#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	48287835	48287835	+	Splice_Site	SNP	G	G	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr7:48287835G>T	ENST00000435803.1	+	14	1683		c.e14-1			NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13						transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTCTTGTTAAGGATCGTATTT	0.383																																					.		.											.	ABCA13	521	0			c.1660-1G>T						.						51.0	50.0	50.0					7																	48287835		1827	4085	5912	SO:0001630	splice_region_variant	154664	exon14			TGTTAAGGATCGT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.1660-1G>T	7.37:g.48287835G>T		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	74.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Splice_Site	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929143	0.34096	.	.	ENSG00000179869	ENST00000435803	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5891	0.56434	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCA13	48258381	1.000000	0.71417	0.073000	0.20177	0.568000	0.35870	4.428000	0.59894	2.074000	0.62210	0.655000	0.94253	.	.		0.383	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	Intron
ACVR2A	92	hgsc.bcm.edu;bcgsc.ca	37	2	148684653	148684659	+	Frame_Shift_Del	DEL	TGGCAAT	TGGCAAT	-			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	TGGCAAT	TGGCAAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr2:148684653_148684659delTGGCAAT	ENST00000241416.7	+	11	1988_1994	c.1352_1358delTGGCAAT	c.(1351-1359)atggcaatgfs	p.MAM451fs	ACVR2A_ENST00000404590.1_Frame_Shift_Del_p.MAM451fs|ACVR2A_ENST00000495775.1_3'UTR|ACVR2A_ENST00000535787.1_Frame_Shift_Del_p.MAM343fs	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	451	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TTTTAGGGAATGGCAATGCTCTGTGAA	0.386																																					p.451_453del		.											.	ACVR2A	831	0			c.1352_1358del						.																																			SO:0001589	frameshift_variant	92	exon11			AGGGAATGGCAAT		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1352_1358delTGGCAAT	2.37:g.148684653_148684659delTGGCAAT	ENSP00000241416:p.Met451fs	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	13.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Frame_Shift_Del	DEL	ENST00000241416.7	37	CCDS33301.1																																																																																			.		0.386	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
ADAMTSL1	92949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	18777771	18777771	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr9:18777771G>A	ENST00000380548.4	+	19	3883	c.3544G>A	c.(3544-3546)Gtc>Atc	p.V1182I		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1182	Ig-like C2-type 2.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CTCGGAGGTGGTCACCCACCT	0.682																																					p.V1182I		.											.	ADAMTSL1	230	0			c.G3544A						.						23.0	28.0	27.0					9																	18777771		2118	4237	6355	SO:0001583	missense	92949	exon19			GAGGTGGTCACCC	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.3544G>A	9.37:g.18777771G>A	ENSP00000369921:p.Val1182Ile	Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	33.0	NM_001040272	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.827372	0.50845	.	.	ENSG00000178031	ENST00000380548	T	0.62639	0.01	5.94	5.94	0.96194	Immunoglobulin-like (1);	0.096148	0.43579	D	0.000545	T	0.51126	0.1656	N	0.12569	0.235	0.80722	D	1	P	0.42296	0.775	B	0.43658	0.426	T	0.45220	-0.9276	10	0.19147	T	0.46	.	20.3552	0.98837	0.0:0.0:1.0:0.0	.	1182	Q8N6G6	ATL1_HUMAN	I	1182	ENSP00000369921:V1182I	ENSP00000369921:V1182I	V	+	1	0	ADAMTSL1	18767771	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.199000	0.51043	2.812000	0.96745	0.557000	0.71058	GTC	.		0.682	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
ALB	213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74274521	74274524	+	Splice_Site	DEL	AAGT	AAGT	-	rs17853494		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr4:74274521_74274524delAAGT	ENST00000295897.4	+	4	570_571	c.481_482delAAGT	c.(481-483)aag>g	p.K161fs	ALB_ENST00000509063.1_Splice_Site_p.K161fs|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_Intron|ALB_ENST00000415165.2_Intron|ALB_ENST00000503124.1_Intron	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATTTTTGAAAAAGTAAGTAATCAG	0.348																																					p.161_161del		.											.	ALB	96	0			c.481_482del						.																																			SO:0001630	splice_region_variant	213	exon4			TTGAAAAAGTAAG	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.482+1AAGT>-	4.37:g.74274525_74274528delAAGT		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	13.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000295897.4	37	CCDS3555.1																																																																																			.		0.348	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	Frame_Shift_Del
ADH1B	125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100235183	100235183	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr4:100235183G>A	ENST00000305046.8	-	6	690	c.623C>T	c.(622-624)gCt>gTt	p.A208V	ADH1B_ENST00000394887.3_Missense_Mutation_p.A168V			P00325	ADH1B_HUMAN	alcohol dehydrogenase 1B (class I), beta polypeptide	208					ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	33				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	GCCCATAACAGCAGATAGGCC	0.483																																					p.A208V		.											.	ADH1B	136	0			c.C623T						.						230.0	231.0	230.0					4																	100235183		2203	4300	6503	SO:0001583	missense	125	exon6			ATAACAGCAGATA	AF153821	CCDS34033.1, CCDS68761.1	4q23	2008-02-05	2007-11-06		ENSG00000196616	ENSG00000196616	1.1.1.1	"""Alcohol dehydrogenases"""	250	protein-coding gene	gene with protein product		103720		ADH2		3006456	Standard	NM_000668		Approved		uc003hus.4	P00325	OTTHUMG00000161413	ENST00000305046.8:c.623C>T	4.37:g.100235183G>A	ENSP00000306606:p.Ala208Val	Somatic	331.0	0.0		WXS	Illumina HiSeq	Phase_I	217.0	49.0	NM_000668	A8MYN5|B4DRS9|B4DVC3|Q13711|Q4ZGI9|Q96KI7	Missense_Mutation	SNP	ENST00000305046.8	37	CCDS34033.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.109666	0.00353	.	.	ENSG00000196616	ENST00000305046;ENST00000394887;ENST00000412614	T;T	0.07688	3.17;3.17	3.81	0.982	0.19762	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.267496	0.36519	N	0.002557	T	0.02848	0.0085	N	0.05124	-0.11	0.29370	N	0.864081	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.003	T	0.46775	-0.9167	10	0.02654	T	1	-5.9832	7.8235	0.29300	0.8179:0.0:0.1821:0.0	.	195;168;208	F5HB16;A8MYN5;P00325	.;.;ADH1B_HUMAN	V	208;168;195	ENSP00000306606:A208V;ENSP00000378351:A168V	ENSP00000306606:A208V	A	-	2	0	ADH1B	100454206	0.955000	0.32602	0.105000	0.21289	0.048000	0.14542	2.017000	0.40981	-0.035000	0.13691	-0.459000	0.05422	GCT	.		0.483	ADH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364853.1	NM_000668	
APBA1	320	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	72131731	72131731	+	Silent	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr9:72131731C>T	ENST00000265381.4	-	2	618	c.396G>A	c.(394-396)caG>caA	p.Q132Q		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	132					axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						CGGCCTCTGCCTGCTCCGTGT	0.706																																					p.Q132Q		.											.	APBA1	91	0			c.G396A						.						36.0	32.0	33.0					9																	72131731		2201	4296	6497	SO:0001819	synonymous_variant	320	exon2			CTCTGCCTGCTCC	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.396G>A	9.37:g.72131731C>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	12.0	NM_001163	O14914|O60570|Q5VYR8	Silent	SNP	ENST00000265381.4	37	CCDS6630.1																																																																																			.		0.706	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
ARHGEF17	9828	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	73020363	73020363	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr11:73020363C>A	ENST00000263674.3	+	1	1030	c.680C>A	c.(679-681)gCc>gAc	p.A227D	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	227					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CAGGCCGGGGCCCGGGCCTCC	0.687																																					p.A227D		.											.	ARHGEF17	227	0			c.C680A						.						19.0	23.0	22.0					11																	73020363		2060	3983	6043	SO:0001583	missense	9828	exon1			CCGGGGCCCGGGC	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.680C>A	11.37:g.73020363C>A	ENSP00000263674:p.Ala227Asp	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	55.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512317	0.64522	.	.	ENSG00000110237	ENST00000263674	T	0.61040	0.14	4.39	3.46	0.39613	.	0.213571	0.23780	N	0.044626	T	0.37705	0.1013	N	0.24115	0.695	0.30306	N	0.788983	B	0.33694	0.421	B	0.29267	0.1	T	0.45527	-0.9255	10	0.62326	D	0.03	-8.0287	7.2727	0.26266	0.0:0.8809:0.0:0.1191	.	227	Q96PE2	ARHGH_HUMAN	D	227	ENSP00000263674:A227D	ENSP00000263674:A227D	A	+	2	0	ARHGEF17	72698011	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	1.404000	0.34623	2.010000	0.58986	0.462000	0.41574	GCC	.		0.687	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
PTCD1	26024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99022509	99022509	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr7:99022509C>T	ENST00000292478.4	-	6	1896	c.1646G>A	c.(1645-1647)aGg>aAg	p.R549K	PTCD1_ENST00000555673.1_Missense_Mutation_p.R598K|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.R598K	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	549					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GACGAGGCCCCTCTTTGCCAG	0.592																																					p.R598K		.											.	.	.	0			c.G1793A						.						75.0	71.0	72.0					7																	99022509		2203	4300	6503	SO:0001583	missense	100526740	exon7			AGGCCCCTCTTTG	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1646G>A	7.37:g.99022509C>T	ENSP00000292478:p.Arg549Lys	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	28.0	NM_001198879	Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	37	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	C	8.495	0.862955	0.17178	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000438524;ENST00000555673;ENST00000413834	T;T;T	0.64438	-0.1;-0.08;-0.08	5.91	4.1	0.47936	.	0.134995	0.64402	N	0.000004	T	0.42810	0.1219	L	0.35542	1.07	0.34009	D	0.651271	B;B	0.31193	0.312;0.028	B;B	0.25884	0.064;0.015	T	0.47289	-0.9129	10	0.09843	T	0.71	-26.2877	8.3548	0.32324	0.0:0.7031:0.0:0.2969	.	598;549	G3V325;O75127	.;PTCD1_HUMAN	K	549;331;598;598	ENSP00000292478:R549K;ENSP00000450995:R598K;ENSP00000400168:R598K	ENSP00000400168:R598K	R	-	2	0	ATP5J2-PTCD1;PTCD1	98860445	0.960000	0.32886	0.971000	0.41717	0.050000	0.14768	1.496000	0.35638	0.829000	0.34733	-0.379000	0.06801	AGG	.		0.592	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
ATRX	546	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	X	76938217	76938217	+	Missense_Mutation	SNP	G	G	A	rs139131007	byFrequency	TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chrX:76938217G>A	ENST00000373344.5	-	9	2745	c.2531C>T	c.(2530-2532)aCa>aTa	p.T844I	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.T806I	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	844					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAAATCTTTTGTATTTGGAAT	0.348			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.T844I		.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	248	1	Unknown(1)	bone(1)	c.C2531T						.						179.0	195.0	190.0					X																	76938217		2203	4294	6497	SO:0001583	missense	546	exon9			TCTTTTGTATTTG	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2531C>T	X.37:g.76938217G>A	ENSP00000362441:p.Thr844Ile	Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	5.0	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.350013	0.00219	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	D;D	0.92099	-2.96;-2.97	5.73	2.03	0.26663	.	0.119448	0.56097	D	0.000027	T	0.79528	0.4461	N	0.08118	0	0.22401	N	0.999134	B;B;B;B	0.31040	0.052;0.305;0.053;0.052	B;B;B;B	0.28232	0.028;0.087;0.039;0.028	T	0.70461	-0.4865	10	0.59425	D	0.04	-8.419	4.9467	0.13993	0.0:0.2218:0.2756:0.5025	.	844;776;806;844	A4LAA3;P46100-6;P46100-4;P46100	.;.;.;ATRX_HUMAN	I	844;806;771	ENSP00000362441:T844I;ENSP00000378967:T806I	ENSP00000362441:T844I	T	-	2	0	ATRX	76824873	0.859000	0.29813	0.216000	0.23742	0.031000	0.12232	0.246000	0.18160	0.003000	0.14656	-0.625000	0.03995	ACA	G|0.999;T|0.001		0.348	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
ATXN2L	11273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28846465	28846465	+	Silent	SNP	T	T	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr16:28846465T>A	ENST00000336783.4	+	19	2687	c.2520T>A	c.(2518-2520)ccT>ccA	p.P840P	ATXN2L_ENST00000340394.8_Silent_p.P840P|ATXN2L_ENST00000395547.2_Silent_p.P840P|ATXN2L_ENST00000564304.1_Silent_p.P846P|ATXN2L_ENST00000382686.4_Silent_p.P840P|ATXN2L_ENST00000570200.1_Silent_p.P840P|ATXN2L_ENST00000565845.1_3'UTR|ATXN2L_ENST00000325215.6_Silent_p.P840P|RP11-24N18.1_ENST00000563565.1_RNA	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	840					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CCTCTACCCCTCAGTACCCTT	0.642																																					p.P840P		.											.	ATXN2L	92	0			c.T2520A						.						154.0	130.0	138.0					16																	28846465		2197	4300	6497	SO:0001819	synonymous_variant	11273	exon19			TACCCCTCAGTAC		CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.2520T>A	16.37:g.28846465T>A		Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	38.0	NM_148414	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Silent	SNP	ENST00000336783.4	37	CCDS10641.1																																																																																			.		0.642	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1	NM_007245	
BCO2	83875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	112070431	112070431	+	Missense_Mutation	SNP	A	A	G	rs146824071	byFrequency	TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr11:112070431A>G	ENST00000357685.5	+	6	881	c.746A>G	c.(745-747)tAt>tGt	p.Y249C	BCO2_ENST00000438022.1_Missense_Mutation_p.Y215C|BCO2_ENST00000532593.1_Missense_Mutation_p.Y144C|BCO2_ENST00000531169.1_Missense_Mutation_p.Y215C|BCO2_ENST00000361053.4_Missense_Mutation_p.Y176C|BCO2_ENST00000526088.1_Missense_Mutation_p.Y215C|AP002884.3_ENST00000532612.1_Missense_Mutation_p.Y147C|BCO2_ENST00000393032.2_Missense_Mutation_p.Y215C			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	249					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						GGTTTCTCCTATAAGGTTATT	0.403													A|||	2	0.000399361	0.0	0.0	5008	,	,		19392	0.0		0.001	False		,,,				2504	0.001				p.Y249C	GBM(177;1916 2099 21049 29541 39946)	.											.	BCO2	68	0			c.A746G						.	A	CYS/TYR,CYS/TYR	3,4399	6.2+/-15.9	0,3,2198	128.0	132.0	131.0		644,746	4.3	1.0	11	dbSNP_134	131	38,8556	25.7+/-73.6	0,38,4259	yes	missense,missense	BCO2	NM_001037290.1,NM_031938.4	194,194	0,41,6457	GG,GA,AA		0.4422,0.0682,0.3155	probably-damaging,probably-damaging	215/546,249/580	112070431	41,12955	2201	4297	6498	SO:0001583	missense	83875	exon6			TCTCCTATAAGGT	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.746A>G	11.37:g.112070431A>G	ENSP00000350314:p.Tyr249Cys	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	26.0	NM_031938	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	ENST00000357685.5	37	CCDS8358.2	.	.	.	.	.	.	.	.	.	.	A	16.43	3.120175	0.56613	6.82E-4	0.004422	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	D;D;D;D;D;D;D	0.95412	-3.7;-3.7;-3.7;-3.7;-3.7;-3.7;-3.7	5.42	4.27	0.50696	.	0.000000	0.85682	D	0.000000	D	0.98112	0.9377	M	0.94021	3.485	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.98476	1.0603	10	0.87932	D	0	-9.5118	12.7544	0.57325	0.8628:0.1372:0.0:0.0	.	226;176;249;76	C9JEZ9;E9PBI8;Q9BYV7;Q8NAZ7	.;.;BCDO2_HUMAN;.	C	249;215;176;215;215;144;215	ENSP00000350314:Y249C;ENSP00000376752:Y215C;ENSP00000354338:Y176C;ENSP00000414843:Y215C;ENSP00000436615:Y215C;ENSP00000431802:Y144C;ENSP00000437053:Y215C	ENSP00000350314:Y249C	Y	+	2	0	BCO2	111575641	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	8.084000	0.89516	0.977000	0.38444	0.533000	0.62120	TAT	A|0.998;G|0.002		0.403	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256570.3	NM_001037290	
BEND5	79656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	49208383	49208383	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr1:49208383C>T	ENST00000371833.3	-	4	892	c.806G>A	c.(805-807)cGg>cAg	p.R269Q	AGBL4_ENST00000371838.1_Intron|BEND5_ENST00000476096.1_Intron|AGBL4_ENST00000371839.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	269						Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						GAAAGTGCTCCGTAACTCCGG	0.473																																					p.R269Q		.											.	BEND5	91	0			c.G806A						.						113.0	105.0	108.0					1																	49208383		2203	4300	6503	SO:0001583	missense	79656	exon4			GTGCTCCGTAACT	BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.806G>A	1.37:g.49208383C>T	ENSP00000360899:p.Arg269Gln	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	11.0	NM_024603	D3DQ27|Q96A62|Q9HAI3	Missense_Mutation	SNP	ENST00000371833.3	37	CCDS552.2	.	.	.	.	.	.	.	.	.	.	C	11.83	1.754417	0.31046	.	.	ENSG00000162373	ENST00000371833	.	.	.	5.45	3.52	0.40303	.	0.119122	0.56097	N	0.000023	T	0.21761	0.0524	N	0.04880	-0.145	0.35690	D	0.814756	B	0.06786	0.001	B	0.01281	0.0	T	0.15838	-1.0423	8	.	.	.	-15.8643	7.2545	0.26168	0.0:0.6867:0.0:0.3133	.	269	Q7L4P6	BEND5_HUMAN	Q	269	.	.	R	-	2	0	BEND5	48980970	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.122000	0.50446	1.510000	0.48803	0.591000	0.81541	CGG	.		0.473	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022323.1	NM_024603	
BHLHE40	8553	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	5025203	5025203	+	Silent	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr3:5025203C>T	ENST00000256495.3	+	5	1668	c.1065C>T	c.(1063-1065)ctC>ctT	p.L355L		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	355					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						ACCCAGGCCTCAACGCCTCTG	0.597																																					p.L355L		.											.	BHLHE40	91	0			c.C1065T						.						157.0	139.0	145.0					3																	5025203		2203	4300	6503	SO:0001819	synonymous_variant	8553	exon5			AGGCCTCAACGCC	AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.1065C>T	3.37:g.5025203C>T		Somatic	158.0	1.0		WXS	Illumina HiSeq	Phase_I	104.0	40.0	NM_003670	Q96TD3	Silent	SNP	ENST00000256495.3	37	CCDS2565.1																																																																																			.		0.597	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670	
BST1	683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	15709230	15709230	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr4:15709230G>A	ENST00000265016.4	+	3	607	c.412G>A	c.(412-414)Gca>Aca	p.A138T	BST1_ENST00000382346.3_Missense_Mutation_p.A153T	NM_004334.2	NP_004325.2	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1	138					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|transferase activity (GO:0016740)			central_nervous_system(1)|large_intestine(1)|lung(2)|stomach(3)|urinary_tract(1)	8						TGGCAGGGTTGCAGATTTCTT	0.448																																					p.A138T		.											.	BST1	90	0			c.G412A						.						137.0	132.0	133.0					4																	15709230		2203	4300	6503	SO:0001583	missense	683	exon3			AGGGTTGCAGATT	D21878	CCDS3416.1	4p15	2010-05-04			ENSG00000109743	ENSG00000109743	3.2.2.5	"""CD molecules"""	1118	protein-coding gene	gene with protein product	"""NAD(+) nucleosidase"", ""ADP-ribosyl cyclase 2"""	600387				8202488	Standard	NM_004334		Approved	CD157	uc003goh.4	Q10588	OTTHUMG00000097739	ENST00000265016.4:c.412G>A	4.37:g.15709230G>A	ENSP00000265016:p.Ala138Thr	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	44.0	NM_004334	B2R6A2|Q1XII0|Q5U0K0|Q96EN3	Missense_Mutation	SNP	ENST00000265016.4	37	CCDS3416.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.060012	0.36373	.	.	ENSG00000109743	ENST00000265016;ENST00000382346	T;T	0.15952	2.38;2.38	5.44	4.6	0.57074	.	0.395559	0.26328	N	0.025019	T	0.17874	0.0429	L	0.55213	1.73	0.09310	N	1	P	0.47253	0.892	B	0.41412	0.356	T	0.10706	-1.0618	10	0.44086	T	0.13	-7.5596	10.3528	0.43945	0.0915:0.0:0.9085:0.0	.	138	Q10588	BST1_HUMAN	T	138;153	ENSP00000265016:A138T;ENSP00000371783:A153T	ENSP00000265016:A138T	A	+	1	0	BST1	15318328	0.246000	0.23909	0.004000	0.12327	0.552000	0.35366	3.957000	0.56730	1.287000	0.44583	0.591000	0.81541	GCA	.		0.448	BST1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214968.2	NM_004334	
CDC45	8318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	19481906	19481906	+	Splice_Site	SNP	G	G	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr22:19481906G>T	ENST00000407835.1	+	7	798		c.e7+1		CDC45_ENST00000437685.2_Splice_Site|CDC45_ENST00000263201.1_Splice_Site|CDC45_ENST00000404724.3_Splice_Site|CDC45_ENST00000483431.1_Splice_Site			O75419	CDC45_HUMAN	cell division cycle 45						DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						AGGCCCGGAGGTGAGTCTGTG	0.562																																					.		.											.	CDC45	227	0			c.404+1G>T						.						67.0	68.0	67.0					22																	19481906		2203	4300	6503	SO:0001630	splice_region_variant	8318	exon5			CCGGAGGTGAGTC	AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.542+1G>T	22.37:g.19481906G>T		Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	46.0	NM_001178011	B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Splice_Site	SNP	ENST00000407835.1	37	CCDS13762.1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.884035	0.33255	.	.	ENSG00000093009	ENST00000407835;ENST00000437685;ENST00000263201;ENST00000404724	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9561	0.64150	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDC45	17861906	1.000000	0.71417	1.000000	0.80357	0.221000	0.24807	5.264000	0.65513	2.295000	0.77249	0.563000	0.77884	.	.		0.562	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317903.1	NM_003504	Intron
CDH1	999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	68842624	68842624	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr16:68842624A>G	ENST00000261769.5	+	5	751	c.560A>G	c.(559-561)aAg>aGg	p.K187R	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Missense_Mutation_p.K187R	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	187	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AAAGAAGGCAAGGTTTTCTAC	0.428			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.K187R		.	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	.	CDH1	3377	2	Unknown(2)	breast(2)	c.A560G						.						58.0	57.0	57.0					16																	68842624		2198	4300	6498	SO:0001583	missense	999	exon5	Familial Cancer Database	HDGC	AAGGCAAGGTTTT	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.560A>G	16.37:g.68842624A>G	ENSP00000261769:p.Lys187Arg	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	23.0	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	ENST00000261769.5	37	CCDS10869.1	.	.	.	.	.	.	.	.	.	.	A	12.07	1.826294	0.32329	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	T;T	0.51071	0.72;0.72	5.78	3.5	0.40072	Cadherin (4);Cadherin-like (1);	0.669534	0.13536	N	0.380600	T	0.34308	0.0893	N	0.21545	0.675	0.32195	N	0.5786	B;B	0.21225	0.025;0.053	B;B	0.29663	0.022;0.105	T	0.40194	-0.9576	10	0.35671	T	0.21	.	8.4372	0.32795	0.7979:0.1329:0.0692:0.0	.	187;187	Q9UII8;P12830	.;CADH1_HUMAN	R	187	ENSP00000261769:K187R;ENSP00000414946:K187R	ENSP00000261769:K187R	K	+	2	0	CDH1	67400125	0.077000	0.21312	0.792000	0.32020	0.957000	0.61999	0.780000	0.26760	1.087000	0.41251	0.533000	0.62120	AAG	.		0.428	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
CDK3	1018	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	73998495	73998495	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr17:73998495A>G	ENST00000425876.2	+	4	570	c.482A>G	c.(481-483)cAt>cGt	p.H161R	TEN1-CDK3_ENST00000567351.1_RNA|CDK3_ENST00000448471.1_Missense_Mutation_p.H161R			Q00526	CDK3_HUMAN	cyclin-dependent kinase 3	161	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			central_nervous_system(1)	1						ACCTACACCCATGAGGTATTG	0.592																																					p.H161R		.											.	CDK3	521	0			c.A482G						.						44.0	37.0	39.0					17																	73998495		2203	4300	6503	SO:0001583	missense	1018	exon5			ACACCCATGAGGT	X66357	CCDS11736.1	17q25.1	2012-09-20			ENSG00000250506	ENSG00000250506		"""Cyclin-dependent kinases"""	1772	protein-coding gene	gene with protein product		123828				1639063	Standard	NM_001258		Approved		uc010dgt.3	Q00526	OTTHUMG00000154861	ENST00000425876.2:c.482A>G	17.37:g.73998495A>G	ENSP00000410561:p.His161Arg	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	21.0	NM_001258		Missense_Mutation	SNP	ENST00000425876.2	37	CCDS11736.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.362987	0.82353	.	.	ENSG00000250506	ENST00000448471;ENST00000425876	T;T	0.41758	0.99;0.99	4.51	4.51	0.55191	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000023	T	0.48132	0.1483	N	0.21282	0.65	0.58432	D	0.999998	D	0.67145	0.996	D	0.67548	0.952	T	0.53436	-0.8439	10	0.87932	D	0	-13.1552	13.162	0.59550	1.0:0.0:0.0:0.0	.	161	Q00526	CDK3_HUMAN	R	161	ENSP00000400088:H161R;ENSP00000410561:H161R	ENSP00000410561:H161R	H	+	2	0	CDK3	71510090	1.000000	0.71417	0.999000	0.59377	0.921000	0.55340	9.083000	0.94067	1.905000	0.55150	0.454000	0.30748	CAT	.		0.592	CDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337389.2	NM_001258	
CLDN16	10686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	190126207	190126207	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr3:190126207G>A	ENST00000264734.2	+	4	945	c.697G>A	c.(697-699)Ggt>Agt	p.G233S	CLDN16_ENST00000456423.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	233			G -> D (in HOMG3). {ECO:0000269|PubMed:10390358}.		calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		ATATAAATTTGGTTGGTCCTG	0.413																																					p.G233S		.											.	CLDN16	227	0			c.G697A	GRCh37	CM056565	CLDN16	M		.						213.0	204.0	207.0					3																	190126207		2203	4300	6503	SO:0001583	missense	10686	exon4			AAATTTGGTTGGT	AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.697G>A	3.37:g.190126207G>A	ENSP00000264734:p.Gly233Ser	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	38.0	NM_006580		Missense_Mutation	SNP	ENST00000264734.2	37	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010989	0.93346	.	.	ENSG00000113946	ENST00000264734	D	0.94232	-3.38	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.96833	0.8966	M	0.83953	2.67	0.80722	D	1	D	0.76494	0.999	D	0.68192	0.956	D	0.97198	0.9862	10	0.87932	D	0	-6.0599	18.5953	0.91227	0.0:0.0:1.0:0.0	.	233	Q9Y5I7	CLD16_HUMAN	S	233	ENSP00000264734:G233S	ENSP00000264734:G233S	G	+	1	0	CLDN16	191608901	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.124000	0.77185	2.624000	0.88883	0.557000	0.71058	GGT	.		0.413	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580	
CLTCL1	8218	hgsc.bcm.edu;broad.mit.edu	37	22	19211532	19211532	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr22:19211532delG	ENST00000263200.10	-	14	2246	c.2174delC	c.(2173-2175)ccafs	p.P725fs	CLTCL1_ENST00000427926.1_Frame_Shift_Del_p.P725fs|CLTCL1_ENST00000353891.5_Frame_Shift_Del_p.P725fs	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	725	Heavy chain arm.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					ATGCACATCTGGGTCTTGGCT	0.512			T	?	ALCL																																p.P725fs		.		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	CLTCL1	230	0			c.2174delC						.						91.0	95.0	94.0					22																	19211532		2036	4192	6228	SO:0001589	frameshift_variant	8218	exon14			ACATCTGGGTCTT		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.2174delC	22.37:g.19211532delG	ENSP00000445677:p.Pro725fs	Somatic	267.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	11.0	NM_001835	B7Z7U5|Q14017|Q15808|Q15809	Frame_Shift_Del	DEL	ENST00000263200.10	37	CCDS46662.1																																																																																			.		0.512	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
CNOT10	25904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	32757737	32757737	+	Silent	SNP	A	A	G			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr3:32757737A>G	ENST00000328834.5	+	6	910	c.594A>G	c.(592-594)aaA>aaG	p.K198K	CNOT10_ENST00000454516.2_Silent_p.K258K|CNOT10_ENST00000538368.1_5'UTR|CNOT10_ENST00000331889.6_Silent_p.K198K|CNOT10_ENST00000463697.1_3'UTR	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	198					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						ACAACAACAAAGATGGATCTA	0.318																																					p.K258K		.											.	CNOT10	91	0			c.A774G						.						98.0	99.0	98.0					3																	32757737		2203	4299	6502	SO:0001819	synonymous_variant	25904	exon6			CAACAAAGATGGA	BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.594A>G	3.37:g.32757737A>G		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	56.0	NM_001256742	B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Silent	SNP	ENST00000328834.5	37	CCDS2655.1																																																																																			.		0.318	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253248.2	NM_015442	
CTNNA2	1496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	80801440	80801440	+	Splice_Site	SNP	G	G	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr2:80801440G>T	ENST00000402739.4	+	12	1898		c.e12+1		CTNNA2_ENST00000540488.1_Splice_Site|CTNNA2_ENST00000343114.3_Splice_Site|CTNNA2_ENST00000466387.1_Splice_Site|CTNNA2_ENST00000541047.1_Splice_Site|AC008067.2_ENST00000609950.1_RNA|CTNNA2_ENST00000496558.1_Splice_Site|CTNNA2_ENST00000361291.4_Splice_Site|AC008067.2_ENST00000430876.1_RNA	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2						axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GATGATCAGGGTATGTGAGGC	0.438																																					.		.											.	CTNNA2	368	0			c.1893+1G>T						.						144.0	138.0	140.0					2																	80801440		2125	4264	6389	SO:0001630	splice_region_variant	1496	exon13			ATCAGGGTATGTG		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1893+1G>T	2.37:g.80801440G>T		Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	43.0	NM_004389	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Splice_Site	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	26.2	4.718590	0.89205	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1825	0.86858	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CTNNA2	80654951	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.799000	0.99117	2.510000	0.84645	0.491000	0.48974	.	.		0.438	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	Intron
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266137	41266137	+	Missense_Mutation	SNP	C	C	A	rs121913409		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr3:41266137C>A	ENST00000349496.5	+	3	414	c.134C>A	c.(133-135)tCt>tAt	p.S45Y	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45Y|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45Y|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45Y|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45del(53)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.S45fs*2(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACAGCTCCTTCTCTGAGTGGT	0.498	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45Y	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+1	CTNNB1	24361	601	Substitution - Missense(421)|Deletion - In frame(152)|Complex - deletion inframe(20)|Unknown(7)|Deletion - Frameshift(1)	soft_tissue(233)|liver(141)|large_intestine(85)|kidney(74)|endometrium(16)|skin(11)|adrenal_gland(9)|stomach(7)|biliary_tract(5)|ovary(4)|lung(3)|central_nervous_system(2)|cervix(2)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(1)|pituitary(1)|prostate(1)|bone(1)|pancreas(1)	c.C134A						.						84.0	74.0	77.0					3																	41266137		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCCTTCTCTGAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.134C>A	3.37:g.41266137C>A	ENSP00000344456:p.Ser45Tyr	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	57.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519229	0.85495	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	M	0.65677	2.01	0.80722	D	1	D	0.76494	0.999	D	0.67231	0.95	T	0.69320	-0.5176	10	0.87932	D	0	-13.6823	20.2983	0.98569	0.0:1.0:0.0:0.0	.	45	P35222	CTNB1_HUMAN	Y	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38Y;ENSP00000385604:S45Y;ENSP00000412219:S45Y;ENSP00000379486:S45Y;ENSP00000344456:S45Y;ENSP00000411226:S38Y;ENSP00000379488:S45Y;ENSP00000409302:S45Y;ENSP00000401599:S45Y	ENSP00000344456:S45Y	S	+	2	0	CTNNB1	41241141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.802000	0.96397	0.655000	0.94253	TCT	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTTN	2017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	70269063	70269063	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr11:70269063G>A	ENST00000301843.8	+	12	1125	c.919G>A	c.(919-921)Ggc>Agc	p.G307S	CTTN_ENST00000376561.3_Missense_Mutation_p.G270S|CTTN_ENST00000346329.3_Missense_Mutation_p.G270S|CTTN_ENST00000538675.1_5'UTR	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	307					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		CAAAGGATTCGGCGGGAAGTA	0.562																																					p.G307S		.											.	CTTN	227	0			c.G919A						.						174.0	147.0	157.0					11																	70269063		2200	4294	6494	SO:0001583	missense	2017	exon12			GGATTCGGCGGGA	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.919G>A	11.37:g.70269063G>A	ENSP00000301843:p.Gly307Ser	Somatic	413.0	0.0		WXS	Illumina HiSeq	Phase_I	350.0	137.0	NM_005231	Q8N707|Q96H99	Missense_Mutation	SNP	ENST00000301843.8	37	CCDS41680.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960680	0.92791	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561	T;T;T	0.54279	0.76;1.08;0.58	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.80534	0.4641	M	0.93283	3.4	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.97110	0.96;0.992;1.0	D	0.85586	0.1243	10	0.62326	D	0.03	-24.7659	18.7266	0.91716	0.0:0.0:1.0:0.0	.	270;307;270	Q96H99;Q14247;Q8N707	.;SRC8_HUMAN;.	S	270;307;270	ENSP00000317189:G270S;ENSP00000301843:G307S;ENSP00000365745:G270S	ENSP00000301843:G307S	G	+	1	0	CTTN	69946711	1.000000	0.71417	0.193000	0.23327	0.800000	0.45204	8.942000	0.92970	2.426000	0.82243	0.655000	0.94253	GGC	.		0.562	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259233.2	NM_138565	
CYP39A1	51302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46620284	46620284	+	Silent	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr6:46620284C>T	ENST00000275016.2	-	1	239	c.36G>A	c.(34-36)ctG>ctA	p.L12L	SLC25A27_ENST00000411689.2_5'Flank|SLC25A27_ENST00000452689.2_5'Flank|SLC25A27_ENST00000371347.5_5'Flank	NM_016593.3	NP_057677.2	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A, polypeptide 1	12					bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	24-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033782)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)|steroid 7-alpha-hydroxylase activity (GO:0008387)	p.L12L(1)	EIF3K/CYP39A1(2)	NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)	21						CAAGGCAACCCAGGATTATAA	0.468																																					p.L12L		.											.	CYP39A1	91	1	Substitution - coding silent(1)	kidney(1)	c.G36A						.						198.0	207.0	204.0					6																	46620284		2203	4300	6503	SO:0001819	synonymous_variant	51302	exon1			GCAACCCAGGATT	AF237982	CCDS4916.1, CCDS75465.1	6p21.1-p11.2	2008-02-05	2003-01-14		ENSG00000146233	ENSG00000146233		"""Cytochrome P450s"""	17449	protein-coding gene	gene with protein product		605994	"""cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1"""			10748047	Standard	NM_016593		Approved		uc003oyf.1	Q9NYL5	OTTHUMG00000014785	ENST00000275016.2:c.36G>A	6.37:g.46620284C>T		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	36.0	NM_016593	Q5VTT0|Q96FW5	Silent	SNP	ENST00000275016.2	37	CCDS4916.1																																																																																			.		0.468	CYP39A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040787.1		
DFNA5	1687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	24758744	24758744	+	Silent	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr7:24758744C>T	ENST00000342947.3	-	4	923	c.498G>A	c.(496-498)caG>caA	p.Q166Q	DFNA5_ENST00000409775.3_Silent_p.Q166Q|DFNA5_ENST00000419307.1_Silent_p.Q2Q|DFNA5_ENST00000409970.1_Silent_p.Q2Q|DFNA5_ENST00000559637.1_5'UTR|DFNA5_ENST00000545231.1_Silent_p.Q2Q	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	166					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TCACACACTTCTGCATCGTCG	0.537																																					p.Q166Q	GBM(78;184 1250 20134 20900 23600)	.											.	DFNA5	91	0			c.G498A						.						234.0	185.0	202.0					7																	24758744		2203	4300	6503	SO:0001819	synonymous_variant	1687	exon4			ACACTTCTGCATC	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.498G>A	7.37:g.24758744C>T		Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	26.0	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Silent	SNP	ENST00000342947.3	37	CCDS5389.1																																																																																			.		0.537	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
DHX16	8449	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30627293	30627293	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr6:30627293T>C	ENST00000376442.3	-	12	2158	c.1963A>G	c.(1963-1965)Atg>Gtg	p.M655V	DHX16_ENST00000376437.5_Missense_Mutation_p.M174V|DHX16_ENST00000480966.1_5'UTR	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	655	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						CGGGCCTGCATGTCAGAGGGC	0.582																																					p.M655V		.											.	DHX16	228	0			c.A1963G						.						47.0	44.0	45.0					6																	30627293		1511	2708	4219	SO:0001583	missense	8449	exon12			CCTGCATGTCAGA	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.1963A>G	6.37:g.30627293T>C	ENSP00000365625:p.Met655Val	Somatic	130.0	2.0		WXS	Illumina HiSeq	Phase_I	182.0	44.0	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	37	CCDS4685.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.423058	0.62733	.	.	ENSG00000204560	ENST00000376442;ENST00000376437	T;T	0.74737	-0.87;-0.87	5.0	5.0	0.66597	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.61438	0.2347	L	0.28014	0.82	0.80722	D	1	P;P;B	0.42735	0.788;0.498;0.202	P;B;B	0.48425	0.577;0.326;0.171	T	0.68078	-0.5504	10	0.52906	T	0.07	.	13.8253	0.63346	0.0:0.0:0.0:1.0	.	595;655;174	B4DZ28;O60231;Q5SQH5	.;DHX16_HUMAN;.	V	655;174	ENSP00000365625:M655V;ENSP00000365620:M174V	ENSP00000365620:M174V	M	-	1	0	DHX16	30735272	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.752000	0.47516	2.111000	0.64477	0.374000	0.22700	ATG	.		0.582	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
DISP1	84976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	223177045	223177045	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr1:223177045A>G	ENST00000284476.6	+	8	2470	c.2306A>G	c.(2305-2307)aAa>aGa	p.K769R		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	769					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		GCTGAATACAAAAAGCTTTTC	0.478																																					p.K769R		.											.	DISP1	68	0			c.A2306G						.						65.0	63.0	64.0					1																	223177045		2203	4300	6503	SO:0001583	missense	84976	exon10			AATACAAAAAGCT	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2306A>G	1.37:g.223177045A>G	ENSP00000284476:p.Lys769Arg	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	198.0	114.0	NM_032890	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	37	CCDS1536.1	.	.	.	.	.	.	.	.	.	.	A	8.000	0.755284	0.15846	.	.	ENSG00000154309	ENST00000284476	D	0.92199	-2.99	5.61	4.46	0.54185	.	0.041993	0.85682	N	0.000000	T	0.82181	0.4981	N	0.13098	0.295	0.49915	D	0.999836	B	0.20052	0.041	B	0.25405	0.06	T	0.72087	-0.4396	10	0.14252	T	0.57	-21.409	7.3385	0.26623	0.8006:0.0:0.0697:0.1298	.	769	Q96F81	DISP1_HUMAN	R	769	ENSP00000284476:K769R	ENSP00000284476:K769R	K	+	2	0	DISP1	221243668	1.000000	0.71417	0.976000	0.42696	0.997000	0.91878	6.343000	0.72986	1.028000	0.39785	0.533000	0.62120	AAA	.		0.478	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890	
DPP10	57628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	116534805	116534805	+	Missense_Mutation	SNP	G	G	A	rs150929011		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr2:116534805G>A	ENST00000410059.1	+	14	1723	c.1243G>A	c.(1243-1245)Gtg>Atg	p.V415M	DPP10_ENST00000393147.2_Missense_Mutation_p.V419M|DPP10_ENST00000310323.8_Missense_Mutation_p.V408M|DPP10_ENST00000409163.1_Missense_Mutation_p.V365M	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	415						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.V408M(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GCAAATTACCGTGCGGCATCT	0.378																																					p.V419M		.											DPP10,NS,carcinoma,0	DPP10	142	1	Substitution - Missense(1)	ovary(1)	c.G1255A						.	G	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	3,4403	6.2+/-15.9	0,3,2200	108.0	105.0	106.0		1222,1255,1093,1231,1243	4.1	0.9	2	dbSNP_134	106	0,8598		0,0,4299	no	missense,missense,missense,missense,missense	DPP10	NM_001004360.3,NM_001178034.1,NM_001178036.1,NM_001178037.1,NM_020868.3	21,21,21,21,21	0,3,6499	AA,AG,GG		0.0,0.0681,0.0231	benign,benign,benign,benign,benign	408/790,419/801,365/747,411/793,415/797	116534805	3,13001	2203	4299	6502	SO:0001583	missense	57628	exon14			ATTACCGTGCGGC	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1243G>A	2.37:g.116534805G>A	ENSP00000386565:p.Val415Met	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	10.0	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493314	0.44352	6.81E-4	0.0	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	4.97	4.1	0.47936	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.202355	0.42548	N	0.000696	T	0.20536	0.0494	L	0.29908	0.895	0.44946	D	0.997961	B;P;B;P	0.38677	0.385;0.524;0.439;0.642	B;B;B;B	0.36378	0.063;0.086;0.104;0.223	T	0.04115	-1.0976	10	0.62326	D	0.03	-14.5709	7.6174	0.28167	0.1874:0.0:0.8126:0.0	.	408;419;411;415	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	M	415;365;419;408;365	ENSP00000386565:V415M;ENSP00000387038:V365M;ENSP00000376855:V419M;ENSP00000309066:V408M	ENSP00000309066:V408M	V	+	1	0	DPP10	116251275	1.000000	0.71417	0.893000	0.35052	0.992000	0.81027	3.538000	0.53597	1.452000	0.47756	0.655000	0.94253	GTG	G|1.000;A|0.000		0.378	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	41416175	41416175	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr21:41416175G>T	ENST00000400454.1	-	31	5690	c.5213C>A	c.(5212-5214)gCt>gAt	p.A1738D		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1738					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGTGGGCCCAGCCTTGGCATT	0.592																																					p.A1738D	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.C5213A						.						75.0	82.0	80.0					21																	41416175		2132	4238	6370	SO:0001583	missense	1826	exon31			GGCCCAGCCTTGG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5213C>A	21.37:g.41416175G>T	ENSP00000383303:p.Ala1738Asp	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	45.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	g	16.72	3.200941	0.58234	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.60672	0.17;0.27	5.53	4.6	0.57074	.	0.109142	0.64402	D	0.000006	T	0.47248	0.1435	L	0.27053	0.805	0.39184	D	0.962836	P	0.38250	0.624	B	0.37267	0.245	T	0.52953	-0.8506	10	0.40728	T	0.16	.	18.011	0.89224	0.0:0.1306:0.8694:0.0	.	1738	O60469	DSCAM_HUMAN	D	1738;1490	ENSP00000383303:A1738D;ENSP00000385342:A1490D	ENSP00000383303:A1738D	A	-	2	0	DSCAM	40338045	1.000000	0.71417	0.936000	0.37596	0.718000	0.41266	7.806000	0.86020	2.605000	0.88082	0.655000	0.94253	GCT	.		0.592	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
DUS3L	56931	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5789643	5789643	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr19:5789643C>A	ENST00000309061.7	-	3	571	c.475G>T	c.(475-477)Ggc>Tgc	p.G159C	DUS3L_ENST00000320699.8_Intron|DUS3L_ENST00000590681.1_5'UTR	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	159							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						CAGCGGGGGCCCAGGTCGGCC	0.672																																					p.G159C		.											.	DUS3L	90	0			c.G475T						.						10.0	16.0	14.0					19																	5789643		2127	4242	6369	SO:0001583	missense	56931	exon3			GGGGGCCCAGGTC		CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.475G>T	19.37:g.5789643C>A	ENSP00000311977:p.Gly159Cys	Somatic	110.0	1.0		WXS	Illumina HiSeq	Phase_I	111.0	60.0	NM_020175	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	ENST00000309061.7	37	CCDS32880.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260195	0.59321	.	.	ENSG00000141994	ENST00000309061	T	0.20881	2.04	4.72	4.72	0.59763	.	0.061205	0.64402	D	0.000004	T	0.44540	0.1298	M	0.81614	2.55	0.53688	D	0.999973	D	0.69078	0.997	D	0.64687	0.928	T	0.47736	-0.9094	10	0.87932	D	0	-25.4976	11.1313	0.48349	0.0:0.8124:0.1876:0.0	.	159	Q96G46	DUS3L_HUMAN	C	159	ENSP00000311977:G159C	ENSP00000311977:G159C	G	-	1	0	DUS3L	5740643	1.000000	0.71417	1.000000	0.80357	0.322000	0.28314	5.508000	0.67006	2.169000	0.68431	0.491000	0.48974	GGC	.		0.672	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451870.2	NM_020175	
ECEL1	9427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	233345176	233345176	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr2:233345176T>C	ENST00000304546.1	-	17	2371	c.2161A>G	c.(2161-2163)Atc>Gtc	p.I721V	ECEL1_ENST00000409941.1_Missense_Mutation_p.I719V	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	721					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CGCCGCTTGATGCACCAGTTC	0.657																																					p.I721V		.											.	ECEL1	90	0			c.A2161G						.						43.0	47.0	46.0					2																	233345176		2203	4300	6503	SO:0001583	missense	9427	exon17			GCTTGATGCACCA	Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.2161A>G	2.37:g.233345176T>C	ENSP00000302051:p.Ile721Val	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	47.0	NM_004826	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	ENST00000304546.1	37	CCDS2493.1	.	.	.	.	.	.	.	.	.	.	T	14.90	2.672103	0.47781	.	.	ENSG00000171551	ENST00000411860;ENST00000304546;ENST00000409941	D;D;D	0.81739	-1.53;-1.53;-1.53	5.4	5.4	0.78164	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.157721	0.53938	D	0.000042	T	0.68054	0.2959	N	0.05608	-0.01	0.53688	D	0.999978	B;B	0.25351	0.011;0.124	B;B	0.30943	0.007;0.122	T	0.68032	-0.5516	10	0.56958	D	0.05	-0.7302	15.4627	0.75373	0.0:0.0:0.0:1.0	.	719;721	O95672-2;O95672	.;ECEL1_HUMAN	V	114;721;719	ENSP00000412683:I114V;ENSP00000302051:I721V;ENSP00000386333:I719V	ENSP00000302051:I721V	I	-	1	0	ECEL1	233053420	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.946000	0.87746	2.067000	0.61834	0.370000	0.22315	ATC	.		0.657	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826	
ELAC1	55520	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	48510804	48510804	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr18:48510804C>A	ENST00000269466.3	+	3	603	c.496C>A	c.(496-498)Ctt>Att	p.L166I	RP11-729L2.2_ENST00000588256.1_Intron|ELAC1_ENST00000591429.1_Missense_Mutation_p.L166I|ELAC1_ENST00000588577.1_Intron|RP11-729L2.2_ENST00000590722.2_Intron|SMAD4_ENST00000452201.2_Intron	NM_018696.2	NP_061166.1	Q9H777	RNZ1_HUMAN	elaC ribonuclease Z 1	166					tRNA 3'-trailer cleavage (GO:0042779)	cytosol (GO:0005829)|nucleus (GO:0005634)	endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(4)|prostate(1)	6		Colorectal(6;0.0269)|all_epithelial(6;0.0729)		Colorectal(21;0.000943)|COAD - Colon adenocarcinoma(17;0.0398)|READ - Rectum adenocarcinoma(32;0.0894)|STAD - Stomach adenocarcinoma(97;0.18)		AAACTCATACCTTCTGTTTGA	0.398																																					p.L166I		.											.	ELAC1	90	0			c.C496A						.						72.0	70.0	71.0					18																	48510804		2203	4300	6503	SO:0001583	missense	55520	exon3			TCATACCTTCTGT	AB029151	CCDS11949.1	18q21	2013-05-24	2013-05-24		ENSG00000141642	ENSG00000141642	3.1.26.11		14197	protein-coding gene	gene with protein product	"""tRNA Z (short form)"", ""RNaseZ(S)"""	608079	"""elaC (E. coli) homolog 1"", ""elaC homolog 1 (E. coli)"""			12711671, 21559454	Standard	NM_018696		Approved	D29	uc002lez.3	Q9H777	OTTHUMG00000132695	ENST00000269466.3:c.496C>A	18.37:g.48510804C>A	ENSP00000269466:p.Leu166Ile	Somatic	152.0	1.0		WXS	Illumina HiSeq	Phase_I	95.0	48.0	NM_018696	Q9NS99	Missense_Mutation	SNP	ENST00000269466.3	37	CCDS11949.1	.	.	.	.	.	.	.	.	.	.	C	9.463	1.093701	0.20471	.	.	ENSG00000141642	ENST00000269466	T	0.41758	0.99	5.95	4.05	0.47172	Beta-lactamase-like (1);	0.409334	0.27851	N	0.017582	T	0.26666	0.0652	N	0.21194	0.64	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.20384	0.029;0.029	T	0.05666	-1.0871	10	0.12103	T	0.63	.	10.8918	0.47000	0.0:0.7091:0.2094:0.0815	.	166;166	Q53EY2;Q9H777	.;RNZ1_HUMAN	I	166	ENSP00000269466:L166I	ENSP00000269466:L166I	L	+	1	0	ELAC1	46764802	0.019000	0.18553	0.999000	0.59377	0.675000	0.39556	0.295000	0.19065	1.504000	0.48704	0.650000	0.86243	CTT	.		0.398	ELAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255992.2		
FAT4	79633	hgsc.bcm.edu;broad.mit.edu	37	4	126372517	126372517	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr4:126372517A>T	ENST00000394329.3	+	9	10359	c.10346A>T	c.(10345-10347)gAa>gTa	p.E3449V	FAT4_ENST00000335110.5_Missense_Mutation_p.E1747V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3449	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCAGGGAATGAAAATGGTGCC	0.463																																					p.E3449V		.											.	FAT4	108	0			c.A10346T						.						101.0	103.0	102.0					4																	126372517		2203	4300	6503	SO:0001583	missense	79633	exon9			GGAATGAAAATGG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10346A>T	4.37:g.126372517A>T	ENSP00000377862:p.Glu3449Val	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	4.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	A	11.01	1.514615	0.27123	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.62498	0.02;0.02	4.76	4.76	0.60689	Cadherin (4);Cadherin-like (1);	0.211286	0.22657	U	0.057258	T	0.40222	0.1108	N	0.04275	-0.24	0.41292	D	0.986981	B;P;P	0.41265	0.253;0.714;0.744	B;B;B	0.38880	0.118;0.284;0.275	T	0.43637	-0.9379	10	0.30078	T	0.28	.	14.4679	0.67497	1.0:0.0:0.0:0.0	.	1747;3449;3449	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	V	3449;1747	ENSP00000377862:E3449V;ENSP00000335169:E1747V	ENSP00000335169:E1747V	E	+	2	0	FAT4	126591967	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.906000	0.63293	2.003000	0.58678	0.459000	0.35465	GAA	.		0.463	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	126400895	126400895	+	Splice_Site	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr4:126400895G>A	ENST00000394329.3	+	14	12486		c.e14-1		FAT4_ENST00000335110.5_Intron	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4						branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATTTATTTTAGATGCCCTAGG	0.408																																					.		.											.	FAT4	108	0			c.12474-1G>A						.						59.0	53.0	55.0					4																	126400895		1568	3582	5150	SO:0001630	splice_region_variant	79633	exon14			ATTTTAGATGCCC	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.12474-1G>A	4.37:g.126400895G>A		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	14.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Splice_Site	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518891	0.27211	.	.	ENSG00000196159	ENST00000394329	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0825	0.89445	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAT4	126620345	1.000000	0.71417	0.536000	0.28039	0.018000	0.09664	7.577000	0.82486	2.262000	0.75019	0.460000	0.39030	.	.		0.408	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	Intron
FBN3	84467	broad.mit.edu;bcgsc.ca	37	19	8138130	8138130	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr19:8138130C>T	ENST00000600128.1	-	62	8168	c.7754G>A	c.(7753-7755)cGc>cAc	p.R2585H	FBN3_ENST00000270509.2_Missense_Mutation_p.R2585H|FBN3_ENST00000601739.1_Missense_Mutation_p.R2585H			Q75N90	FBN3_HUMAN	fibrillin 3	2585	EGF-like 43; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AAGAGTGTTGCGACAGGAGGC	0.657																																					p.R2585H		.											.	FBN3	100	0			c.G7754A						.						34.0	38.0	37.0					19																	8138130		2203	4300	6503	SO:0001583	missense	84467	exon61			GTGTTGCGACAGG		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7754G>A	19.37:g.8138130C>T	ENSP00000470498:p.Arg2585His	Somatic	455.0	2.0		WXS	Illumina HiSeq	Phase_I	282.0	19.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	0.082	-1.181518	0.01633	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	T	0.21734	1.99	4.39	-1.72	0.08107	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.140230	0.49305	N	0.000142	T	0.06735	0.0172	N	0.04162	-0.26	0.24003	N	0.996205	B;B	0.13145	0.001;0.007	B;B	0.08055	0.001;0.003	T	0.34354	-0.9832	10	0.15066	T	0.55	.	6.5037	0.22184	0.1091:0.2709:0.0:0.62	.	2585;648	Q75N90;Q6ZNB8	FBN3_HUMAN;.	H	2585;648	ENSP00000270509:R2585H	ENSP00000270509:R2585H	R	-	2	0	FBN3	8044130	1.000000	0.71417	0.521000	0.27850	0.025000	0.11179	3.223000	0.51231	-0.920000	0.03799	-0.975000	0.02590	CGC	.		0.657	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
FER1L5	90342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	97360146	97360146	+	RNA	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr2:97360146G>A	ENST00000457909.1	+	0	2145							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						TGGAAGAATGGGGCATACACA	0.622																																					p.G1256E		.											.	FER1L5	23	0			c.G3767A						.						91.0	83.0	86.0					2																	97360146		692	1591	2283			90342	exon33			AGAATGGGGCATA	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97360146G>A		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	28.0	NM_001113382	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	37		.	.	.	.	.	.	.	.	.	.	G	10.52	1.372537	0.24857	.	.	ENSG00000214272	ENST00000414152;ENST00000436930	.	.	.	4.69	1.71	0.24356	.	.	.	.	.	T	0.62319	0.2418	L	0.61036	1.89	.	.	.	D	0.76494	0.999	D	0.65874	0.939	T	0.66060	-0.6017	7	0.44086	T	0.13	-7.1371	7.0607	0.25123	0.3273:0.0:0.6727:0.0	.	1256	A0AVI2	FR1L5_HUMAN	E	1256;1214	.	ENSP00000444148:G1256E	G	+	2	0	FER1L5	96723873	0.565000	0.26610	0.000000	0.03702	0.867000	0.49689	2.110000	0.41873	0.165000	0.19558	0.462000	0.41574	GGG	.		0.622	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
FGD3	89846	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	95738644	95738644	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr9:95738644C>T	ENST00000375482.3	+	3	602	c.106C>T	c.(106-108)Cct>Tct	p.P36S	FGD3_ENST00000337352.6_Missense_Mutation_p.P36S|FGD3_ENST00000468206.1_3'UTR|FGD3_ENST00000416701.2_Missense_Mutation_p.P36S	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	36					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						TCAGGCGCTCCCTGTTGGGCC	0.657																																					p.P36S		.											.	FGD3	228	0			c.C106T						.						19.0	22.0	21.0					9																	95738644		1882	4110	5992	SO:0001583	missense	89846	exon3			GCGCTCCCTGTTG	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.106C>T	9.37:g.95738644C>T	ENSP00000364631:p.Pro36Ser	Somatic	163.0	1.0		WXS	Illumina HiSeq	Phase_I	117.0	40.0	NM_001083536	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	ENST00000375482.3	37	CCDS43849.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.847007	0.32606	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352	T;T;T	0.71934	-0.61;-0.61;-0.61	4.48	2.39	0.29439	.	.	.	.	.	T	0.59046	0.2165	L	0.57536	1.79	0.09310	N	0.999994	B;P	0.35507	0.379;0.506	B;B	0.31686	0.134;0.063	T	0.42865	-0.9426	9	0.16896	T	0.51	.	6.8172	0.23837	0.1901:0.5992:0.2107:0.0	.	36;36	F8W7P2;Q5JSP0	.;FGD3_HUMAN	S	36	ENSP00000364631:P36S;ENSP00000413833:P36S;ENSP00000336914:P36S	ENSP00000336914:P36S	P	+	1	0	FGD3	94778465	0.185000	0.23213	0.028000	0.17463	0.026000	0.11368	1.188000	0.32102	0.992000	0.38840	0.655000	0.94253	CCT	.		0.657	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	NM_033086	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	39264849	39264849	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr13:39264849G>A	ENST00000280481.7	+	1	3584	c.3368G>A	c.(3367-3369)gGc>gAc	p.G1123D		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1123					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CCAGCACCAGGCTCTGAGAAA	0.438																																					p.G1123D		.											.	FREM2	100	0			c.G3368A						.						61.0	61.0	61.0					13																	39264849		2203	4300	6503	SO:0001583	missense	341640	exon1			CACCAGGCTCTGA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3368G>A	13.37:g.39264849G>A	ENSP00000280481:p.Gly1123Asp	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	6.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061662	0.76187	.	.	ENSG00000150893	ENST00000280481	T	0.26373	1.74	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.61451	0.2348	H	0.94734	3.575	0.80722	D	1	D	0.64830	0.994	P	0.58013	0.831	T	0.71056	-0.4703	10	0.66056	D	0.02	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1123	Q5SZK8	FREM2_HUMAN	D	1123	ENSP00000280481:G1123D	ENSP00000280481:G1123D	G	+	2	0	FREM2	38162849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.864000	0.99589	2.890000	0.99128	0.650000	0.86243	GGC	.		0.438	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
GAS2L2	246176	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	34079749	34079749	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr17:34079749A>T	ENST00000254466.6	-	1	148	c.121T>A	c.(121-123)Tgg>Agg	p.W41R	GAS2L2_ENST00000587565.1_Missense_Mutation_p.W41R	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	41	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TCGCGAAGCCACTCAGCCAGG	0.607																																					p.W41R		.											.	GAS2L2	227	0			c.T121A						.						78.0	65.0	69.0					17																	34079749		2203	4300	6503	SO:0001583	missense	246176	exon1			GAAGCCACTCAGC	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.121T>A	17.37:g.34079749A>T	ENSP00000254466:p.Trp41Arg	Somatic	215.0	1.0		WXS	Illumina HiSeq	Phase_I	183.0	15.0	NM_139285	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.102866	0.76983	.	.	ENSG00000132139	ENST00000254466;ENST00000359507	D	0.99329	-5.75	5.46	5.46	0.80206	Calponin homology domain (5);	0.000000	0.64402	D	0.000004	D	0.99585	0.9850	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97907	1.0306	10	0.87932	D	0	-19.186	14.8606	0.70379	1.0:0.0:0.0:0.0	.	41	Q8NHY3	GA2L2_HUMAN	R	41	ENSP00000254466:W41R	ENSP00000254466:W41R	W	-	1	0	GAS2L2	31103862	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	9.025000	0.93694	2.296000	0.77279	0.482000	0.46254	TGG	.		0.607	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
GCAT	23464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	38212648	38212648	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr22:38212648G>A	ENST00000248924.6	+	9	1239	c.1183G>A	c.(1183-1185)Gtg>Atg	p.V395M	GCAT_ENST00000323205.6_Missense_Mutation_p.V421M	NM_014291.3	NP_055106.1	O75600	KBL_HUMAN	glycine C-acetyltransferase	395					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|L-threonine catabolic process to glycine (GO:0019518)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	glycine C-acetyltransferase activity (GO:0008890)|pyridoxal phosphate binding (GO:0030170)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	12	Melanoma(58;0.045)				Glycine(DB00145)	GATCTCAGCAGTGCATAGCGA	0.617																																					p.V421M		.											.	GCAT	90	0			c.G1261A						.						81.0	72.0	75.0					22																	38212648		2203	4300	6503	SO:0001583	missense	23464	exon9			TCAGCAGTGCATA	AF077740	CCDS13957.1, CCDS54527.1	22q13.1	2010-01-19	2010-01-19		ENSG00000100116	ENSG00000100116	2.3.1.29		4188	protein-coding gene	gene with protein product	"""2-amino-3-ketobutyrate coenzyme A ligase"""	607422	"""glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)"""				Standard	NM_014291		Approved	KBL	uc003aua.2	O75600	OTTHUMG00000150664	ENST00000248924.6:c.1183G>A	22.37:g.38212648G>A	ENSP00000248924:p.Val395Met	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	44.0	NM_001171690	E2QC23|Q6ZWF1|Q96CA9	Missense_Mutation	SNP	ENST00000248924.6	37	CCDS13957.1	.	.	.	.	.	.	.	.	.	.	g	19.66	3.869526	0.72065	.	.	ENSG00000100116	ENST00000323205;ENST00000248924	D;D	0.90620	-2.7;-2.7	5.42	4.41	0.53225	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.116625	0.64402	N	0.000017	D	0.90410	0.6998	L	0.33339	1.005	0.36264	D	0.854711	B;D	0.56035	0.007;0.974	B;P	0.55749	0.034;0.783	D	0.93296	0.6672	10	0.72032	D	0.01	-21.3337	14.3991	0.67031	0.0712:0.0:0.9288:0.0	.	421;395	E2QC23;O75600	.;KBL_HUMAN	M	421;395	ENSP00000371110:V421M;ENSP00000248924:V395M	ENSP00000248924:V395M	V	+	1	0	GCAT	36542594	1.000000	0.71417	0.838000	0.33150	0.470000	0.32858	5.387000	0.66243	1.325000	0.45301	-0.119000	0.15052	GTG	.		0.617	GCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319506.1	NM_014291.2	
GNL3L	54552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54566597	54566597	+	Silent	SNP	C	C	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chrX:54566597C>A	ENST00000336470.4	+	4	250	c.111C>A	c.(109-111)acC>acA	p.T37T	GNL3L_ENST00000360845.2_Silent_p.T37T|GNL3L_ENST00000489691.1_3'UTR	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	37					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						AGAAAGCAACCTCCAAAGTGC	0.453																																					p.T37T		.											.	GNL3L	131	0			c.C111A						.						110.0	96.0	101.0					X																	54566597		2203	4300	6503	SO:0001819	synonymous_variant	54552	exon4			AGCAACCTCCAAA	AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.111C>A	X.37:g.54566597C>A		Somatic	342.0	0.0		WXS	Illumina HiSeq	Phase_I	288.0	99.0	NM_001184819		Silent	SNP	ENST00000336470.4	37	CCDS14360.1																																																																																			.		0.453	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056805.1	NM_019067	
GPR1	2825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	207040977	207040977	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr2:207040977C>T	ENST00000407325.2	-	3	1357	c.995G>A	c.(994-996)tGt>tAt	p.C332Y	GPR1_ENST00000437420.1_Missense_Mutation_p.C332Y	NM_001098199.1|NM_001261452.1|NM_001261453.1|NM_001261454.1|NM_001261455.1|NM_005279.3	NP_001091669.1|NP_001248381.1|NP_001248382.1|NP_001248383.1|NP_001248384.1|NP_005270.2	P46091	GPR1_HUMAN	G protein-coupled receptor 1	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	18		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		TGTGCCAGAACAGCTGACTTC	0.433																																					p.C332Y		.											.	GPR1	90	0			c.G995A						.						76.0	74.0	74.0					2																	207040977		2203	4300	6503	SO:0001583	missense	2825	exon3			CCAGAACAGCTGA		CCDS2368.1	2q33.3	2014-01-30			ENSG00000183671	ENSG00000183671		"""GPCR / Class A : Orphans"""	4463	protein-coding gene	gene with protein product		600239				7851889	Standard	NM_005279		Approved		uc031rqv.1	P46091	OTTHUMG00000132894	ENST00000407325.2:c.995G>A	2.37:g.207040977C>T	ENSP00000384345:p.Cys332Tyr	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	45.0	NM_001098199	A5JUU6|A8K4L1|Q53TR9|Q6NVX4	Missense_Mutation	SNP	ENST00000407325.2	37	CCDS2368.1	.	.	.	.	.	.	.	.	.	.	C	3.201	-0.163738	0.06502	.	.	ENSG00000183671	ENST00000407325;ENST00000437420	T;T	0.72282	-0.64;-0.64	5.45	5.45	0.79879	.	0.593736	0.18045	N	0.153470	T	0.49830	0.1580	N	0.08118	0	0.38126	D	0.938004	B	0.25007	0.116	B	0.19391	0.025	T	0.51545	-0.8692	10	0.26408	T	0.33	.	12.6099	0.56546	0.0:0.9245:0.0:0.0755	.	332	P46091	GPR1_HUMAN	Y	332	ENSP00000384345:C332Y;ENSP00000397535:C332Y	ENSP00000384345:C332Y	C	-	2	0	GPR1	206749222	0.977000	0.34250	0.996000	0.52242	0.855000	0.48748	3.329000	0.52060	2.579000	0.87056	0.655000	0.94253	TGT	.		0.433	GPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256394.2	NM_001098199	
GRIP2	80852	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	14548392	14548392	+	RNA	SNP	C	C	T	rs374577398		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr3:14548392C>T	ENST00000273083.3	-	0	2379							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						CGGCGAGAAGCGGGCTGCTGG	0.657																																					.		.											.	GRIP2	69	0			.						.	C	HIS/ARG	0,4036		0,0,2018	17.0	22.0	20.0		2605	2.7	0.1	3		20	1,8333		0,1,4166	no	missense	GRIP2	NM_001080423.2	29	0,1,6184	TT,TC,CC		0.012,0.0,0.0081	benign	869/1141	14548392	1,12369	2018	4167	6185			80852	.			GAGAAGCGGGCTG	AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14548392C>T		Somatic	198.0	1.0		WXS	Illumina HiSeq	Phase_I	153.0	70.0	.	Q8TEH9|Q9H7H3	RNA	SNP	ENST00000273083.3	37																																																																																				.		0.657	GRIP2-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000340582.2	NM_001080423	
HFE2	148738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	145416462	145416462	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr1:145416462C>A	ENST00000336751.5	+	4	1045	c.807C>A	c.(805-807)aaC>aaA	p.N269K	HFE2_ENST00000497365.1_Missense_Mutation_p.N43K|HFE2_ENST00000357836.5_Missense_Mutation_p.N156K|HFE2_ENST00000475797.1_Missense_Mutation_p.N43K	NM_213653.3	NP_998818.1	Q6ZVN8	RGMC_HUMAN	hemochromatosis type 2 (juvenile)	269					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|iron ion homeostasis (GO:0055072)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	14	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AAACTGCTAACCCTGGGAACC	0.502																																					p.N269K		.											.	HFE2	91	0			c.C807A						.						107.0	108.0	108.0					1																	145416462		2203	4300	6503	SO:0001583	missense	148738	exon4			TGCTAACCCTGGG	AY372521	CCDS72877.1, CCDS72878.1, CCDS72879.1	1q21.2	2014-06-26			ENSG00000168509	ENSG00000168509			4887	protein-coding gene	gene with protein product	"""repulsive guidance molecule c"""	608374				10205270, 14647275	Standard	NM_213653		Approved	JH, HFE2A, RGMC, HJV, hemojuvelin, haemojuvelin	uc001eni.2	Q6ZVN8	OTTHUMG00000013748	ENST00000336751.5:c.807C>A	1.37:g.145416462C>A	ENSP00000337014:p.Asn269Lys	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	38.0	NM_213653	B1ALI7|Q2PQ63|Q6IMF6|Q8NAH2|Q8WVJ5	Missense_Mutation	SNP	ENST00000336751.5	37	CCDS910.1	.	.	.	.	.	.	.	.	.	.	C	4.206	0.036975	0.08148	.	.	ENSG00000168509	ENST00000357836;ENST00000336751;ENST00000497365;ENST00000475797	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.18	3.23	0.37069	Repulsive guidance molecule, C-terminal (1);	0.541229	0.19997	N	0.101436	T	0.42698	0.1214	N	0.22421	0.69	0.29765	N	0.835266	B	0.23185	0.081	B	0.21917	0.037	T	0.29761	-1.0001	10	0.06099	T	0.92	-18.4474	4.1701	0.10326	0.1604:0.5972:0.1555:0.0868	.	269	Q6ZVN8	RGMC_HUMAN	K	156;269;43;43	ENSP00000350495:N156K;ENSP00000337014:N269K;ENSP00000421820:N43K;ENSP00000425716:N43K	ENSP00000337014:N269K	N	+	3	2	HFE2	144127819	0.474000	0.25886	0.992000	0.48379	0.991000	0.79684	0.833000	0.27504	1.417000	0.47077	0.655000	0.94253	AAC	.		0.502	HFE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038527.1	NM_145277	
HIRIP3	8479	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30005727	30005728	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr16:30005727_30005728insT	ENST00000279392.3	-	4	1568_1569	c.738_739insA	c.(736-741)gaagagfs	p.E247fs	HIRIP3_ENST00000566471.1_5'Flank|INO80E_ENST00000567705.1_5'Flank|INO80E_ENST00000563197.1_5'Flank|INO80E_ENST00000567254.1_5'Flank|HIRIP3_ENST00000564026.1_Intron|INO80E_ENST00000304516.7_5'Flank	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	247	Glu-rich.				chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						tcttctttctcttcctcctcca	0.49																																					p.E247fs		.											.	HIRIP3	90	0			c.739_740insA						.																																			SO:0001589	frameshift_variant	8479	exon4			CTTTCTCTTCCTC	AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118	ENST00000279392.3:c.739dupA	16.37:g.30005729_30005729dupT	ENSP00000279392:p.Glu247fs	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	21.0	NM_003609	H3BSR3|O75707|O75708	Frame_Shift_Ins	INS	ENST00000279392.3	37	CCDS10664.1																																																																																			.		0.490	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255160.2	NM_003609	
IPO13	9670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	44415602	44415602	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr1:44415602G>A	ENST00000372343.3	+	2	1260	c.598G>A	c.(598-600)Gct>Act	p.A200T		NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	200					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				GGAATGTGGGGCTGTCTTCCC	0.622																																					p.A200T		.											.	IPO13	226	0			c.G598A						.						15.0	17.0	16.0					1																	44415602		2203	4298	6501	SO:0001583	missense	9670	exon2			TGTGGGGCTGTCT	AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.598G>A	1.37:g.44415602G>A	ENSP00000361418:p.Ala200Thr	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	21.0	NM_014652	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	ENST00000372343.3	37	CCDS503.1	.	.	.	.	.	.	.	.	.	.	G	2.188	-0.385964	0.04966	.	.	ENSG00000117408	ENST00000372343	T	0.41065	1.01	5.46	4.54	0.55810	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.275968	0.41396	N	0.000890	T	0.20941	0.0504	N	0.12182	0.205	0.80722	D	1	B	0.26602	0.154	B	0.27380	0.079	T	0.05852	-1.0860	10	0.08381	T	0.77	-7.8459	8.0028	0.30308	0.0808:0.0:0.6636:0.2557	.	200	O94829	IPO13_HUMAN	T	200	ENSP00000361418:A200T	ENSP00000361418:A200T	A	+	1	0	IPO13	44188189	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	2.050000	0.41297	1.290000	0.44636	0.491000	0.48974	GCT	.		0.622	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022846.1	NM_014652	
ICE1	23379	broad.mit.edu;ucsc.edu;mdanderson.org	37	5	5463008	5463008	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr5:5463008T>A	ENST00000296564.7	+	13	3783	c.3561T>A	c.(3559-3561)taT>taA	p.Y1187*		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1187					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TAGGGGATTATAGTTCAGGGG	0.368																																					p.Y1187X		.											.	KIAA0947	48	0			c.T3561A						.						86.0	75.0	78.0					5																	5463008		1831	4087	5918	SO:0001587	stop_gained	23379	exon13			GGATTATAGTTCA																												ENST00000296564.7:c.3561T>A	5.37:g.5463008T>A	ENSP00000296564:p.Tyr1187*	Somatic	123.0	1.0		WXS	Illumina HiSeq	Phase_I	109.0	30.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Nonsense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	T	41	8.858859	0.98980	.	.	ENSG00000164151	ENST00000296564	.	.	.	5.0	0.98	0.19750	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.1096	6.6008	0.22699	0.0:0.3597:0.0:0.6403	.	.	.	.	X	1187	.	ENSP00000296564:Y1187X	Y	+	3	2	KIAA0947	5516008	0.011000	0.17503	0.113000	0.21522	0.455000	0.32408	-0.171000	0.09883	-0.079000	0.12707	0.254000	0.18369	TAT	.		0.368	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
KDM3B	51780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	137734001	137734001	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr5:137734001A>G	ENST00000314358.5	+	10	3166	c.2966A>G	c.(2965-2967)tAc>tGc	p.Y989C	KDM3B_ENST00000394866.1_Missense_Mutation_p.Y645C|KDM3B_ENST00000542866.1_Missense_Mutation_p.Y21C	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	989					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						ACCTCAAAATACATCCTGGCC	0.517																																					p.Y989C		.											.	KDM3B	542	0			c.A2966G						.						133.0	126.0	128.0					5																	137734001		2203	4300	6503	SO:0001583	missense	51780	exon10			CAAAATACATCCT	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2966A>G	5.37:g.137734001A>G	ENSP00000326563:p.Tyr989Cys	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	228.0	76.0	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.501133	0.85176	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.73897	-0.22;-0.79;-0.75	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.85613	0.5737	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.87568	0.2476	10	0.87932	D	0	-23.0814	15.102	0.72288	1.0:0.0:0.0:0.0	.	645;989	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	C	989;779;645;21	ENSP00000326563:Y989C;ENSP00000378335:Y645C;ENSP00000439462:Y21C	ENSP00000326563:Y989C	Y	+	2	0	KDM3B	137761900	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	1.963000	0.57068	0.454000	0.30748	TAC	.		0.517	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
KRT39	390792	broad.mit.edu;mdanderson.org	37	17	39116562	39116562	+	Silent	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr17:39116562G>A	ENST00000355612.2	-	6	1223	c.1188C>T	c.(1186-1188)taC>taT	p.Y396Y	AC004231.2_ENST00000418393.1_RNA	NM_213656.3	NP_998821.3	Q6A163	K1C39_HUMAN	keratin 39	396	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	17		Breast(137;0.00043)|Ovarian(249;0.15)				GAAGGCTGCGGTATGTGGTAA	0.483																																					p.Y396Y		.											.	.	.	0			c.C1188T						.						126.0	111.0	116.0					17																	39116562		2203	4296	6499	SO:0001819	synonymous_variant	390792	exon6			GCTGCGGTATGTG	AJ786657	CCDS11382.1	17q21.2	2013-01-16			ENSG00000196859	ENSG00000196859		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	32971	protein-coding gene	gene with protein product						16831889	Standard	NM_213656		Approved	KA35	uc002hvo.1	Q6A163	OTTHUMG00000133424	ENST00000355612.2:c.1188C>T	17.37:g.39116562G>A		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	12.0	NM_213656	B2RXK6|Q6IFU6	Silent	SNP	ENST00000355612.2	37	CCDS11382.1																																																																																			.		0.483	KRT39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257287.1	NM_213656	
L1CAM	3897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153135689	153135689	+	Silent	SNP	C	C	A	rs201381558		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chrX:153135689C>A	ENST00000370060.1	-	9	1002	c.813G>T	c.(811-813)acG>acT	p.T271T	L1CAM_ENST00000370057.3_Silent_p.T271T|L1CAM_ENST00000538883.1_Silent_p.T273T|L1CAM_ENST00000361699.4_Silent_p.T271T|L1CAM_ENST00000370055.1_Silent_p.T266T|L1CAM_ENST00000361981.3_Silent_p.T266T|L1CAM_ENST00000543994.1_Silent_p.T273T	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	271	Ig-like C2-type 3.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGATGGTGGGCGTGGGACTGC	0.637																																					p.T271T		.											.	L1CAM	138	0			c.G813T						.						112.0	112.0	112.0					X																	153135689		2203	4300	6503	SO:0001819	synonymous_variant	3897	exon8			GGTGGGCGTGGGA	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.813G>T	X.37:g.153135689C>A		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	29.0	NM_000425	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	CCDS14733.1																																																																																			.		0.637	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
LDHAL6B	92483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	59499173	59499173	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr15:59499173C>A	ENST00000307144.4	+	1	132	c.34C>A	c.(34-36)Cag>Aag	p.Q12K	MYO1E_ENST00000288235.4_Intron	NM_033195.2	NP_149972.1	Q9BYZ2	LDH6B_HUMAN	lactate dehydrogenase A-like 6B	12					cellular carbohydrate metabolic process (GO:0044262)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)	10						GCGGGCCAGCCAGAGAGTGAG	0.582																																					p.Q12K		.											.	LDHAL6B	226	0			c.C34A						.						37.0	36.0	36.0					15																	59499173		2191	4290	6481	SO:0001583	missense	92483	exon1			GCCAGCCAGAGAG	AY009108	CCDS10171.1	15q21.3	2011-01-27	2004-07-27	2004-07-28	ENSG00000171989	ENSG00000171989			21481	protein-coding gene	gene with protein product			"""lactate dehydrogenase A-like 6"""	LDHAL6		15870898	Standard	NM_033195		Approved	LDHL, LDH6B	uc002agb.4	Q9BYZ2	OTTHUMG00000132714	ENST00000307144.4:c.34C>A	15.37:g.59499173C>A	ENSP00000302393:p.Gln12Lys	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	38.0	NM_033195	Q6DUY4|Q96LI2	Missense_Mutation	SNP	ENST00000307144.4	37	CCDS10171.1	.	.	.	.	.	.	.	.	.	.	C	1.967	-0.437395	0.04636	.	.	ENSG00000171989	ENST00000307144	T	0.66638	-0.22	0.827	-0.333	0.12671	.	.	.	.	.	T	0.42877	0.1222	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17992	-1.0351	9	0.21014	T	0.42	.	3.2405	0.06779	0.0:0.6516:0.0:0.3484	.	12	Q9BYZ2	LDH6B_HUMAN	K	12	ENSP00000302393:Q12K	ENSP00000302393:Q12K	Q	+	1	0	LDHAL6B	57286465	0.070000	0.21116	0.001000	0.08648	0.069000	0.16628	0.149000	0.16243	-0.143000	0.11334	0.305000	0.20034	CAG	.		0.582	LDHAL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256015.1	NM_033195	
LRR1	122769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	50074175	50074175	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr14:50074175T>A	ENST00000298288.6	+	3	664	c.340T>A	c.(340-342)Tgt>Agt	p.C114S	LRR1_ENST00000557531.1_3'UTR|LRR1_ENST00000318317.4_Intron	NM_152329.3	NP_689542.2	Q96L50	LLR1_HUMAN	leucine rich repeat protein 1	114					protein ubiquitination (GO:0016567)					kidney(2)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TCATAGAGGCTGTAATGTTGA	0.353																																					p.C114S		.											.	LRR1	227	0			c.T340A						.						60.0	66.0	64.0					14																	50074175		2203	4300	6503	SO:0001583	missense	122769	exon3			AGAGGCTGTAATG	BC030142	CCDS9686.1, CCDS9687.1	14q21.3	2011-02-02	2011-02-02	2011-02-02	ENSG00000165501	ENSG00000165501			19742	protein-coding gene	gene with protein product	"""LRR-repeat protein 1"""	609193	"""peptidylprolyl isomerase (cyclophilin)-like 5"""	PPIL5		11804328, 21074724	Standard	NR_037792		Approved	MGC20689, LRR-1	uc001wwn.3	Q96L50	OTTHUMG00000140273	ENST00000298288.6:c.340T>A	14.37:g.50074175T>A	ENSP00000298288:p.Cys114Ser	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	17.0	NM_152329	A5D6X3|B4DDE0|Q52M24|Q86SZ1|Q8N6H9	Missense_Mutation	SNP	ENST00000298288.6	37	CCDS9686.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.691893	0.00731	.	.	ENSG00000165501	ENST00000298288;ENST00000361579	T	0.17213	2.29	5.58	5.58	0.84498	.	0.392987	0.34110	N	0.004248	T	0.08582	0.0213	N	0.14661	0.345	0.09310	N	0.999996	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.36335	-0.9752	10	0.09338	T	0.73	-1.303	8.3678	0.32397	0.1301:0.0:0.1359:0.734	.	136;114	A8MSW2;Q96L50	.;LLR1_HUMAN	S	114;136	ENSP00000298288:C114S	ENSP00000298288:C114S	C	+	1	0	LRR1	49143925	0.634000	0.27190	0.393000	0.26258	0.116000	0.19942	1.132000	0.31418	2.262000	0.75019	0.529000	0.55759	TGT	.		0.353	LRR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410790.1	NM_203467	
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	39920643	39920643	+	Silent	SNP	T	T	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr1:39920643T>A	ENST00000372915.3	+	88	20733	c.20646T>A	c.(20644-20646)gcT>gcA	p.A6882A	MACF1_ENST00000361689.2_Silent_p.A4924A|MACF1_ENST00000564288.1_Silent_p.A6983A|MACF1_ENST00000317713.7_Silent_p.A4924A|MACF1_ENST00000545844.1_Silent_p.A4924A|MACF1_ENST00000289893.4_Silent_p.A5426A|MACF1_ENST00000567887.1_Silent_p.A7020A|MACF1_ENST00000539005.1_Silent_p.A4794A			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6882					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AACTGGTGGCTAATGCTGAGC	0.542																																					p.A4924A		.											.	MACF1	165	0			c.T14772A						.						98.0	86.0	90.0					1																	39920643		2203	4300	6503	SO:0001819	synonymous_variant	23499	exon86			GGTGGCTAATGCT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.20646T>A	1.37:g.39920643T>A		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	6.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.18|10.18	1.279980|1.279980	0.23392|0.23392	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000360115|ENST00000372925	.|.	.|.	.|.	5.51|5.51	-6.37|-6.37	0.01963|0.01963	.|.	.|.	.|.	.|.	.|.	T|.	0.33059|.	0.0850|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.44513|.	-0.9323|.	4|.	.|.	.|.	.|.	.|.	0.1858|0.1858	0.00128|0.00128	0.3236:0.2168:0.2266:0.2331|0.3236:0.2168:0.2266:0.2331	.|.	.|.	.|.	.|.	Q|K	26|3928	.|.	.|.	L|X	+|+	2|1	0|0	MACF1|MACF1	39693230|39693230	0.489000|0.489000	0.26004|0.26004	0.952000|0.952000	0.39060|0.39060	0.968000|0.968000	0.65278|0.65278	-0.291000|-0.291000	0.08343|0.08343	-0.604000|-0.604000	0.05760|0.05760	-0.408000|-0.408000	0.06270|0.06270	CTA|TAA	.		0.542	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
MAMLD1	10046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	149671633	149671633	+	Silent	SNP	G	G	C			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chrX:149671633G>C	ENST00000370401.2	+	6	2440	c.2130G>C	c.(2128-2130)ggG>ggC	p.G710G	MAMLD1_ENST00000426613.2_Silent_p.G685G|MAMLD1_ENST00000262858.5_Silent_p.G710G|MAMLD1_ENST00000432680.2_Intron|MAMLD1_ENST00000455522.2_Silent_p.G150G			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	710					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					AGGCCCTGGGGAGTGAGTCCT	0.652																																					p.G710G		.											.	MAMLD1	130	0			c.G2130C						.						73.0	73.0	73.0					X																	149671633		2203	4299	6502	SO:0001819	synonymous_variant	10046	exon5			CCTGGGGAGTGAG	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.2130G>C	X.37:g.149671633G>C		Somatic	412.0	0.0		WXS	Illumina HiSeq	Phase_I	355.0	130.0	NM_005491	B2RCQ4|B4DG93|B9EGA5	Silent	SNP	ENST00000370401.2	37	CCDS14693.2																																																																																			.		0.652	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491	
MAPT	4137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	44060964	44060964	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr17:44060964T>A	ENST00000571987.1	+	5	794	c.794T>A	c.(793-795)aTc>aAc	p.I265N	MAPT_ENST00000574436.1_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000262410.5_Missense_Mutation_p.I265N|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000431008.3_Intron|MAPT_ENST00000344290.5_Missense_Mutation_p.I265N|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000415613.2_Missense_Mutation_p.I265N|MAPT_ENST00000420682.2_Intron|MAPT_ENST00000535772.1_Intron			P10636	TAU_HUMAN	microtubule-associated protein tau	265					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	GAGGGTGCCATCCCCCTCCCT	0.672																																					p.I265N		.											.	MAPT	91	0			c.T794A						.						31.0	30.0	30.0					17																	44060964		2202	4299	6501	SO:0001583	missense	4137	exon6			GTGCCATCCCCCT	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.794T>A	17.37:g.44060964T>A	ENSP00000458742:p.Ile265Asn	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	26.0	NM_001123066	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Missense_Mutation	SNP	ENST00000571987.1	37	CCDS11501.1	.	.	.	.	.	.	.	.	.	.	T	9.722	1.159964	0.21454	.	.	ENSG00000186868	ENST00000344290;ENST00000262410;ENST00000415613	T;T;T	0.15139	2.45;2.47;2.45	5.47	2.0	0.26442	.	0.732533	0.11787	N	0.529564	T	0.13586	0.0329	L	0.50333	1.59	0.09310	N	1	P;P	0.45474	0.859;0.638	B;B	0.40534	0.332;0.178	T	0.16453	-1.0402	10	0.23891	T	0.37	-1.5043	4.2549	0.10712	0.0:0.1789:0.1734:0.6477	.	265;265	P10636-9;P10636	.;TAU_HUMAN	N	265	ENSP00000340820:I265N;ENSP00000262410:I265N;ENSP00000410838:I265N	ENSP00000262410:I265N	I	+	2	0	MAPT	41416801	0.007000	0.16637	0.715000	0.30552	0.007000	0.05969	0.016000	0.13377	0.353000	0.24079	0.459000	0.35465	ATC	.		0.672	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	NM_016835	
MDH1	4190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	63832431	63832431	+	Silent	SNP	C	C	T	rs542095115		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr2:63832431C>T	ENST00000233114.8	+	7	1128	c.693C>T	c.(691-693)ggC>ggT	p.G231G	MDH1_ENST00000539945.1_Silent_p.G249G|MDH1_ENST00000394423.1_Silent_p.G231G|MDH1_ENST00000409908.1_Silent_p.G66G|MDH1_ENST00000544381.1_Silent_p.G142G|MDH1_ENST00000409476.1_Silent_p.G107G	NM_005917.3	NP_005908.1	P40925	MDHC_HUMAN	malate dehydrogenase 1, NAD (soluble)	231					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|malate metabolic process (GO:0006108)|NADH metabolic process (GO:0006734)|oxaloacetate metabolic process (GO:0006107)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	diiodophenylpyruvate reductase activity (GO:0047860)|L-malate dehydrogenase activity (GO:0030060)|malic enzyme activity (GO:0004470)|NAD binding (GO:0051287)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(4)	13						AGCAGCGTGGCGCTGCTGTCA	0.517													c|||	1	0.000199681	0.0	0.0	5008	,	,		18924	0.0		0.0	False		,,,				2504	0.001				p.G249G		.											.	MDH1	537	0			c.C747T						.						49.0	47.0	47.0					2																	63832431		2203	4300	6503	SO:0001819	synonymous_variant	4190	exon7			GCGTGGCGCTGCT		CCDS1874.1, CCDS56121.1, CCDS56122.1	2p23	2012-10-02			ENSG00000014641	ENSG00000014641	1.1.1.37		6970	protein-coding gene	gene with protein product		154200					Standard	NM_005917		Approved		uc010ypv.2	P40925	OTTHUMG00000129512	ENST00000233114.8:c.693C>T	2.37:g.63832431C>T		Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	50.0	NM_001199111	B2R5V5|B4DUN2|B7Z3I7|F5H098|Q6I9V0	Silent	SNP	ENST00000233114.8	37	CCDS1874.1																																																																																			.		0.517	MDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251687.1		
METTL21C	196541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103343267	103343267	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr13:103343267G>T	ENST00000267273.6	-	2	183	c.178C>A	c.(178-180)Cct>Act	p.P60T		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	60					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						TAATCTGTAGGAACAAATTTC	0.433																																					p.P60T		.											.	METTL21C	90	0			c.C178A						.						154.0	142.0	146.0					13																	103343267		2203	4300	6503	SO:0001583	missense	196541	exon2			CTGTAGGAACAAA		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.178C>A	13.37:g.103343267G>T	ENSP00000267273:p.Pro60Thr	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	51.0	NM_001010977		Missense_Mutation	SNP	ENST00000267273.6	37	CCDS32003.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242805	0.79912	.	.	ENSG00000139780	ENST00000267273	T	0.16597	2.33	6.16	6.16	0.99307	.	0.204155	0.52532	D	0.000064	T	0.31513	0.0799	L	0.29908	0.895	0.44424	D	0.997345	D	0.69078	0.997	D	0.64042	0.921	T	0.00496	-1.1705	10	0.56958	D	0.05	-24.158	19.848	0.96722	0.0:0.0:1.0:0.0	.	60	Q5VZV1	MT21C_HUMAN	T	60	ENSP00000267273:P60T	ENSP00000267273:P60T	P	-	1	0	METTL21C	102141268	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.459000	0.80802	2.937000	0.99478	0.650000	0.86243	CCT	.		0.433	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
MGA	23269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	41988802	41988802	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr15:41988802A>T	ENST00000570161.1	+	2	1594	c.1594A>T	c.(1594-1596)Aaa>Taa	p.K532*	MGA_ENST00000566586.1_Nonsense_Mutation_p.K532*|MGA_ENST00000219905.7_Nonsense_Mutation_p.K532*|MGA_ENST00000389936.4_Nonsense_Mutation_p.K532*|MGA_ENST00000545763.1_Nonsense_Mutation_p.K532*			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGGTCTTAGAAAACATTCACC	0.373																																					p.K532X		.											.	MGA	522	0			c.A1594T						.						74.0	66.0	68.0					15																	41988802		1842	4088	5930	SO:0001587	stop_gained	23269	exon3			CTTAGAAAACATT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1594A>T	15.37:g.41988802A>T	ENSP00000457035:p.Lys532*	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	8.0	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	A	35	5.545638	0.96488	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	5.54	5.54	0.83059	.	0.470570	0.22266	N	0.062322	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.68	0.77360	1.0:0.0:0.0:0.0	.	.	.	.	X	532	.	ENSP00000219905:K532X	K	+	1	0	MGA	39776094	0.999000	0.42202	0.998000	0.56505	0.821000	0.46438	2.947000	0.49058	2.107000	0.64212	0.379000	0.24179	AAA	.		0.373	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
MLLT6	4302	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	36876674	36876674	+	Silent	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr17:36876674G>A	ENST00000325718.7	+	15	2296	c.2205G>A	c.(2203-2205)cgG>cgA	p.R735R	MIR4726_ENST00000577947.1_RNA|CTB-58E17.9_ENST00000579499.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	735	Leucine-zipper.			R -> W (in Ref. 4; BAD92870). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					AGAACCAGCGGCTGCAAGAGC	0.662			T	MLL	AL																																p.R735R		.		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6	659	0			c.G2205A						.						34.0	29.0	31.0					17																	36876674		2200	4286	6486	SO:0001819	synonymous_variant	4302	exon15			CCAGCGGCTGCAA		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.2205G>A	17.37:g.36876674G>A		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	41.0	NM_005937	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Silent	SNP	ENST00000325718.7	37	CCDS11327.1																																																																																			.		0.662	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
MUSK	4593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	113509934	113509934	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr9:113509934C>G	ENST00000374448.4	+	7	901	c.767C>G	c.(766-768)tCc>tGc	p.S256C	MUSK_ENST00000416899.2_Missense_Mutation_p.S256C|MUSK_ENST00000189978.5_Missense_Mutation_p.S256C	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	256	Ig-like 3.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						TCTTCTGGGTCCATTCAAGAG	0.413																																					p.S266C		.											.	MUSK	1379	0			c.C797G						.						168.0	155.0	159.0					9																	113509934		1867	4119	5986	SO:0001583	missense	4593	exon8			CTGGGTCCATTCA	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.767C>G	9.37:g.113509934C>G	ENSP00000363571:p.Ser256Cys	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	32.0	NM_001166280	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	ENST00000374448.4	37	CCDS48005.1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521598	0.64747	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000416899	T	0.12984	2.63	5.68	5.68	0.88126	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.40423	0.1116	M	0.87971	2.92	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79784	0.976;0.993	T	0.32903	-0.9889	10	0.59425	D	0.04	.	10.6852	0.45839	0.0:0.9133:0.0:0.0867	.	256;266	O15146;F5H6T2	MUSK_HUMAN;.	C	256;256;256;266;266;256	ENSP00000363571:S256C	ENSP00000189978:S256C	S	+	2	0	MUSK	112549755	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.256000	0.51492	2.675000	0.91044	0.655000	0.94253	TCC	.		0.413	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
MYH11	4629	broad.mit.edu;bcgsc.ca	37	16	15853534	15853534	+	Missense_Mutation	SNP	G	G	A	rs375276152		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr16:15853534G>A	ENST00000300036.5	-	12	1409	c.1300C>T	c.(1300-1302)Cgc>Tgc	p.R434C	MYH11_ENST00000452625.2_Missense_Mutation_p.R441C|MYH11_ENST00000396324.3_Missense_Mutation_p.R441C|MYH11_ENST00000576790.2_Missense_Mutation_p.R434C	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	434	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AGTATCCAGCGGAAAAGGCGC	0.537			T	CBFB	AML																																p.R441C		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	666	0			c.C1321T						.	G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4393	2.1+/-5.4	0,1,2196	102.0	90.0	94.0		1321,1321,1300,1300	4.8	1.0	16		94	0,8600		0,0,4300	no	missense,missense,missense,missense	MYH11	NM_001040113.1,NM_001040114.1,NM_002474.2,NM_022844.2	180,180,180,180	0,1,6496	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	441/1946,441/1980,434/1973,434/1939	15853534	1,12993	2197	4300	6497	SO:0001583	missense	4629	exon13			TCCAGCGGAAAAG	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1300C>T	16.37:g.15853534G>A	ENSP00000300036:p.Arg434Cys	Somatic	201.0	1.0		WXS	Illumina HiSeq	Phase_I	182.0	8.0	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475796	0.84640	2.28E-4	0.0	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28	5.75	4.8	0.61643	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.92799	0.7710	M	0.79123	2.44	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.73380	0.969;0.969;0.969;0.969;0.969;0.98	D	0.93462	0.6811	10	0.72032	D	0.01	.	13.8474	0.63477	0.0731:0.0:0.9269:0.0	.	441;434;434;441;434;441	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	C	434;434;441;441;441	ENSP00000300036:R434C;ENSP00000345136:R434C;ENSP00000379616:R441C;ENSP00000407821:R441C	ENSP00000300036:R434C	R	-	1	0	MYH11	15761035	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	7.917000	0.87498	1.430000	0.47334	0.561000	0.74099	CGC	.		0.537	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
NR1H2	7376	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	50881836	50881836	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr19:50881836C>A	ENST00000253727.5	+	6	765	c.530C>A	c.(529-531)tCa>tAa	p.S177*	NR1H2_ENST00000593926.1_Nonsense_Mutation_p.S177*|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000599105.1_Nonsense_Mutation_p.S177*|NR1H2_ENST00000411902.2_Nonsense_Mutation_p.S80*|NR1H2_ENST00000598168.1_Nonsense_Mutation_p.S177*	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	177					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CAGCAGGAGTCACAGTCACAG	0.632																																					p.S177X		.											.	NR1H2	186	0			c.C530A						.						35.0	46.0	42.0					19																	50881836		2163	4263	6426	SO:0001587	stop_gained	7376	exon6			AGGAGTCACAGTC	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.530C>A	19.37:g.50881836C>A	ENSP00000253727:p.Ser177*	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	27.0	NM_007121	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Nonsense_Mutation	SNP	ENST00000253727.5	37	CCDS42593.1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729108	0.69074	.	.	ENSG00000131408	ENST00000253727;ENST00000411902;ENST00000376942	.	.	.	1.62	0.529	0.17095	.	0.346219	0.24391	N	0.038939	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	6.1298	0.20199	0.4374:0.5625:0.0:0.0	.	.	.	.	X	177;80;177	.	ENSP00000253727:S177X	S	+	2	0	NR1H2	55573648	0.018000	0.18449	0.995000	0.50966	0.250000	0.25880	-0.173000	0.09854	0.127000	0.18452	-0.755000	0.03482	TCA	.		0.632	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
NTRK3	4916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	88423567	88423567	+	Silent	SNP	G	G	A	rs79813886	byFrequency	TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr15:88423567G>A	ENST00000360948.2	-	18	2429	c.2268C>T	c.(2266-2268)ttC>ttT	p.F756F	NTRK3_ENST00000357724.2_Silent_p.F748F|NTRK3_ENST00000557856.1_Silent_p.F734F|NTRK3_ENST00000355254.2_Silent_p.F742F|NTRK3_ENST00000394480.2_Silent_p.F742F	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	756	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGATCACCCCGAAGCTCCATA	0.517			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)			G|||	2	0.000399361	0.0	0.0	5008	,	,		20038	0.001		0.0	False		,,,				2504	0.001				p.F756F		.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	3538	0			c.C2268T						.	G	,	0,4402		0,0,2201	127.0	111.0	116.0		2268,2226	-2.5	1.0	15	dbSNP_132	116	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous	NTRK3	NM_001012338.2,NM_002530.3	,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,	756/840,742/826	88423567	1,12999	2201	4299	6500	SO:0001819	synonymous_variant	4916	exon19			CACCCCGAAGCTC	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.2268C>T	15.37:g.88423567G>A		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	37.0	NM_001012338	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	CCDS32322.1																																																																																			G|0.999;A|0.001		0.517	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228526698	228526698	+	Silent	SNP	T	T	C			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr1:228526698T>C	ENST00000422127.1	+	69	17273	c.17229T>C	c.(17227-17229)aaT>aaC	p.N5743N	OBSCN_ENST00000284548.11_Silent_p.N5743N|OBSCN_ENST00000366707.4_Silent_p.N3377N|OBSCN_ENST00000570156.2_Silent_p.N6700N|OBSCN_ENST00000366709.4_Silent_p.N2862N	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5743	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCTTCCGCAATGTGCGGGACA	0.627																																					p.N6700N		.											.	OBSCN	403	0			c.T20100C						.						11.0	14.0	13.0					1																	228526698		1887	3764	5651	SO:0001819	synonymous_variant	84033	exon80			CCGCAATGTGCGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.17229T>C	1.37:g.228526698T>C		Somatic	259.0	0.0		WXS	Illumina HiSeq	Phase_I	278.0	86.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.774647	0.31411	.	.	ENSG00000154358	ENST00000441106	.	.	.	5.19	-3.62	0.04543	.	.	.	.	.	T	0.62672	0.2447	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60657	-0.7220	4	.	.	.	.	13.5375	0.61653	0.0:0.3254:0.0:0.6746	.	.	.	.	R	359	.	.	C	+	1	0	OBSCN	226593321	0.009000	0.17119	0.323000	0.25347	0.650000	0.38633	-0.800000	0.04555	-0.887000	0.03961	-0.285000	0.09966	TGT	.		0.627	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR1F1	4992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3254987	3254987	+	Silent	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr16:3254987G>A	ENST00000304646.2	+	1	741	c.741G>A	c.(739-741)gtG>gtA	p.V247V	AJ003147.9_ENST00000576468.1_RNA	NM_012360.1	NP_036492.1	O43749	OR1F1_HUMAN	olfactory receptor, family 1, subfamily F, member 1	247					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(2)|lung(7)	11						ACCTGGCTGTGGTTCTCCTCT	0.493																																					p.V247V		.											.	OR1F1	68	0			c.G741A						.						208.0	191.0	197.0					16																	3254987		2197	4300	6497	SO:0001819	synonymous_variant	4992	exon1			GGCTGTGGTTCTC	Y14442	CCDS10496.1	16p13.3	2012-08-09			ENSG00000168124	ENSG00000168124		"""GPCR / Class A : Olfactory receptors"""	8194	protein-coding gene	gene with protein product		603232		OR1F4, OR1F6, OR1F7, OR1F8, OR1F9, OR1F5, OR1F10, OR1F13P		9288094, 9500546	Standard	NM_012360		Approved	Olfmf, OR16-36, OR16-37, OR16-88, OR16-89, OR16-90, OLFMF, OR3-145	uc010uwu.2	O43749	OTTHUMG00000133153	ENST00000304646.2:c.741G>A	16.37:g.3254987G>A		Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	44.0	NM_012360	O15246|Q6IFL5	Silent	SNP	ENST00000304646.2	37	CCDS10496.1																																																																																			.		0.493	OR1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206985.1		
OR2T6	254879	ucsc.edu;bcgsc.ca	37	1	248551236	248551236	+	Silent	SNP	G	G	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr1:248551236G>T	ENST00000355728.2	+	1	327	c.327G>T	c.(325-327)ggG>ggT	p.G109G		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G109G(1)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTTTATGGGGGCTGAATTCT	0.562																																					p.G109G		.											.	OR2T6	71	1	Substitution - coding silent(1)	lung(1)	c.G327T						.						94.0	100.0	98.0					1																	248551236		2203	4300	6503	SO:0001819	synonymous_variant	254879	exon1			TATGGGGGCTGAA	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.327G>T	1.37:g.248551236G>T		Somatic	114.0	2.0		WXS	Illumina HiSeq	.	154.0	53.0	NM_001005471	A6NE36	Silent	SNP	ENST00000355728.2	37	CCDS31114.1																																																																																			.		0.562	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
OR5M8	219484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56258001	56258001	+	Silent	SNP	A	A	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr11:56258001A>T	ENST00000327216.2	-	1	870	c.846T>A	c.(844-846)ccT>ccA	p.P282P		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					GGTTCAGCATAGGGATTACTG	0.323																																					p.P282P		.											.	OR5M8	68	0			c.T846A						.						45.0	52.0	49.0					11																	56258001		2201	4295	6496	SO:0001819	synonymous_variant	219484	exon1			CAGCATAGGGATT	AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.846T>A	11.37:g.56258001A>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	15.0	NM_001005282	B2RNM5|Q6IEW3|Q96RB8	Silent	SNP	ENST00000327216.2	37	CCDS31533.1																																																																																			.		0.323	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282	
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	55591092	55591092	+	Silent	SNP	A	A	G			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr10:55591092A>G	ENST00000320301.6	-	30	4579	c.4185T>C	c.(4183-4185)gtT>gtC	p.V1395V	PCDH15_ENST00000395432.2_Silent_p.V1358V|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000409834.1_Silent_p.V1006V|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000437009.1_Silent_p.V1324V|PCDH15_ENST00000414778.1_Silent_p.V1400V|PCDH15_ENST00000373965.2_Silent_p.V1402V|PCDH15_ENST00000395430.1_Silent_p.V1395V|PCDH15_ENST00000395438.1_Silent_p.V1395V|PCDH15_ENST00000361849.3_Silent_p.V1395V|PCDH15_ENST00000395445.1_Silent_p.V1402V|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395433.1_Silent_p.V1373V	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1395					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AGCTGACCAAAACCACCAAGA	0.458										HNSCC(58;0.16)																											p.V1400V		.											.	PCDH15	193	0			c.T4200C						.						225.0	198.0	207.0					10																	55591092		2203	4300	6503	SO:0001819	synonymous_variant	65217	exon31			GACCAAAACCACC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4185T>C	10.37:g.55591092A>G		Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	40.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																			.		0.458	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
PIBF1	10464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	73468073	73468073	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr13:73468073C>A	ENST00000326291.6	+	11	1812	c.1474C>A	c.(1474-1476)Cag>Aag	p.Q492K		NM_006346.2	NP_006337.2	Q8WXW3	PIBF1_HUMAN	progesterone immunomodulatory binding factor 1	492						centrosome (GO:0005813)				breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		TGAAAAATATCAGAAAAAATT	0.328																																					p.Q492K		.											.	PIBF1	136	0			c.C1474A						.						77.0	80.0	79.0					13																	73468073		2203	4300	6503	SO:0001583	missense	10464	exon11			AAATATCAGAAAA	AF330046	CCDS31991.1	13q21.33	2014-02-20	2007-10-17	2007-10-17	ENSG00000083535	ENSG00000083535			23352	protein-coding gene	gene with protein product	"""progesterone-induced blocking factor 1"""	607532	"""chromosome 13 open reading frame 24"""	C13orf24		11935316	Standard	NM_006346		Approved	CEP90	uc001vjc.3	Q8WXW3	OTTHUMG00000017071	ENST00000326291.6:c.1474C>A	13.37:g.73468073C>A	ENSP00000317144:p.Gln492Lys	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	35.0	NM_006346	O95664|Q6U9V2|Q6UG50|Q86V07|Q96SF4	Missense_Mutation	SNP	ENST00000326291.6	37	CCDS31991.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670586	0.67814	.	.	ENSG00000083535	ENST00000326291	T	0.24151	1.87	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.45196	0.1330	L	0.50333	1.59	0.58432	D	0.999999	D;D	0.67145	0.996;0.996	D;D	0.72982	0.979;0.979	T	0.12915	-1.0529	10	0.25106	T	0.35	-10.5628	18.6527	0.91437	0.0:1.0:0.0:0.0	.	492;492	Q8WXW3;Q4G0R1	PIBF1_HUMAN;.	K	492	ENSP00000317144:Q492K	ENSP00000317144:Q492K	Q	+	1	0	PIBF1	72366074	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.680000	0.74518	2.477000	0.83638	0.650000	0.86243	CAG	.		0.328	PIBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045255.1	NM_006346	
PLEKHM2	23207	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	16051919	16051919	+	Missense_Mutation	SNP	G	G	A	rs552932422		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr1:16051919G>A	ENST00000375799.3	+	8	1047	c.820G>A	c.(820-822)Gag>Aag	p.E274K	RP11-288I21.1_ENST00000453804.1_RNA|PLEKHM2_ENST00000375793.2_Missense_Mutation_p.E254K	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	274	Interaction with KIF5B.				Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CCCCTTCAACGAGGAGCCGGC	0.677													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16308	0.0		0.0	False		,,,				2504	0.0				p.E274K		.											.	PLEKHM2	23	0			c.G820A						.																																			SO:0001583	missense	23207	exon8			TTCAACGAGGAGC	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.820G>A	1.37:g.16051919G>A	ENSP00000364956:p.Glu274Lys	Somatic	158.0	1.0		WXS	Illumina HiSeq	Phase_I	127.0	49.0	NM_015164	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	ENST00000375799.3	37	CCDS44063.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942934	0.73672	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.53423	0.7;0.62	5.35	4.43	0.53597	.	0.176841	0.49916	D	0.000132	T	0.40473	0.1118	L	0.27053	0.805	0.48395	D	0.999647	D	0.60575	0.988	P	0.45753	0.492	T	0.36817	-0.9732	10	0.54805	T	0.06	-20.7744	14.5021	0.67729	0.0:0.3017:0.6983:0.0	.	274	Q8IWE5	PKHM2_HUMAN	K	274;254	ENSP00000364956:E274K;ENSP00000364950:E254K	ENSP00000364950:E254K	E	+	1	0	PLEKHM2	15924506	0.998000	0.40836	1.000000	0.80357	0.716000	0.41182	2.780000	0.47742	1.233000	0.43693	-0.321000	0.08615	GAG	.		0.677	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164	
PPAP2A	8611	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	54763977	54763977	+	Splice_Site	SNP	T	T	C			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr5:54763977T>C	ENST00000307259.8	-	3	631	c.211A>G	c.(211-213)Att>Gtt	p.I71V	PPAP2A_ENST00000264775.5_Splice_Site_p.I72V|PPAP2A_ENST00000515132.1_5'UTR	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A	71					androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				CCAAGAATAATCTGAAAAAGA	0.333																																					p.I72V		.											.	PPAP2A	92	0			c.A214G						.						59.0	66.0	63.0					5																	54763977		2203	4299	6502	SO:0001630	splice_region_variant	8611	exon3			GAATAATCTGAAA	AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.211-1A>G	5.37:g.54763977T>C		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	21.0	NM_176895	B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	Missense_Mutation	SNP	ENST00000307259.8	37	CCDS34159.1	.	.	.	.	.	.	.	.	.	.	T	12.78	2.040158	0.35989	.	.	ENSG00000067113	ENST00000264775;ENST00000307259	T;T	0.74106	-0.81;-0.81	5.63	4.46	0.54185	.	0.288085	0.22170	N	0.063660	T	0.67487	0.2898	L	0.49699	1.58	0.34975	D	0.753528	B;B	0.06786	0.001;0.0	B;B	0.15484	0.013;0.003	T	0.68078	-0.5504	10	0.30854	T	0.27	-15.5351	11.6628	0.51356	0.0:0.0697:0.0:0.9303	.	71;72	O14494;G3XA95	LPP1_HUMAN;.	V	72;71	ENSP00000264775:I72V;ENSP00000302229:I71V	ENSP00000264775:I72V	I	-	1	0	PPAP2A	54799734	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.936000	0.70153	1.071000	0.40834	0.467000	0.42956	ATT	.		0.333	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368073.1		Missense_Mutation
POC5	134359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	74981292	74981292	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr5:74981292T>G	ENST00000428202.2	-	10	1336	c.1147A>C	c.(1147-1149)Aat>Cat	p.N383H	POC5_ENST00000380475.2_Missense_Mutation_p.N266H|POC5_ENST00000446329.2_Missense_Mutation_p.N358H|POC5_ENST00000510798.1_Missense_Mutation_p.N266H|POC5_ENST00000514838.2_Missense_Mutation_p.N355H	NM_001099271.1	NP_001092741.1	Q8NA72	POC5_HUMAN	POC5 centriolar protein	383					cell cycle (GO:0007049)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TCCTTTTTATTATTTGTGGAG	0.383																																					p.N383H		.											.	POC5	45	0			c.A1147C						.						158.0	164.0	162.0					5																	74981292		1888	4125	6013	SO:0001583	missense	134359	exon10			TTTTATTATTTGT	AK093098	CCDS47236.1, CCDS47237.1	5q13.3	2013-08-05	2013-08-05	2010-03-26	ENSG00000152359	ENSG00000152359			26658	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 37"", ""POC5 centriolar protein homolog (Chlamydomonas)"""	C5orf37		19349582	Standard	NM_152408		Approved	FLJ35779, MGC120442, MGC120443, MGC120444, hPOC5	uc003keh.4	Q8NA72	OTTHUMG00000162487	ENST00000428202.2:c.1147A>C	5.37:g.74981292T>G	ENSP00000410216:p.Asn383His	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	50.0	NM_001099271	B4DJG7|Q494X7|Q494X9|Q6P085	Missense_Mutation	SNP	ENST00000428202.2	37	CCDS47236.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.980825	0.53827	.	.	ENSG00000152359	ENST00000428202;ENST00000514838;ENST00000380475;ENST00000510798;ENST00000446329	T;T;T;T;T	0.46819	1.89;1.47;0.86;0.86;1.89	4.36	4.36	0.52297	.	0.552273	0.21013	N	0.081660	T	0.62563	0.2438	M	0.70595	2.14	0.09310	N	1	D;D;D	0.71674	0.995;0.993;0.998	P;P;D	0.64877	0.885;0.878;0.93	T	0.54536	-0.8279	10	0.52906	T	0.07	-6.8685	10.2513	0.43370	0.0:0.0:0.0:1.0	.	266;383;358	Q8NA72-2;Q8NA72;Q8NA72-3	.;POC5_HUMAN;.	H	383;355;266;266;358	ENSP00000410216:N383H;ENSP00000420971:N355H;ENSP00000369842:N266H;ENSP00000426796:N266H;ENSP00000399481:N358H	ENSP00000369842:N266H	N	-	1	0	POC5	75017048	0.007000	0.16637	0.004000	0.12327	0.636000	0.38137	1.189000	0.32114	2.185000	0.69588	0.459000	0.35465	AAT	.		0.383	POC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369124.1	NM_152408	
PPP2R5D	5528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42957352	42957352	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr6:42957352C>T	ENST00000485511.1	+	2	210	c.31C>T	c.(31-33)Ccc>Tcc	p.P11S	PPP2R5D_ENST00000472118.1_Missense_Mutation_p.P11S|PPP2R5D_ENST00000461010.1_Intron|PPP2R5D_ENST00000394110.3_Missense_Mutation_p.P11S	NM_001270476.1|NM_006245.3	NP_001257405.1|NP_006236.1	Q14738	2A5D_HUMAN	protein phosphatase 2, regulatory subunit B', delta	11					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of catalytic activity (GO:0050790)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	25			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CTTTCAGGAGCCCCCCAAGGT	0.502																																					p.P11S	Melanoma(63;587 1613 29742 31770)	.											.	PPP2R5D	1082	0			c.C31T						.						52.0	49.0	50.0					6																	42957352		2203	4300	6503	SO:0001583	missense	5528	exon2			CAGGAGCCCCCCA	L76702	CCDS4878.1, CCDS43464.1, CCDS55002.1	6p21.1	2010-06-18	2010-04-14		ENSG00000112640	ENSG00000112640		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9312	protein-coding gene	gene with protein product		601646	"""protein phosphatase 2, regulatory subunit B (B56), delta isoform"", ""protein phosphatase 2, regulatory subunit B', delta isoform"""			7592815	Standard	NM_006245		Approved	B56D	uc003oth.4	Q14738	OTTHUMG00000014716	ENST00000485511.1:c.31C>T	6.37:g.42957352C>T	ENSP00000417963:p.Pro11Ser	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	20.0	NM_180976	A8K3I9|B5BUA6|O00494|O00696|Q15171|Q5TC39	Missense_Mutation	SNP	ENST00000485511.1	37	CCDS4878.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425611	0.62733	.	.	ENSG00000112640	ENST00000485511;ENST00000394110;ENST00000472118;ENST00000541610	T;T;T	0.41065	1.05;1.01;1.05	5.84	4.02	0.46733	.	3.298050	0.01007	N	0.003778	T	0.19087	0.0458	L	0.31664	0.95	0.80722	D	1	B;B	0.31209	0.001;0.313	B;B	0.23419	0.001;0.046	T	0.01245	-1.1407	10	0.52906	T	0.07	-9.3292	11.6182	0.51102	0.3237:0.6763:0.0:0.0	.	11;11	Q14738;Q14738-2	2A5D_HUMAN;.	S	11	ENSP00000417963:P11S;ENSP00000377669:P11S;ENSP00000420550:P11S	ENSP00000230402:P11S	P	+	1	0	PPP2R5D	43065330	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	0.978000	0.29488	0.780000	0.33566	0.655000	0.94253	CCC	.		0.502	PPP2R5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040573.3	NM_006245	
PTCH1	5727	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	98231224	98231224	+	Missense_Mutation	SNP	C	C	A	rs374691153		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr9:98231224C>A	ENST00000331920.6	-	14	2358	c.2059G>T	c.(2059-2061)Gtg>Ttg	p.V687L	PTCH1_ENST00000430669.2_Missense_Mutation_p.V621L|PTCH1_ENST00000418258.1_Missense_Mutation_p.V536L|PTCH1_ENST00000437951.1_Missense_Mutation_p.V621L|PTCH1_ENST00000429896.2_Missense_Mutation_p.V536L|PTCH1_ENST00000421141.1_Missense_Mutation_p.V536L|PTCH1_ENST00000375274.2_Missense_Mutation_p.V686L	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	687					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				ACGGGCTGCACAGAGATCTCG	0.627																																					p.V687L		.											.	PTCH1	3532	0			c.G2059T	GRCh37	CI962340	PTCH1	I		.						128.0	121.0	123.0					9																	98231224		2203	4300	6503	SO:0001583	missense	5727	exon14			GCTGCACAGAGAT	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2059G>T	9.37:g.98231224C>A	ENSP00000332353:p.Val687Leu	Somatic	158.0	1.0		WXS	Illumina HiSeq	Phase_I	138.0	48.0	NM_000264	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279126	0.59758	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000375271	D;D;D;D;D;D;D;D	0.90732	-2.62;-2.6;-2.59;-2.59;-2.6;-2.59;-2.62;-2.72	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.84741	0.5539	N	0.19112	0.55	0.80722	D	1	B;B;B;B	0.21147	0.052;0.013;0.032;0.004	B;B;B;B	0.26969	0.075;0.039;0.03;0.016	T	0.79617	-0.1729	10	0.23302	T	0.38	-22.8166	18.1325	0.89606	0.0:1.0:0.0:0.0	.	536;621;686;687	Q13635-4;Q13635-3;Q13635-2;Q13635	.;.;.;PTC1_HUMAN	L	687;621;536;536;123;621;536;686;352	ENSP00000332353:V687L;ENSP00000389744:V621L;ENSP00000399981:V536L;ENSP00000396135:V536L;ENSP00000410287:V621L;ENSP00000414823:V536L;ENSP00000364423:V686L;ENSP00000364420:V352L	ENSP00000332353:V687L	V	-	1	0	PTCH1	97271045	1.000000	0.71417	0.966000	0.40874	0.941000	0.58515	7.195000	0.77798	2.505000	0.84491	0.557000	0.71058	GTG	.		0.627	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
RASGRP4	115727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38912649	38912649	+	Silent	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr19:38912649G>A	ENST00000587738.1	-	2	238	c.168C>T	c.(166-168)tgC>tgT	p.C56C	RASGRP4_ENST00000426920.2_Silent_p.C56C|RASGRP4_ENST00000586305.1_Silent_p.C56C|RASGRP4_ENST00000293062.9_Silent_p.C56C|RASGRP4_ENST00000454404.2_Silent_p.C56C|RASGRP4_ENST00000433821.2_Silent_p.C56C|RASGRP4_ENST00000587753.1_Silent_p.C56C			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	56	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CATCTTCGCTGCAGCCGCCCT	0.627																																					p.C56C		.											.	RASGRP4	660	0			c.C168T						.						34.0	39.0	37.0					19																	38912649		2057	4199	6256	SO:0001819	synonymous_variant	115727	exon2			TTCGCTGCAGCCG	AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.168C>T	19.37:g.38912649G>A		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	34.0	NM_001146206	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Silent	SNP	ENST00000587738.1	37	CCDS46068.1																																																																																			.		0.627	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460540.1	NM_170604	
RBP4	5950	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	95360550	95360550	+	Missense_Mutation	SNP	G	G	A	rs367834906		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr10:95360550G>A	ENST00000371467.1	-	3	441	c.122C>T	c.(121-123)aCc>aTc	p.T41I	RBP4_ENST00000371464.3_Missense_Mutation_p.T41I|FFAR4_ENST00000604414.1_Intron|RBP4_ENST00000371469.2_Missense_Mutation_p.T39I			P02753	RET4_HUMAN	retinol binding protein 4, plasma	41					cardiac muscle tissue development (GO:0048738)|detection of light stimulus involved in visual perception (GO:0050908)|embryonic organ morphogenesis (GO:0048562)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic skeletal system development (GO:0048706)|eye development (GO:0001654)|female genitalia morphogenesis (GO:0048807)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|lung development (GO:0030324)|maintenance of gastrointestinal epithelium (GO:0030277)|male gonad development (GO:0008584)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|phototransduction, visible light (GO:0007603)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of insulin secretion (GO:0032024)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to retinoic acid (GO:0032526)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|retinol transport (GO:0034633)|spermatogenesis (GO:0007283)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	retinal binding (GO:0016918)|retinol binding (GO:0019841)|retinol transporter activity (GO:0034632)			large_intestine(1)|lung(3)|skin(1)	5		Colorectal(252;0.122)			Vitamin A(DB00162)	GGCGTACCAGGTCCCAGAGAA	0.687																																					p.T41I	Pancreas(5;160 256 1117 46697 50185)	.											.	RBP4	90	0			c.C122T						.	G	ILE/THR	1,4405	2.1+/-5.4	0,1,2202	25.0	26.0	26.0		122	1.0	0.5	10		26	0,8598		0,0,4299	no	missense	RBP4	NM_006744.3	89	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign	41/202	95360550	1,13003	2203	4299	6502	SO:0001583	missense	5950	exon3			TACCAGGTCCCAG	BC020633	CCDS31249.1	10q23.33	2014-01-22	2001-11-28		ENSG00000138207	ENSG00000138207		"""Lipocalins"""	9922	protein-coding gene	gene with protein product		180250	"""retinol-binding protein 4, plasma"""				Standard	XM_005270023		Approved		uc001kit.3	P02753	OTTHUMG00000018773	ENST00000371467.1:c.122C>T	10.37:g.95360550G>A	ENSP00000360522:p.Thr41Ile	Somatic	311.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	32.0	NM_006744	D3DR38|O43478|O43479|Q5VY24|Q8WWA3|Q9P178	Missense_Mutation	SNP	ENST00000371467.1	37	CCDS31249.1	.	.	.	.	.	.	.	.	.	.	G	7.025	0.559526	0.13436	2.27E-4	0.0	ENSG00000138207	ENST00000371464;ENST00000371469;ENST00000371467;ENST00000371463	T;T	0.10763	2.84;2.84	5.25	1.05	0.20165	Lipocalin conserved site (1);Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.317296	0.37809	N	0.001921	T	0.08088	0.0202	L	0.45581	1.43	0.22710	N	0.998824	B	0.19073	0.033	B	0.23419	0.046	T	0.35773	-0.9775	10	0.19147	T	0.46	-6.019	4.4617	0.11669	0.3928:0.0:0.4625:0.1447	.	41	P02753	RET4_HUMAN	I	41;39;41;39	ENSP00000360519:T41I;ENSP00000360522:T41I	ENSP00000360518:T39I	T	-	2	0	RBP4	95350540	0.243000	0.23878	0.467000	0.27180	0.398000	0.30690	0.267000	0.18552	0.220000	0.20860	0.306000	0.20318	ACC	.		0.687	RBP4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049431.1	NM_006744	
RGS20	8601	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	54792096	54792096	+	Silent	SNP	G	G	A	rs35570213		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr8:54792096G>A	ENST00000297313.3	+	2	536	c.444G>A	c.(442-444)agG>agA	p.R148R	RGS20_ENST00000276500.4_5'Flank|RGS20_ENST00000522225.1_5'Flank|RGS20_ENST00000344277.6_Intron|RP11-1070A24.2_ENST00000606037.1_RNA	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	148					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			GTCCGCTGAGGCCCCCCCATC	0.736																																					p.R148R		.											.	RGS20	227	0			c.G444A						.						7.0	7.0	7.0					8																	54792096		1958	3860	5818	SO:0001819	synonymous_variant	8601	exon2			GCTGAGGCCCCCC	AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.444G>A	8.37:g.54792096G>A		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	81.0	NM_170587	Q96BG9	Silent	SNP	ENST00000297313.3	37	CCDS6155.1																																																																																			.		0.736	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1		
RP1	6101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	55540553	55540553	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr8:55540553G>C	ENST00000220676.1	+	4	4259	c.4111G>C	c.(4111-4113)Gat>Cat	p.D1371H		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1371					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CATTCAGAAAGATCTAAATAT	0.333																																					p.D1371H	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.G4111C						.						55.0	60.0	59.0					8																	55540553		2202	4300	6502	SO:0001583	missense	6101	exon4			CAGAAAGATCTAA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.4111G>C	8.37:g.55540553G>C	ENSP00000220676:p.Asp1371His	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	35.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.896347	0.52121	.	.	ENSG00000104237	ENST00000220676	T	0.26957	1.7	5.89	5.01	0.66863	.	0.588335	0.16177	N	0.226015	T	0.30417	0.0764	L	0.32530	0.975	0.09310	N	1	D	0.62365	0.991	P	0.52710	0.707	T	0.09707	-1.0662	10	0.87932	D	0	.	11.7279	0.51720	0.1338:0.0:0.8662:0.0	.	1371	P56715	RP1_HUMAN	H	1371	ENSP00000220676:D1371H	ENSP00000220676:D1371H	D	+	1	0	RP1	55703106	0.819000	0.29175	0.895000	0.35142	0.648000	0.38561	2.279000	0.43435	2.793000	0.96121	0.655000	0.94253	GAT	.		0.333	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
RSPO1	284654	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	38082337	38082337	+	Silent	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr1:38082337C>T	ENST00000401069.1	-	4	817	c.105G>A	c.(103-105)gaG>gaA	p.E35E	RSPO1_ENST00000401068.1_Silent_p.E35E|RSPO1_ENST00000401070.1_Silent_p.E35E|RSPO1_ENST00000373059.1_Silent_p.E8E|RSPO1_ENST00000401071.2_Silent_p.E35E|RSPO1_ENST00000356545.2_Silent_p.E35E	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	35					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCTGGCTCCCCTCGGCACTGA	0.557																																					p.E35E	GBM(122;680 2230 27822 42821)	.											.	RSPO1	22	0			c.G105A						.						57.0	59.0	58.0					1																	38082337		2033	4179	6212	SO:0001819	synonymous_variant	284654	exon4			GCTCCCCTCGGCA	AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.105G>A	1.37:g.38082337C>T		Somatic	268.0	2.0		WXS	Illumina HiSeq	Phase_I	199.0	80.0	NM_001242910	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Silent	SNP	ENST00000401069.1	37	CCDS41304.1																																																																																			.		0.557	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2	NM_173640	
RTKN2	219790	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	64022532	64022532	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr10:64022532C>T	ENST00000373789.3	-	2	205	c.109G>A	c.(109-111)Gga>Aga	p.G37R	RTKN2_ENST00000395260.3_Missense_Mutation_p.G37R|RTKN2_ENST00000395265.1_Missense_Mutation_p.G37R	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	37					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					TTCCATATTCCTTCTCGCATT	0.343																																					p.G37R		.											.	RTKN2	68	0			c.G109A						.						109.0	93.0	99.0					10																	64022532		2203	4300	6503	SO:0001583	missense	219790	exon2			ATATTCCTTCTCG	BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.109G>A	10.37:g.64022532C>T	ENSP00000362894:p.Gly37Arg	Somatic	78.0	1.0		WXS	Illumina HiSeq	Phase_I	44.0	21.0	NM_145307	Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Missense_Mutation	SNP	ENST00000373789.3	37	CCDS7263.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933435	0.92458	.	.	ENSG00000182010	ENST00000395265;ENST00000373789;ENST00000395260	T;T;T	0.80824	0.03;-0.14;-1.42	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.90542	0.7036	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.91059	0.4884	10	0.72032	D	0.01	7.3794	19.3863	0.94557	0.0:1.0:0.0:0.0	.	37;37	Q8IZC4-3;Q8IZC4	.;RTKN2_HUMAN	R	37	ENSP00000378682:G37R;ENSP00000362894:G37R;ENSP00000378678:G37R	ENSP00000362894:G37R	G	-	1	0	RTKN2	63692538	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.824000	0.75288	2.739000	0.93911	0.655000	0.94253	GGA	.		0.343	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091618.1	NM_145307	
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4153733	4153733	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr7:4153733G>A	ENST00000404826.2	+	25	3789	c.3650G>A	c.(3649-3651)cGc>cAc	p.R1217H	SDK1_ENST00000389531.3_Missense_Mutation_p.R1217H	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1217	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AAGTACTGGCGCTCAGACCTC	0.582																																					p.R1217H		.											.	SDK1	138	0			c.G3650A						.						70.0	68.0	69.0					7																	4153733		2203	4300	6503	SO:0001583	missense	221935	exon25			ACTGGCGCTCAGA	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3650G>A	7.37:g.4153733G>A	ENSP00000385899:p.Arg1217His	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	42.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586943	0.86851	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.56941	0.43;0.43	5.38	5.38	0.77491	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.158761	0.42682	D	0.000676	T	0.77322	0.4113	M	0.87269	2.87	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.73708	0.981;0.976	T	0.81369	-0.0964	10	0.72032	D	0.01	.	19.1613	0.93533	0.0:0.0:1.0:0.0	.	1217;1217	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	H	1217	ENSP00000385899:R1217H;ENSP00000374182:R1217H	ENSP00000374182:R1217H	R	+	2	0	SDK1	4120259	1.000000	0.71417	0.938000	0.37757	0.523000	0.34469	8.296000	0.89940	2.507000	0.84556	0.655000	0.94253	CGC	.		0.582	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SHPRH	257218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	146275926	146275926	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr6:146275926T>A	ENST00000367505.2	-	2	797	c.533A>T	c.(532-534)gAg>gTg	p.E178V	SHPRH_ENST00000438092.2_Missense_Mutation_p.E178V|SHPRH_ENST00000367503.3_Missense_Mutation_p.E178V|SHPRH_ENST00000275233.7_Missense_Mutation_p.E178V			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	178					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GAAGGATGACTCCACCAGAAT	0.363																																					p.E178V		.											.	SHPRH	92	0			c.A533T						.						119.0	111.0	113.0					6																	146275926		1836	4098	5934	SO:0001583	missense	257218	exon2			GATGACTCCACCA	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.533A>T	6.37:g.146275926T>A	ENSP00000356475:p.Glu178Val	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	26.0	NM_173082	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	T	21.7	4.190428	0.78789	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.66	5.66	0.87406	.	0.072072	0.53938	D	0.000045	T	0.75079	0.3801	M	0.61703	1.905	0.58432	D	0.999998	D;D;D;D	0.89917	0.989;0.996;0.998;1.0	P;P;P;D	0.91635	0.839;0.67;0.823;0.999	T	0.76900	-0.2788	10	0.51188	T	0.08	-14.8336	15.8839	0.79226	0.0:0.0:0.0:1.0	.	67;178;178;67	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	V	178;178;178;178;67	ENSP00000356475:E178V;ENSP00000356473:E178V;ENSP00000412797:E178V;ENSP00000275233:E178V	ENSP00000275233:E178V	E	-	2	0	SHPRH	146317619	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	3.635000	0.54309	2.158000	0.67659	0.533000	0.62120	GAG	.		0.363	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
SIAH1	6477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	48396330	48396330	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr16:48396330G>A	ENST00000380006.2	-	1	1463	c.10C>T	c.(10-12)Cag>Tag	p.Q4*	SIAH1_ENST00000356721.3_Nonsense_Mutation_p.Q35*|SIAH1_ENST00000394725.2_Nonsense_Mutation_p.Q4*|SIAH1_ENST00000573005.1_5'Flank			Q8IUQ4	SIAH1_HUMAN	siah E3 ubiquitin protein ligase 1	4					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell cycle (GO:0007049)|nervous system development (GO:0007399)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein catabolic process (GO:0030163)|protein destabilization (GO:0031648)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|stomach(1)	7		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				GTAGCAGTCTGACGGCTCATT	0.428																																					p.Q35X		.											.	SIAH1	415	0			c.C103T						.						61.0	58.0	59.0					16																	48396330		2200	4300	6500	SO:0001587	stop_gained	6477	exon2			CAGTCTGACGGCT	U76247	CCDS10735.1, CCDS32444.1	16q12.1	2013-06-03	2012-02-23		ENSG00000196470	ENSG00000196470			10857	protein-coding gene	gene with protein product		602212	"""seven in absentia homolog 1 (Drosophila)"""			9403064, 9334332	Standard	NM_001006610		Approved	hSIAH1	uc002efo.1	Q8IUQ4	OTTHUMG00000175417	ENST00000380006.2:c.10C>T	16.37:g.48396330G>A	ENSP00000369343:p.Gln4*	Somatic	237.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	71.0	NM_001006610	A0FKF3|O43269|Q49A58|Q92880	Nonsense_Mutation	SNP	ENST00000380006.2	37	CCDS10735.1	.	.	.	.	.	.	.	.	.	.	G	48	14.140680	0.99781	.	.	ENSG00000196470	ENST00000356721;ENST00000394725;ENST00000380006	.	.	.	5.43	5.43	0.79202	.	0.142052	0.48286	U	0.000183	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-0.6805	19.2389	0.93873	0.0:0.0:1.0:0.0	.	.	.	.	X	35;4;20	.	ENSP00000349156:Q35X	Q	-	1	0	SIAH1	46953831	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.714000	0.98744	2.555000	0.86185	0.655000	0.94253	CAG	.		0.428	SIAH1-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256842.12		
SNX8	29886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2294745	2294745	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr7:2294745G>C	ENST00000222990.3	-	11	1386	c.1344C>G	c.(1342-1344)caC>caG	p.H448Q		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	448					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		TCAGGGTGCTGTGTGGTCCCG	0.637																																					p.H448Q		.											.	SNX8	290	0			c.C1344G						.						66.0	52.0	57.0					7																	2294745		2185	4293	6478	SO:0001583	missense	29886	exon11			GGTGCTGTGTGGT	AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.1344C>G	7.37:g.2294745G>C	ENSP00000222990:p.His448Gln	Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	34.0	NM_013321	A4D207|Q96I67	Missense_Mutation	SNP	ENST00000222990.3	37	CCDS5331.1	.	.	.	.	.	.	.	.	.	.	G	8.955	0.969170	0.18659	.	.	ENSG00000106266	ENST00000222990	.	.	.	5.15	1.25	0.21368	.	0.397901	0.26258	N	0.025414	T	0.24392	0.0591	N	0.22421	0.69	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.16630	-1.0396	9	0.23302	T	0.38	.	8.9545	0.35809	0.3008:0.0:0.6992:0.0	.	448	Q9Y5X2	SNX8_HUMAN	Q	448	.	ENSP00000222990:H448Q	H	-	3	2	SNX8	2261271	0.025000	0.19082	0.000000	0.03702	0.146000	0.21551	1.663000	0.37429	0.198000	0.20407	-0.259000	0.10710	CAC	.		0.637	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322949.2		
SOX10	6663	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	38369604	38369604	+	Silent	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr22:38369604C>T	ENST00000396884.2	-	4	1581	c.1299G>A	c.(1297-1299)cgG>cgA	p.R433R	POLR2F_ENST00000405557.1_Intron|SOX10_ENST00000360880.2_Silent_p.R433R|POLR2F_ENST00000407936.1_Intron	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	433					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					TGTAGAGGGGCCGCTGCGAGG	0.637																																					p.R433R	Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)	.											.	SOX10	650	0			c.G1299A						.						23.0	28.0	27.0					22																	38369604		2192	4290	6482	SO:0001819	synonymous_variant	6663	exon4			GAGGGGCCGCTGC		CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.1299G>A	22.37:g.38369604C>T		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	14.0	NM_006941	B4DV62|Q6FHW7	Silent	SNP	ENST00000396884.2	37	CCDS13964.1																																																																																			.		0.637	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313875.1	NM_006941	
SPATA16	83893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	172643141	172643141	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr3:172643141A>T	ENST00000351008.3	-	7	1406	c.1223T>A	c.(1222-1224)tTc>tAc	p.F408Y		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	408					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TTTACCTGTGAATATCGGCAG	0.363																																					p.F408Y		.											.	SPATA16	94	0			c.T1223A						.						61.0	62.0	62.0					3																	172643141		2203	4299	6502	SO:0001583	missense	83893	exon7			CCTGTGAATATCG	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.1223T>A	3.37:g.172643141A>T	ENSP00000341765:p.Phe408Tyr	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	33.0	NM_031955	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	37	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	A	12.54	1.968609	0.34754	.	.	ENSG00000144962	ENST00000351008	T	0.16897	2.31	5.3	2.77	0.32553	.	0.175750	0.40728	N	0.001040	T	0.10852	0.0265	N	0.19112	0.55	0.23210	N	0.998114	B	0.15930	0.015	B	0.14578	0.011	T	0.22626	-1.0211	10	0.49607	T	0.09	-4.8638	9.5057	0.39044	0.7197:0.0:0.0:0.2803	.	408	Q9BXB7	SPT16_HUMAN	Y	408	ENSP00000341765:F408Y	ENSP00000341765:F408Y	F	-	2	0	SPATA16	174125835	1.000000	0.71417	0.946000	0.38457	0.328000	0.28507	3.020000	0.49643	0.331000	0.23511	0.460000	0.39030	TTC	.		0.363	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
SPTB	6710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	65252575	65252575	+	Missense_Mutation	SNP	T	T	C	rs368552247		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr14:65252575T>C	ENST00000389721.5	-	16	3688	c.3656A>G	c.(3655-3657)aAc>aGc	p.N1219S	SPTB_ENST00000542895.1_Missense_Mutation_p.N1219S|SPTB_ENST00000556626.1_Missense_Mutation_p.N1219S|SPTB_ENST00000389720.3_Missense_Mutation_p.N1219S|SPTB_ENST00000389722.3_Missense_Mutation_p.N1219S	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1219					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		ATCCCGGTTGTTCTCCATAGA	0.517																																					p.N1219S		.											.	SPTB	100	0			c.A3656G						.	T	SER/ASN,SER/ASN	1,4405	2.1+/-5.4	0,1,2202	192.0	196.0	195.0		3656,3656	3.7	1.0	14		195	0,8600		0,0,4300	no	missense,missense	SPTB	NM_000347.5,NM_001024858.2	46,46	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign,benign	1219/2138,1219/2329	65252575	1,13005	2203	4300	6503	SO:0001583	missense	6710	exon16			CGGTTGTTCTCCA		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3656A>G	14.37:g.65252575T>C	ENSP00000374371:p.Asn1219Ser	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	25.0	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	T	13.69	2.313233	0.40895	2.27E-4	0.0	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	4.94	3.7	0.42460	.	0.205937	0.43919	D	0.000501	T	0.26991	0.0661	N	0.11560	0.145	0.44515	D	0.997468	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08617	-1.0713	10	0.44086	T	0.13	.	9.7829	0.40660	0.0:0.0:0.3506:0.6494	.	1219;1223	P11277;Q59FP5	SPTB1_HUMAN;.	S	1223;1219;3;1219;1219;1219;1219	ENSP00000374372:N1219S;ENSP00000451752:N1219S;ENSP00000374371:N1219S;ENSP00000443882:N1219S;ENSP00000374370:N1219S	ENSP00000334218:N3S	N	-	2	0	SPTB	64322328	0.995000	0.38212	1.000000	0.80357	0.994000	0.84299	1.599000	0.36751	1.983000	0.57843	0.443000	0.29094	AAC	.		0.517	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
STAB2	55576	broad.mit.edu;mdanderson.org	37	12	104136328	104136328	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr12:104136328T>A	ENST00000388887.2	+	56	6231	c.6027T>A	c.(6025-6027)tgT>tgA	p.C2009*		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GGCCTGATTGTCTGCGTATGT	0.562																																					p.C2009X		.											.	STAB2	104	0			c.T6027A						.						192.0	172.0	179.0					12																	104136328		2203	4300	6503	SO:0001587	stop_gained	55576	exon56			TGATTGTCTGCGT	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.6027T>A	12.37:g.104136328T>A	ENSP00000373539:p.Cys2009*	Somatic	249.0	1.0		WXS	Illumina HiSeq	Phase_I	195.0	13.0	NM_017564		Nonsense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	T	45	11.592248	0.99580	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	.	.	.	4.9	-0.3	0.12804	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4376	0.44445	0.0:0.5506:0.0:0.4494	.	.	.	.	X	2009;696	.	ENSP00000258495:C696X	C	+	3	2	STAB2	102660458	0.927000	0.31430	0.963000	0.40424	0.075000	0.17131	-0.140000	0.10342	-0.048000	0.13401	0.460000	0.39030	TGT	.		0.562	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
STEAP4	79689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	87912273	87912273	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr7:87912273C>T	ENST00000380079.4	-	3	768	c.667G>A	c.(667-669)Gta>Ata	p.V223I	AC003991.3_ENST00000447758.1_RNA|STEAP4_ENST00000414498.1_Missense_Mutation_p.V223I|AC003991.3_ENST00000434733.1_RNA|AC003991.3_ENST00000595121.1_RNA|STEAP4_ENST00000301959.5_Intron|AC003991.3_ENST00000600908.1_RNA	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	223					copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					GGGTAGATTACGTCTCTTATA	0.378																																					p.V223I		.											.	STEAP4	90	0			c.G667A						.						90.0	86.0	87.0					7																	87912273		1884	4107	5991	SO:0001583	missense	79689	exon4			AGATTACGTCTCT	AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.667G>A	7.37:g.87912273C>T	ENSP00000369419:p.Val223Ile	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	63.0	NM_001205315	Q658Q9|Q687X4|Q8WWB0|Q9H5R1	Missense_Mutation	SNP	ENST00000380079.4	37	CCDS43611.1	.	.	.	.	.	.	.	.	.	.	C	1.263	-0.615247	0.03663	.	.	ENSG00000127954	ENST00000380079;ENST00000414498	T;T	0.11063	3.16;2.81	6.08	1.24	0.21308	.	0.325818	0.35838	N	0.002950	T	0.06554	0.0168	N	0.25144	0.715	0.28116	N	0.930817	B;B	0.24675	0.109;0.109	B;B	0.16722	0.016;0.01	T	0.33471	-0.9867	10	0.22706	T	0.39	-6.2203	10.7338	0.46113	0.0:0.5653:0.0:0.4347	.	223;223	C9JS50;Q687X5	.;STEA4_HUMAN	I	223	ENSP00000369419:V223I;ENSP00000394399:V223I	ENSP00000369419:V223I	V	-	1	0	STEAP4	87750209	0.005000	0.15991	0.056000	0.19401	0.073000	0.16967	0.196000	0.17176	0.167000	0.19631	0.591000	0.81541	GTA	.		0.378	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332712.4	NM_024636	
TMEM203	94107	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	140099480	140099491	+	In_Frame_Del	DEL	CATGAGCAGCTG	CATGAGCAGCTG	-	rs201112261|rs143273542		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	CATGAGCAGCTG	CATGAGCAGCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr9:140099480_140099491delCATGAGCAGCTG	ENST00000343666.5	-	1	599_610	c.376_387delCAGCTGCTCATG	c.(376-387)cagctgctcatgdel	p.QLLM126del	TMEM203_ENST00000537254.1_In_Frame_Del_p.QLLM126del|TPRN_ENST00000541945.1_5'Flank|NDOR1_ENST00000458322.2_5'Flank|NDOR1_ENST00000344894.5_5'Flank|NDOR1_ENST00000371521.4_5'Flank|NDOR1_ENST00000427047.2_5'Flank	NM_053045.1	NP_444273.1	Q969S6	TM203_HUMAN	transmembrane protein 203	126						integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(1)	2	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		AGGCGCGGATCATGAGCAGCTGCAGGAGAATG	0.599																																					p.126_129del		.											.	TMEM203	22	0			c.376_387del						.																																			SO:0001651	inframe_deletion	94107	exon1			GCGGATCATGAGC	BC009283	CCDS35185.1	9q34.3	2007-12-18			ENSG00000187713	ENSG00000187713			28217	protein-coding gene	gene with protein product	"""HBeAg-binding protein 1"""					12477932	Standard	NM_053045		Approved	MGC14327, HBEBP1	uc004clv.3	Q969S6	OTTHUMG00000020985	ENST00000343666.5:c.376_387delCAGCTGCTCATG	9.37:g.140099480_140099491delCATGAGCAGCTG	ENSP00000375053:p.Gln126_Met129del	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	16.0	NM_053045	Q6NW08	In_Frame_Del	DEL	ENST00000343666.5	37	CCDS35185.1																																																																																			.		0.599	TMEM203-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055325.2	NM_053045	
TMEM247	388946	hgsc.bcm.edu;bcgsc.ca	37	2	46707887	46707887	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr2:46707887A>C	ENST00000434431.1	+	2	461	c.461A>C	c.(460-462)gAg>gCg	p.E154A		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	154						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											CTGCAGCAAGAGGCGGCGCCC	0.687																																					p.E154A		.											.	.	.	0			c.A461C						.						16.0	20.0	19.0					2																	46707887		690	1590	2280	SO:0001583	missense	388946	exon2			AGCAAGAGGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.461A>C	2.37:g.46707887A>C	ENSP00000388684:p.Glu154Ala	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	9.0	NM_001145051		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	A	4.562	0.104456	0.08731	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.12	1.52	0.23074	.	.	.	.	.	T	0.25531	0.0621	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.18967	-1.0320	7	0.37606	T	0.19	.	8.7168	0.34416	0.6235:0.3765:0.0:0.0	.	154	A6NEH6	YB028_HUMAN	A	154	.	ENSP00000388684:E154A	E	+	2	0	AC018682.6	46561391	0.914000	0.31030	0.027000	0.17364	0.000000	0.00434	2.075000	0.41538	0.127000	0.18452	-0.461000	0.05368	GAG	.		0.687	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
TMPRSS11E	28983	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	69343131	69343131	+	Missense_Mutation	SNP	T	T	C	rs377258215		TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr4:69343131T>C	ENST00000305363.4	+	8	816	c.752T>C	c.(751-753)aTa>aCa	p.I251T		NM_014058.3	NP_054777.2	Q9UL52	TM11E_HUMAN	transmembrane protease, serine 11E	251	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cognition (GO:0050890)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|lung(19)|pancreas(1)|skin(3)	24						GGAGTAACAATAAAACCTTCG	0.373																																					p.I251T		.											.	TMPRSS11E	70	0			c.T752C						.	T	THR/ILE	0,4406		0,0,2203	143.0	156.0	152.0		752	5.4	0.0	4		152	1,8591	1.2+/-3.3	0,1,4295	no	missense	TMPRSS11E	NM_014058.3	89	0,1,6498	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging	251/424	69343131	1,12997	2203	4296	6499	SO:0001583	missense	28983	exon8			TAACAATAAAACC	AF064819	CCDS33993.1	4q13.2	2010-04-13			ENSG00000087128	ENSG00000087128		"""Serine peptidases / Transmembrane"""	24465	protein-coding gene	gene with protein product		610399	"""transmembrane protease, serine 11E2"""	TMPRSS11E2		15328353	Standard	NM_014058		Approved	DESC1	uc003hdz.4	Q9UL52	OTTHUMG00000160438	ENST00000305363.4:c.752T>C	4.37:g.69343131T>C	ENSP00000307519:p.Ile251Thr	Somatic	187.0	1.0		WXS	Illumina HiSeq	Phase_I	179.0	80.0	NM_014058	A6NL71|Q14DC8|Q6UW31	Missense_Mutation	SNP	ENST00000305363.4	37	CCDS33993.1	.	.	.	.	.	.	.	.	.	.	T	8.939	0.965246	0.18583	0.0	1.16E-4	ENSG00000087128	ENST00000305363	T	0.58652	0.32	5.38	5.38	0.77491	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.126700	0.06909	N	0.807259	T	0.37732	0.1014	N	0.05259	-0.085	0.09310	N	1	P	0.38300	0.626	B	0.33690	0.168	T	0.14980	-1.0453	10	0.20519	T	0.43	.	13.3423	0.60551	0.0:0.0:0.0:1.0	.	251	Q9UL52	TM11E_HUMAN	T	251	ENSP00000307519:I251T	ENSP00000307519:I251T	I	+	2	0	TMPRSS11E	69025726	0.686000	0.27661	0.011000	0.14972	0.034000	0.12701	2.924000	0.48876	2.035000	0.60131	0.477000	0.44152	ATA	.		0.373	TMPRSS11E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360584.1	NM_014058	
TSSC1	7260	broad.mit.edu;bcgsc.ca	37	2	3217959	3217959	+	Silent	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr2:3217959G>A	ENST00000382125.4	-	5	669	c.477C>T	c.(475-477)atC>atT	p.I159I	TSSC1_ENST00000478754.1_5'UTR|TSSC1_ENST00000443925.2_Silent_p.I159I|TSSC1_ENST00000398659.4_Silent_p.I186I	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	159										breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		CCCACAGCAGGATATGGTTAT	0.418																																					p.I159I	Colon(140;1261 1762 4183 34270 49743)	.											.	TSSC1	90	0			c.C477T						.						130.0	119.0	123.0					2																	3217959		2203	4300	6503	SO:0001819	synonymous_variant	7260	exon5			CAGCAGGATATGG	AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.477C>T	2.37:g.3217959G>A		Somatic	99.0	2.0		WXS	Illumina HiSeq	Phase_I	108.0	43.0	NM_003310	D6W4Y1|O43179|Q53S19|Q53SG2	Silent	SNP	ENST00000382125.4	37	CCDS1651.1																																																																																			.		0.418	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206694.2	NM_003310	
UBXN1	51035	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	62445539	62445539	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr11:62445539delT	ENST00000301935.5	-	5	508	c.342delA	c.(340-342)gaafs	p.E114fs	UBXN1_ENST00000294119.2_Frame_Shift_Del_p.E114fs|UBXN1_ENST00000529640.1_Frame_Shift_Del_p.E114fs|UBXN1_ENST00000524762.1_5'UTR|UBXN1_ENST00000533000.1_5'Flank			Q04323	UBXN1_HUMAN	UBX domain protein 1	114	Interaction with BRCA1.				negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|K6-linked polyubiquitin binding (GO:0071796)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|lung(12)	17						ATGCCTCCCGTTCCTCTCTTT	0.582																																					p.E114fs		.											.	UBXN1	90	0			c.342delA						.						100.0	80.0	87.0					11																	62445539		2202	4299	6501	SO:0001589	frameshift_variant	51035	exon5			CTCCCGTTCCTCT		CCDS8029.1, CCDS66105.1, CCDS73307.1	11q23	2014-02-12	2008-07-25		ENSG00000162191	ENSG00000162191		"""UBX domain containing"""	18402	protein-coding gene	gene with protein product	"""SAPK substrate protein 1"""					12838346, 20351172	Standard	NM_001286078		Approved	LOC51035, 2B28, UBXD10, SAKS1	uc001nuj.3	Q04323	OTTHUMG00000167580	ENST00000301935.5:c.342delA	11.37:g.62445539delT	ENSP00000303991:p.Glu114fs	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	28.0	NM_015853	Q9BV93|Q9BVV5	Frame_Shift_Del	DEL	ENST00000301935.5	37																																																																																				.		0.582	UBXN1-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000395153.1	NM_015853	
VSX2	338917	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	74706315	74706315	+	Silent	SNP	G	G	A			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr14:74706315G>A	ENST00000261980.2	+	1	141	c.51G>A	c.(49-51)gtG>gtA	p.V17V		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	17	Pro-rich.				cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		CCGAGACAGTGGCCAAGAGTA	0.662																																					p.V17V		.											.	VSX2	69	0			c.G51A						.						17.0	23.0	21.0					14																	74706315		1922	3665	5587	SO:0001819	synonymous_variant	338917	exon1			GACAGTGGCCAAG	AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.51G>A	14.37:g.74706315G>A		Somatic	101.0	1.0		WXS	Illumina HiSeq	Phase_I	76.0	8.0	NM_182894	A1A4X6	Silent	SNP	ENST00000261980.2	37	CCDS9827.1																																																																																			.		0.662	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412323.1	NM_182894	
YTHDC2	64848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	112926896	112926896	+	Silent	SNP	C	C	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr5:112926896C>T	ENST00000161863.4	+	27	4197	c.3984C>T	c.(3982-3984)agC>agT	p.S1328S		NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	1328	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GGGAAAGCAGCATAGTTTACT	0.403																																					p.S1328S		.											.	YTHDC2	92	0			c.C3984T						.						158.0	159.0	159.0					5																	112926896		2202	4300	6502	SO:0001819	synonymous_variant	64848	exon27			AAGCAGCATAGTT	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.3984C>T	5.37:g.112926896C>T		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	38.0	NM_022828	B2RP66	Silent	SNP	ENST00000161863.4	37	CCDS4113.1																																																																																			.		0.403	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
ZAN	7455	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100344318	100344318	+	RNA	SNP	A	A	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr7:100344318A>T	ENST00000348028.3	+	0	1089				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546292.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TTTATGCTTCAGTCTTGGGTT	0.557																																					.		.											.	ZAN	142	0			.						.						134.0	136.0	135.0					7																	100344318		1930	4143	6073			7455	.			TGCTTCAGTCTTG	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100344318A>T		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	73.0	.	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37																																																																																				.		0.557	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZNF226	7769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44676265	44676265	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NK-01A-11D-A28X-10	TCGA-DD-A4NK-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85d5f17f-7a02-4e34-aeb5-0a41708f9af4	fecea418-1023-458d-aac6-ce383901f30a	g.chr19:44676265G>T	ENST00000590089.1	+	5	407	c.40G>T	c.(40-42)Gct>Tct	p.A14S	ZNF226_ENST00000337433.5_Missense_Mutation_p.A14S|ZNF226_ENST00000588742.1_Missense_Mutation_p.A14S|ZNF226_ENST00000588883.1_Missense_Mutation_p.A14S|ZNF226_ENST00000454662.2_Missense_Mutation_p.A14S|ZNF226_ENST00000413984.2_Missense_Mutation_p.A14S|ZNF226_ENST00000588795.1_Missense_Mutation_p.A14S|ZNF226_ENST00000300823.6_Missense_Mutation_p.A14S|ZNF226_ENST00000589160.1_Missense_Mutation_p.A14S			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	14	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				CAAGGACGTGGCTGTGGCCTT	0.512																																					p.A14S	Pancreas(115;581 1665 13228 19278 50070)	.											.	.	.	0			c.G40T						.						165.0	164.0	165.0					19																	44676265		2203	4300	6503	SO:0001583	missense	7769	exon4			GACGTGGCTGTGG	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.40G>T	19.37:g.44676265G>T	ENSP00000465121:p.Ala14Ser	Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	52.0	NM_015919	Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	ENST00000590089.1	37	CCDS46102.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038600	0.75617	.	.	ENSG00000167380	ENST00000300823;ENST00000337433;ENST00000413984;ENST00000454662	T;T;T;T	0.03181	4.02;4.02;4.02;4.02	4.32	3.28	0.37604	Krueppel-associated box (4);	.	.	.	.	T	0.18087	0.0434	M	0.85197	2.74	0.28737	N	0.902177	D;D	0.76494	0.979;0.999	P;D	0.74674	0.822;0.984	T	0.01930	-1.1245	9	0.66056	D	0.02	.	9.9256	0.41489	0.1011:0.0:0.8989:0.0	.	14;14	Q9NYT6;Q8WWE6	ZN226_HUMAN;.	S	14	ENSP00000300823:A14S;ENSP00000336719:A14S;ENSP00000407474:A14S;ENSP00000393265:A14S	ENSP00000300823:A14S	A	+	1	0	ZNF226	49368105	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.797000	0.38804	1.177000	0.42855	0.650000	0.86243	GCT	.		0.512	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
