000	0.71417	0.994000	0.49952	0.147000	0.21601	3.512000	0.53407	2.732000	0.93576	0.591000	0.81541	AAC	.		0.502	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
RPE65	6121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	68910330	68910330	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:68910330C>T	ENST00000262340.5	-	5	432	c.379G>A	c.(379-381)Gag>Aag	p.E127K		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	127					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						TCAGTAACCTCTACTCCTCGA	0.368																																					p.E127K		.											.	RPE65	91	0			c.G379A						.						64.0	67.0	66.0					1																	68910330		2203	4300	6503	SO:0001583	missense	6121	exon5			TAACCTCTACTCC	U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.379G>A	1.37:g.68910330C>T	ENSP00000262340:p.Glu127Lys	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	22.0	NM_000329	A8K1L0|Q5T9U3	Missense_Mutation	SNP	ENST00000262340.5	37	CCDS643.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.185934	0.57909	.	.	ENSG00000116745	ENST00000262340	D	0.94232	-3.38	5.05	5.05	0.67936	.	0.431282	0.19527	N	0.112134	D	0.85186	0.5639	L	0.46157	1.445	0.80722	D	1	B	0.13145	0.007	B	0.17098	0.017	T	0.81243	-0.1021	10	0.06891	T	0.86	-15.4338	18.5839	0.91181	0.0:1.0:0.0:0.0	.	127	Q16518	RPE65_HUMAN	K	127	ENSP00000262340:E127K	ENSP00000262340:E127K	E	-	1	0	RPE65	68682918	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.320000	0.79064	2.627000	0.88993	0.655000	0.94253	GAG	.		0.368	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329	
RXRG	6258	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	165386378	165386378	+	Silent	SNP	C	C	A	rs200365240		TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:165386378C>A	ENST00000359842.5	-	4	824	c.522G>T	c.(520-522)acG>acT	p.T174T	RXRG_ENST00000470566.1_5'UTR	NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	174					gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	TATCCCGACACGTGTAGATGA	0.488																																					p.T174T		.											.	RXRG	186	0			c.G522T						.						194.0	167.0	176.0					1																	165386378		2203	4300	6503	SO:0001819	synonymous_variant	6258	exon4			CCGACACGTGTAG	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.522G>T	1.37:g.165386378C>A		Somatic	340.0	1.0		WXS	Illumina HiSeq	Phase_I	452.0	91.0	NM_006917	A6NIP1|Q6IBU7	Silent	SNP	ENST00000359842.5	37	CCDS1248.1																																																																																			C|0.999;T|0.001		0.488	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2	NM_006917	
SACS	26278	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	23907796	23907796	+	Silent	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr13:23907796G>A	ENST00000382292.3	-	9	10492	c.10219C>T	c.(10219-10221)Cta>Tta	p.L3407L	SACS_ENST00000402364.1_Silent_p.L2657L|SACS_ENST00000382298.3_Silent_p.L3407L			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3407					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AGTGACTTTAGAATTTTTATA	0.338																																					p.L3407L		.											.	SACS	298	0			c.C10219T						.						83.0	86.0	85.0					13																	23907796		2203	4299	6502	SO:0001819	synonymous_variant	26278	exon10			ACTTTAGAATTTT	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.10219C>T	13.37:g.23907796G>A		Somatic	68.0	1.0		WXS	Illumina HiSeq	Phase_I	58.0	19.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2																																																																																			.		0.338	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
CPSF7	79869	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	61197634	61197634	+	5'Flank	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr11:61197634G>T	ENST00000394888.4	-	0	0				SDHAF2_ENST00000543265.1_Missense_Mutation_p.V6L|SDHAF2_ENST00000301761.2_Missense_Mutation_p.V6L|SDHAF2_ENST00000534878.1_Missense_Mutation_p.V6L|CPSF7_ENST00000541963.1_5'Flank|SDHAF2_ENST00000542074.1_Missense_Mutation_p.V6L|SDHAF2_ENST00000537782.1_Missense_Mutation_p.V6L|CPSF7_ENST00000448745.1_5'Flank|RP11-286N22.8_ENST00000544880.1_3'UTR|CPSF7_ENST00000439958.3_5'Flank|CPSF7_ENST00000340437.4_5'Flank|RP11-286N22.8_ENST00000543044.1_5'UTR	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						GGTGTCTACAGTGTTCTCGAC	0.637																																					p.V6L		.											.	SDHAF2	92	0			c.G16T						.						71.0	74.0	73.0					11																	61197634		2202	4299	6501	SO:0001631	upstream_gene_variant	54949	exon1			TCTACAGTGTTCT		CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198		11.37:g.61197634G>T	Exception_encountered	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	12.0	NM_017841	B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	ENST00000394888.4	37	CCDS44619.1	.	.	.	.	.	.	.	.	.	.	g	13.23	2.175354	0.38413	.	.	ENSG00000256591;ENSG00000167985;ENSG00000167985	ENST00000541135;ENST00000301761;ENST00000543265	T;T;T	0.79247	-1.25;-1.09;-1.17	4.72	1.62	0.23740	.	1.596220	0.02981	N	0.145639	T	0.65037	0.2653	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44757	-0.9307	10	0.29301	T	0.29	0.0216	3.692	0.08350	0.2189:0.0:0.5824:0.1986	.	6	Q9NX18	SDHF2_HUMAN	L	6	ENSP00000443130:V6L;ENSP00000301761:V6L;ENSP00000443660:V6L	ENSP00000440939:V6L	V	+	1	0	SDHAF2;RP11-286N22.8	60954210	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.721000	0.25911	0.231000	0.21079	0.556000	0.70494	GTG	.		0.637	CPSF7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347835.2	NM_024811	
SEMA3A	10371	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	83610674	83610674	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr7:83610674C>A	ENST00000265362.4	-	14	1929	c.1615G>T	c.(1615-1617)Ggt>Tgt	p.G539C	SEMA3A_ENST00000436949.1_Missense_Mutation_p.G539C	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	539					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CATGCAGAACCATCCCAAGCA	0.458																																					p.G539C		.											.	SEMA3A	156	0			c.G1615T						.						73.0	66.0	68.0					7																	83610674		2203	4300	6503	SO:0001583	missense	10371	exon14			CAGAACCATCCCA	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1615G>T	7.37:g.83610674C>A	ENSP00000265362:p.Gly539Cys	Somatic	256.0	1.0		WXS	Illumina HiSeq	Phase_I	160.0	50.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606179	0.66445	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.23348	1.91;1.91	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.62853	0.2462	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.70766	-0.4783	10	0.87932	D	0	.	19.8579	0.96771	0.0:1.0:0.0:0.0	.	539	Q14563	SEM3A_HUMAN	C	539	ENSP00000265362:G539C;ENSP00000415260:G539C	ENSP00000265362:G539C	G	-	1	0	SEMA3A	83448610	1.000000	0.71417	0.984000	0.44739	0.029000	0.11900	7.770000	0.85390	2.687000	0.91594	0.655000	0.94253	GGT	.		0.458	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SHROOM4	57477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	50376662	50376662	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chrX:50376662G>A	ENST00000289292.7	-	4	2694	c.2411C>T	c.(2410-2412)cCa>cTa	p.P804L	SHROOM4_ENST00000376020.2_Missense_Mutation_p.P804L|SHROOM4_ENST00000460112.3_Missense_Mutation_p.P688L			Q9ULL8	SHRM4_HUMAN	shroom family member 4	804					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					TATAGGTTTTGGTCTCTGGGT	0.438																																					p.P804L		.											.	SHROOM4	131	0			c.C2411T						.						118.0	109.0	112.0					X																	50376662		2203	4300	6503	SO:0001583	missense	57477	exon4			GGTTTTGGTCTCT	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.2411C>T	X.37:g.50376662G>A	ENSP00000289292:p.Pro804Leu	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	72.0	NM_020717	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	37	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.557934	0.45590	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	D;D;D	0.87650	-2.28;-2.28;-2.28	5.92	5.06	0.68205	.	0.245301	0.34223	N	0.004145	T	0.80276	0.4593	L	0.32530	0.975	0.35986	D	0.836336	P	0.50272	0.933	B	0.41440	0.357	D	0.84080	0.0384	10	0.72032	D	0.01	.	9.1331	0.36857	0.0:0.1551:0.6808:0.1641	.	804	Q9ULL8	SHRM4_HUMAN	L	804;804;688	ENSP00000289292:P804L;ENSP00000365188:P804L;ENSP00000421450:P688L	ENSP00000289292:P804L	P	-	2	0	SHROOM4	50393402	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.307000	0.51888	1.230000	0.43646	0.600000	0.82982	CCA	.		0.438	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
SKIDA1	387640	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	21805067	21805067	+	Missense_Mutation	SNP	T	T	C	rs199700139		TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr10:21805067T>C	ENST00000449193.2	-	4	3937	c.1685A>G	c.(1684-1686)aAt>aGt	p.N562S	SKIDA1_ENST00000444772.3_Missense_Mutation_p.N483S	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	481						nucleus (GO:0005634)											CTTTACAGCATTGGAAATTTC	0.483																																					p.N562S		.											.	.	.	0			c.A1685G						.	T	SER/ASN	0,3874		0,0,1937	85.0	86.0	85.0		1685	3.7	1.0	10		85	1,8285		0,1,4142	yes	missense	C10orf140	NM_207371.3	46	0,1,6079	CC,CT,TT		0.0121,0.0,0.0082	benign	562/909	21805067	1,12159	1937	4143	6080	SO:0001583	missense	387640	exon4			ACAGCATTGGAAA	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1685A>G	10.37:g.21805067T>C	ENSP00000410041:p.Asn562Ser	Somatic	133.0	1.0		WXS	Illumina HiSeq	Phase_I	72.0	26.0	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	37	CCDS44363.1	.	.	.	.	.	.	.	.	.	.	T	0.096	-1.159293	0.01686	0.0	1.21E-4	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	5.88	3.74	0.42951	.	0.609558	0.17253	N	0.181088	T	0.16128	0.0388	N	0.12746	0.255	0.24955	N	0.991761	B	0.02656	0.0	B	0.01281	0.0	T	0.14254	-1.0479	9	0.18276	T	0.48	-1.6653	3.2325	0.06754	0.0:0.4981:0.2245:0.2773	.	562	E9PAX1	.	S	562;483	.	ENSP00000442432:N483S	N	-	2	0	C10orf140	21845073	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.185000	0.42584	1.483000	0.48342	-0.182000	0.12963	AAT	.		0.483	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
SLC7A13	157724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	87229802	87229802	+	Nonsense_Mutation	SNP	A	A	T	rs201235225		TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:87229802A>T	ENST00000297524.3	-	3	1179	c.1076T>A	c.(1075-1077)tTg>tAg	p.L359*	SLC7A13_ENST00000419776.2_Nonsense_Mutation_p.L350*|SLC7A13_ENST00000520624.1_5'Flank	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	359						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						ATAGTTTATCAAATCAATTAG	0.328																																					p.L359X		.											.	SLC7A13	90	0			c.T1076A						.						46.0	54.0	51.0					8																	87229802		2203	4298	6501	SO:0001587	stop_gained	157724	exon3			TTTATCAAATCAA	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.1076T>A	8.37:g.87229802A>T	ENSP00000297524:p.Leu359*	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	29.0	NM_138817	Q05C37|Q08AH9|Q96N84	Nonsense_Mutation	SNP	ENST00000297524.3	37	CCDS34917.1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.918491	0.52546	.	.	ENSG00000164893	ENST00000297524;ENST00000419776	.	.	.	5.27	5.27	0.74061	.	0.000000	0.48767	D	0.000164	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4479	0.61151	1.0:0.0:0.0:0.0	.	.	.	.	X	359;350	.	ENSP00000297524:L359X	L	-	2	0	SLC7A13	87298918	0.997000	0.39634	0.627000	0.29227	0.106000	0.19336	5.073000	0.64395	2.102000	0.63906	0.528000	0.53228	TTG	A|0.999;G|0.001		0.328	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817	
SLC9B1	150159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	103912818	103912818	+	Silent	SNP	T	T	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr4:103912818T>C	ENST00000296422.7	-	2	192	c.51A>G	c.(49-51)caA>caG	p.Q17Q	SLC9B1_ENST00000394789.3_Silent_p.Q17Q	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	17					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TTGTAGATGTTTGGAAGTTTT	0.249																																					p.Q17Q		.											.	.	.	0			c.A51G						.						48.0	48.0	48.0					4																	103912818		2196	4291	6487	SO:0001819	synonymous_variant	150159	exon2			AGATGTTTGGAAG	AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.51A>G	4.37:g.103912818T>C		Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	9.0	NM_001100874	A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Silent	SNP	ENST00000296422.7	37	CCDS34041.1																																																																																			.		0.249	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173	
SLCO5A1	81796	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	70591818	70591818	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:70591818G>A	ENST00000260126.4	-	8	2525	c.1819C>T	c.(1819-1821)Cgc>Tgc	p.R607C	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.R552C|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.R607C	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	607						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.R607C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			ATCACTTGGCGACTTTGGACA	0.453																																					p.R607C		.											.	SLCO5A1	94	1	Substitution - Missense(1)	kidney(1)	c.C1819T						.						142.0	133.0	136.0					8																	70591818		2203	4300	6503	SO:0001583	missense	81796	exon8			CTTGGCGACTTTG	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1819C>T	8.37:g.70591818G>A	ENSP00000260126:p.Arg607Cys	Somatic	183.0	1.0		WXS	Illumina HiSeq	Phase_I	164.0	41.0	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916520	0.73098	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.42900	1.07;1.44;0.96	5.8	4.92	0.64577	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000005	T	0.54334	0.1852	L	0.31926	0.97	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.991;0.977	T	0.55698	-0.8100	10	0.48119	T	0.1	.	16.2099	0.82148	0.0:0.0:0.8658:0.1342	.	552;607;607	E9PKK5;Q9H2Y9;G3V1C0	.;SO5A1_HUMAN;.	C	607;607;552	ENSP00000260126:R607C;ENSP00000434422:R607C;ENSP00000431611:R552C	ENSP00000260126:R607C	R	-	1	0	SLCO5A1	70754372	1.000000	0.71417	0.993000	0.49108	0.772000	0.43724	4.750000	0.62162	1.425000	0.47237	0.655000	0.94253	CGC	.		0.453	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
SLIT2	9353	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	20512134	20512134	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr4:20512134A>G	ENST00000504154.1	+	10	1183	c.931A>G	c.(931-933)Aca>Gca	p.T311A	SLIT2_ENST00000273739.5_Missense_Mutation_p.T315A|SLIT2_ENST00000503837.1_Missense_Mutation_p.T315A|SLIT2_ENST00000503823.1_Missense_Mutation_p.T311A	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	311					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GGAACAGAACACAATCAAAGT	0.318																																					p.T311A		.											SLIT2,brain,glioma,-2	SLIT2	521	0			c.A931G						.						104.0	113.0	110.0					4																	20512134		2203	4300	6503	SO:0001583	missense	9353	exon10			CAGAACACAATCA	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.931A>G	4.37:g.20512134A>G	ENSP00000422591:p.Thr311Ala	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	4.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	A	8.767	0.924957	0.18056	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.5	2.94	0.34122	.	0.122223	0.56097	D	0.000026	T	0.19287	0.0463	N	0.00991	-1.07	0.25653	N	0.98608	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23583	-1.0184	10	0.13108	T	0.6	.	8.9132	0.35565	0.1266:0.0:0.1289:0.7445	.	311;311	O94813-3;O94813	.;SLIT2_HUMAN	A	311;311;315;315;315	ENSP00000427548:T311A;ENSP00000422591:T311A;ENSP00000273739:T315A;ENSP00000422261:T315A	ENSP00000273739:T315A	T	+	1	0	SLIT2	20121232	0.993000	0.37304	0.998000	0.56505	0.951000	0.60555	1.035000	0.30216	0.345000	0.23873	-0.429000	0.05907	ACA	.		0.318	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
SMC5	23137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	72879295	72879295	+	Silent	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr9:72879295G>T	ENST00000361138.5	+	2	319	c.261G>T	c.(259-261)tcG>tcT	p.S87S		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	87					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						CAGGGAAGTCGAGCATTGTGT	0.373																																					p.S87S		.											.	SMC5	229	0			c.G261T						.						143.0	140.0	141.0					9																	72879295		2203	4300	6503	SO:0001819	synonymous_variant	23137	exon2			GAAGTCGAGCATT	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.261G>T	9.37:g.72879295G>T		Somatic	291.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	69.0	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Silent	SNP	ENST00000361138.5	37	CCDS6632.1																																																																																			.		0.373	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
SNCA	6622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	90756778	90756778	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr4:90756778C>T	ENST00000394986.1	-	2	462	c.41G>A	c.(40-42)gGa>gAa	p.G14E	SNCA_ENST00000508895.1_Missense_Mutation_p.G14E|SNCA_ENST00000345009.4_Missense_Mutation_p.G14E|RP11-67M1.1_ENST00000501215.1_RNA|SNCA_ENST00000394991.3_Missense_Mutation_p.G14E|SNCA_ENST00000420646.2_Missense_Mutation_p.G14E|SNCA_ENST00000502987.1_Missense_Mutation_p.G14E|SNCA_ENST00000505199.1_Missense_Mutation_p.G14E|RP11-67M1.1_ENST00000513653.1_RNA|SNCA_ENST00000506244.1_Missense_Mutation_p.G14E|SNCA_ENST00000336904.3_Missense_Mutation_p.G14E|SNCA_ENST00000394989.2_Missense_Mutation_p.G14E			P37840	SYUA_HUMAN	synuclein, alpha (non A4 component of amyloid precursor)	14					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adult locomotory behavior (GO:0008344)|aging (GO:0007568)|behavioral response to cocaine (GO:0048148)|cellular response to copper ion (GO:0071280)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to oxidative stress (GO:0034599)|dopamine biosynthetic process (GO:0042416)|dopamine uptake involved in synaptic transmission (GO:0051583)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|long-term synaptic potentiation (GO:0060291)|microglial cell activation (GO:0001774)|mitochondrial ATP synthesis coupled electron transport (GO:0042775)|mitochondrial membrane organization (GO:0007006)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dopamine metabolic process (GO:0045963)|negative regulation of dopamine uptake involved in synaptic transmission (GO:0051585)|negative regulation of exocytosis (GO:0045920)|negative regulation of histone acetylation (GO:0035067)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of monooxygenase activity (GO:0032769)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of norepinephrine uptake (GO:0051622)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of serotonin uptake (GO:0051612)|negative regulation of thrombin receptor signaling pathway (GO:0070495)|negative regulation of transporter activity (GO:0032410)|neutral lipid metabolic process (GO:0006638)|oxidation-reduction process (GO:0055114)|phospholipid metabolic process (GO:0006644)|positive regulation of endocytosis (GO:0045807)|positive regulation of glutathione peroxidase activity (GO:1903284)|positive regulation of hydrogen peroxide catabolic process (GO:1903285)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of receptor recycling (GO:0001921)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein destabilization (GO:0031648)|receptor internalization (GO:0031623)|regulation of acyl-CoA biosynthetic process (GO:0050812)|regulation of dopamine secretion (GO:0014059)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glutamate secretion (GO:0014048)|regulation of locomotion (GO:0040012)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of macrophage activation (GO:0043030)|regulation of neuron death (GO:1901214)|regulation of phospholipase activity (GO:0010517)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|response to iron(II) ion (GO:0010040)|response to lipopolysaccharide (GO:0032496)|response to magnesium ion (GO:0032026)|synapse organization (GO:0050808)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular region (GO:0005576)|fibril (GO:0043205)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nuclear outer membrane (GO:0005640)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribosome (GO:0005840)|rough endoplasmic reticulum (GO:0005791)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	alpha-tubulin binding (GO:0043014)|calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|dynein binding (GO:0045502)|ferrous iron binding (GO:0008198)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|oxidoreductase activity (GO:0016491)|phospholipid binding (GO:0005543)|phosphoprotein binding (GO:0051219)|tau protein binding (GO:0048156)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.42e-05)		AGCCACAACTCCCTCCTTGGC	0.428																																					p.G14E		.											.	SNCA	90	0			c.G41A						.						135.0	124.0	128.0					4																	90756778		2203	4300	6503	SO:0001583	missense	6622	exon2			ACAACTCCCTCCT	L08850	CCDS3634.1, CCDS43252.1	4q21.3-q22	2014-05-22			ENSG00000145335	ENSG00000145335		"""Parkinson disease"""	11138	protein-coding gene	gene with protein product		163890	"""Parkinson disease (autosomal dominant, Lewy body) 4"""	PARK1, PARK4		8248242, 14593171	Standard	NM_000345		Approved	NACP, PD1, alpha-synuclein	uc003hsr.3	P37840	OTTHUMG00000130948	ENST00000394986.1:c.41G>A	4.37:g.90756778C>T	ENSP00000378437:p.Gly14Glu	Somatic	200.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	60.0	NM_000345	A8K2A4|Q13701|Q4JHI3|Q6IAU6	Missense_Mutation	SNP	ENST00000394986.1	37	CCDS3634.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917650	0.92249	.	.	ENSG00000145335	ENST00000394989;ENST00000420646;ENST00000345009;ENST00000394986;ENST00000394991;ENST00000336904;ENST00000508895;ENST00000506244;ENST00000505199;ENST00000502987;ENST00000506691	D;D;D;D;D;D;D;D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96	4.28	4.28	0.50868	.	0.000000	0.64402	D	0.000001	D	0.95623	0.8577	M	0.70595	2.14	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.95931	0.8938	10	0.87932	D	0	-4.8285	18.1022	0.89509	0.0:1.0:0.0:0.0	.	14;14;14	P37840-3;P37840;P37840-2	.;SYUA_HUMAN;.	E	14	ENSP00000378440:G14E;ENSP00000396241:G14E;ENSP00000343683:G14E;ENSP00000378437:G14E;ENSP00000378442:G14E;ENSP00000338345:G14E;ENSP00000426955:G14E;ENSP00000422238:G14E;ENSP00000421485:G14E;ENSP00000426034:G14E;ENSP00000423445:G14E	ENSP00000338345:G14E	G	-	2	0	SNCA	90975801	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.467000	0.80930	2.701000	0.92244	0.644000	0.83932	GGA	.		0.428	SNCA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253547.2		
CAPN15	6650	ucsc.edu;mdanderson.org	37	16	601376	601376	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr16:601376G>A	ENST00000219611.2	+	8	2504	c.2141G>A	c.(2140-2142)cGc>cAc	p.R714H	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	714	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CTGGGCCTGCGCCCCCGGCAT	0.682																																					p.R714H		.											.	SOLH	523	0			c.G2141A						.						52.0	61.0	58.0					16																	601376		2200	4297	6497	SO:0001583	missense	6650	exon8			GCCTGCGCCCCCG	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.2141G>A	16.37:g.601376G>A	ENSP00000219611:p.Arg714His	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	15.0	3.0	NM_005632	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	37	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	g	29.2	4.989237	0.93106	.	.	ENSG00000103326	ENST00000219611	D	0.87809	-2.3	5.36	5.36	0.76844	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.91774	0.7398	L	0.49256	1.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92401	0.5929	10	0.72032	D	0.01	.	17.6567	0.88180	0.0:0.0:1.0:0.0	.	714	O75808	CAN15_HUMAN	H	714	ENSP00000219611:R714H	ENSP00000219611:R714H	R	+	2	0	SOLH	541377	1.000000	0.71417	0.995000	0.50966	0.793000	0.44817	9.745000	0.98856	2.509000	0.84616	0.556000	0.70494	CGC	.		0.682	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
SOX21	11166	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	95364066	95364066	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr13:95364066G>A	ENST00000376945.2	-	1	323	c.238C>T	c.(238-240)Cgg>Tgg	p.R80W	SOX21-AS1_ENST00000438290.2_lincRNA	NM_007084.2	NP_009015.1	Q9Y651	SOX21_HUMAN	SRY (sex determining region Y)-box 21	80					hair follicle development (GO:0001942)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6	all_neural(89;0.0646)|Medulloblastoma(90;0.163)					GGCTTGCGCCGCGGCCGGTAC	0.657																																					p.R80W		.											.	SOX21	514	0			c.C238T						.						70.0	65.0	67.0					13																	95364066		2203	4300	6503	SO:0001583	missense	11166	exon1			TGCGCCGCGGCCG	AF107044	CCDS9473.1	13q31-q32	2008-07-18			ENSG00000125285	ENSG00000125285		"""SRY (sex determining region Y)-boxes"""	11197	protein-coding gene	gene with protein product	"""SRY-box 21"""	604974				10441749	Standard	NM_007084		Approved	SOX25	uc001vma.3	Q9Y651	OTTHUMG00000017209	ENST00000376945.2:c.238C>T	13.37:g.95364066G>A	ENSP00000366144:p.Arg80Trp	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	63.0	NM_007084	P35715|Q15504|Q5TBS1	Missense_Mutation	SNP	ENST00000376945.2	37	CCDS9473.1	.	.	.	.	.	.	.	.	.	.	g	15.18	2.758392	0.49468	.	.	ENSG00000125285	ENST00000376945	D	0.92348	-3.02	3.04	1.2	0.21068	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (1);	0.000000	0.64402	U	0.000008	D	0.94032	0.8088	M	0.72479	2.2	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	D	0.91498	0.5217	10	0.87932	D	0	.	6.7491	0.23477	0.1009:0.0:0.7251:0.174	.	80	Q9Y651	SOX21_HUMAN	W	80	ENSP00000366144:R80W	ENSP00000366144:R80W	R	-	1	2	SOX21	94162067	0.998000	0.40836	0.999000	0.59377	0.635000	0.38103	2.381000	0.44336	-0.019000	0.14055	-0.348000	0.07805	CGG	.		0.657	SOX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045467.4	NM_007084	
SPAG6	9576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	22675715	22675715	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr10:22675715G>T	ENST00000376624.3	+	5	647	c.505G>T	c.(505-507)Gtt>Ttt	p.V169F	SPAG6_ENST00000313311.6_Missense_Mutation_p.V169F|SPAG6_ENST00000376603.2_Missense_Mutation_p.V245F|SPAG6_ENST00000376601.1_Intron|RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000538630.1_Missense_Mutation_p.V144F	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	169					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						TGCAGGAGCTGTTCCTCTTTT	0.463																																					p.V169F		.											.	SPAG6	153	0			c.G505T						.						111.0	103.0	105.0					10																	22675715		2203	4300	6503	SO:0001583	missense	9576	exon5			GGAGCTGTTCCTC	AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.505G>T	10.37:g.22675715G>T	ENSP00000365811:p.Val169Phe	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	26.0	NM_172242	A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Missense_Mutation	SNP	ENST00000376624.3	37	CCDS7139.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.895267	0.72639	.	.	ENSG00000077327	ENST00000376624;ENST00000376603;ENST00000538630;ENST00000313311;ENST00000435326	T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;0.53	5.6	3.75	0.43078	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87916	0.6298	H	0.94771	3.58	0.80722	D	1	P;P;P;P	0.52577	0.925;0.953;0.954;0.911	P;P;P;P	0.62649	0.905;0.807;0.771;0.853	D	0.89225	0.3573	10	0.87932	D	0	-19.2613	10.9645	0.47403	0.2031:0.0:0.7969:0.0	.	144;245;169;169	B4DXZ4;O75602-3;O75602-2;O75602	.;.;.;SPAG6_HUMAN	F	169;245;144;169;245	ENSP00000365811:V169F;ENSP00000365788:V245F;ENSP00000441325:V144F;ENSP00000323599:V169F;ENSP00000406594:V245F	ENSP00000323599:V169F	V	+	1	0	SPAG6	22715721	1.000000	0.71417	0.727000	0.30756	0.977000	0.68977	4.132000	0.57977	0.841000	0.35020	0.563000	0.77884	GTT	.		0.463	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047187.1		
SPATA13	221178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	24864810	24864810	+	Silent	SNP	T	T	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr13:24864810T>C	ENST00000382095.4	+	8	1400	c.993T>C	c.(991-993)taT>taC	p.Y331Y	SPATA13_ENST00000424834.2_Silent_p.Y956Y|SPATA13_ENST00000343003.6_Silent_p.Y275Y|SPATA13_ENST00000399949.2_Silent_p.Y253Y|RP11-307N16.6_ENST00000382141.4_Silent_p.Y834Y|SPATA13_ENST00000409126.1_Silent_p.Y191Y|SPATA13_ENST00000382108.3_Silent_p.Y956Y	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	331	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		TTGCCATCTATTCCGAGTACT	0.567																																					p.Y956Y		.											.	SPATA13	229	0			c.T2868C						.						81.0	86.0	84.0					13																	24864810		2203	4300	6503	SO:0001819	synonymous_variant	221178	exon9			CATCTATTCCGAG	AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.993T>C	13.37:g.24864810T>C		Somatic	276.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	78.0	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Silent	SNP	ENST00000382095.4	37	CCDS9305.1	.	.	.	.	.	.	.	.	.	.	T	9.558	1.117774	0.20877	.	.	ENSG00000182957	ENST00000424834	.	.	.	5.34	-3.24	0.05094	.	.	.	.	.	T	0.62696	0.2449	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61123	-0.7126	4	.	.	.	.	13.2731	0.60172	0.0:0.4039:0.0:0.5961	.	.	.	.	L	994	.	.	F	+	1	0	SPATA13	23762810	0.926000	0.31397	0.877000	0.34402	0.946000	0.59487	0.031000	0.13710	-0.610000	0.05716	-0.375000	0.07067	TTC	.		0.567	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
SPHKAP	80309	broad.mit.edu;ucsc.edu;mdanderson.org	37	2	228881311	228881311	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr2:228881311G>T	ENST00000392056.3	-	7	4305	c.4259C>A	c.(4258-4260)tCa>tAa	p.S1420*	SPHKAP_ENST00000344657.5_Nonsense_Mutation_p.S1420*	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1420						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CGAGCAAAGTGATCGCCTTTT	0.458																																					p.S1420X		.											.	SPHKAP	167	0			c.C4259A						.						79.0	82.0	81.0					2																	228881311		2203	4300	6503	SO:0001587	stop_gained	80309	exon7			CAAAGTGATCGCC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4259C>A	2.37:g.228881311G>T	ENSP00000375909:p.Ser1420*	Somatic	150.0	1.0		WXS	Illumina HiSeq	Phase_I	117.0	48.0	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Nonsense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	41	8.798580	0.98958	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	.	.	.	5.66	3.78	0.43462	.	0.767289	0.12450	N	0.467871	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.1473	0.20293	0.1744:0.1506:0.675:0.0	.	.	.	.	X	1420	.	ENSP00000339886:S1420X	S	-	2	0	SPHKAP	228589555	0.020000	0.18652	0.002000	0.10522	0.355000	0.29361	1.214000	0.32419	1.318000	0.45170	0.655000	0.94253	TCA	.		0.458	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158604337	158604337	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr1:158604337G>A	ENST00000368147.4	-	39	5741	c.5561C>T	c.(5560-5562)aCt>aTt	p.T1854I		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1854					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCTCACCTGAGTAGCAGCTAA	0.383																																					p.T1854I		.											.	SPTA1	142	0			c.C5561T						.						188.0	171.0	177.0					1																	158604337		1928	4134	6062	SO:0001583	missense	6708	exon39			ACCTGAGTAGCAG	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5561C>T	1.37:g.158604337G>A	ENSP00000357129:p.Thr1854Ile	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	56.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	6.497	0.459910	0.12342	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.46819	0.86;0.86	5.64	2.81	0.32909	.	0.252307	0.20832	N	0.084865	T	0.12263	0.0298	N	0.21373	0.66	0.30554	N	0.765147	B	0.14438	0.01	B	0.17979	0.02	T	0.23547	-1.0185	10	0.19147	T	0.46	.	7.8622	0.29516	0.3011:0.0:0.6989:0.0	.	1854	P02549	SPTA1_HUMAN	I	1854	ENSP00000357130:T1854I;ENSP00000357129:T1854I	ENSP00000357129:T1854I	T	-	2	0	SPTA1	156870961	1.000000	0.71417	0.997000	0.53966	0.906000	0.53458	3.524000	0.53495	0.501000	0.28013	-0.157000	0.13467	ACT	.		0.383	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SPTB	6710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	65260364	65260364	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr14:65260364G>A	ENST00000389721.5	-	13	2049	c.2017C>T	c.(2017-2019)Ctc>Ttc	p.L673F	SPTB_ENST00000556626.1_Missense_Mutation_p.L673F|SPTB_ENST00000389722.3_Missense_Mutation_p.L673F|SPTB_ENST00000542895.1_Missense_Mutation_p.L673F|SPTB_ENST00000389720.3_Missense_Mutation_p.L673F	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	673					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TGTAAGATGAGCACACTGGTC	0.547																																					p.L673F		.											.	SPTB	100	0			c.C2017T						.						119.0	85.0	96.0					14																	65260364		2203	4300	6503	SO:0001583	missense	6710	exon13			AGATGAGCACACT		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.2017C>T	14.37:g.65260364G>A	ENSP00000374371:p.Leu673Phe	Somatic	244.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	77.0	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	G	9.838	1.190293	0.21954	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	5.02	4.1	0.47936	.	0.000000	0.64402	D	0.000002	T	0.46776	0.1410	M	0.74881	2.28	0.40999	D	0.984916	B;B	0.29037	0.128;0.231	B;B	0.34301	0.179;0.179	T	0.40850	-0.9541	10	0.23302	T	0.38	.	9.058	0.36416	0.0857:0.1517:0.7626:0.0	.	673;677	P11277;Q59FP5	SPTB1_HUMAN;.	F	677;673;673;673;673;673	ENSP00000374372:L673F;ENSP00000451752:L673F;ENSP00000374371:L673F;ENSP00000443882:L673F;ENSP00000374370:L673F	ENSP00000374370:L673F	L	-	1	0	SPTB	64330117	0.737000	0.28175	0.977000	0.42913	0.952000	0.60782	0.797000	0.26999	2.494000	0.84150	0.561000	0.74099	CTC	.		0.547	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
TBL3	10607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2026901	2026901	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr16:2026901C>T	ENST00000568546.1	+	14	1507	c.1379C>T	c.(1378-1380)aCa>aTa	p.T460I		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	460					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						TCCAAGAACACAGCCCCAGAC	0.607																																					p.T460I	Melanoma(118;616 1651 35077 38081 48633)	.											.	TBL3	90	0			c.C1379T						.						114.0	91.0	99.0					16																	2026901		2198	4300	6498	SO:0001583	missense	10607	exon14			AGAACACAGCCCC	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.1379C>T	16.37:g.2026901C>T	ENSP00000454836:p.Thr460Ile	Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	38.0	NM_006453	Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	ENST00000568546.1	37	CCDS10453.1	.	.	.	.	.	.	.	.	.	.	C	5.628	0.300504	0.10678	.	.	ENSG00000183751	ENST00000332704	.	.	.	5.27	0.796	0.18648	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.462635	0.20004	N	0.101267	T	0.36331	0.0963	M	0.61703	1.905	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.17137	-1.0379	9	0.19147	T	0.46	-0.2246	5.1339	0.14924	0.3416:0.4733:0.113:0.0721	.	222;460	A0JLS5;Q12788	.;TBL3_HUMAN	I	460	.	ENSP00000331815:T460I	T	+	2	0	TBL3	1966902	0.000000	0.05858	0.001000	0.08648	0.538000	0.34931	0.141000	0.16076	0.588000	0.29660	0.561000	0.74099	ACA	.		0.607	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250615.3	NM_006453	
TAOK2	9344	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	29994582	29994582	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr16:29994582C>T	ENST00000308893.4	+	12	2232	c.1189C>T	c.(1189-1191)Cgg>Tgg	p.R397W	TAOK2_ENST00000416441.2_Missense_Mutation_p.R224W|TAOK2_ENST00000543033.1_Missense_Mutation_p.R397W|TAOK2_ENST00000279394.3_Missense_Mutation_p.R397W	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	397	Glu-rich.				actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						CCCTGAAGCCCGGGAGATGGC	0.617																																					p.R397W		.											.	TAOK2	521	0			c.C1189T						.						45.0	41.0	42.0					16																	29994582		2197	4300	6497	SO:0001583	missense	9344	exon12			GAAGCCCGGGAGA	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.1189C>T	16.37:g.29994582C>T	ENSP00000310094:p.Arg397Trp	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	22.0	NM_004783	A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Missense_Mutation	SNP	ENST00000308893.4	37	CCDS10663.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.509159	0.44660	.	.	ENSG00000149930	ENST00000416441;ENST00000308893;ENST00000543033;ENST00000279394	T;T;T	0.30182	1.54;1.54;1.54	5.24	1.95	0.26073	.	0.131951	0.47852	D	0.000209	T	0.21718	0.0523	N	0.08118	0	0.39578	D	0.969385	D;D;D;P;D	0.71674	0.997;0.998;0.987;0.784;0.983	P;P;B;B;P	0.55923	0.617;0.787;0.432;0.075;0.586	T	0.06180	-1.0841	9	.	.	.	.	6.5214	0.22277	0.3083:0.4626:0.2291:0.0	.	588;224;397;397;397	Q86V37;Q9UL54-3;Q9UL54-2;A0PJ48;Q9UL54	.;.;.;.;TAOK2_HUMAN	W	397	ENSP00000310094:R397W;ENSP00000440336:R397W;ENSP00000279394:R397W	.	R	+	1	2	TAOK2	29902083	0.999000	0.42202	0.999000	0.59377	0.156000	0.22039	0.599000	0.24089	0.551000	0.29008	0.563000	0.77884	CGG	.		0.617	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	NM_016151	
TEKT3	64518	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	15234365	15234365	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr17:15234365T>C	ENST00000395930.1	-	3	724	c.538A>G	c.(538-540)Aga>Gga	p.R180G	TEKT3_ENST00000338696.2_Missense_Mutation_p.R180G	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	180					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		CGCTCCAGTCTTTTCTTCACA	0.403																																					p.R180G		.											.	TEKT3	92	0			c.A538G						.						97.0	92.0	94.0					17																	15234365		2203	4300	6503	SO:0001583	missense	64518	exon3			CCAGTCTTTTCTT	AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.538A>G	17.37:g.15234365T>C	ENSP00000379263:p.Arg180Gly	Somatic	94.0	1.0		WXS	Illumina HiSeq	Phase_I	93.0	34.0	NM_031898	B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	ENST00000395930.1	37	CCDS11169.1	.	.	.	.	.	.	.	.	.	.	T	10.75	1.439212	0.25900	.	.	ENSG00000125409	ENST00000395930;ENST00000338696;ENST00000539245	T;T;T	0.03524	3.9;3.9;3.9	5.61	1.83	0.25207	.	0.281791	0.43747	D	0.000538	T	0.15003	0.0362	H	0.94462	3.54	0.29159	N	0.877887	B	0.33940	0.433	B	0.41174	0.349	T	0.10042	-1.0647	10	0.72032	D	0.01	-8.5785	14.7371	0.69424	0.0:0.0:0.5326:0.4674	.	180	Q9BXF9	TEKT3_HUMAN	G	180;180;14	ENSP00000379263:R180G;ENSP00000343995:R180G;ENSP00000443280:R14G	ENSP00000343995:R180G	R	-	1	2	TEKT3	15175090	0.996000	0.38824	0.489000	0.27452	0.038000	0.13279	2.094000	0.41719	0.453000	0.26858	-0.316000	0.08728	AGA	.		0.403	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130385.2	NM_031898	
TELO2	9894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	1545384	1545384	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr16:1545384G>C	ENST00000262319.6	+	3	652	c.373G>C	c.(373-375)Gcc>Ccc	p.A125P		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	125					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GCGGCTGCTGGCCAGATTCCT	0.692																																					p.A125P		.											.	TELO2	90	0			c.G373C						.						5.0	6.0	6.0					16																	1545384		2111	4145	6256	SO:0001583	missense	9894	exon3			CTGCTGGCCAGAT	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.373G>C	16.37:g.1545384G>C	ENSP00000262319:p.Ala125Pro	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	7.0	NM_016111	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	37	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.570224	0.45798	.	.	ENSG00000100726	ENST00000262319	D	0.85258	-1.96	5.34	2.97	0.34412	.	0.445445	0.23424	N	0.048340	T	0.81293	0.4792	L	0.57536	1.79	0.19300	N	0.999976	P	0.39665	0.682	B	0.40199	0.322	T	0.70995	-0.4720	10	0.33141	T	0.24	-11.1656	10.1187	0.42607	0.086:0.0:0.7725:0.1415	.	125	Q9Y4R8	TELO2_HUMAN	P	125	ENSP00000262319:A125P	ENSP00000262319:A125P	A	+	1	0	TELO2	1485385	1.000000	0.71417	0.837000	0.33122	0.165000	0.22458	4.829000	0.62737	1.222000	0.43521	0.655000	0.94253	GCC	.		0.692	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111	
TMEM71	137835	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133769495	133769495	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr8:133769495G>A	ENST00000356838.3	-	3	228	c.86C>T	c.(85-87)aCg>aTg	p.T29M	TMEM71_ENST00000523829.1_Missense_Mutation_p.T29M|TMEM71_ENST00000517538.1_5'UTR|TMEM71_ENST00000377901.4_Missense_Mutation_p.T29M	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	29						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GAAAATGCACGTGGGAGACAG	0.448																																					p.T29M		.											.	TMEM71	92	0			c.C86T						.						73.0	67.0	69.0					8																	133769495		2203	4300	6503	SO:0001583	missense	137835	exon3			ATGCACGTGGGAG	AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.86C>T	8.37:g.133769495G>A	ENSP00000349296:p.Thr29Met	Somatic	154.0	1.0		WXS	Illumina HiSeq	Phase_I	129.0	37.0	NM_144649	Q3KRC2|Q8WVZ4|Q96LX9	Missense_Mutation	SNP	ENST00000356838.3	37	CCDS6366.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427299	0.25726	.	.	ENSG00000165071	ENST00000523829;ENST00000356838;ENST00000377901;ENST00000519187;ENST00000519304	.	.	.	5.29	1.08	0.20341	.	0.982436	0.08320	N	0.963978	T	0.33614	0.0869	L	0.57536	1.79	0.09310	N	1	P;P;P	0.52170	0.951;0.951;0.895	B;B;B	0.39805	0.31;0.31;0.23	T	0.27606	-1.0069	9	0.59425	D	0.04	0.0626	9.364	0.38212	0.0:0.4808:0.3697:0.1496	.	29;29;29	Q6P5X7;Q6P5X7-3;Q6P5X7-2	TMM71_HUMAN;.;.	M	29	.	ENSP00000349296:T29M	T	-	2	0	TMEM71	133838677	0.001000	0.12720	0.002000	0.10522	0.049000	0.14656	0.290000	0.18975	0.321000	0.23259	0.579000	0.79373	ACG	.		0.448	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379591.1	NM_144649	
UNC80	285175	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	210841642	210841642	+	Silent	SNP	G	G	A			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr2:210841642G>A	ENST00000439458.1	+	57	8660	c.8580G>A	c.(8578-8580)ctG>ctA	p.L2860L	UNC80_ENST00000539183.1_Silent_p.L306L|UNC80_ENST00000272845.6_Silent_p.L2855L	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2860					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TTCAGCTGCTGGCCCAACCAG	0.483																																					p.L2860L		.											.	UNC80	90	0			c.G8580A						.						41.0	37.0	38.0					2																	210841642		692	1591	2283	SO:0001819	synonymous_variant	285175	exon57			GCTGCTGGCCCAA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.8580G>A	2.37:g.210841642G>A		Somatic	153.0	2.0		WXS	Illumina HiSeq	Phase_I	125.0	40.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	ENST00000439458.1	37	CCDS46504.1																																																																																			.		0.483	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
USPL1	10208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	31205167	31205167	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr13:31205167A>T	ENST00000255304.4	+	4	766	c.424A>T	c.(424-426)Aat>Tat	p.N142Y	USPL1_ENST00000465952.1_3'UTR	NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	142					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		CAGCAAACATAATGGAGAAGT	0.363																																					p.N142Y	Ovarian(60;318 1180 1554 28110 31601)	.											.	USPL1	524	0			c.A424T						.						68.0	69.0	69.0					13																	31205167		2203	4300	6503	SO:0001583	missense	10208	exon4			AAACATAATGGAG	X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.424A>T	13.37:g.31205167A>T	ENSP00000255304:p.Asn142Tyr	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	22.0	NM_005800	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	ENST00000255304.4	37	CCDS9336.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.492378	0.64074	.	.	ENSG00000132952	ENST00000255304	T	0.08720	3.06	6.07	-2.51	0.06365	.	0.799706	0.12362	N	0.475533	T	0.17066	0.0410	L	0.60455	1.87	0.09310	N	1	D	0.65815	0.995	D	0.63192	0.912	T	0.07790	-1.0754	10	0.66056	D	0.02	-7.5718	7.454	0.27255	0.4808:0.0:0.408:0.1112	.	142	Q5W0Q7	USPL1_HUMAN	Y	142	ENSP00000255304:N142Y	ENSP00000255304:N142Y	N	+	1	0	USPL1	30103167	0.000000	0.05858	0.000000	0.03702	0.407000	0.30961	-0.061000	0.11693	-0.279000	0.09167	-0.250000	0.11733	AAT	.		0.363	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800	
WWC2	80014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	184182073	184182073	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr4:184182073A>G	ENST00000403733.3	+	11	1496	c.1297A>G	c.(1297-1299)Agc>Ggc	p.S433G	WWC2_ENST00000448232.2_Missense_Mutation_p.S433G|WWC2_ENST00000504005.1_Missense_Mutation_p.S115G|WWC2_ENST00000378925.3_Missense_Mutation_p.S335G|WWC2_ENST00000513834.1_Missense_Mutation_p.S433G	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	433	Ser-rich.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		CCTCTCTGCCAGCACCCTGTC	0.517																																					p.S433G		.											.	WWC2	93	0			c.A1297G						.						31.0	30.0	31.0					4																	184182073		2202	4300	6502	SO:0001583	missense	80014	exon11			TCTGCCAGCACCC	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.1297A>G	4.37:g.184182073A>G	ENSP00000384222:p.Ser433Gly	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	33.0	NM_024949	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	ENST00000403733.3	37	CCDS34109.2	.	.	.	.	.	.	.	.	.	.	A	23.9	4.474497	0.84640	.	.	ENSG00000151718	ENST00000403733;ENST00000378925;ENST00000513834;ENST00000448232;ENST00000504005	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.69115	0.3075	M	0.81497	2.545	0.58432	D	0.999998	D	0.69078	0.997	D	0.75020	0.985	T	0.73522	-0.3956	10	0.56958	D	0.05	-20.6401	14.628	0.68635	1.0:0.0:0.0:0.0	.	433	Q6AWC2	WWC2_HUMAN	G	433;335;433;433;115	ENSP00000384222:S433G;ENSP00000368205:S335G;ENSP00000425054:S433G;ENSP00000398577:S433G;ENSP00000427569:S115G	ENSP00000368205:S335G	S	+	1	0	WWC2	184419067	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.097000	0.94193	2.046000	0.60703	0.528000	0.53228	AGC	.		0.517	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
ZNF37A	7587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	38406925	38406925	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr10:38406925G>T	ENST00000361085.5	+	7	1191	c.846G>T	c.(844-846)caG>caT	p.Q282H	ZNF37A_ENST00000351773.3_Missense_Mutation_p.Q282H	NM_001178101.1|NM_003421.2	NP_001171572.1|NP_003412.1	P17032	ZN37A_HUMAN	zinc finger protein 37A	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|prostate(1)	28						CCTTCACCCAGAAGTCAGCCC	0.388																																					p.Q282H		.											.	ZNF37A	90	0			c.G846T						.						73.0	76.0	75.0					10																	38406925		2202	4300	6502	SO:0001583	missense	7587	exon7			CACCCAGAAGTCA	X69115	CCDS31183.1	10p11.2	2013-01-08	2006-05-11		ENSG00000075407	ENSG00000075407		"""Zinc fingers, C2H2-type"", ""-"""	13102	protein-coding gene	gene with protein product			"""zinc finger protein 37a (KOX 21)"""			2014798, 8464732	Standard	NM_001178101		Approved	KOX21, ZNF37	uc001izl.3	P17032	OTTHUMG00000017990	ENST00000361085.5:c.846G>T	10.37:g.38406925G>T	ENSP00000354377:p.Gln282His	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	11.0	NM_003421	B3KRQ3|D3DRZ3|Q96B88	Missense_Mutation	SNP	ENST00000361085.5	37	CCDS31183.1	.	.	.	.	.	.	.	.	.	.	G	7.786	0.710557	0.15239	.	.	ENSG00000075407	ENST00000351773;ENST00000361085	T;T	0.17054	2.3;2.3	2.34	1.41	0.22369	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10723	0.0262	L	0.39085	1.19	0.09310	N	1	B	0.17268	0.021	B	0.14578	0.011	T	0.37220	-0.9715	9	0.20519	T	0.43	.	3.0136	0.06052	0.1588:0.0:0.5766:0.2646	.	282	P17032	ZN37A_HUMAN	H	282	ENSP00000329141:Q282H;ENSP00000354377:Q282H	ENSP00000329141:Q282H	Q	+	3	2	ZNF37A	38446931	0.000000	0.05858	0.981000	0.43875	0.734000	0.41952	-4.049000	0.00305	0.324000	0.23333	0.591000	0.81541	CAG	.		0.388	ZNF37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047624.2	NM_003421	
ZNF423	23090	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	49671538	49671538	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr16:49671538T>G	ENST00000561648.1	-	4	1578	c.1525A>C	c.(1525-1527)Aac>Cac	p.N509H	ZNF423_ENST00000562520.1_Missense_Mutation_p.N449H|ZNF423_ENST00000562871.1_Missense_Mutation_p.N449H|ZNF423_ENST00000262383.2_Missense_Mutation_p.N509H|ZNF423_ENST00000535559.1_Missense_Mutation_p.N392H|ZNF423_ENST00000567169.1_Missense_Mutation_p.N392H|ZNF423_ENST00000563137.2_Missense_Mutation_p.N449H	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	509					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TCAGAGGGGTTGGCGTTGGGG	0.577																																					p.N509H		.											.	ZNF423	228	0			c.A1525C						.						86.0	82.0	83.0					16																	49671538		2198	4300	6498	SO:0001583	missense	23090	exon4			AGGGGTTGGCGTT	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1525A>C	16.37:g.49671538T>G	ENSP00000455426:p.Asn509His	Somatic	110.0	1.0		WXS	Illumina HiSeq	Phase_I	84.0	32.0	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	T	0.643	-0.812592	0.02798	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.08634	3.07;3.12	4.64	0.983	0.19767	.	0.240277	0.41938	N	0.000786	T	0.03651	0.0104	N	0.08118	0	0.27273	N	0.958327	B	0.32101	0.356	B	0.34931	0.192	T	0.42916	-0.9423	9	.	.	.	.	5.8255	0.18550	0.0:0.1546:0.1412:0.7042	.	509	Q2M1K9	ZN423_HUMAN	H	509;392	ENSP00000262383:N509H;ENSP00000442321:N392H	.	N	-	1	0	ZNF423	48229039	0.998000	0.40836	0.412000	0.26496	0.166000	0.22503	0.590000	0.23954	0.131000	0.18576	0.459000	0.35465	AAC	.		0.577	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
ZNF440	126070	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11942559	11942559	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:11942559C>G	ENST00000304060.5	+	4	732	c.568C>G	c.(568-570)Cac>Gac	p.H190D		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	190					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TGTTCGAAGACACATGGTAAT	0.393																																					p.H190D		.											.	ZNF440	68	0			c.C568G						.						130.0	131.0	131.0					19																	11942559		2203	4300	6503	SO:0001583	missense	126070	exon4			CGAAGACACATGG	AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.568C>G	19.37:g.11942559C>G	ENSP00000305373:p.His190Asp	Somatic	226.0	2.0		WXS	Illumina HiSeq	Phase_I	176.0	78.0	NM_152357	Q8N1R9	Missense_Mutation	SNP	ENST00000304060.5	37	CCDS42503.1	.	.	.	.	.	.	.	.	.	.	c	13.05	2.120210	0.37436	.	.	ENSG00000171295	ENST00000304060;ENST00000427505	D;D	0.86769	-2.17;-2.17	1.11	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95762	0.8621	H	0.99336	4.52	0.18873	N	0.999985	D	0.89917	1.0	D	0.80764	0.994	D	0.86683	0.1918	9	0.87932	D	0	.	9.7494	0.40466	0.0:1.0:0.0:0.0	.	190	Q8IYI8	ZN440_HUMAN	D	190;193	ENSP00000305373:H190D;ENSP00000393489:H193D	ENSP00000305373:H190D	H	+	1	0	ZNF440	11803559	0.497000	0.26067	0.011000	0.14972	0.021000	0.10359	2.448000	0.44926	0.924000	0.37069	0.205000	0.17691	CAC	.		0.393	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344508.1	NM_152357	
ZNF676	163223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	22362974	22362974	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NF-01A-11D-A27I-10	TCGA-DD-A4NF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	22ec33a5-0591-489b-acaa-9a7dae5f9f59	b191ad27-9a0d-4b6e-9e4f-b019a8aa53be	g.chr19:22362974G>C	ENST00000397121.2	-	3	1862	c.1545C>G	c.(1543-1545)agC>agG	p.S515R		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TCGAGGACCAGCTGAAGGCTT	0.408																																					p.S515R		.											.	ZNF676	90	0			c.C1545G						.						63.0	66.0	65.0					19																	22362974		2151	4273	6424	SO:0001583	missense	163223	exon3			GGACCAGCTGAAG	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1545C>G	19.37:g.22362974G>C	ENSP00000380310:p.Ser515Arg	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	13.0	NM_001001411	A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	0.014	-1.577780	0.00879	.	.	ENSG00000196109	ENST00000397121	T	0.07216	3.21	0.81	-1.62	0.08372	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05135	0.0137	L	0.38175	1.15	0.09310	N	1	P	0.46621	0.881	B	0.40134	0.32	T	0.34279	-0.9835	9	0.13108	T	0.6	.	4.2702	0.10783	0.1971:0.0:0.587:0.2158	.	515	Q8N7Q3	ZN676_HUMAN	R	515	ENSP00000380310:S515R	ENSP00000380310:S515R	S	-	3	2	ZNF676	22154814	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-8.795000	0.00016	-1.122000	0.02945	-1.109000	0.02080	AGC	.		0.408	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
