#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAM19	8728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	156918883	156918885	+	In_Frame_Del	DEL	AAG	AAG	-	rs146858323	byFrequency	TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr5:156918883_156918885delAAG	ENST00000517905.1	-	17	1988_1990	c.1944_1946delCTT	c.(1942-1947)ttcttt>ttt	p.648_649FF>F	ADAM19_ENST00000394020.1_In_Frame_Del_p.650_651FF>F|ADAM19_ENST00000257527.4_In_Frame_Del_p.648_649FF>F|ADAM19_ENST00000430702.2_In_Frame_Del_p.381_382FF>F			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	648	Cys-rich.				heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTCAGTTTCAAAGAAGGAGGTGT	0.557																																					p.648_649del		.											.	ADAM19	294	0			c.1944_1946del						.																																			SO:0001651	inframe_deletion	8728	exon17			GTTTCAAAGAAGG	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.1944_1946delCTT	5.37:g.156918886_156918888delAAG	ENSP00000428654:p.Phe649del	Somatic	209.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	44.0	NM_033274	Q9BZL5|Q9UHP2	In_Frame_Del	DEL	ENST00000517905.1	37																																																																																				.		0.557	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274	
AKAP8	10270	broad.mit.edu;mdanderson.org	37	19	15484748	15484748	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr19:15484748C>A	ENST00000269701.2	-	4	280	c.220G>T	c.(220-222)Gcc>Tcc	p.A74S		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	74					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						ATGTGCATGGCAGGGGCCCCG	0.627																																					p.A74S	GBM(190;1671 2163 3274 27186 30476)	.											.	AKAP8	290	0			c.G220T						.						37.0	39.0	39.0					19																	15484748		2203	4300	6503	SO:0001583	missense	10270	exon4			GCATGGCAGGGGC	Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.220G>T	19.37:g.15484748C>A	ENSP00000269701:p.Ala74Ser	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	9.0	NM_005858		Missense_Mutation	SNP	ENST00000269701.2	37	CCDS12329.1	.	.	.	.	.	.	.	.	.	.	C	7.884	0.730846	0.15507	.	.	ENSG00000105127	ENST00000269701	T	0.44083	0.93	5.07	0.184	0.15086	.	1.054450	0.07427	N	0.895112	T	0.32010	0.0815	L	0.51422	1.61	0.51482	D	0.999921	B	0.10296	0.003	B	0.08055	0.003	T	0.27938	-1.0059	10	0.27082	T	0.32	-13.8548	2.9889	0.05977	0.1453:0.5448:0.1416:0.1682	.	74	O43823	AKAP8_HUMAN	S	74	ENSP00000269701:A74S	ENSP00000269701:A74S	A	-	1	0	AKAP8	15345748	0.000000	0.05858	0.785000	0.31869	0.019000	0.09904	-0.883000	0.04170	0.195000	0.20347	0.655000	0.94253	GCC	.		0.627	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3	NM_005858	
AKT2	208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40742001	40742001	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr19:40742001T>C	ENST00000392038.2	-	11	1269	c.971A>G	c.(970-972)gAc>gGc	p.D324G	AKT2_ENST00000311278.6_Missense_Mutation_p.D281G|AKT2_ENST00000579047.1_Missense_Mutation_p.D262G|AKT2_ENST00000424901.1_Missense_Mutation_p.D324G	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	324	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)	p.D324G(1)		breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			ATAGTCATTGTCCTCCAGCAC	0.637			A		"""ovarian, pancreatic """																																p.D324G		.		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	.	AKT2	978	1	Substitution - Missense(1)	kidney(1)	c.A971G						.						72.0	58.0	62.0					19																	40742001		2203	4300	6503	SO:0001583	missense	208	exon11			TCATTGTCCTCCA	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.971A>G	19.37:g.40742001T>C	ENSP00000375892:p.Asp324Gly	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	24.0	NM_001626	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	ENST00000392038.2	37	CCDS12552.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.661738	0.88154	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278;ENST00000391845	T;T;T	0.20069	2.1;2.1;2.1	5.66	5.66	0.87406	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042391	0.85682	D	0.000000	T	0.18173	0.0436	N	0.00778	-1.195	0.80722	D	1	B;B;D	0.76494	0.02;0.11;0.999	B;B;D	0.77004	0.116;0.196;0.989	T	0.56444	-0.7978	10	0.39692	T	0.17	.	14.8659	0.70416	0.0:0.0:0.0:1.0	.	262;281;324	B4DG79;Q0VAN0;P31751	.;.;AKT2_HUMAN	G	324;225;324;281;144	ENSP00000375892:D324G;ENSP00000399532:D324G;ENSP00000309428:D281G	ENSP00000309428:D281G	D	-	2	0	AKT2	45433841	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.994000	0.88315	2.159000	0.67721	0.459000	0.35465	GAC	.		0.637	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626	
ANAPC5	51433	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	121783834	121783834	+	Splice_Site	DEL	C	C	-			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr12:121783834delC	ENST00000261819.3	-	4	519	c.398delG	c.(397-399)ggt>gt	p.G133fs	ANAPC5_ENST00000541887.1_Splice_Site_p.G133fs|ANAPC5_ENST00000536366.1_Frame_Shift_Del_p.G12fs|ANAPC5_ENST00000344395.4_Splice_Site_p.G34fs|ANAPC5_ENST00000441917.2_Splice_Site_p.G34fs	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	133					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CAGAAACAAACCTACAAAATA	0.453																																					p.G133fs		.											.	ANAPC5	290	0			c.398delG						.						86.0	76.0	80.0					12																	121783834		2203	4300	6503	SO:0001630	splice_region_variant	51433	exon4			AACAAACCTACAA	AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.398-1G>-	12.37:g.121783834delC		Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	19.0	NM_016237	E9PFB2|Q8N4H7|Q9BQD4	Frame_Shift_Del	DEL	ENST00000261819.3	37	CCDS9220.1																																																																																			.		0.453	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402582.1		Frame_Shift_Del
ANGPTL1	9068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	178822882	178822882	+	Silent	SNP	A	A	G			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr1:178822882A>G	ENST00000234816.2	-	4	1311	c.864T>C	c.(862-864)caT>caC	p.H288H	ANGPTL1_ENST00000367629.1_Silent_p.H288H|RALGPS2_ENST00000367635.3_Intron|RALGPS2_ENST00000367634.2_Intron	NM_004673.3	NP_004664.1	O95841	ANGL1_HUMAN	angiopoietin-like 1	288	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			breast(2)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	14						CACTGACCGAATGCCCAGCTT	0.373																																					p.H288H		.											.	ANGPTL1	90	0			c.T864C						.						101.0	97.0	98.0					1																	178822882		2203	4300	6503	SO:0001819	synonymous_variant	9068	exon4			GACCGAATGCCCA	AF107253	CCDS1327.1	1q25.2	2013-02-06			ENSG00000116194	ENSG00000116194		"""Fibrinogen C domain containing"""	489	protein-coding gene	gene with protein product	"""angioarrestin"""	603874		ANGPT3		10025962, 9286704	Standard	NM_004673		Approved	ANG3, AngY, ARP1	uc001gma.3	O95841	OTTHUMG00000035075	ENST00000234816.2:c.864T>C	1.37:g.178822882A>G		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	19.0	NM_004673	Q5T5Z5	Silent	SNP	ENST00000234816.2	37	CCDS1327.1																																																																																			.		0.373	ANGPTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084924.1	NM_004673	
ANO8	57719	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17443815	17443815	+	Silent	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr19:17443815G>A	ENST00000159087.4	-	5	668	c.510C>T	c.(508-510)cgC>cgT	p.R170R	GTPBP3_ENST00000361619.5_5'Flank	NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	170					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GCAGCCAGAAGCGGATGATGC	0.622																																					p.R170R		.											.	ANO8	93	0			c.C510T						.						62.0	56.0	58.0					19																	17443815		2203	4300	6503	SO:0001819	synonymous_variant	57719	exon5			CCAGAAGCGGATG	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.510C>T	19.37:g.17443815G>A		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	29.0	NM_020959	A6NIJ0	Silent	SNP	ENST00000159087.4	37	CCDS32949.1																																																																																			.		0.622	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644	
APOB	338	hgsc.bcm.edu;bcgsc.ca	37	2	21229380	21229381	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr2:21229380_21229381insA	ENST00000233242.1	-	26	10486_10487	c.10359_10360insT	c.(10357-10362)actgtcfs	p.V3454fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3454	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGGAAGAGACAGTAGGTTTTG	0.391																																					p.V3454fs		.											APOB,back,malignant_melanoma,+2	APOB	175	0			c.10360_10361insT						.																																			SO:0001589	frameshift_variant	338	exon26			AAGAGACAGTAGG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10360dupT	2.37:g.21229381_21229381dupA	ENSP00000233242:p.Val3454fs	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	181.0	58.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.391	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
C11orf63	79864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	122774639	122774639	+	Silent	SNP	A	A	G			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr11:122774639A>G	ENST00000531316.1	+	2	443	c.351A>G	c.(349-351)caA>caG	p.Q117Q	C11orf63_ENST00000307257.6_Silent_p.Q117Q|C11orf63_ENST00000227349.2_Silent_p.Q117Q			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	117					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GCAGGCAACAACCAATAGAAG	0.433																																					p.Q117Q		.											.	C11orf63	93	0			c.A351G						.						170.0	191.0	184.0					11																	122774639		2202	4299	6501	SO:0001819	synonymous_variant	79864	exon3			GCAACAACCAATA	BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.351A>G	11.37:g.122774639A>G		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	24.0	NM_024806	A8K6G0|Q96GB5|Q9H5D6	Silent	SNP	ENST00000531316.1	37	CCDS8438.1																																																																																			.		0.433	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
C1RL	51279	ucsc.edu;bcgsc.ca	37	12	7249174	7249174	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr12:7249174G>A	ENST00000266542.4	-	6	1369	c.1277C>T	c.(1276-1278)aCg>aTg	p.T426M	C1RL_ENST00000545280.1_Intron|C1RL_ENST00000544702.1_3'UTR|C1RL_ENST00000504702.2_Intron	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	426	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GTGCCTTTGCGTCTCATCCCC	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0				p.T426M		.											.	C1RL	91	0			c.C1277T						.						151.0	144.0	146.0					12																	7249174		2203	4300	6503	SO:0001583	missense	51279	exon6			CTTTGCGTCTCAT	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.1277C>T	12.37:g.7249174G>A	ENSP00000266542:p.Thr426Met	Somatic	262.0	2.0		WXS	Illumina HiSeq	.	206.0	73.0	NM_016546	Q53GX9	Missense_Mutation	SNP	ENST00000266542.4	37	CCDS8573.1	.	.	.	.	.	.	.	.	.	.	G	2.462	-0.323939	0.05350	.	.	ENSG00000139178	ENST00000266542	T	0.44083	0.93	4.98	-5.31	0.02730	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.428750	0.03836	N	0.269762	T	0.36138	0.0956	L	0.47016	1.485	0.09310	N	0.999999	B	0.29612	0.251	B	0.23150	0.044	T	0.25012	-1.0144	10	0.36615	T	0.2	.	14.7057	0.69189	0.7726:0.0:0.2274:0.0	.	426	Q9NZP8	C1RL_HUMAN	M	426	ENSP00000266542:T426M	ENSP00000266542:T426M	T	-	2	0	C1RL	7140316	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-3.225000	0.00550	-1.523000	0.01767	-0.409000	0.06214	ACG	.		0.582	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	NM_016546	
C3	718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6693481	6693481	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr19:6693481C>A	ENST00000245907.6	-	25	3264	c.3172G>T	c.(3172-3174)Gcc>Tcc	p.A1058S		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1058					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TGTCTGAAGGCCAGCTGCTGG	0.642																																					p.A1058S		.											.	C3	95	0			c.G3172T						.						41.0	36.0	38.0					19																	6693481		2202	4300	6502	SO:0001583	missense	718	exon25			TGAAGGCCAGCTG	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.3172G>T	19.37:g.6693481C>A	ENSP00000245907:p.Ala1058Ser	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	9.0	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608901	0.46527	.	.	ENSG00000125730	ENST00000245907	T	0.30182	1.54	5.52	3.39	0.38822	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.249575	0.46145	D	0.000315	T	0.24314	0.0589	L	0.35288	1.05	0.34864	D	0.742877	B	0.30542	0.284	B	0.40982	0.345	T	0.16188	-1.0411	10	0.06891	T	0.86	.	9.5697	0.39420	0.0:0.8304:0.0:0.1696	.	1058	P01024	CO3_HUMAN	S	1058	ENSP00000245907:A1058S	ENSP00000245907:A1058S	A	-	1	0	C3	6644481	0.019000	0.18553	1.000000	0.80357	0.259000	0.26198	0.315000	0.19451	1.480000	0.48289	0.650000	0.86243	GCC	.		0.642	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
C7orf43	55262	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99754066	99754066	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr7:99754066T>A	ENST00000316937.3	-	8	1368	c.1183A>T	c.(1183-1185)Aat>Tat	p.N395Y	C7orf43_ENST00000498638.1_5'UTR|C7orf43_ENST00000419841.1_Missense_Mutation_p.N163Y|C7orf43_ENST00000457641.1_Missense_Mutation_p.N126Y|C7orf43_ENST00000394035.2_5'Flank|MIR4658_ENST00000584344.1_RNA	NM_018275.3	NP_060745.3	Q8WVR3	CG043_HUMAN	chromosome 7 open reading frame 43	395										breast(1)|endometrium(3)|large_intestine(3)|lung(2)|prostate(1)	10	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCTTGGAGATTGTTAAGCAGC	0.567																																					p.N395Y		.											.	C7orf43	90	0			c.A1183T						.						83.0	76.0	79.0					7																	99754066		2203	4300	6503	SO:0001583	missense	55262	exon8			GGAGATTGTTAAG		CCDS5687.1	7q22.1	2011-11-25			ENSG00000146826	ENSG00000146826			25604	protein-coding gene	gene with protein product						12477932	Standard	NM_018275		Approved	FLJ10925	uc003utr.3	Q8WVR3	OTTHUMG00000154862	ENST00000316937.3:c.1183A>T	7.37:g.99754066T>A	ENSP00000324741:p.Asn395Tyr	Somatic	225.0	1.0		WXS	Illumina HiSeq	Phase_I	313.0	86.0	NM_018275	A4D2A9|D6W5U4|Q9BQJ1|Q9BUB6|Q9NV47	Missense_Mutation	SNP	ENST00000316937.3	37	CCDS5687.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.75|14.75	2.628605|2.628605	0.46944|0.46944	.|.	.|.	ENSG00000146826|ENSG00000146826	ENST00000457641;ENST00000316937;ENST00000419841|ENST00000456769	T;T;T|.	0.53640|.	0.63;0.62;0.61|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.40956|0.40956	0.1138|0.1138	N|N	0.19112|0.19112	0.55|0.55	0.43259|0.43259	D|D	0.995191|0.995191	P;D|.	0.58268|.	0.926;0.982|.	B;P|.	0.54815|.	0.35;0.761|.	T|T	0.32640|0.32640	-0.9899|-0.9899	10|5	0.66056|.	D|.	0.02|.	-11.3416|-11.3416	8.466|8.466	0.32956|0.32956	0.0:0.0863:0.0:0.9137|0.0:0.0863:0.0:0.9137	.|.	163;395|.	E9PFF9;Q8WVR3|.	.;CG043_HUMAN|.	Y|L	126;395;163|300	ENSP00000396432:N126Y;ENSP00000324741:N395Y;ENSP00000406326:N163Y|.	ENSP00000324741:N395Y|.	N|Q	-|-	1|2	0|0	C7orf43|C7orf43	99592002|99592002	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.442000|0.442000	0.32017|0.32017	3.116000|3.116000	0.50399|0.50399	2.182000|2.182000	0.69389|0.69389	0.459000|0.459000	0.35465|0.35465	AAT|CAA	.		0.567	C7orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337395.2	NM_018275	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	181767517	181767517	+	Silent	SNP	G	G	A	rs377180948		TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr1:181767517G>A	ENST00000367573.2	+	48	6489	c.6489G>A	c.(6487-6489)ccG>ccA	p.P2163P	CACNA1E_ENST00000357570.5_Silent_p.P2114P|CACNA1E_ENST00000360108.3_Silent_p.P2144P|CACNA1E_ENST00000526775.1_Silent_p.P2101P|CACNA1E_ENST00000367567.4_Silent_p.P1727P|CACNA1E_ENST00000358338.5_Silent_p.P2052P|CACNA1E_ENST00000367570.1_Silent_p.P2120P	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2163					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.P2120P(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CACCCGTCCCGCCAAAGCCCC	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16398	0.0		0.0	False		,,,				2504	0.0				p.P2163P		.											CACNA1E,NS,carcinoma,0	CACNA1E	95	1	Substitution - coding silent(1)	ovary(1)	c.G6489A						.						79.0	91.0	87.0					1																	181767517		1989	4156	6145	SO:0001819	synonymous_variant	777	exon48			CGTCCCGCCAAAG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6489G>A	1.37:g.181767517G>A		Somatic	89.0	1.0		WXS	Illumina HiSeq	Phase_I	111.0	34.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1																																																																																			.		0.627	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CACNA2D4	93589	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	1953666	1953666	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr12:1953666C>T	ENST00000382722.5	-	25	2734	c.2372G>A	c.(2371-2373)aGc>aAc	p.S791N	CACNA2D4_ENST00000539048.2_5'UTR|CACNA2D4_ENST00000585732.1_Missense_Mutation_p.S652N|CACNA2D4_ENST00000585708.1_Missense_Mutation_p.S727N|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.S727N|CACNA2D4_ENST00000587995.1_Missense_Mutation_p.S766N|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.S791N	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	791					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GGTGAACACGCTGGCCTCGTC	0.577																																					p.S791N	Colon(2;101 179 21030 23310 28141)	.											.	CACNA2D4	23	0			c.G2372A						.						49.0	56.0	54.0					12																	1953666		2072	4212	6284	SO:0001583	missense	93589	exon25			AACACGCTGGCCT	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2372G>A	12.37:g.1953666C>T	ENSP00000372169:p.Ser791Asn	Somatic	145.0	1.0		WXS	Illumina HiSeq	Phase_I	210.0	75.0	NM_172364	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	ENST00000382722.5	37	CCDS44785.1	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.406957	0.01155	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.32272	1.46	5.04	3.2	0.36748	.	0.096626	0.64402	N	0.000001	T	0.16171	0.0389	L	0.28115	0.83	0.34566	D	0.712888	B;B	0.12013	0.001;0.005	B;B	0.10450	0.005;0.005	T	0.28332	-1.0047	10	0.02654	T	1	.	8.2915	0.31960	0.0:0.7393:0.0:0.2607	.	791;791	Q7Z3S7-2;Q7Z3S7	.;CA2D4_HUMAN	N	727;791;791	ENSP00000372169:S791N	ENSP00000280663:S791N	S	-	2	0	CACNA2D4	1823927	0.916000	0.31088	0.415000	0.26534	0.116000	0.19942	1.792000	0.38754	0.530000	0.28619	0.561000	0.74099	AGC	.		0.577	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		
CANX	821	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	179150758	179150758	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr5:179150758T>A	ENST00000247461.4	+	12	1696	c.1496T>A	c.(1495-1497)aTc>aAc	p.I499N	CANX_ENST00000504734.1_Missense_Mutation_p.I499N|CANX_ENST00000415618.2_Missense_Mutation_p.I534N|CANX_ENST00000452673.2_Missense_Mutation_p.I499N|CANX_ENST00000512607.2_Missense_Mutation_p.I391N	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	499					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	TTCCTGGTTATCCTCTTCTGC	0.433																																					p.I499N		.											.	CANX	90	0			c.T1496A						.						148.0	145.0	146.0					5																	179150758		2203	4300	6503	SO:0001583	missense	821	exon12			TGGTTATCCTCTT	L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.1496T>A	5.37:g.179150758T>A	ENSP00000247461:p.Ile499Asn	Somatic	149.0	1.0		WXS	Illumina HiSeq	Phase_I	103.0	34.0	NM_001746	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Missense_Mutation	SNP	ENST00000247461.4	37	CCDS4447.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.221407	0.58560	.	.	ENSG00000127022	ENST00000504734;ENST00000415618;ENST00000452673;ENST00000247461;ENST00000512607	T;T;T;T;T	0.53857	0.62;0.6;0.62;0.62;0.63	5.69	5.69	0.88448	.	0.314012	0.33834	N	0.004502	T	0.52008	0.1708	L	0.46157	1.445	0.54753	D	0.999987	P;P	0.44478	0.836;0.74	B;B	0.43386	0.418;0.24	T	0.57294	-0.7836	10	0.72032	D	0.01	-11.1308	15.6168	0.76773	0.0:0.0:0.0:1.0	.	534;499	B4DGP8;P27824	.;CALX_HUMAN	N	499;534;499;499;391	ENSP00000424063:I499N;ENSP00000394817:I534N;ENSP00000391646:I499N;ENSP00000247461:I499N;ENSP00000423588:I391N	ENSP00000247461:I499N	I	+	2	0	CANX	179083364	1.000000	0.71417	0.996000	0.52242	0.412000	0.31113	8.040000	0.89188	2.173000	0.68751	0.454000	0.30748	ATC	.		0.433	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253500.2	NM_001024649	
CCDC30	728621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	43076659	43076659	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr1:43076659G>A	ENST00000340612.4	+	9	1394	c.1394G>A	c.(1393-1395)aGc>aAc	p.S465N	CCDC30_ENST00000507855.1_Missense_Mutation_p.S254N|CCDC30_ENST00000428554.2_Missense_Mutation_p.S465N|CCDC30_ENST00000390640.4_Missense_Mutation_p.S254N|CCDC30_ENST00000342022.4_Missense_Mutation_p.S465N			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	465						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						CATGTCAAAAGCAACCAGGAA	0.353																																					p.S465N		.											.	CCDC30	90	0			c.G1394A						.						97.0	93.0	94.0					1																	43076659		2203	4300	6503	SO:0001583	missense	728621	exon10			TCAAAAGCAACCA	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1394G>A	1.37:g.43076659G>A	ENSP00000340378:p.Ser465Asn	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	9.0	NM_001080850	Q14F06|Q5VVM5	Missense_Mutation	SNP	ENST00000340612.4	37	CCDS30690.1	.	.	.	.	.	.	.	.	.	.	G	3.607	-0.080286	0.07141	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.68	-0.387	0.12463	.	0.599099	0.18985	N	0.125775	T	0.33294	0.0858	L	0.46741	1.465	0.29212	N	0.874542	B;B	0.20368	0.01;0.044	B;B	0.26416	0.015;0.069	T	0.17653	-1.0362	10	0.23891	T	0.37	.	4.1754	0.10349	0.4932:0.1846:0.3222:0.0	.	465;254	Q5VVM6;Q5VVM6-2	CCD30_HUMAN;.	N	465;254;465;465;254	ENSP00000397035:S465N;ENSP00000426711:S254N;ENSP00000340378:S465N;ENSP00000339280:S465N;ENSP00000375051:S254N	ENSP00000340378:S465N	S	+	2	0	CCDC30	42849246	0.997000	0.39634	0.991000	0.47740	0.008000	0.06430	0.388000	0.20735	0.026000	0.15269	-0.251000	0.11542	AGC	.		0.353	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019524.3	NM_025030	
CD1B	910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158301185	158301185	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr1:158301185G>T	ENST00000368168.3	-	1	136	c.29C>A	c.(28-30)gCt>gAt	p.A10D		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	10					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					AAAGAGAACAGCTAACAGTTG	0.468																																					p.A10D		.											.	CD1B	92	0			c.C29A						.						81.0	73.0	76.0					1																	158301185		2203	4300	6503	SO:0001583	missense	910	exon1			AGAACAGCTAACA	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.29C>A	1.37:g.158301185G>T	ENSP00000357150:p.Ala10Asp	Somatic	271.0	0.0		WXS	Illumina HiSeq	Phase_I	292.0	62.0	NM_001764	Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	ENST00000368168.3	37	CCDS1176.1	.	.	.	.	.	.	.	.	.	.	G	8.634	0.894454	0.17613	.	.	ENSG00000158485	ENST00000368168	T	0.01388	4.95	3.14	0.839	0.18907	.	0.870979	0.09334	N	0.816454	T	0.00998	0.0033	M	0.72118	2.19	0.09310	N	1	P;D	0.58268	0.947;0.982	P;P	0.48524	0.58;0.521	T	0.48019	-0.9071	10	0.23302	T	0.38	0.0619	5.6837	0.17790	0.3004:0.0:0.6996:0.0	.	10;10	B4E0D2;P29016	.;CD1B_HUMAN	D	10	ENSP00000357150:A10D	ENSP00000357150:A10D	A	-	2	0	CD1B	156567809	0.000000	0.05858	0.001000	0.08648	0.234000	0.25298	-0.905000	0.04075	0.218000	0.20820	0.650000	0.86243	GCT	.		0.468	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764	
CDNF	441549	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	14862095	14862095	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr10:14862095T>C	ENST00000378442.1	-	6	645	c.142A>G	c.(142-144)Atc>Gtc	p.I48V	CDNF_ENST00000378441.2_5'UTR			Q49AH0	CDNF_HUMAN	cerebral dopamine neurotrophic factor	150						extracellular region (GO:0005576)				breast(2)|large_intestine(2)|lung(1)	5						CTATGCAGGATCTGCTTCAGC	0.478																																					p.I150V		.											.	CDNF	90	0			c.A448G						.						131.0	131.0	131.0					10																	14862095		2203	4300	6503	SO:0001583	missense	441549	exon4			GCAGGATCTGCTT	BC037872	CCDS31148.1	10p13	2009-06-04	2009-06-04	2009-06-04	ENSG00000185267	ENSG00000185267			24913	protein-coding gene	gene with protein product	"""conserved dopamine neurotrophic factor"""	611233	"""arginine-rich, mutated in early stage tumors-like 1"""	ARMETL1		17611540	Standard	NM_001029954		Approved		uc001inb.1	Q49AH0	OTTHUMG00000017713	ENST00000378442.1:c.142A>G	10.37:g.14862095T>C	ENSP00000367703:p.Ile48Val	Somatic	93.0	1.0		WXS	Illumina HiSeq	Phase_I	155.0	39.0	NM_001029954	A2RUU0|B4DVW3	Missense_Mutation	SNP	ENST00000378442.1	37		.	.	.	.	.	.	.	.	.	.	T	21.4	4.147337	0.77888	.	.	ENSG00000185267	ENST00000378442;ENST00000465530	.	.	.	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.61813	0.2377	L	0.59967	1.855	0.47153	D	0.999339	B	0.27932	0.194	B	0.30782	0.12	T	0.61197	-0.7111	9	0.51188	T	0.08	-25.2449	15.3143	0.74062	0.0:0.0:0.0:1.0	.	150	Q49AH0	CDNF_HUMAN	V	48;150	.	ENSP00000367703:I48V	I	-	1	0	CDNF	14902101	1.000000	0.71417	0.904000	0.35570	0.836000	0.47400	4.945000	0.63568	2.264000	0.75181	0.533000	0.62120	ATC	.		0.478	CDNF-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000046919.1	NM_001029954	
CDYL	9425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	4935914	4935914	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr6:4935914G>C	ENST00000328908.5	+	5	1150	c.1019G>C	c.(1018-1020)aGa>aCa	p.R340T	CDYL_ENST00000449732.2_Missense_Mutation_p.R154T|CDYL_ENST00000472453.1_3'UTR|CDYL_ENST00000397588.3_Missense_Mutation_p.R286T|CDYL_ENST00000343762.5_Missense_Mutation_p.R154T			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	340					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		AGTGCCTACAGATACAGAGAT	0.463																																					p.R286T		.											.	CDYL	90	0			c.G857C						.						122.0	114.0	117.0					6																	4935914		2203	4300	6503	SO:0001583	missense	9425	exon3			CCTACAGATACAG	AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.1019G>C	6.37:g.4935914G>C	ENSP00000330512:p.Arg340Thr	Somatic	170.0	1.0		WXS	Illumina HiSeq	Phase_I	251.0	167.0	NM_004824	A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	SNP	ENST00000328908.5	37		.	.	.	.	.	.	.	.	.	.	G	18.86	3.714257	0.68730	.	.	ENSG00000153046	ENST00000328908;ENST00000440139;ENST00000397588;ENST00000449732;ENST00000343762	T;T;T;T	0.58060	0.75;0.36;0.39;0.39	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	N	0.25890	0.77	0.80722	D	1	B;B	0.32245	0.254;0.361	B;B	0.34590	0.139;0.186	T	0.10590	-1.0623	9	.	.	.	.	19.6321	0.95713	0.0:0.0:1.0:0.0	.	286;340	Q9Y232-2;Q9Y232	.;CDYL1_HUMAN	T	340;66;286;154;154	ENSP00000330512:R340T;ENSP00000380718:R286T;ENSP00000394076:R154T;ENSP00000340908:R154T	.	R	+	2	0	CDYL	4880913	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.640000	0.98453	2.884000	0.98904	0.655000	0.94253	AGA	.		0.463	CDYL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000039736.1	NM_004824	
CENPE	1062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	104066455	104066455	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr4:104066455T>C	ENST00000265148.3	-	32	4698	c.4609A>G	c.(4609-4611)Ata>Gta	p.I1537V	CENPE_ENST00000380026.3_Missense_Mutation_p.I1512V	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1537					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ATTTGTTTTATATTAAATTGT	0.294																																					p.I1537V		.											.	CENPE	277	0			c.A4609G						.						53.0	51.0	51.0					4																	104066455		2201	4298	6499	SO:0001583	missense	1062	exon32			GTTTTATATTAAA	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.4609A>G	4.37:g.104066455T>C	ENSP00000265148:p.Ile1537Val	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	14.0	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-2.934242	0.00053	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.66638	-0.21;-0.22	4.09	-5.37	0.02681	.	.	.	.	.	T	0.37812	0.1017	N	0.11427	0.14	0.09310	N	1	B;B	0.20261	0.043;0.001	B;B	0.17722	0.019;0.001	T	0.44620	-0.9316	9	0.02654	T	1	.	11.6933	0.51529	0.0:0.224:0.0:0.776	.	1512;1537	Q02224-3;Q02224	.;CENPE_HUMAN	V	1537;1537;1512	ENSP00000265148:I1537V;ENSP00000369365:I1512V	ENSP00000265148:I1537V	I	-	1	0	CENPE	104285904	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.273000	0.01164	-1.176000	0.02747	-0.404000	0.06349	ATA	.		0.294	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CEP290	80184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	88479875	88479875	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr12:88479875T>G	ENST00000552810.1	-	34	4721	c.4378A>C	c.(4378-4380)Att>Ctt	p.I1460L	CEP290_ENST00000547691.2_Missense_Mutation_p.I520L|CEP290_ENST00000397838.3_Missense_Mutation_p.I520L|CEP290_ENST00000309041.7_Missense_Mutation_p.I1462L	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1460					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTCTCCTTAATTTTCCTTAGA	0.343																																					p.I1460L		.											.	CEP290	96	0			c.A4378C						.						136.0	117.0	123.0					12																	88479875		1811	4066	5877	SO:0001583	missense	80184	exon34			CCTTAATTTTCCT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.4378A>C	12.37:g.88479875T>G	ENSP00000448012:p.Ile1460Leu	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	16.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	T	13.03	2.114262	0.37339	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.68331	0.25;-0.32;-0.32;0.25	5.78	3.34	0.38264	.	0.199343	0.51477	N	0.000095	T	0.58192	0.2105	L	0.51422	1.61	0.37309	D	0.909023	P	0.46327	0.876	P	0.47134	0.539	T	0.61417	-0.7067	10	0.05351	T	0.99	.	8.5254	0.33302	0.0:0.0652:0.2326:0.7022	.	1460	O15078	CE290_HUMAN	L	520;1460;1462;520	ENSP00000446905:I520L;ENSP00000448012:I1460L;ENSP00000308021:I1462L;ENSP00000380938:I520L	ENSP00000308021:I1462L	I	-	1	0	CEP290	87004006	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	3.478000	0.53158	0.414000	0.25790	0.455000	0.32223	ATT	.		0.343	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
CPSF3L	54973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	1257366	1257366	+	Intron	SNP	T	T	G			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr1:1257366T>G	ENST00000435064.1	-	2	111				CPSF3L_ENST00000450926.2_Intron|CPSF3L_ENST00000419704.1_Intron|GLTPD1_ENST00000343938.4_5'Flank|CPSF3L_ENST00000540437.1_Splice_Site|CPSF3L_ENST00000421495.2_Intron|CPSF3L_ENST00000411962.1_Intron|CPSF3L_ENST00000545578.1_Intron	NM_001256460.1|NM_017871.5	NP_001243389.1|NP_060341.2	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor 3-like						snRNA processing (GO:0016180)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|integrator complex (GO:0032039)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(3)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		AGGGGCTGCCTGCCACAGAGA	0.632																																					.		.											.	CPSF3L	90	0			.						.																																			SO:0001627	intron_variant	54973	.			GCTGCCTGCCACA	AL136813	CCDS21.1, CCDS57959.1, CCDS57960.1, CCDS57961.1, CCDS72678.1	1p36.33	2008-02-05			ENSG00000127054	ENSG00000127054			26052	protein-coding gene	gene with protein product	"""integrator complex subunit 11"""	611354				15684398, 16239144	Standard	NM_001256456		Approved	FLJ20542, RC-68, CPSF73L, INT11, INTS11	uc001aee.2	Q5TA45	OTTHUMG00000003330	ENST00000435064.1:c.29-893A>C	1.37:g.1257366T>G		Somatic	272.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	81.0	.	A8K5S2|B3KPR3|B4DM87|G3V1S5|Q5TA46|Q5TA48|Q5TA52|Q5TA53|Q5TA54|Q7L3D7|Q96HY1|Q9BW36|Q9H0F9|Q9H8R5|Q9HAA6|Q9NWX9	Splice_Site	SNP	ENST00000435064.1	37	CCDS21.1																																																																																			.		0.632	CPSF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009360.2	NM_017871	
CTNND2	1501	broad.mit.edu;ucsc.edu	37	5	11117631	11117631	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr5:11117631A>T	ENST00000304623.8	-	13	2397	c.2208T>A	c.(2206-2208)tgT>tgA	p.C736*	CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000503622.1_Nonsense_Mutation_p.C399*|CTNND2_ENST00000458100.2_Nonsense_Mutation_p.C303*|CTNND2_ENST00000359640.2_Nonsense_Mutation_p.C736*|CTNND2_ENST00000511377.1_Nonsense_Mutation_p.C645*	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	736					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TAAGCCCATCACACTCTCTCA	0.512																																					p.C736X		.											.	CTNND2	293	0			c.T2208A						.						206.0	166.0	179.0					5																	11117631		2203	4300	6503	SO:0001587	stop_gained	1501	exon13			CCCATCACACTCT	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2208T>A	5.37:g.11117631A>T	ENSP00000307134:p.Cys736*	Somatic	236.0	1.0		WXS	Illumina HiSeq	Phase_I	228.0	72.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Nonsense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	A	41	8.943922	0.99012	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	.	.	.	5.6	-4.28	0.03732	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.6383	12.4624	0.55738	0.5559:0.0:0.4441:0.0	.	.	.	.	X	736;736;645;303;399	.	ENSP00000307134:C736X	C	-	3	2	CTNND2	11170631	0.116000	0.22171	0.704000	0.30370	0.983000	0.72400	-0.225000	0.09151	-1.107000	0.03004	0.528000	0.53228	TGT	.		0.512	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
CYP27A1	1593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219674376	219674376	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr2:219674376C>T	ENST00000258415.4	+	2	759	c.332C>T	c.(331-333)gCc>gTc	p.A111V		NM_000784.3	NP_000775.1	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A, polypeptide 1	111					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cholestanetriol 26-monooxygenase activity (GO:0047749)|cholesterol 26-hydroxylase activity (GO:0031073)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(3)|urinary_tract(1)	26		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Chenodeoxycholic acid(DB06777)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Pegvisomant(DB00082)	CTGGCCAGTGCCCCGCTCTTG	0.547																																					p.A111V		.											.	CYP27A1	91	0			c.C332T						.						144.0	127.0	133.0					2																	219674376		2203	4300	6503	SO:0001583	missense	1593	exon2			CCAGTGCCCCGCT	BC017044	CCDS2423.1	2q35	2013-09-19	2003-01-14		ENSG00000135929	ENSG00000135929		"""Cytochrome P450s"""	2605	protein-coding gene	gene with protein product	"""cerebrotendinous xanthomatosis"""	606530	"""cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1"""	CYP27		2019602	Standard	NM_000784		Approved	CTX, CP27	uc002viz.4	Q02318	OTTHUMG00000048238	ENST00000258415.4:c.332C>T	2.37:g.219674376C>T	ENSP00000258415:p.Ala111Val	Somatic	211.0	0.0		WXS	Illumina HiSeq	Phase_I	205.0	73.0	NM_000784	A8K303|Q6LDB4|Q86YQ6	Missense_Mutation	SNP	ENST00000258415.4	37	CCDS2423.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292194	0.59976	.	.	ENSG00000135929	ENST00000258415;ENST00000411688	T;T	0.69040	-0.37;-0.37	5.67	5.67	0.87782	.	0.154974	0.56097	D	0.000021	T	0.57917	0.2086	L	0.43923	1.385	0.47441	D	0.999426	P	0.37370	0.592	B	0.37091	0.241	T	0.56366	-0.7991	10	0.30854	T	0.27	-25.2004	12.112	0.53844	0.0:0.9226:0.0:0.0774	.	111	Q02318	CP27A_HUMAN	V	111;17	ENSP00000258415:A111V;ENSP00000392671:A17V	ENSP00000258415:A111V	A	+	2	0	CYP27A1	219382620	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	6.510000	0.73729	2.677000	0.91161	0.655000	0.94253	GCC	.		0.547	CYP27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109734.4		
ACKR1	2532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159175737	159175737	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr1:159175737A>T	ENST00000368122.2	+	2	1187	c.508A>T	c.(508-510)Act>Tct	p.T170S	CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000537147.1_Missense_Mutation_p.T170S|DARC_ENST00000368121.2_Missense_Mutation_p.T172S	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		170					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					CCTGGGGCTCACTGTGGGAAT	0.627																																					p.T172S		.											.	DARC	659	0			c.A514T						.						38.0	32.0	34.0					1																	159175737		2203	4300	6503	SO:0001583	missense	2532	exon1			GGGCTCACTGTGG																												ENST00000368122.2:c.508A>T	1.37:g.159175737A>T	ENSP00000357104:p.Thr170Ser	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	23.0	NM_001122951	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	ENST00000368122.2	37	CCDS1183.1	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.116638	0.00349	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.36157	1.27;1.27;1.27	4.8	-6.86	0.01676	.	1.437920	0.05370	N	0.535262	T	0.04048	0.0113	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.12837	0.008;0.005	T	0.21518	-1.0243	10	0.08837	T	0.75	-15.3394	1.028	0.01532	0.3298:0.3145:0.1458:0.2099	.	172;170	Q5Y7A1;Q16570	.;DUFFY_HUMAN	S	170;170;170;172	ENSP00000357104:T170S;ENSP00000441985:T170S;ENSP00000357103:T172S	ENSP00000352341:T170S	T	+	1	0	DARC	157442361	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.796000	0.04575	-1.454000	0.01926	-3.678000	0.00024	ACT	.		0.627	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2		
DCLRE1C	64421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	14951131	14951131	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr10:14951131C>A	ENST00000378278.2	-	14	1392	c.1355G>T	c.(1354-1356)tGt>tTt	p.C452F	DCLRE1C_ENST00000378255.1_Missense_Mutation_p.C332F|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.C337F|DCLRE1C_ENST00000378289.4_Intron|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.C332F|DCLRE1C_ENST00000378242.1_Missense_Mutation_p.C105F|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.C332F|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.C332F|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.C337F|DCLRE1C_ENST00000492201.1_5'UTR|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.C332F|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.C337F			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	452					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						GGATTCTTCACAATCTACAAA	0.463								Non-homologous end-joining																													p.C452F		.											.	DCLRE1C	228	0			c.G1355T						.						108.0	100.0	102.0					10																	14951131		2203	4300	6503	SO:0001583	missense	64421	exon14			TCTTCACAATCTA	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1355G>T	10.37:g.14951131C>A	ENSP00000367527:p.Cys452Phe	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	31.0	NM_001033855	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	ENST00000378278.2	37	CCDS31149.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227083	0.79576	.	.	ENSG00000152457	ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000378242	T;T;T;T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.55081	0.1898	M	0.76002	2.32	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.56238	-0.8012	10	0.87932	D	0	.	19.9857	0.97347	0.0:1.0:0.0:0.0	.	337;452	Q96SD1-3;Q96SD1	.;DCR1C_HUMAN	F	332;337;337;337;332;332;332;452;332;105	ENSP00000400529:C332F;ENSP00000367492:C337F;ENSP00000350349:C337F;ENSP00000367496:C337F;ENSP00000380030:C332F;ENSP00000367503:C332F;ENSP00000367502:C332F;ENSP00000367527:C452F;ENSP00000367506:C332F;ENSP00000367488:C105F	ENSP00000350349:C337F	C	-	2	0	DCLRE1C	14991137	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	5.359000	0.66074	2.706000	0.92434	0.655000	0.94253	TGT	.		0.463	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046934.1	NM_022487	
DDX11	1663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	31249813	31249813	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr12:31249813G>A	ENST00000407793.2	+	17	1902	c.1651G>A	c.(1651-1653)Gag>Aag	p.E551K	DDX11_ENST00000545668.1_Missense_Mutation_p.E551K|DDX11_ENST00000539673.1_3'UTR|DDX11_ENST00000350437.4_Missense_Mutation_p.E551K|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000228264.6_Missense_Mutation_p.E525K|DDX11_ENST00000542838.1_Missense_Mutation_p.E551K	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	551					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CCCTGCAGACGAGAGTCAGGC	0.617										Multiple Myeloma(12;0.14)																											p.E551K		.											.	DDX11	229	0			c.G1651A						.						49.0	48.0	49.0					12																	31249813		2203	4300	6503	SO:0001583	missense	1663	exon17			GCAGACGAGAGTC	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1651G>A	12.37:g.31249813G>A	ENSP00000384703:p.Glu551Lys	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	67.0	NM_030653	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.173169	0.38413	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	3.56	3.56	0.40772	.	0.579436	0.18328	N	0.144574	T	0.41096	0.1144	L	0.54908	1.71	0.80722	D	1	P;P;P;P	0.50710	0.938;0.929;0.875;0.938	B;B;B;B	0.37267	0.245;0.163;0.173;0.245	T	0.36939	-0.9727	10	0.12430	T	0.62	.	12.707	0.57065	0.0:0.0:1.0:0.0	.	525;551;551;551	Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	K	551;551;276;525;551;551	ENSP00000443426:E551K;ENSP00000384703:E551K;ENSP00000228264:E525K;ENSP00000440402:E551K;ENSP00000309965:E551K	ENSP00000228264:E525K	E	+	1	0	DDX11	31141080	1.000000	0.71417	0.016000	0.15963	0.012000	0.07955	4.925000	0.63425	1.813000	0.52934	0.505000	0.49811	GAG	.		0.617	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
DEGS1	8560	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	224377758	224377758	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr1:224377758A>T	ENST00000323699.4	+	2	728	c.562A>T	c.(562-564)Atc>Ttc	p.I188F	DEGS1_ENST00000391877.3_Missense_Mutation_p.I188F	NM_003676.3	NP_003667.1	O15121	DEGS1_HUMAN	delta(4)-desaturase, sphingolipid 1	188					small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|kidney(3)|large_intestine(2)|lung(4)	10	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		TCTGGAAGTTATCAATACCGT	0.388																																					p.I188F		.											.	DEGS1	90	0			c.A562T						.						191.0	192.0	192.0					1																	224377758		2203	4300	6503	SO:0001583	missense	8560	exon2			GAAGTTATCAATA	AF002668	CCDS1540.1	1q42.11	2013-09-02	2011-12-09	2004-12-14	ENSG00000143753	ENSG00000143753		"""Fatty acid desaturases"""	13709	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 1"", ""dihydroceramide desaturase 1"""	615843	"""degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)"""			9188692, 20105137	Standard	NM_003676		Approved	MLD, Des-1, DES1, FADS7, DEGS-1	uc001hoj.3	O15121	OTTHUMG00000037496	ENST00000323699.4:c.562A>T	1.37:g.224377758A>T	ENSP00000316476:p.Ile188Phe	Somatic	76.0	1.0		WXS	Illumina HiSeq	Phase_I	89.0	22.0	NM_003676		Missense_Mutation	SNP	ENST00000323699.4	37	CCDS1540.1	.	.	.	.	.	.	.	.	.	.	A	9.273	1.046266	0.19748	.	.	ENSG00000143753	ENST00000415210;ENST00000323699;ENST00000391877	T;T;T	0.18502	2.21;2.21;2.21	6.02	4.86	0.63082	Fatty acid desaturase, type 1 (1);	0.099263	0.64402	D	0.000001	T	0.19685	0.0473	L	0.41710	1.295	0.58432	D	0.999997	B;P	0.50369	0.004;0.934	B;P	0.47864	0.049;0.559	T	0.00896	-1.1523	10	0.35671	T	0.21	.	12.7138	0.57103	0.8771:0.0:0.0:0.1229	.	188;167	O15121;E7EMA0	DEGS1_HUMAN;.	F	167;188;188	ENSP00000400545:I167F;ENSP00000316476:I188F;ENSP00000375749:I188F	ENSP00000316476:I188F	I	+	1	0	DEGS1	222444381	0.992000	0.36948	0.877000	0.34402	0.103000	0.19146	3.087000	0.50167	2.309000	0.77851	0.448000	0.29417	ATC	.		0.388	DEGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091285.2		
DNHD1	144132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6567458	6567458	+	Silent	SNP	T	T	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr11:6567458T>C	ENST00000527990.2	+	19	5289	c.5289T>C	c.(5287-5289)taT>taC	p.Y1763Y	DNHD1_ENST00000254579.6_Silent_p.Y1763Y			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1763					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ACCACTTGTATGCCCCACTGT	0.587																																					p.Y1763Y		.											.	DNHD1	24	0			c.T5289C						.						56.0	50.0	52.0					11																	6567458		692	1591	2283	SO:0001819	synonymous_variant	144132	exon21			CTTGTATGCCCCA	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.5289T>C	11.37:g.6567458T>C		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	31.0	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Silent	SNP	ENST00000527990.2	37	CCDS44532.1																																																																																			.		0.587	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
DKK3	27122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	11987381	11987381	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr11:11987381T>A	ENST00000396505.2	-	7	1043	c.805A>T	c.(805-807)Agt>Tgt	p.S269C	DKK3_ENST00000326932.4_Missense_Mutation_p.S269C|DKK3_ENST00000525493.1_Missense_Mutation_p.S269C|DKK3_ENST00000527132.1_Intron|DKK3_ENST00000450094.2_Missense_Mutation_p.S241C	NM_015881.5	NP_056965.3	Q9UBP4	DKK3_HUMAN	dickkopf WNT signaling pathway inhibitor 3	269	DKK-type Cys-2.				adrenal gland development (GO:0030325)|anatomical structure morphogenesis (GO:0009653)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of transcription, DNA-templated (GO:0045892)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|pancreas(1)	8				Epithelial(150;0.000502)		AGGAGGCCACTGGCACAAGGG	0.662																																					p.S269C		.											.	DKK3	721	0			c.A805T						.						62.0	60.0	61.0					11																	11987381		2201	4294	6495	SO:0001583	missense	27122	exon7			GGCCACTGGCACA	AF177396	CCDS7808.1	11p15.3	2013-05-15	2013-05-15		ENSG00000050165	ENSG00000050165			2893	protein-coding gene	gene with protein product	"""regulated in glioma"""	605416	"""dickkopf (Xenopus laevis) homolog 3"", ""dickkopf 3 homolog (Xenopus laevis)"""			10570958	Standard	XM_006718177		Approved	REIC, RIG	uc001mjv.3	Q9UBP4	OTTHUMG00000165709	ENST00000396505.2:c.805A>T	11.37:g.11987381T>A	ENSP00000379762:p.Ser269Cys	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	19.0	NM_015881	A8K1I2|D3DQW1|Q9ULB7	Missense_Mutation	SNP	ENST00000396505.2	37	CCDS7808.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.236128	0.79800	.	.	ENSG00000050165	ENST00000396505;ENST00000326932;ENST00000366345;ENST00000525493;ENST00000450094;ENST00000326914	T;T;T;T	0.33216	2.14;2.14;2.14;1.42	5.65	4.54	0.55810	.	0.410373	0.32671	N	0.005782	T	0.38295	0.1035	L	0.40543	1.245	0.40982	D	0.984786	D;D;D	0.76494	0.999;0.985;0.985	P;P;P	0.62560	0.904;0.628;0.628	T	0.27331	-1.0077	10	0.62326	D	0.03	-21.9131	6.6644	0.23032	0.0:0.0772:0.2795:0.6433	.	269;241;269	F6SYF8;E7EUD0;Q9UBP4	.;.;DKK3_HUMAN	C	269;269;212;269;241;113	ENSP00000379762:S269C;ENSP00000314910:S269C;ENSP00000433112:S269C;ENSP00000398365:S241C	ENSP00000314730:S113C	S	-	1	0	DKK3	11943957	0.982000	0.34865	1.000000	0.80357	0.998000	0.95712	1.876000	0.39588	2.146000	0.66826	0.533000	0.62120	AGT	.		0.662	DKK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385863.1	NM_013253	
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184947229	184947229	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr3:184947229T>C	ENST00000231887.3	-	4	529	c.454A>G	c.(454-456)Att>Gtt	p.I152V	EHHADH_ENST00000475987.1_5'UTR|EHHADH_ENST00000456310.1_Missense_Mutation_p.I56V	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	152	Enoyl-CoA hydratase / isomerase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			CCTGAGGTAATTAAGTCAAGT	0.463																																					p.I152V		.											.	EHHADH	93	0			c.A454G						.						74.0	69.0	71.0					3																	184947229		2203	4300	6503	SO:0001583	missense	1962	exon4			AGGTAATTAAGTC	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.454A>G	3.37:g.184947229T>C	ENSP00000231887:p.Ile152Val	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	40.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	T	15.28	2.786578	0.49997	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.68025	-0.3;-0.3	6.07	6.07	0.98685	Crotonase, core (1);	0.130265	0.64402	D	0.000001	T	0.70833	0.3269	L	0.52759	1.655	0.80722	D	1	D	0.56746	0.977	P	0.52189	0.692	T	0.70718	-0.4795	10	0.41790	T	0.15	-21.2101	15.6102	0.76710	0.0:0.0:0.0:1.0	.	152	Q08426	ECHP_HUMAN	V	152;152;56	ENSP00000231887:I152V;ENSP00000387746:I56V	ENSP00000231887:I152V	I	-	1	0	EHHADH	186429923	1.000000	0.71417	0.973000	0.42090	0.413000	0.31143	4.471000	0.60182	2.330000	0.79161	0.528000	0.53228	ATT	.		0.463	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
EPS8L1	54869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55598913	55598913	+	Silent	SNP	A	A	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr19:55598913A>T	ENST00000201647.6	+	20	2159	c.2103A>T	c.(2101-2103)tcA>tcT	p.S701S	EPS8L1_ENST00000586329.1_Silent_p.S526S|EPS8L1_ENST00000540810.1_Silent_p.S637S|EPS8L1_ENST00000245618.5_Silent_p.S574S|EPS8L1_ENST00000588359.1_Silent_p.S387S	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	701					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		AGAAAGTGTCAGAGCTGGAGG	0.582																																					p.S701S	Ovarian(149;255 1863 3636 27051 29647)	.											.	EPS8L1	115	0			c.A2103T						.						133.0	130.0	131.0					19																	55598913		2203	4300	6503	SO:0001819	synonymous_variant	54869	exon20			AGTGTCAGAGCTG	AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.2103A>T	19.37:g.55598913A>T		Somatic	226.0	0.0		WXS	Illumina HiSeq	Phase_I	214.0	67.0	NM_133180	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Silent	SNP	ENST00000201647.6	37	CCDS12914.1																																																																																			.		0.582	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	
FAM120A	23196	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	96233651	96233652	+	Frame_Shift_Ins	INS	-	-	T	rs368570688		TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr9:96233651_96233652insT	ENST00000277165.6	+	2	897_898	c.703_704insT	c.(703-705)attfs	p.I235fs	FAM120A_ENST00000375389.3_Frame_Shift_Ins_p.I235fs|FAM120A_ENST00000333936.5_Frame_Shift_Ins_p.I235fs|FAM120A_ENST00000340893.4_Frame_Shift_Ins_p.I235fs	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	235						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TCGTTTTCCTATTTTTGCTGCT	0.416																																					p.I235fs		.											.	FAM120A	90	0			c.703_704insT						.																																			SO:0001589	frameshift_variant	23196	exon2			TTTCCTATTTTTG	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.708dupT	9.37:g.96233656_96233656dupT	ENSP00000277165:p.Ile235fs	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	31.0	NM_014612	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Frame_Shift_Ins	INS	ENST00000277165.6	37	CCDS6706.1																																																																																			.		0.416	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053160.2	NM_014612	
FLT3	2322	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	28626760	28626760	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr13:28626760T>C	ENST00000241453.7	-	5	617	c.536A>G	c.(535-537)cAg>cGg	p.Q179R	FLT3_ENST00000537084.1_Missense_Mutation_p.Q179R|FLT3_ENST00000380982.4_Missense_Mutation_p.Q179R	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	179					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAGGGCGTCCTGGTTTTCCAT	0.403			"""Mis, O"""		"""AML, ALL"""																																p.Q179R		.		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	.	FLT3	42117	0			c.A536G						.						115.0	111.0	112.0					13																	28626760		2203	4300	6503	SO:0001583	missense	2322	exon5			GCGTCCTGGTTTT	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.536A>G	13.37:g.28626760T>C	ENSP00000241453:p.Gln179Arg	Somatic	140.0	1.0		WXS	Illumina HiSeq	Phase_I	73.0	36.0	NM_004119	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	ENST00000241453.7	37	CCDS31953.1	.	.	.	.	.	.	.	.	.	.	T	12.20	1.867191	0.32977	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.78595	-1.12;-1.19;-0.93	5.73	5.73	0.89815	.	0.287885	0.30611	N	0.009258	T	0.64349	0.2590	L	0.32530	0.975	0.23325	N	0.997904	B;B	0.29341	0.197;0.242	B;B	0.26094	0.066;0.041	T	0.55915	-0.8065	10	0.36615	T	0.2	.	7.0538	0.25087	0.1324:0.0:0.222:0.6455	.	179;179	P36888-2;P36888	.;FLT3_HUMAN	R	179	ENSP00000241453:Q179R;ENSP00000370369:Q179R;ENSP00000438139:Q179R	ENSP00000241453:Q179R	Q	-	2	0	FLT3	27524760	0.020000	0.18652	0.875000	0.34327	0.617000	0.37484	1.588000	0.36633	2.174000	0.68829	0.528000	0.53228	CAG	.		0.403	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		
FRY	10129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	32850640	32850640	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr13:32850640G>A	ENST00000380250.3	+	57	8822	c.8326G>A	c.(8326-8328)Gtg>Atg	p.V2776M	FRY_ENST00000542859.1_Missense_Mutation_p.V146M	NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2776						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CAAGTTCAGTGTGTTAGAACT	0.388																																					p.V2776M		.											.	FRY	142	0			c.G8326A						.						175.0	157.0	163.0					13																	32850640		1892	4117	6009	SO:0001583	missense	10129	exon57			TTCAGTGTGTTAG	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.8326G>A	13.37:g.32850640G>A	ENSP00000369600:p.Val2776Met	Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	35.0	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.564999|4.564999	0.86439|0.86439	.|.	.|.	ENSG00000073910|ENSG00000073910	ENST00000380235|ENST00000380250;ENST00000542859	.|T	.|0.28895	.|1.59	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.058305	.|0.64402	.|D	.|0.000002	T|T	0.52468|0.52468	0.1736|0.1736	L|L	0.58354|0.58354	1.805|1.805	0.80722|0.80722	D|D	1|1	.|D;P	.|0.71674	.|0.998;0.769	.|D;B	.|0.65443	.|0.935;0.297	T|T	0.42682|0.42682	-0.9437|-0.9437	6|10	0.72032|0.41790	D|T	0.01|0.15	.|.	19.616|19.616	0.95634|0.95634	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|557;2776	.|Q8NB82;Q5TBA9	.|.;FRY_HUMAN	Y|M	403|2776;146	.|ENSP00000369600:V2776M	ENSP00000369567:C403Y|ENSP00000369600:V2776M	C|V	+|+	2|1	0|0	FRY|FRY	31748640|31748640	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.777000|0.777000	0.43975|0.43975	9.339000|9.339000	0.96797|0.96797	2.642000|2.642000	0.89623|0.89623	0.555000|0.555000	0.69702|0.69702	TGT|GTG	.		0.388	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
GAD2	2572	hgsc.bcm.edu;bcgsc.ca	37	10	26505807	26505807	+	Silent	SNP	C	C	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr10:26505807C>T	ENST00000376261.3	+	1	572	c.69C>T	c.(67-69)ccC>ccT	p.P23P	GAD2_ENST00000259271.3_Silent_p.P23P|GAD2_ENST00000376248.1_5'Flank	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	23					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CCGAGAATCCCGGCACAGGTA	0.607																																					p.P23P		.											.	GAD2	515	0			c.C69T						.						51.0	60.0	57.0					10																	26505807		2203	4300	6503	SO:0001819	synonymous_variant	2572	exon1			GAATCCCGGCACA	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.69C>T	10.37:g.26505807C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_000818	Q9UD87	Silent	SNP	ENST00000376261.3	37	CCDS7149.1																																																																																			.		0.607	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
GADL1	339896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	30819694	30819694	+	Nonsense_Mutation	SNP	C	C	A	rs145224145		TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr3:30819694C>A	ENST00000282538.5	-	14	1519	c.1369G>T	c.(1369-1371)Gag>Tag	p.E457*	GADL1_ENST00000498387.1_5'UTR	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	457					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						GCCCAGAACTCGGGTCCTTCT	0.328																																					p.E457X		.											.	GADL1	90	0			c.G1369T						.						78.0	82.0	81.0					3																	30819694		2203	4300	6503	SO:0001587	stop_gained	339896	exon14			AGAACTCGGGTCC	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1369G>T	3.37:g.30819694C>A	ENSP00000282538:p.Glu457*	Somatic	298.0	1.0		WXS	Illumina HiSeq	Phase_I	230.0	78.0	NM_207359		Nonsense_Mutation	SNP	ENST00000282538.5	37	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	C	41	8.641858	0.98897	.	.	ENSG00000144644	ENST00000282538	.	.	.	6.02	5.13	0.70059	.	0.057263	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-11.7558	16.0963	0.81127	0.0:0.8656:0.1344:0.0	.	.	.	.	X	457	.	ENSP00000282538:E457X	E	-	1	0	GADL1	30794698	1.000000	0.71417	0.944000	0.38274	0.996000	0.88848	5.913000	0.69957	1.521000	0.48983	0.655000	0.94253	GAG	C|0.999;T|0.000		0.328	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	NM_207359	
GOLGB1	2804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	121416717	121416717	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr3:121416717G>A	ENST00000340645.5	-	13	2763	c.2638C>T	c.(2638-2640)Cag>Tag	p.Q880*	GOLGB1_ENST00000393667.3_Nonsense_Mutation_p.Q885*	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	880					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AGTAAGAGCTGATCCATTTTT	0.423																																					p.Q885X		.											.	GOLGB1	161	0			c.C2653T						.						152.0	158.0	156.0					3																	121416717		2203	4299	6502	SO:0001587	stop_gained	2804	exon13			AGAGCTGATCCAT	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.2638C>T	3.37:g.121416717G>A	ENSP00000341848:p.Gln880*	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	29.0	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Nonsense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	G	37	6.399190	0.97537	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	.	.	.	5.35	4.48	0.54585	.	0.000000	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	11.8048	0.52147	0.0842:0.0:0.9158:0.0	.	.	.	.	X	880;885;844;692	.	ENSP00000341848:Q880X	Q	-	1	0	GOLGB1	122899407	0.078000	0.21339	0.994000	0.49952	0.914000	0.54420	0.896000	0.28377	1.494000	0.48533	0.655000	0.94253	CAG	.		0.423	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
HIPK3	10114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	33308240	33308240	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr11:33308240G>A	ENST00000303296.4	+	2	585	c.280G>A	c.(280-282)Gtc>Atc	p.V94I	HIPK3_ENST00000456517.1_Missense_Mutation_p.V94I|HIPK3_ENST00000379016.3_Missense_Mutation_p.V94I|HIPK3_ENST00000525975.1_Missense_Mutation_p.V94I	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	94					apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						TGCTACAAAGGTCATAGCAGC	0.478																																					p.V94I		.											.	HIPK3	336	0			c.G280A						.						79.0	72.0	75.0					11																	33308240		2202	4298	6500	SO:0001583	missense	10114	exon2			ACAAAGGTCATAG	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.280G>A	11.37:g.33308240G>A	ENSP00000304226:p.Val94Ile	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	31.0	NM_001048200	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	37	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.552126	0.27739	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.52057	0.7;0.68;0.7;0.7	5.65	5.65	0.86999	.	0.102900	0.42682	D	0.000670	T	0.31702	0.0805	N	0.14661	0.345	0.32898	D	0.512834	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.001	T	0.33007	-0.9885	10	0.32370	T	0.25	.	13.9438	0.64071	0.0723:0.0:0.9277:0.0	.	94;94	Q9H422-2;Q9H422	.;HIPK3_HUMAN	I	94	ENSP00000431710:V94I;ENSP00000304226:V94I;ENSP00000368301:V94I;ENSP00000398241:V94I	ENSP00000304226:V94I	V	+	1	0	HIPK3	33264816	1.000000	0.71417	0.995000	0.50966	0.947000	0.59692	3.819000	0.55686	2.673000	0.90976	0.585000	0.79938	GTC	.		0.478	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
KCNMB3	27094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	178984440	178984440	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr3:178984440C>T	ENST00000349697.2	-	1	319	c.59G>A	c.(58-60)gGg>gAg	p.G20E	KCNMB3_ENST00000497599.1_Missense_Mutation_p.G20E	NM_171828.1	NP_741979.1	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	0					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	GACTTACCTCCCCTGGCGCCT	0.577																																					p.G20E		.											.	KCNMB3	90	0			c.G59A						.						50.0	49.0	49.0					3																	178984440		2203	4300	6503	SO:0001583	missense	27094	exon1			TACCTCCCCTGGC	AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000349697.2:c.59G>A	3.37:g.178984440C>T	ENSP00000327866:p.Gly20Glu	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	29.0	NM_171828	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	ENST00000349697.2	37	CCDS3225.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.965002	0.53507	.	.	ENSG00000171121	ENST00000497599;ENST00000349697	T;T	0.17854	2.25;2.96	5.38	3.46	0.39613	.	.	.	.	.	T	0.17323	0.0416	N	0.08118	0	0.80722	D	1	D;D	0.67145	0.994;0.996	P;D	0.63381	0.865;0.914	T	0.08249	-1.0731	9	0.87932	D	0	.	8.1343	0.31046	0.1803:0.6457:0.174:0.0	.	20;20	E9PER5;Q9NPA1-2	.;.	E	20	ENSP00000417091:G20E;ENSP00000327866:G20E	ENSP00000327866:G20E	G	-	2	0	KCNMB3	180467134	0.943000	0.32029	1.000000	0.80357	0.380000	0.30137	0.671000	0.25172	1.269000	0.44280	0.505000	0.49811	GGG	.		0.577	KCNMB3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358530.1		
KPNA5	3841	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	117019926	117019927	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr6:117019926_117019927delAA	ENST00000368564.1	+	5	548_549	c.400_401delAA	c.(400-402)aaafs	p.K134fs	KPNA5_ENST00000356348.1_Frame_Shift_Del_p.K134fs			O15131	IMA6_HUMAN	karyopherin alpha 5 (importin alpha 6)	131					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(6)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		GAGATTTGTGAAATTTCTTGAA	0.287																																					p.134_134del		.											.	KPNA5	290	0			c.400_401del						.																																			SO:0001589	frameshift_variant	3841	exon5			TTTGTGAAATTTC	AF005361	CCDS5111.1	6q22.2	2013-02-14			ENSG00000196911	ENSG00000196911		"""Importins"", ""Armadillo repeat containing"""	6398	protein-coding gene	gene with protein product		604545				9395085	Standard	NM_002269		Approved	SRP6, IPOA6	uc003pxh.3	O15131	OTTHUMG00000015448	ENST00000368564.1:c.400_401delAA	6.37:g.117019926_117019927delAA	ENSP00000357552:p.Lys134fs	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	23.0	NM_002269	B2RAI5|Q86X23	Frame_Shift_Del	DEL	ENST00000368564.1	37	CCDS5111.1																																																																																			.		0.287	KPNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041967.1	NM_002269	
KRT38	8687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39596873	39596873	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr17:39596873T>C	ENST00000246646.3	-	1	300	c.301A>G	c.(301-303)Aat>Gat	p.N101D		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	101	Head.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				TCATGGCCATTCAGGGTGTTT	0.587																																					p.N101D		.											.	KRT38	92	0			c.A301G						.						115.0	102.0	107.0					17																	39596873		2203	4300	6503	SO:0001583	missense	8687	exon1			GGCCATTCAGGGT	Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.301A>G	17.37:g.39596873T>C	ENSP00000246646:p.Asn101Asp	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	70.0	NM_006771	A2RRM5|Q6A164	Missense_Mutation	SNP	ENST00000246646.3	37	CCDS11392.1	.	.	.	.	.	.	.	.	.	.	T	19.88	3.908876	0.72868	.	.	ENSG00000171360	ENST00000246646	D	0.81996	-1.56	4.72	4.72	0.59763	.	0.000000	0.52532	D	0.000076	D	0.87811	0.6271	M	0.78049	2.395	0.09310	N	1	D	0.60575	0.988	P	0.57204	0.815	T	0.81506	-0.0902	10	0.66056	D	0.02	.	10.5173	0.44898	0.0:0.0:0.0:1.0	.	101	O76015	KRT38_HUMAN	D	101	ENSP00000246646:N101D	ENSP00000246646:N101D	N	-	1	0	KRT38	36850399	0.000000	0.05858	0.016000	0.15963	0.737000	0.42083	0.286000	0.18902	1.982000	0.57802	0.528000	0.53228	AAT	.		0.587	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	NM_006771	
LHCGR	3973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	48958372	48958372	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr2:48958372A>C	ENST00000294954.7	-	2	248	c.227T>G	c.(226-228)aTa>aGa	p.I76R	STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_Missense_Mutation_p.I76R|LHCGR_ENST00000344775.3_Missense_Mutation_p.I76R|LHCGR_ENST00000403273.1_Missense_Mutation_p.I76R|LHCGR_ENST00000405626.1_Missense_Mutation_p.I76R	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	76					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TTACATTTTTATGACCTCATT	0.328																																					p.I76R		.											.	LHCGR	589	0			c.T227G						.						90.0	91.0	90.0					2																	48958372		2203	4300	6503	SO:0001583	missense	3973	exon2			ATTTTTATGACCT		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.227T>G	2.37:g.48958372A>C	ENSP00000294954:p.Ile76Arg	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	11.0	NM_000233	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	A	6.720	0.501628	0.12822	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907;ENST00000428232	D;D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52;-1.52	5.89	4.75	0.60458	.	0.993034	0.08199	N	0.982596	T	0.70745	0.3259	N	0.05230	-0.09	0.34550	D	0.711215	P	0.44690	0.841	P	0.49387	0.609	T	0.66712	-0.5854	9	.	.	.	.	9.3413	0.38082	0.9198:0.0:0.0802:0.0	.	76	P22888	LSHR_HUMAN	R	76;76;76;76;76;42	ENSP00000344301:I76R;ENSP00000294954:I76R;ENSP00000386033:I76R;ENSP00000385847:I76R;ENSP00000385406:I76R;ENSP00000403748:I42R	.	I	-	2	0	LHCGR	48811876	0.983000	0.35010	0.934000	0.37439	0.964000	0.63967	3.136000	0.50554	2.247000	0.74100	0.482000	0.46254	ATA	.		0.328	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
LRRN3	54674	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	110764538	110764538	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr7:110764538delA	ENST00000422987.3	+	2	2541	c.1710delA	c.(1708-1710)cgafs	p.R570fs	IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000489381.1_Intron|LRRN3_ENST00000451085.1_Frame_Shift_Del_p.R570fs|LRRN3_ENST00000308478.5_Frame_Shift_Del_p.R570fs|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000452895.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	570	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AAAGTGCTCGAATACCATCTG	0.353																																					p.R570fs		.											.	LRRN3	154	0			c.1710delA						.						58.0	55.0	56.0					7																	110764538		2203	4300	6503	SO:0001589	frameshift_variant	54674	exon2			TGCTCGAATACCA	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1710delA	7.37:g.110764538delA	ENSP00000412417:p.Arg570fs	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	20.0	NM_018334	O43377|Q6I9V8|Q8IYQ6	Frame_Shift_Del	DEL	ENST00000422987.3	37	CCDS5754.1																																																																																			.		0.353	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
MBOAT2	129642	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	9022691	9022691	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr2:9022691C>T	ENST00000305997.3	-	6	654	c.456G>A	c.(454-456)atG>atA	p.M152I	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	152					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCTTCCGAAACATCCCTGAGA	0.433																																					p.M152I	Ovarian(194;1699 3813 22401)	.											.	MBOAT2	90	0			c.G456A						.						119.0	96.0	103.0					2																	9022691		2203	4300	6503	SO:0001583	missense	129642	exon6			CCGAAACATCCCT	BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.456G>A	2.37:g.9022691C>T	ENSP00000302177:p.Met152Ile	Somatic	173.0	1.0		WXS	Illumina HiSeq	Phase_I	153.0	47.0	NM_138799	A9EDR2|Q8NCE7|Q96KY4	Missense_Mutation	SNP	ENST00000305997.3	37	CCDS1660.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.758429	0.49468	.	.	ENSG00000143797	ENST00000305997;ENST00000462696	T;T	0.73681	-0.77;-0.77	5.67	5.67	0.87782	.	0.212280	0.53938	D	0.000044	T	0.65491	0.2696	L	0.28556	0.865	0.47511	D	0.999447	B;B	0.14012	0.004;0.009	B;B	0.21360	0.02;0.034	T	0.58713	-0.7588	10	0.21014	T	0.42	-33.1504	17.953	0.89059	0.0:1.0:0.0:0.0	.	152;152	B7Z3I3;Q6ZWT7	.;MBOA2_HUMAN	I	152;129	ENSP00000302177:M152I;ENSP00000417409:M129I	ENSP00000302177:M152I	M	-	3	0	MBOAT2	8940142	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.256000	0.58810	2.673000	0.90976	0.467000	0.42956	ATG	.		0.433	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206735.1	NM_138799	
MEGF8	1954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	42837807	42837807	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr19:42837807G>T	ENST00000251268.6	+	2	238	c.238G>T	c.(238-240)Gag>Tag	p.E80*	MEGF8_ENST00000334370.4_Nonsense_Mutation_p.E80*	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	80	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCTGGACACAGAGTGCACGTA	0.617																																					p.E80X		.											.	MEGF8	23	0			c.G238T						.						89.0	93.0	92.0					19																	42837807		2073	4195	6268	SO:0001587	stop_gained	1954	exon2			GACACAGAGTGCA	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.238G>T	19.37:g.42837807G>T	ENSP00000251268:p.Glu80*	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	35.0	NM_001271938	A8KAY0|O75097	Nonsense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	G	43	10.194334	0.99357	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-8.5856	16.3026	0.82830	0.0:0.0:1.0:0.0	.	.	.	.	X	80	.	ENSP00000251268:E80X	E	+	1	0	MEGF8	47529647	1.000000	0.71417	0.920000	0.36463	0.908000	0.53690	8.684000	0.91242	2.453000	0.82957	0.486000	0.48141	GAG	.		0.617	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
MLXIPL	51085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	73013995	73013995	+	Missense_Mutation	SNP	G	G	A	rs146487355	byFrequency	TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr7:73013995G>A	ENST00000313375.3	-	8	979	c.932C>T	c.(931-933)cCg>cTg	p.P311L	MLXIPL_ENST00000434326.1_Missense_Mutation_p.P218L|MLXIPL_ENST00000354613.1_Missense_Mutation_p.P311L|MLXIPL_ENST00000429400.2_Missense_Mutation_p.P311L|MLXIPL_ENST00000395189.1_Missense_Mutation_p.P218L|MLXIPL_ENST00000414749.2_Missense_Mutation_p.P311L	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	311					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				AGGCATGGGCGGCTGTGGGAG	0.607													G|||	2	0.000399361	0.0	0.0	5008	,	,		14638	0.0		0.002	False		,,,				2504	0.0				p.P311L		.											.	MLXIPL	91	0			c.C932T						.	G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	59.0	71.0	67.0		932,932,932,932	2.7	0.5	7	dbSNP_134	67	20,8580	14.6+/-50.1	0,20,4280	yes	missense,missense,missense,missense	MLXIPL	NM_032951.2,NM_032952.2,NM_032953.2,NM_032954.2	98,98,98,98	0,21,6482	AA,AG,GG		0.2326,0.0227,0.1615	benign,benign,benign,benign	311/853,311/834,311/851,311/832	73013995	21,12985	2203	4300	6503	SO:0001583	missense	51085	exon8			ATGGGCGGCTGTG	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.932C>T	7.37:g.73013995G>A	ENSP00000320886:p.Pro311Leu	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	27.0	NM_032954	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	ENST00000313375.3	37	CCDS5553.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	g	9.433	1.085980	0.20390	2.27E-4	0.002326	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000395189;ENST00000434326;ENST00000453275	T;T;T;T;T;T	0.21031	2.6;2.6;2.6;2.62;2.03;2.03	4.52	2.71	0.32032	.	2.015250	0.02428	N	0.083230	T	0.17450	0.0419	L	0.38175	1.15	0.09310	N	0.999992	B;B;B;B;B;B	0.18610	0.008;0.029;0.017;0.029;0.029;0.029	B;B;B;B;B;B	0.06405	0.001;0.002;0.001;0.002;0.002;0.002	T	0.28650	-1.0037	10	0.10902	T	0.67	-0.4025	7.1123	0.25396	0.2121:0.0:0.7879:0.0	.	218;218;311;311;311;311	C5HU01;Q9NP71-6;Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	.;.;MLXPL_HUMAN;.;.;.	L	311;311;311;311;218;218;144	ENSP00000412330:P311L;ENSP00000406296:P311L;ENSP00000320886:P311L;ENSP00000346629:P311L;ENSP00000378616:P218L;ENSP00000392636:P218L	ENSP00000320886:P311L	P	-	2	0	MLXIPL	72651931	0.136000	0.22515	0.540000	0.28089	0.961000	0.63080	1.575000	0.36493	0.364000	0.24374	0.550000	0.68814	CCG	G|0.998;A|0.002		0.607	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
MRPS35	60488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	27908279	27908279	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr12:27908279G>A	ENST00000081029.3	+	8	939	c.868G>A	c.(868-870)Gaa>Aaa	p.E290K	MRPS35_ENST00000538315.1_3'UTR|Y_RNA_ENST00000516776.1_RNA	NM_021821.3	NP_068593.2	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S35	0						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	6	Lung SC(9;0.0873)					TAAAGAAATTGAAGAGTACAA	0.338																																					p.E290K		.											.	MRPS35	90	0			c.G868A						.						67.0	79.0	75.0					12																	27908279		2202	4296	6498	SO:0001583	missense	60488	exon8			GAAATTGAAGAGT	AF182422	CCDS8714.1, CCDS53769.1	12p11	2012-09-13			ENSG00000061794	ENSG00000061794		"""Mitochondrial ribosomal proteins / small subunits"""	16635	protein-coding gene	gene with protein product		611995				11279123	Standard	NM_021821		Approved	MRPS28, MDS023	uc001rih.3	P82673	OTTHUMG00000169215	ENST00000081029.3:c.868G>A	12.37:g.27908279G>A	ENSP00000081029:p.Glu290Lys	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	27.0	NM_021821	B2RDZ7|Q96Q21	Missense_Mutation	SNP	ENST00000081029.3	37	CCDS8714.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.204644	0.38905	.	.	ENSG00000061794	ENST00000081029;ENST00000321446	T	0.46819	0.86	6.05	4.18	0.49190	.	0.485515	0.26210	N	0.025681	T	0.27629	0.0679	N	0.20483	0.58	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.07790	-1.0754	10	0.15499	T	0.54	-16.1596	6.9671	0.24629	0.1411:0.153:0.706:0.0	.	290	P82673	RT35_HUMAN	K	290;254	ENSP00000081029:E290K	ENSP00000081029:E290K	E	+	1	0	MRPS35	27799546	0.731000	0.28111	0.923000	0.36655	0.975000	0.68041	1.612000	0.36889	1.533000	0.49186	0.637000	0.83480	GAA	.		0.338	MRPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402897.1	NM_021821	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1267292	1267292	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr11:1267292C>A	ENST00000529681.1	+	31	9240	c.9182C>A	c.(9181-9183)tCc>tAc	p.S3061Y	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.S3064Y	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3061	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCACCAAATCCACAGCTACC	0.592																																					p.S3061Y		.											.	.	.	0			c.C9182A						.						170.0	189.0	183.0					11																	1267292		2093	4205	6298	SO:0001583	missense	727897	exon31			CCAAATCCACAGC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9182C>A	11.37:g.1267292C>A	ENSP00000436812:p.Ser3061Tyr	Somatic	397.0	1.0		WXS	Illumina HiSeq	Phase_I	409.0	123.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	4.664	0.123473	0.08931	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.20069	2.1;2.29	3.21	2.26	0.28386	.	.	.	.	.	T	0.14442	0.0349	L	0.34521	1.04	0.09310	N	1	P;B	0.36144	0.539;0.386	B;B	0.28011	0.085;0.059	T	0.12218	-1.0556	9	0.87932	D	0	.	9.8854	0.41257	0.2053:0.7946:0.0:0.0	.	3644;3064	A7Y9J9;E9PBJ0	.;.	Y	3061;3064;3033;3021	ENSP00000436812:S3061Y;ENSP00000415793:S3064Y	ENSP00000343037:S3033Y	S	+	2	0	MUC5B	1223868	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.289000	0.08365	0.670000	0.31165	0.523000	0.50628	TCC	.		0.592	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MYT1	4661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	62839416	62839416	+	Silent	SNP	G	G	A	rs544053715	byFrequency	TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr20:62839416G>A	ENST00000328439.1	+	7	1231	c.867G>A	c.(865-867)gaG>gaA	p.E289E	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Silent_p.E289E	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					aagaggaggaggaggaagagg	0.567													g|||	2	0.000399361	0.0	0.0014	5008	,	,		14500	0.0		0.001	False		,,,				2504	0.0				p.E289E	GBM(59;481 1041 20555 21139 33705)	.											.	MYT1	704	0			c.G867A						.						37.0	37.0	37.0					20																	62839416		2203	4300	6503	SO:0001819	synonymous_variant	4661	exon7			GGAGGAGGAGGAA	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.867G>A	20.37:g.62839416G>A		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	14.0	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Silent	SNP	ENST00000328439.1	37	CCDS13558.1																																																																																			.		0.567	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
MYT1	4661	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	20	62839434	62839434	+	Silent	SNP	G	G	A	rs537698482	byFrequency	TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr20:62839434G>A	ENST00000328439.1	+	7	1249	c.885G>A	c.(883-885)gaG>gaA	p.E295E	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Silent_p.E295E	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					aggaagaggaggaggaagagg	0.572																																					p.E295E	GBM(59;481 1041 20555 21139 33705)	.											.	MYT1	704	0			c.G885A						.						47.0	47.0	47.0					20																	62839434		2203	4300	6503	SO:0001819	synonymous_variant	4661	exon7			AGAGGAGGAGGAA	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.885G>A	20.37:g.62839434G>A		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	7.0	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Silent	SNP	ENST00000328439.1	37	CCDS13558.1																																																																																			.		0.572	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
NBAS	51594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	15378653	15378653	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr2:15378653G>C	ENST00000281513.5	-	45	5907	c.5882C>G	c.(5881-5883)tCa>tGa	p.S1961*	NBAS_ENST00000441750.1_Nonsense_Mutation_p.S1841*	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1961					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GTGGGCAAGTGATTTCTCCAG	0.408																																					p.S1961X		.											.	NBAS	94	0			c.C5882G						.						106.0	107.0	107.0					2																	15378653		2203	4300	6503	SO:0001587	stop_gained	51594	exon45			GCAAGTGATTTCT	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5882C>G	2.37:g.15378653G>C	ENSP00000281513:p.Ser1961*	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	35.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Nonsense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	48|48	14.352992|14.352992	0.99791|0.99791	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000442506|ENST00000441750;ENST00000281513;ENST00000417461	.|.	.|.	.|.	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	.|0.101468	.|0.64402	.|D	.|0.000003	D|.	0.82384|.	0.5025|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.83259|.	-0.0049|.	3|.	.|0.87932	.|D	.|0	.|.	20.4238|20.4238	0.99064|0.99064	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	D|X	1009|1841;1961;53	.|.	.|ENSP00000281513:S1961X	H|S	-|-	1|2	0|0	NBAS|NBAS	15296104|15296104	1.000000|1.000000	0.71417|0.71417	0.592000|0.592000	0.28758|0.28758	0.979000|0.979000	0.70002|0.70002	8.491000|8.491000	0.90468|0.90468	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	CAC|TCA	.		0.408	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
NFS1	9054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34263098	34263098	+	Missense_Mutation	SNP	G	G	A	rs200454792		TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr20:34263098G>A	ENST00000374092.4	-	8	887	c.817C>T	c.(817-819)Cgg>Tgg	p.R273W	RP1-309K20.6_ENST00000541176.2_5'Flank|NFS1_ENST00000498084.1_5'Flank|NFS1_ENST00000540053.1_Missense_Mutation_p.R71W|NFS1_ENST00000374085.1_Missense_Mutation_p.R213W|NFS1_ENST00000397425.1_Missense_Mutation_p.R213W|NFS1_ENST00000541387.1_Missense_Mutation_p.R222W	NM_021100.4	NP_066923.3	Q9Y697	NFS1_HUMAN	NFS1 cysteine desulfurase	273					cysteine metabolic process (GO:0006534)|iron incorporation into metallo-sulfur cluster (GO:0018283)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|protein complex assembly (GO:0006461)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine desulfurase activity (GO:0031071)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	18	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)	ACACGGGGCCGGCGACGGATG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		16043	0.001		0.0	False		,,,				2504	0.0				p.R273W		.											.	NFS1	92	0			c.C817T						.						19.0	22.0	21.0					20																	34263098		2203	4300	6503	SO:0001583	missense	9054	exon8			GGGGCCGGCGACG	AF097025	CCDS13262.1, CCDS56185.1	20q11.22	2013-08-06	2013-08-06		ENSG00000244005	ENSG00000244005	2.8.1.7		15910	protein-coding gene	gene with protein product		603485	"""nitrogen fixation 1 (S. cerevisiae, homolog)"", ""NFS1 nitrogen fixation 1 homolog (S. cerevisiae)"""			9885568, 16847322	Standard	NM_021100		Approved	NifS, IscS	uc002xdw.2	Q9Y697	OTTHUMG00000032361	ENST00000374092.4:c.817C>T	20.37:g.34263098G>A	ENSP00000363205:p.Arg273Trp	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	81.0	NM_021100	B3KMA5|B4DXK9|E1P5R8|F5GYK5|Q6P0L8|Q9NTZ5|Q9Y481	Missense_Mutation	SNP	ENST00000374092.4	37	CCDS13262.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	20.7	4.027859	0.75390	.	.	ENSG00000244005	ENST00000374092;ENST00000374085;ENST00000397425;ENST00000540053;ENST00000541387	D;D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21;-2.21	5.03	2.96	0.34315	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.111143	0.64402	D	0.000012	D	0.95105	0.8414	H	0.96301	3.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.95353	0.8448	10	0.87932	D	0	-1.3711	12.6107	0.56549	0.0:0.0:0.5509:0.4491	.	222;273	F5GYK5;Q9Y697	.;NFS1_HUMAN	W	273;213;213;71;222	ENSP00000363205:R273W;ENSP00000363198:R213W;ENSP00000380570:R213W;ENSP00000438594:R71W;ENSP00000440897:R222W	ENSP00000363198:R213W	R	-	1	2	NFS1	33726512	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.712000	0.47186	0.616000	0.30141	0.462000	0.41574	CGG	G|0.999;A|0.000		0.547	NFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078936.4	NM_021100	
NLGN1	22871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	173998531	173998531	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr3:173998531G>T	ENST00000457714.1	+	7	2339	c.1910G>T	c.(1909-1911)aGa>aTa	p.R637I	NLGN1_ENST00000361589.4_Missense_Mutation_p.R637I|NLGN1_ENST00000401917.3_Missense_Mutation_p.R677I|NLGN1_ENST00000545397.1_Missense_Mutation_p.R637I	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	654					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ATCACTTTCAGACCTACGAGA	0.433																																					p.R637I		.											.	NLGN1	231	0			c.G1910T						.						122.0	121.0	121.0					3																	173998531		2203	4300	6503	SO:0001583	missense	22871	exon7			CTTTCAGACCTAC	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1910G>T	3.37:g.173998531G>T	ENSP00000392500:p.Arg637Ile	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	53.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	G	10.58	1.389465	0.25118	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	5.59	5.59	0.84812	.	0.049426	0.85682	D	0.000000	T	0.56217	0.1970	L	0.36672	1.1	0.80722	D	1	B	0.16166	0.016	B	0.22152	0.038	T	0.49312	-0.8953	10	0.22109	T	0.4	.	13.2118	0.59830	0.0729:0.0:0.9271:0.0	.	637	Q8N2Q7-2	.	I	637;637;637;677	ENSP00000392500:R637I;ENSP00000354541:R637I;ENSP00000441108:R637I;ENSP00000385750:R677I	ENSP00000354541:R637I	R	+	2	0	NLGN1	175481225	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.090000	0.71397	2.793000	0.96121	0.655000	0.94253	AGA	.		0.433	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
NOL7	51406	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	13618350	13618350	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr6:13618350T>C	ENST00000451315.2	+	5	511	c.479T>C	c.(478-480)gTa>gCa	p.V160A	RP1-223E5.4_ENST00000566170.1_RNA|NOL7_ENST00000474485.1_3'UTR|AL441883.1_ENST00000600057.1_3'UTR	NM_016167.3	NP_057251.2	Q9UMY1	NOL7_HUMAN	nucleolar protein 7, 27kDa	160						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(1)	5	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.135)	Epithelial(50;0.176)			AAAGTTAAAGTACAAAAAGTA	0.303																																					p.V160A		.											.	NOL7	90	0			c.T479C						.						43.0	47.0	45.0					6																	13618350		2201	4296	6497	SO:0001583	missense	51406	exon5			TTAAAGTACAAAA	AF172066	CCDS4528.1	6p23	2008-05-23	2004-02-10		ENSG00000225921	ENSG00000225921			21040	protein-coding gene	gene with protein product		611533	"""chromosome 6 open reading frame 90"", ""polyglutamine binding protein 3"""	C6orf90, PQBP3		16205646	Standard	NM_016167		Approved	NOP27, RARG-1, dJ223E5.2	uc003naz.3	Q9UMY1	OTTHUMG00000014277	ENST00000451315.2:c.479T>C	6.37:g.13618350T>C	ENSP00000405674:p.Val160Ala	Somatic	223.0	1.0		WXS	Illumina HiSeq	Phase_I	263.0	60.0	NM_016167	Q5T297|Q9Y3U7	Missense_Mutation	SNP	ENST00000451315.2	37	CCDS4528.1	.	.	.	.	.	.	.	.	.	.	T	9.968	1.224724	0.22457	.	.	ENSG00000225921	ENST00000451315	.	.	.	4.01	4.01	0.46588	.	0.570613	0.16562	N	0.208984	T	0.08492	0.0211	N	0.19112	0.55	0.31172	N	0.703062	P	0.36027	0.533	B	0.31495	0.131	T	0.07597	-1.0764	9	0.06236	T	0.91	-14.242	9.6169	0.39696	0.0:0.0:0.0:1.0	.	160	Q9UMY1	NOL7_HUMAN	A	160	.	ENSP00000405674:V160A	V	+	2	0	NOL7	13726329	0.480000	0.25933	0.887000	0.34795	0.970000	0.65996	0.983000	0.29552	2.029000	0.59856	0.533000	0.62120	GTA	.		0.303	NOL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039904.1	NM_016167	
OR5K3	403277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	98109590	98109590	+	Silent	SNP	G	G	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr3:98109590G>C	ENST00000383695.1	+	1	81	c.81G>C	c.(79-81)ctG>ctC	p.L27L	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						AGACTGTTCTGTTTGTGGTGT	0.418																																					p.L27L		.											.	OR5K3	68	0			c.G81C						.						236.0	216.0	223.0					3																	98109590		2203	4300	6503	SO:0001819	synonymous_variant	403277	exon1			TGTTCTGTTTGTG		CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.81G>C	3.37:g.98109590G>C		Somatic	289.0	0.0		WXS	Illumina HiSeq	Phase_I	218.0	58.0	NM_001005516		Silent	SNP	ENST00000383695.1	37	CCDS33803.1																																																																																			.		0.418	OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359110.1		
OTOP1	133060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	4199475	4199475	+	Silent	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr4:4199475C>A	ENST00000296358.4	-	5	1110	c.1086G>T	c.(1084-1086)ggG>ggT	p.G362G		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	362					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCCCCGCAGCCCCCATAAGCA	0.542																																					p.G362G		.											.	OTOP1	92	0			c.G1086T						.						41.0	44.0	43.0					4																	4199475		2203	4300	6503	SO:0001819	synonymous_variant	133060	exon5			CGCAGCCCCCATA	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.1086G>T	4.37:g.4199475C>A		Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	54.0	NM_177998	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.542	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
PKD1L2	114780	broad.mit.edu;ucsc.edu;mdanderson.org	37	16	81142804	81142804	+	RNA	SNP	C	C	T	rs529627344		TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr16:81142804C>T	ENST00000534142.1	-	0	1468				RNU6-1191P_ENST00000516799.1_RNA|PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000525539.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GTTACCTCCTCGTAGTTGAAG	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		19117	0.0		0.0	False		,,,				2504	0.001				.		.											.	PKD1L2	92	0			.						.						44.0	45.0	45.0					16																	81142804		1967	4139	6106			114780	.			CCTCCTCGTAGTT	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81142804C>T		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	41.0	.	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000534142.1	37																																																																																				.		0.532	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene	OTTHUMT00000387969.1		
PTPLAD2	401494	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21008070	21008070	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr9:21008070G>A	ENST00000495827.2	-	6	611	c.566C>T	c.(565-567)tCc>tTc	p.S189F	PTPLAD2_ENST00000513293.2_Missense_Mutation_p.S189F	NM_001010915.3	NP_001010915.2	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain containing 2	189					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		GAAATAGATGGATAAGTCAAA	0.353																																					p.S189F		.											.	PTPLAD2	91	0			c.C566T						.						117.0	112.0	113.0					9																	21008070		1876	4110	5986	SO:0001583	missense	401494	exon6			TAGATGGATAAGT		CCDS43791.1	9p21.3	2008-02-05			ENSG00000188921	ENSG00000188921			20920	protein-coding gene	gene with protein product		615941					Standard	NM_001010915		Approved	Em:AL662879.1, OTTHUMG00000021016	uc010mir.1	Q5VWC8	OTTHUMG00000021016	ENST00000495827.2:c.566C>T	9.37:g.21008070G>A	ENSP00000419503:p.Ser189Phe	Somatic	135.0	1.0		WXS	Illumina HiSeq	Phase_I	81.0	19.0	NM_001010915	Q7Z385	Missense_Mutation	SNP	ENST00000495827.2	37	CCDS43791.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.824485	0.50739	.	.	ENSG00000188921	ENST00000513293;ENST00000495827	T;T	0.34275	1.37;1.37	5.64	3.82	0.43975	.	0.295899	0.33792	N	0.004545	T	0.35595	0.0937	L	0.57536	1.79	0.24520	N	0.994162	B	0.06786	0.001	B	0.14578	0.011	T	0.34700	-0.9818	10	0.66056	D	0.02	-18.0133	12.249	0.54587	0.1391:0.0:0.8609:0.0	.	189	Q5VWC8	HACD4_HUMAN	F	189	ENSP00000426475:S189F;ENSP00000419503:S189F	ENSP00000419503:S189F	S	-	2	0	PTPLAD2	20998070	1.000000	0.71417	0.532000	0.27989	0.965000	0.64279	3.409000	0.52657	0.868000	0.35678	0.650000	0.86243	TCC	.		0.353	PTPLAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055434.3	NM_001010915	
PTPLAD2	401494	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21008109	21008109	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr9:21008109G>A	ENST00000495827.2	-	6	572	c.527C>T	c.(526-528)tCa>tTa	p.S176L	PTPLAD2_ENST00000513293.2_Missense_Mutation_p.S176L	NM_001010915.3	NP_001010915.2	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain containing 2	176					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		AGTGCCAAATGATTCAAAATA	0.363																																					p.S176L		.											.	PTPLAD2	91	0			c.C527T						.						118.0	112.0	114.0					9																	21008109		1868	4107	5975	SO:0001583	missense	401494	exon6			CCAAATGATTCAA		CCDS43791.1	9p21.3	2008-02-05			ENSG00000188921	ENSG00000188921			20920	protein-coding gene	gene with protein product		615941					Standard	NM_001010915		Approved	Em:AL662879.1, OTTHUMG00000021016	uc010mir.1	Q5VWC8	OTTHUMG00000021016	ENST00000495827.2:c.527C>T	9.37:g.21008109G>A	ENSP00000419503:p.Ser176Leu	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	21.0	NM_001010915	Q7Z385	Missense_Mutation	SNP	ENST00000495827.2	37	CCDS43791.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.178924	0.57692	.	.	ENSG00000188921	ENST00000513293;ENST00000495827	T;T	0.31247	1.5;1.5	5.64	4.74	0.60224	.	0.384793	0.26816	N	0.022344	T	0.30262	0.0759	L	0.47716	1.5	0.38633	D	0.951419	B	0.06786	0.001	B	0.10450	0.005	T	0.12218	-1.0556	10	0.52906	T	0.07	-22.4092	14.9311	0.70916	0.0703:0.0:0.9297:0.0	.	176	Q5VWC8	HACD4_HUMAN	L	176	ENSP00000426475:S176L;ENSP00000419503:S176L	ENSP00000419503:S176L	S	-	2	0	PTPLAD2	20998109	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.388000	0.59633	1.494000	0.48533	0.650000	0.86243	TCA	.		0.363	PTPLAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055434.3	NM_001010915	
RAD1	5810	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	34914910	34914910	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr5:34914910T>C	ENST00000382038.2	-	2	1507	c.88A>G	c.(88-90)Atc>Gtc	p.I30V	RAD1_ENST00000341754.4_Missense_Mutation_p.I30V|BRIX1_ENST00000336767.5_5'Flank	NM_002853.3	NP_002844.1	O60671	RAD1_HUMAN	RAD1 checkpoint DNA exonuclease	30					cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|meiotic recombination checkpoint (GO:0051598)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|substantia nigra development (GO:0021762)	chromosome (GO:0005694)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|damaged DNA binding (GO:0003684)|exodeoxyribonuclease III activity (GO:0008853)			endometrium(3)|large_intestine(1)|lung(5)|urinary_tract(1)	10	all_lung(31;0.000107)	Lung NSC(810;5.19e-05)|Ovarian(839;0.0448)|Breast(839;0.198)	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			GCTTTCAAGATAGTGGAGAGA	0.463								Other conserved DNA damage response genes																													p.I30V		.											.	RAD1	227	0			c.A88G						.						133.0	122.0	126.0					5																	34914910		2203	4300	6503	SO:0001583	missense	5810	exon2			TCAAGATAGTGGA	AF074717	CCDS3905.1	5p13	2014-08-08	2014-08-08		ENSG00000113456	ENSG00000113456	3.1.11.2		9806	protein-coding gene	gene with protein product	"""exonuclease homolog RAD1"", ""checkpoint control protein HRAD1"", ""cell cycle checkpoint protein Hrad1"", ""Rad1-like DNA damage checkpoint"", ""DNA repair exonuclease REC1"""	603153	"""RAD1 (S. pombe) homolog"", ""RAD1 homolog (S. pombe)"""			9716408, 9828137	Standard	NR_026591		Approved	HRAD1, REC1	uc003jix.3	O60671	OTTHUMG00000090783	ENST00000382038.2:c.88A>G	5.37:g.34914910T>C	ENSP00000371469:p.Ile30Val	Somatic	304.0	1.0		WXS	Illumina HiSeq	Phase_I	255.0	66.0	NM_002853	O75572|O95304|Q1W161|Q5KSM0|Q5KSM1|Q9UEP1	Missense_Mutation	SNP	ENST00000382038.2	37	CCDS3905.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.314731	0.40996	.	.	ENSG00000113456	ENST00000382038;ENST00000341754;ENST00000542494	T;T	0.15952	2.38;2.38	5.83	-0.575	0.11734	.	0.353536	0.30602	N	0.009261	T	0.10551	0.0258	L	0.35542	1.07	0.21473	N	0.999678	B	0.02656	0.0	B	0.09377	0.004	T	0.19647	-1.0299	10	0.39692	T	0.17	.	6.9281	0.24426	0.0:0.358:0.1301:0.5119	.	30	O60671	RAD1_HUMAN	V	30	ENSP00000371469:I30V;ENSP00000340879:I30V	ENSP00000313467:I30V	I	-	1	0	RAD1	34950667	0.710000	0.27896	0.005000	0.12908	0.974000	0.67602	0.606000	0.24194	-0.304000	0.08843	0.533000	0.62120	ATC	.		0.463	RAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207567.1	NM_002853	
RASSF8	11228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	26217450	26217450	+	Silent	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr12:26217450C>A	ENST00000405154.2	+	3	322	c.123C>A	c.(121-123)acC>acA	p.T41T	RASSF8_ENST00000381352.3_Silent_p.T41T|RASSF8_ENST00000541490.1_Silent_p.T41T|RASSF8_ENST00000282884.9_Silent_p.T41T|RASSF8_ENST00000542865.1_Silent_p.T41T	NM_001164748.1	NP_001158220.1	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 8	41	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				signal transduction (GO:0007165)					cervix(2)|endometrium(1)|large_intestine(6)|lung(15)|urinary_tract(1)	25	Colorectal(261;0.0847)					GAAGGTACACCCTTATAGAGA	0.363																																					p.T41T		.											.	RASSF8	90	0			c.C123A						.						95.0	100.0	98.0					12																	26217450		2203	4300	6503	SO:0001819	synonymous_variant	11228	exon4			GTACACCCTTATA	U82396	CCDS8705.1, CCDS53765.1	12p12.3	2013-05-30	2008-02-22	2005-09-14	ENSG00000123094	ENSG00000123094			13232	protein-coding gene	gene with protein product		608231	"""chromosome 12 open reading frame 2"""	C12orf2			Standard	NM_007211		Approved	HoJ-1	uc001rgx.3	Q8NHQ8	OTTHUMG00000169087	ENST00000405154.2:c.123C>A	12.37:g.26217450C>A		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	32.0	NM_007211	A8K1Z0|O95647|Q5SCI2|Q76KB6	Silent	SNP	ENST00000405154.2	37	CCDS53765.1																																																																																			.		0.363	RASSF8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402209.2	NM_007211	
RBL1	5933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	35683995	35683995	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr20:35683995C>T	ENST00000373664.3	-	11	1494	c.1428G>A	c.(1426-1428)atG>atA	p.M476I	RBL1_ENST00000344359.3_Missense_Mutation_p.M476I	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	476	Domain A.|Pocket; binds T and E1A.				chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				TTTCCTGAACCATTACAGTCT	0.388																																					p.M476I		.											.	RBL1	419	0			c.G1428A						.						112.0	103.0	106.0					20																	35683995		2202	4299	6501	SO:0001583	missense	5933	exon11			CTGAACCATTACA	L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.1428G>A	20.37:g.35683995C>T	ENSP00000362768:p.Met476Ile	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	39.0	NM_183404	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	SNP	ENST00000373664.3	37	CCDS13289.1	.	.	.	.	.	.	.	.	.	.	C	4.373	0.068759	0.08436	.	.	ENSG00000080839	ENST00000373664;ENST00000344359	D;D	0.86366	-2.11;-2.11	4.8	3.84	0.44239	Retinoblastoma-associated protein, A-box (1);Cyclin-like (2);	0.140268	0.64402	D	0.000003	T	0.68007	0.2954	N	0.04705	-0.18	0.44946	D	0.997967	P;B	0.38827	0.649;0.005	B;B	0.32624	0.149;0.028	T	0.66248	-0.5971	10	0.14252	T	0.57	-7.3058	10.2705	0.43481	0.1532:0.6992:0.1476:0.0	.	476;476	P28749-2;P28749	.;RBL1_HUMAN	I	476	ENSP00000362768:M476I;ENSP00000343646:M476I	ENSP00000343646:M476I	M	-	3	0	RBL1	35117409	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.408000	0.44574	1.256000	0.44068	-0.181000	0.13052	ATG	.		0.388	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2	NM_002895	
SNRK	54861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	43381915	43381915	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr3:43381915C>G	ENST00000296088.7	+	5	1172	c.868C>G	c.(868-870)Ctc>Gtc	p.L290V	SNRK_ENST00000437827.1_Missense_Mutation_p.L84V|SNRK_ENST00000454177.1_Missense_Mutation_p.L290V|SNRK_ENST00000429705.2_Missense_Mutation_p.L290V	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		ATACAAAAATCTCTCGGAAGA	0.478																																					p.L290V		.											.	SNRK	815	0			c.C868G						.						87.0	90.0	89.0					3																	43381915		1958	4149	6107	SO:0001583	missense	54861	exon5			AAAAATCTCTCGG	D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.868C>G	3.37:g.43381915C>G	ENSP00000296088:p.Leu290Val	Somatic	200.0	0.0		WXS	Illumina HiSeq	Phase_I	217.0	70.0	NM_017719		Missense_Mutation	SNP	ENST00000296088.7	37	CCDS43075.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844580	0.71488	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088;ENST00000437827	D;D;D;T	0.82893	-1.66;-1.66;-1.66;-0.81	5.33	5.33	0.75918	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.77685	0.4167	L	0.41573	1.285	0.80722	D	1	B	0.25904	0.137	B	0.31614	0.133	T	0.71751	-0.4498	10	0.06365	T	0.9	.	19.3838	0.94548	0.0:1.0:0.0:0.0	.	290	Q9NRH2	SNRK_HUMAN	V	290;290;290;84	ENSP00000401246:L290V;ENSP00000411375:L290V;ENSP00000296088:L290V;ENSP00000409516:L84V	ENSP00000296088:L290V	L	+	1	0	SNRK	43356919	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	4.920000	0.63390	2.670000	0.90874	0.655000	0.94253	CTC	.		0.478	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719	
SNTB1	6641	hgsc.bcm.edu;broad.mit.edu	37	8	121824005	121824005	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr8:121824005C>A	ENST00000395601.3	-	2	493	c.79G>T	c.(79-81)Gaa>Taa	p.E27*	SNTB1_ENST00000519177.1_5'Flank|RP11-713M15.2_ENST00000605955.1_RNA|SNTB1_ENST00000517992.1_Nonsense_Mutation_p.E27*	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	27	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			ACCAAAACTTCCAGCAGCCCG	0.682																																					p.E27X		.											.	SNTB1	228	0			c.G79T						.						13.0	12.0	12.0					8																	121824005		2159	4227	6386	SO:0001587	stop_gained	6641	exon1			AAACTTCCAGCAG	AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.79G>T	8.37:g.121824005C>A	ENSP00000378965:p.Glu27*	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	5.0	NM_021021	A8K9E0|O14912|Q4KMG8	Nonsense_Mutation	SNP	ENST00000395601.3	37	CCDS6334.1	.	.	.	.	.	.	.	.	.	.	C	39	7.500416	0.98322	.	.	ENSG00000172164	ENST00000395601;ENST00000517992;ENST00000520717	.	.	.	4.97	4.1	0.47936	.	0.233112	0.42420	D	0.000703	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.8622	0.57920	0.0:0.9195:0.0:0.0805	.	.	.	.	X	27	.	ENSP00000378965:E27X	E	-	1	0	SNTB1	121893186	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.878000	0.75567	1.073000	0.40885	0.561000	0.74099	GAA	.		0.682	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381535.1	NM_021021	
SNTG2	54221	hgsc.bcm.edu;broad.mit.edu	37	2	1093900	1093900	+	Missense_Mutation	SNP	C	C	T	rs192264442	byFrequency	TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr2:1093900C>T	ENST00000308624.5	+	3	358	c.229C>T	c.(229-231)Cgc>Tgc	p.R77C	SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	77	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TGTTACACTCCGCAGACAGCC	0.358																																					p.R77C		.											.	SNTG2	136	0			c.C229T						.						219.0	224.0	223.0					2																	1093900		1844	4095	5939	SO:0001583	missense	54221	exon3			ACACTCCGCAGAC	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.229C>T	2.37:g.1093900C>T	ENSP00000311837:p.Arg77Cys	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	4.0	NM_018968	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	C	6.641	0.486677	0.12641	.	.	ENSG00000172554	ENST00000308624	T	0.27557	1.66	4.68	4.68	0.58851	PDZ/DHR/GLGF (3);	0.191315	0.44483	D	0.000445	T	0.31734	0.0806	L	0.53729	1.69	0.80722	D	1	B	0.21688	0.059	B	0.19666	0.026	T	0.10428	-1.0630	10	0.45353	T	0.12	.	15.3884	0.74723	0.0:1.0:0.0:0.0	.	77	Q9NY99	SNTG2_HUMAN	C	77	ENSP00000311837:R77C	ENSP00000311837:R77C	R	+	1	0	SNTG2	1083900	0.996000	0.38824	1.000000	0.80357	0.026000	0.11368	1.692000	0.37731	2.121000	0.65114	0.563000	0.77884	CGC	C|0.998;A|0.002		0.358	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
SPTBN1	6711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	54876897	54876897	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr2:54876897T>G	ENST00000356805.4	+	26	5629	c.5348T>G	c.(5347-5349)cTc>cGc	p.L1783R	SPTBN1_ENST00000333896.5_Missense_Mutation_p.L1770R	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1783	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AAGGATGGCCTCAATGAAGCC	0.537																																					p.L1783R		.											.	SPTBN1	140	0			c.T5348G						.						82.0	76.0	78.0					2																	54876897		2203	4300	6503	SO:0001583	missense	6711	exon26			ATGGCCTCAATGA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.5348T>G	2.37:g.54876897T>G	ENSP00000349259:p.Leu1783Arg	Somatic	279.0	0.0		WXS	Illumina HiSeq	Phase_I	258.0	80.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.576172	0.86645	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.64803	-0.12;-0.12	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.85843	0.5791	H	0.95917	3.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90388	0.4393	10	0.87932	D	0	.	16.0606	0.80836	0.0:0.0:0.0:1.0	.	1770;1783	Q01082-3;Q01082	.;SPTB2_HUMAN	R	1783;1770	ENSP00000349259:L1783R;ENSP00000334156:L1770R	ENSP00000334156:L1770R	L	+	2	0	SPTBN1	54730401	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.945000	0.87732	2.201000	0.70794	0.454000	0.30748	CTC	.		0.537	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
ST3GAL6	10402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	98487331	98487331	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr3:98487331A>C	ENST00000483910.1	+	2	336	c.47A>C	c.(46-48)tAt>tCt	p.Y16S	ST3GAL6_ENST00000265261.6_5'UTR|ST3GAL6_ENST00000468553.1_Missense_Mutation_p.Y16S|ST3GAL6_ENST00000394162.1_Missense_Mutation_p.Y16S|ST3GAL6_ENST00000462152.1_Intron	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6	16					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						GTCTTCCTCTATTATGTACTG	0.398																																					p.Y69S		.											.	ST3GAL6	91	0			c.A206C						.						249.0	230.0	237.0					3																	98487331		2203	4300	6503	SO:0001583	missense	10402	exon2			TCCTCTATTATGT	AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.47A>C	3.37:g.98487331A>C	ENSP00000417376:p.Tyr16Ser	Somatic	188.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	41.0	NM_001271145	B2RCH2|B3KMI1|D3DN39|F8W6U0	Missense_Mutation	SNP	ENST00000483910.1	37	CCDS2933.1	.	.	.	.	.	.	.	.	.	.	A	16.24	3.066198	0.55539	.	.	ENSG00000064225	ENST00000483910;ENST00000460774;ENST00000497008;ENST00000486334;ENST00000394162;ENST00000468553;ENST00000485391;ENST00000492254	T;T;T;T	0.53206	0.68;0.63;0.68;0.73	6.06	6.06	0.98353	.	0.194728	0.36740	N	0.002429	T	0.46132	0.1377	L	0.32530	0.975	0.80722	D	1	D;P	0.54397	0.966;0.895	P;B	0.49012	0.598;0.307	T	0.47302	-0.9128	10	0.62326	D	0.03	-7.9031	13.0011	0.58676	1.0:0.0:0.0:0.0	.	39;16	C9J480;Q9Y274	.;SIA10_HUMAN	S	16;16;16;16;16;16;16;39	ENSP00000417376:Y16S;ENSP00000418896:Y16S;ENSP00000377717:Y16S;ENSP00000417201:Y39S	ENSP00000377717:Y16S	Y	+	2	0	ST3GAL6	99970021	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	4.619000	0.61218	2.324000	0.78689	0.533000	0.62120	TAT	.		0.398	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353013.2	NM_006100	
SULT6B1	391365	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	37414600	37414600	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr2:37414600C>A	ENST00000535679.1	-	2	209	c.210G>T	c.(208-210)tgG>tgT	p.W70C	SULT6B1_ENST00000379149.2_Missense_Mutation_p.W70C|SULT6B1_ENST00000260637.3_Missense_Mutation_p.W32C|SULT6B1_ENST00000407963.1_Missense_Mutation_p.W32C			Q6IMI4	ST6B1_HUMAN	sulfotransferase family, cytosolic, 6B, member 1	70						cytoplasm (GO:0005737)	sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(1)	12		all_hematologic(82;0.248)				TGTGGAGAATCCAGTTTGAAC	0.294																																					p.W32C		.											.	SULT6B1	91	0			c.G96T						.						32.0	34.0	33.0					2																	37414600		2199	4292	6491	SO:0001583	missense	391365	exon2			GAGAATCCAGTTT	AY289770, AY289774	CCDS33182.1	2p22.2	2007-07-26			ENSG00000138068	ENSG00000138068		"""Sulfotransferases, cytosolic"""	33433	protein-coding gene	gene with protein product						14676822	Standard	XM_005264307		Approved		uc002rpu.3	Q6IMI4	OTTHUMG00000152160	ENST00000535679.1:c.210G>T	2.37:g.37414600C>A	ENSP00000444081:p.Trp70Cys	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	5.0	NM_001032377	B2RTS7	Missense_Mutation	SNP	ENST00000535679.1	37		.	.	.	.	.	.	.	.	.	.	C	16.27	3.075785	0.55646	.	.	ENSG00000138068	ENST00000535679;ENST00000379149;ENST00000260637;ENST00000407963	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	5.04	4.15	0.48705	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	H	0.98802	4.335	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79434	-0.1805	10	0.87932	D	0	.	13.7929	0.63152	0.1548:0.8452:0.0:0.0	.	70	Q6IMI4	ST6B1_HUMAN	C	70;70;32;32	ENSP00000444081:W70C;ENSP00000368444:W70C;ENSP00000260637:W32C;ENSP00000384950:W32C	ENSP00000260637:W32C	W	-	3	0	SULT6B1	37268104	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.242000	0.58714	1.319000	0.45190	0.650000	0.86243	TGG	.		0.294	SULT6B1-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001032377	
TANC2	26115	broad.mit.edu;bcgsc.ca	37	17	61315195	61315196	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	-	-	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr17:61315195_61315196insA	ENST00000424789.2	+	6	572_573	c.568_569insA	c.(568-570)gaafs	p.E190fs	TANC2_ENST00000389520.4_Frame_Shift_Ins_p.E190fs|AC037445.1_ENST00000581421.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	190					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						AAGCTATTCTGAAAATGTGGAA	0.337																																					p.E190fs		.											.	TANC2	24	0			c.568_569insA						.																																			SO:0001589	frameshift_variant	26115	exon6			TATTCTGAAAATG	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.572dupA	17.37:g.61315199_61315199dupA	ENSP00000387593:p.Glu190fs	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	9.0	NM_025185	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Frame_Shift_Ins	INS	ENST00000424789.2	37	CCDS45754.1																																																																																			.		0.337	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		
TGFB2	7042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	218609331	218609331	+	Silent	SNP	A	A	G			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr1:218609331A>G	ENST00000366930.4	+	5	1241	c.774A>G	c.(772-774)acA>acG	p.T258T	TGFB2_ENST00000479322.1_3'UTR|TGFB2_ENST00000366929.4_Silent_p.T286T	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	258					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		GCACCTCCACATATACCAGTG	0.373																																					p.T286T		.											.	TGFB2	710	0			c.A858G						.						82.0	86.0	85.0					1																	218609331		2203	4300	6503	SO:0001819	synonymous_variant	7042	exon6			CTCCACATATACC	M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.774A>G	1.37:g.218609331A>G		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	22.0	NM_001135599	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Silent	SNP	ENST00000366930.4	37	CCDS1521.1																																																																																			.		0.373	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238	
THBS1	7057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	39886581	39886581	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr15:39886581G>A	ENST00000260356.5	+	21	3610	c.3445G>A	c.(3445-3447)Ggg>Agg	p.G1149R	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	1149	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TGGTAGACTAGGGTTGTTTGT	0.418																																					p.G1149R		.											.	THBS1	653	0			c.G3445A						.						163.0	153.0	157.0					15																	39886581		2200	4297	6497	SO:0001583	missense	7057	exon21			AGACTAGGGTTGT		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.3445G>A	15.37:g.39886581G>A	ENSP00000260356:p.Gly1149Arg	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	29.0	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	G	33	5.214773	0.95104	.	.	ENSG00000137801	ENST00000260356	D	0.96992	-4.2	5.44	5.44	0.79542	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.35262	N	0.003331	D	0.98529	0.9509	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99285	1.0897	10	0.87932	D	0	-20.1238	19.6125	0.95613	0.0:0.0:1.0:0.0	.	1064;1149	B4E3J7;P07996	.;TSP1_HUMAN	R	1149	ENSP00000260356:G1149R	ENSP00000260356:G1149R	G	+	1	0	THBS1	37673873	1.000000	0.71417	0.813000	0.32504	0.995000	0.86356	9.813000	0.99286	2.698000	0.92095	0.591000	0.81541	GGG	.		0.418	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
TLR9	54106	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	52256679	52256679	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr3:52256679G>T	ENST00000360658.2	-	2	2286	c.1653C>A	c.(1651-1653)gaC>gaA	p.D551E	TLR9_ENST00000494383.1_Missense_Mutation_p.P705T|TLR9_ENST00000597542.1_Missense_Mutation_p.D575E	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	551					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	TGTAGCTGAGGTCCAGGGCCT	0.632																																					p.D551E		.											.	TLR9	587	0			c.C1653A						.						52.0	46.0	48.0					3																	52256679		2203	4300	6503	SO:0001583	missense	54106	exon2			GCTGAGGTCCAGG	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.1653C>A	3.37:g.52256679G>T	ENSP00000353874:p.Asp551Glu	Somatic	84.0	1.0		WXS	Illumina HiSeq	Phase_I	130.0	49.0	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	CCDS2848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.950009|3.950009	0.73787|0.73787	.|.	.|.	ENSG00000239732|ENSG00000173366	ENST00000360658|ENST00000494383	T|.	0.59772|.	0.24|.	5.39|5.39	4.52|4.52	0.55395|0.55395	.|.	0.000000|.	0.43747|.	D|.	0.000533|.	T|T	0.64316|0.64316	0.2587|0.2587	M|M	0.71036|0.71036	2.16|2.16	0.45452|0.45452	D|D	0.998421|0.998421	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.79784|.	0.985;0.993|.	T|T	0.63646|0.63646	-0.6590|-0.6590	10|5	0.87932|.	D|.	0|.	.|.	8.2826|8.2826	0.31908|0.31908	0.1794:0.0:0.8206:0.0|0.1794:0.0:0.8206:0.0	.|.	648;551|.	B4E0A1;Q9NR96|.	.;TLR9_HUMAN|.	E|T	551|705	ENSP00000353874:D551E|.	ENSP00000353874:D551E|.	D|P	-|-	3|1	2|0	TLR9|RP11-330H6.5	52231719|52231719	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	0.782000|0.782000	0.26788|0.26788	1.285000|1.285000	0.44548|0.44548	0.561000|0.561000	0.74099|0.74099	GAC|CCT	.		0.632	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
TMIGD1	388364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	28656378	28656378	+	Silent	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr17:28656378G>A	ENST00000328886.4	-	3	324	c.252C>T	c.(250-252)tcC>tcT	p.S84S	TMIGD1_ENST00000538566.2_Silent_p.S84S	NM_206832.1	NP_996663.1	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain containing 1	84	Ig-like C2-type 1.					integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	12						AGACAGAGCTGGAATTGATTT	0.493																																					p.S84S		.											.	TMIGD1	90	0			c.C252T						.						141.0	121.0	128.0					17																	28656378		2203	4300	6503	SO:0001819	synonymous_variant	388364	exon3			AGAGCTGGAATTG	AY358153	CCDS32605.1	17q11.2	2013-01-29	2006-07-05	2006-07-05		ENSG00000182271		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32431	protein-coding gene	gene with protein product				TMIGD		12975309	Standard	NM_206832		Approved	UNQ9372	uc002hfa.1	Q6UXZ0		ENST00000328886.4:c.252C>T	17.37:g.28656378G>A		Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	47.0	NM_206832	A8K2K1|Q6ZMC6	Silent	SNP	ENST00000328886.4	37	CCDS32605.1																																																																																			.		0.493	TMIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447955.1	NM_206832	
TNXB	7148	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32063403	32063403	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr6:32063403C>T	ENST00000479795.1	-	3	2367	c.2227G>A	c.(2227-2229)Gaa>Aaa	p.E743K	TNXB_ENST00000375244.3_Missense_Mutation_p.E743K|TNXB_ENST00000375247.2_Missense_Mutation_p.E743K			P22105	TENX_HUMAN	tenascin XB	743	EGF-like 19. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CCGCAGTCTTCGCCAGCATAC	0.602																																					p.E743K		.											.	TNXB	90	0			c.G2227A						.						62.0	64.0	63.0					6																	32063403		2152	4250	6402	SO:0001583	missense	7148	exon3			AGTCTTCGCCAGC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.2227G>A	6.37:g.32063403C>T	ENSP00000418248:p.Glu743Lys	Somatic	300.0	1.0		WXS	Illumina HiSeq	Phase_I	580.0	96.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000479795.1	37		.	.	.	.	.	.	.	.	.	.	C	11.84	1.759124	0.31137	.	.	ENSG00000168477	ENST00000375244;ENST00000375247;ENST00000479795	T;T;T	0.03212	4.01;4.01;4.01	4.91	3.97	0.46021	.	0.146450	0.31472	N	0.007587	T	0.00967	0.0032	N	0.13198	0.31	0.27199	N	0.960216	P	0.51791	0.948	B	0.42771	0.397	T	0.51196	-0.8736	10	0.09590	T	0.72	.	13.5857	0.61928	0.0:0.8429:0.1571:0.0	.	743	P22105-3	.	K	743	ENSP00000364393:E743K;ENSP00000364396:E743K;ENSP00000418248:E743K	ENSP00000364393:E743K	E	-	1	0	TNXB	32171381	0.900000	0.30661	0.679000	0.29978	0.014000	0.08584	3.149000	0.50655	2.267000	0.75376	0.655000	0.94253	GAA	.		0.602	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	NM_019105	
TPCN2	219931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	68854594	68854594	+	Silent	SNP	G	G	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr11:68854594G>A	ENST00000294309.3	+	24	2201	c.2100G>A	c.(2098-2100)aaG>aaA	p.K700K	TPCN2_ENST00000542467.1_Silent_p.K518K|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	700					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TCCTTCACAAGTGGGACCCCC	0.652																																					p.K700K		.											.	TPCN2	90	0			c.G2100A						.						41.0	43.0	43.0					11																	68854594		2200	4294	6494	SO:0001819	synonymous_variant	219931	exon24			TCACAAGTGGGAC	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.2100G>A	11.37:g.68854594G>A		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	22.0	NM_139075	Q9NT82	Silent	SNP	ENST00000294309.3	37	CCDS8189.1																																																																																			.		0.652	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179499955	179499955	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr2:179499955T>G	ENST00000591111.1	-	178	37262	c.37038A>C	c.(37036-37038)gaA>gaC	p.E12346D	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E4922D|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E5047D|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E5114D|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E13987D|TTN_ENST00000342992.6_Missense_Mutation_p.E11419D|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12346					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTCTGAGATTTCTGCATCAA	0.388																																					p.E13987D		.											.	TTN	636	0			c.A41961C						.						184.0	169.0	174.0					2																	179499955		1879	4108	5987	SO:0001583	missense	7273	exon228			TGAGATTTCTGCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.37038A>C	2.37:g.179499955T>G	ENSP00000465570:p.Glu12346Asp	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	39.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	11.89	1.773424	0.31411	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.85	2.13	0.27403	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60274	0.2256	M	0.87269	2.87	0.39071	D	0.960718	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.72625	0.978;0.978;0.978;0.978	T	0.63435	-0.6638	9	0.87932	D	0	.	9.5744	0.39447	0.0:0.2588:0.0:0.7412	.	4922;5047;5114;12346	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	11419;4922;5114;5047;4922	ENSP00000343764:E11419D;ENSP00000434586:E4922D;ENSP00000340554:E5114D;ENSP00000352154:E5047D	ENSP00000340554:E5114D	E	-	3	2	TTN	179208200	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.646000	0.37249	0.125000	0.18397	-0.256000	0.11100	GAA	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBE2N	7334	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	93835657	93835657	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr12:93835657C>T	ENST00000318066.2	-	1	381	c.4G>A	c.(4-6)Gcc>Acc	p.A2T	UBE2N_ENST00000552442.1_Missense_Mutation_p.A2T|UBE2N_ENST00000549833.1_5'Flank|UBE2N_ENST00000550657.1_Missense_Mutation_p.A2T	NM_003348.3	NP_003339.1	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N	2					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|DNA double-strand break processing (GO:0000729)|double-strand break repair via homologous recombination (GO:0000724)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone ubiquitination (GO:0016574)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone modification (GO:0031058)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|postreplication repair (GO:0006301)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of DNA repair (GO:0006282)|regulation of histone ubiquitination (GO:0033182)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-MMS2 complex (GO:0031372)|UBC13-UEV1A complex (GO:0035370)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|liver(2)|lung(5)	10						GGCAGCCCGGCCATCTTGTCA	0.682								Direct reversal of damage;Rad6 pathway																													p.A2T	Pancreas(197;738 2228 30225 32034 33454)	.											.	UBE2N	659	0			c.G4A						.						32.0	34.0	33.0					12																	93835657		2203	4300	6503	SO:0001583	missense	7334	exon1			GCCCGGCCATCTT	D83004	CCDS31875.1	12q22	2011-05-19	2011-05-19			ENSG00000177889		"""Ubiquitin-conjugating enzymes E2"""	12492	protein-coding gene	gene with protein product		603679	"""ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)"", ""ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)"""			8902611	Standard	NM_003348		Approved	UbcH-ben, UBC13, MGC8489	uc001tcp.3	P61088	OTTHUMG00000170156	ENST00000318066.2:c.4G>A	12.37:g.93835657C>T	ENSP00000316176:p.Ala2Thr	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	57.0	NM_003348	Q16781|Q53Y81	Missense_Mutation	SNP	ENST00000318066.2	37	CCDS31875.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.073088	0.76415	.	.	ENSG00000177889	ENST00000318066;ENST00000550657;ENST00000552442	T;T;T	0.66460	1.09;-0.21;-0.14	4.79	3.9	0.45041	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.42682	U	0.000667	T	0.61476	0.2350	L	0.54323	1.7	0.42564	D	0.993154	B	0.09022	0.002	B	0.08055	0.003	T	0.63107	-0.6711	10	0.72032	D	0.01	0.1856	12.7691	0.57410	0.0:0.8348:0.1652:0.0	.	2	P61088	UBE2N_HUMAN	T	2	ENSP00000316176:A2T;ENSP00000449352:A2T;ENSP00000448352:A2T	ENSP00000316176:A2T	A	-	1	0	UBE2N	92359788	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.096000	0.41738	1.368000	0.46115	0.563000	0.77884	GCC	.		0.682	UBE2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407710.1	NM_003348	
UBQLN3	50613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5529136	5529136	+	Silent	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr11:5529136C>A	ENST00000311659.4	-	2	1800	c.1653G>T	c.(1651-1653)ggG>ggT	p.G551G	HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_5'Flank|HBG2_ENST00000380252.1_5'Flank	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	551										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACTACCCGTCCCTGCTAGGC	0.572																																					p.G551G	Ovarian(72;684 1260 12332 41642 52180)	.											.	UBQLN3	93	0			c.G1653T						.						54.0	48.0	50.0					11																	5529136		2201	4297	6498	SO:0001819	synonymous_variant	50613	exon2			ACCCGTCCCTGCT	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1653G>T	11.37:g.5529136C>A		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	27.0	NM_017481	Q9NRE0	Silent	SNP	ENST00000311659.4	37	CCDS7758.1																																																																																			.		0.572	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481	
UNC119B	84747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	121151187	121151187	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr12:121151187T>G	ENST00000344651.4	+	2	395	c.355T>G	c.(355-357)Tca>Gca	p.S119A	UNC119B_ENST00000539658.1_3'UTR	NM_001080533.1	NP_001074002.1	A6NIH7	U119B_HUMAN	unc-119 homolog B (C. elegans)	119					cilium morphogenesis (GO:0060271)|lipoprotein transport (GO:0042953)	ciliary transition zone (GO:0035869)	lipid binding (GO:0008289)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACCTTGCGTTTCAGGTAGGCC	0.438											OREG0022197	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S119A		.											.	UNC119B	69	0			c.T355G						.						124.0	109.0	114.0					12																	121151187		2203	4300	6503	SO:0001583	missense	84747	exon2			TGCGTTTCAGGTA		CCDS31914.1	12q24	2014-06-16	2001-11-28		ENSG00000175970	ENSG00000175970			16488	protein-coding gene	gene with protein product	"""POC7 centriolar protein homolog B (Chlamydomonas)"""		"""unc119 (C.elegans) homolog B"""				Standard	NM_001080533		Approved	MGC5139, POC7B	uc001tyz.4	A6NIH7	OTTHUMG00000169201	ENST00000344651.4:c.355T>G	12.37:g.121151187T>G	ENSP00000344942:p.Ser119Ala	Somatic	171.0	0.0	1509	WXS	Illumina HiSeq	Phase_I	151.0	49.0	NM_001080533		Missense_Mutation	SNP	ENST00000344651.4	37	CCDS31914.1	.	.	.	.	.	.	.	.	.	.	T	9.946	1.218750	0.22373	.	.	ENSG00000175970	ENST00000344651;ENST00000537794	.	.	.	5.25	-0.0333	0.13901	Immunoglobulin E-set (1);	1.294440	0.04863	N	0.444469	T	0.40979	0.1139	L	0.42245	1.32	0.18873	N	0.999989	B	0.02656	0.0	B	0.10450	0.005	T	0.29243	-1.0018	9	0.25751	T	0.34	-16.3266	10.1812	0.42968	0.1118:0.0:0.464:0.4242	.	119	A6NIH7	U119B_HUMAN	A	119	.	ENSP00000344942:S119A	S	+	1	0	UNC119B	119635570	1.000000	0.71417	0.190000	0.23270	0.866000	0.49608	0.825000	0.27393	-0.140000	0.11394	0.460000	0.39030	TCA	.		0.438	UNC119B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402857.1	NM_001080533	
VAV3	10451	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	108116734	108116734	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr1:108116734C>A	ENST00000370056.4	-	26	2711	c.2437G>T	c.(2437-2439)Gat>Tat	p.D813Y	VAV3_ENST00000527011.1_Missense_Mutation_p.D841Y|VAV3_ENST00000544443.1_Missense_Mutation_p.D217Y|VAV3_ENST00000415432.2_Missense_Mutation_p.D253Y|VAV3_ENST00000343258.4_5'UTR	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	813	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.|Sufficient for interaction with ROS1.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TTCACCACATCTCCTTTCAAC	0.463																																					p.D813Y		.											.	VAV3	1339	0			c.G2437T						.						270.0	238.0	249.0					1																	108116734		2203	4300	6503	SO:0001583	missense	10451	exon26			CCACATCTCCTTT	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.2437G>T	1.37:g.108116734C>A	ENSP00000359073:p.Asp813Tyr	Somatic	223.0	2.0		WXS	Illumina HiSeq	Phase_I	137.0	67.0	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	.	.	.	.	.	.	.	.	.	.	C	31	5.084462	0.94100	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000544443;ENST00000415432	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	5.93	5.93	0.95920	Src homology-3 domain (4);Variant SH3 (1);	0.041303	0.85682	D	0.000000	T	0.46425	0.1392	M	0.80422	2.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.995;0.98;0.999;0.997	T	0.46679	-0.9174	10	0.87932	D	0	.	20.3312	0.98718	0.0:1.0:0.0:0.0	.	841;245;813;253	E9PQ97;B7Z3Z5;Q9UKW4;Q9UKW4-3	.;.;VAV3_HUMAN;.	Y	813;841;217;253	ENSP00000359073:D813Y;ENSP00000432540:D841Y;ENSP00000446404:D217Y;ENSP00000394897:D253Y	ENSP00000359073:D813Y	D	-	1	0	VAV3	107918257	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.818000	0.86416	2.797000	0.96272	0.655000	0.94253	GAT	.		0.463	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
WASL	8976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	123334793	123334793	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr7:123334793C>T	ENST00000223023.4	-	8	1134	c.802G>A	c.(802-804)Gtt>Att	p.V268I		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	268					actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCATTTTTAACAGCTTCAACA	0.343																																					p.V268I		.											.	WASL	90	0			c.G802A						.						108.0	115.0	113.0					7																	123334793		2203	4300	6503	SO:0001583	missense	8976	exon8			TTTTAACAGCTTC	D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.802G>A	7.37:g.123334793C>T	ENSP00000223023:p.Val268Ile	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	24.0	NM_003941	A1JUI9|Q7Z746	Missense_Mutation	SNP	ENST00000223023.4	37	CCDS34743.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872612	0.91587	.	.	ENSG00000106299	ENST00000223023	D	0.95137	-3.62	5.87	4.99	0.66335	Wiscott-Aldrich syndrome, C-terminal (1);	0.056133	0.64402	N	0.000001	D	0.93083	0.7798	M	0.64676	1.99	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	D	0.90512	0.4482	10	0.72032	D	0.01	-12.7737	14.8933	0.70625	0.0:0.9312:0.0:0.0688	.	268	O00401	WASL_HUMAN	I	268	ENSP00000223023:V268I	ENSP00000223023:V268I	V	-	1	0	WASL	123122029	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.006000	0.70724	1.494000	0.48533	-0.225000	0.12378	GTT	.		0.343	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348522.1	NM_003941	
WEE2	494551	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	141408580	141408580	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A4NG-01A-11D-A27I-10	TCGA-DD-A4NG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	03c88506-d72e-4a44-a34e-a7f0564f1799	2b8a07c1-c041-4779-b4df-4bd6a8128dd8	g.chr7:141408580delA	ENST00000397541.2	+	1	428	c.22delA	c.(22-24)aaafs	p.K8fs	WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000495800.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	8			K -> T (in dbSNP:rs35672788). {ECO:0000269|PubMed:17344846}.		female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					AGATATTGACAAAGAACTAAG	0.443																																					p.K8fs		.											.	WEE2	305	0			c.22delA						.						125.0	120.0	122.0					7																	141408580		1876	4110	5986	SO:0001589	frameshift_variant	494551	exon1			ATTGACAAAGAAC	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.22delA	7.37:g.141408580delA	ENSP00000380675:p.Lys8fs	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	50.0	NM_001105558		Frame_Shift_Del	DEL	ENST00000397541.2	37	CCDS43660.1																																																																																			.		0.443	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349091.1	NM_001105558	
