#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA4	24	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	94476865	94476865	+	Missense_Mutation	SNP	A	A	G	rs61750575		TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr1:94476865A>G	ENST00000370225.3	-	39	5623	c.5537T>C	c.(5536-5538)aTt>aCt	p.I1846T	ABCA4_ENST00000535881.1_5'UTR|ABCA4_ENST00000465352.1_5'Flank|ABCA4_ENST00000536513.1_Missense_Mutation_p.I116T	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1846			I -> T. {ECO:0000269|PubMed:11527935}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TGCAAGGTCAATGAGGCCCCG	0.597																																					p.I1846T		.											.	ABCA4	162	0			c.T5537C	GRCh37	CM990067	ABCA4	M	rs61750575	.						77.0	77.0	77.0					1																	94476865		2203	4300	6503	SO:0001583	missense	24	exon39			AGGTCAATGAGGC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.5537T>C	1.37:g.94476865A>G	ENSP00000359245:p.Ile1846Thr	Somatic	377.0	0.0		WXS	Illumina HiSeq	Phase_I	317.0	17.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	A	18.27	3.586442	0.66105	.	.	ENSG00000198691	ENST00000546054;ENST00000370225;ENST00000536513	D;D	0.87256	-2.23;-2.23	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	D	0.91195	0.7226	M	0.78637	2.42	0.80722	D	1	P;D	0.69078	0.566;0.997	B;D	0.65140	0.403;0.932	D	0.92581	0.6074	10	0.87932	D	0	.	14.5621	0.68148	1.0:0.0:0.0:0.0	rs61750575	116;1846	B4DWY6;P78363	.;ABCA4_HUMAN	T	638;1846;116	ENSP00000359245:I1846T;ENSP00000439707:I116T	ENSP00000359245:I1846T	I	-	2	0	ABCA4	94249453	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.099000	0.94207	2.074000	0.62210	0.477000	0.44152	ATT	.		0.597	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
ADAM21	8747	broad.mit.edu;ucsc.edu	37	14	70924853	70924853	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr14:70924853G>A	ENST00000603540.1	+	2	895	c.637G>A	c.(637-639)Gtt>Att	p.V213I	ADAM21_ENST00000267499.3_Missense_Mutation_p.V213I|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	213	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.|Poly-Val.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TCTGGAGCTAGTTGTTGTGGT	0.433																																					p.V213I		.											.	ADAM21	92	0			c.G637A						.						61.0	64.0	63.0					14																	70924853		2200	4295	6495	SO:0001583	missense	8747	exon2			GAGCTAGTTGTTG	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.637G>A	14.37:g.70924853G>A	ENSP00000474385:p.Val213Ile	Somatic	71.0	1.0		WXS	Illumina HiSeq	Phase_I	57.0	9.0	NM_003813	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	G	3.436	-0.115000	0.06881	.	.	ENSG00000139985	ENST00000267499	T	0.10005	2.92	3.86	0.734	0.18294	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.591407	0.13722	N	0.367335	T	0.11580	0.0282	L	0.55017	1.72	0.09310	N	1	B	0.32893	0.389	B	0.38921	0.285	T	0.26780	-1.0093	10	0.59425	D	0.04	.	3.802	0.08761	0.0909:0.1516:0.5752:0.1824	.	213	Q9UKJ8	ADA21_HUMAN	I	213	ENSP00000267499:V213I	ENSP00000267499:V213I	V	+	1	0	ADAM21	69994606	0.000000	0.05858	0.009000	0.14445	0.000000	0.00434	-0.027000	0.12371	0.030000	0.15379	-0.312000	0.09012	GTT	.		0.433	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
AMY2B	280	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	104120169	104120169	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr1:104120169A>G	ENST00000361355.4	+	10	1775	c.1159A>G	c.(1159-1161)Att>Gtt	p.I387V	AMY2B_ENST00000491397.1_Intron	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	387					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)	p.I387F(1)		breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		AGAAGTTACTATTAATCCAGA	0.353																																					p.I387V		.											.	AMY2B	90	1	Substitution - Missense(1)	lung(1)	c.A1159G						.						95.0	99.0	98.0					1																	104120169		2202	4297	6499	SO:0001583	missense	280	exon10			GTTACTATTAATC	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.1159A>G	1.37:g.104120169A>G	ENSP00000354610:p.Ile387Val	Somatic	515.0	2.0		WXS	Illumina HiSeq	Phase_I	386.0	137.0	NM_020978	B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	ENST00000361355.4	37	CCDS782.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.905330	0.52333	.	.	ENSG00000240038	ENST00000361355	.	.	.	4.82	4.82	0.62117	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.47488	0.1448	M	0.63843	1.955	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.55192	-0.8179	9	0.59425	D	0.04	.	14.3577	0.66748	1.0:0.0:0.0:0.0	.	387	P19961	AMY2B_HUMAN	V	387	.	ENSP00000354610:I387V	I	+	1	0	AMY2B	103921692	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.274000	0.78538	1.789000	0.52484	0.372000	0.22366	ATT	.		0.353	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030318.1	NM_020978	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41268766	41268766	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr3:41268766A>T	ENST00000349496.5	+	7	1284	c.1004A>T	c.(1003-1005)aAa>aTa	p.K335I	CTNNB1_ENST00000396185.3_Missense_Mutation_p.K335I|CTNNB1_ENST00000453024.1_Missense_Mutation_p.K328I|CTNNB1_ENST00000405570.1_Missense_Mutation_p.K335I|CTNNB1_ENST00000396183.3_Missense_Mutation_p.K335I	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	335					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.K335I(8)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACTTACGAAAAACTACTGTGG	0.383		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.K335I	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,Wilms_tumour,0	CTNNB1	24361	8	Substitution - Missense(8)	liver(7)|kidney(1)	c.A1004T						.						110.0	108.0	109.0					3																	41268766		2203	4300	6503	SO:0001583	missense	1499	exon7	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACGAAAAACTACT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1004A>T	3.37:g.41268766A>T	ENSP00000344456:p.Lys335Ile	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	19.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	29.8	5.040885	0.93685	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82148	0.4974	M	0.89287	3.02	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.75484	0.97;0.986	D	0.85830	0.1391	10	0.72032	D	0.01	-3.7939	15.5934	0.76558	1.0:0.0:0.0:0.0	.	263;335	B4DSW9;P35222	.;CTNB1_HUMAN	I	335;335;335;328;335	ENSP00000385604:K335I;ENSP00000379486:K335I;ENSP00000344456:K335I;ENSP00000411226:K328I;ENSP00000379488:K335I	ENSP00000344456:K335I	K	+	2	0	CTNNB1	41243770	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.339000	0.96797	2.094000	0.63399	0.482000	0.46254	AAA	.		0.383	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CHST2	9435	broad.mit.edu;bcgsc.ca	37	3	142840928	142840928	+	Missense_Mutation	SNP	C	C	T	rs539420111		TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr3:142840928C>T	ENST00000309575.3	+	2	2654	c.1270C>T	c.(1270-1272)Cgg>Tgg	p.R424W		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	424					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.R424R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						CCTGGTGGTGCGGTACGAGGA	0.592																																					p.R424W		.											.	CHST2	93	1	Substitution - coding silent(1)	breast(1)	c.C1270T						.						56.0	56.0	56.0					3																	142840928		2203	4300	6503	SO:0001583	missense	9435	exon2			GTGGTGCGGTACG	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1270C>T	3.37:g.142840928C>T	ENSP00000307911:p.Arg424Trp	Somatic	145.0	1.0		WXS	Illumina HiSeq	Phase_I	148.0	10.0	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354834	0.61293	.	.	ENSG00000175040	ENST00000309575	D	0.84070	-1.8	4.33	3.42	0.39159	Sulfotransferase domain (1);	0.000000	0.64402	D	0.000001	D	0.91841	0.7418	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92401	0.5929	10	0.87932	D	0	-15.3322	11.2518	0.49031	0.3442:0.6558:0.0:0.0	.	424	Q9Y4C5	CHST2_HUMAN	W	424	ENSP00000307911:R424W	ENSP00000307911:R424W	R	+	1	2	CHST2	144323618	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.686000	0.61700	0.964000	0.38108	0.407000	0.27541	CGG	.		0.592	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
DHX16	8449	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30624804	30624804	+	Silent	SNP	A	A	G			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr6:30624804A>G	ENST00000376442.3	-	13	2268	c.2073T>C	c.(2071-2073)gaT>gaC	p.D691D	DHX16_ENST00000480966.1_5'Flank|DHX16_ENST00000376437.5_Silent_p.D210D	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	691	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						AGAACCCTGGATCCAGCACAT	0.547																																					p.D691D		.											.	DHX16	228	0			c.T2073C						.						130.0	96.0	108.0					6																	30624804		1511	2709	4220	SO:0001819	synonymous_variant	8449	exon13			CCCTGGATCCAGC	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.2073T>C	6.37:g.30624804A>G		Somatic	135.0	1.0		WXS	Illumina HiSeq	Phase_I	111.0	37.0	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Silent	SNP	ENST00000376442.3	37	CCDS4685.1																																																																																			.		0.547	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
EPHB4	2050	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	100402889	100402889	+	Silent	SNP	A	A	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr7:100402889A>T	ENST00000358173.3	-	16	3201	c.2733T>A	c.(2731-2733)tcT>tcA	p.S911S	EPHB4_ENST00000360620.3_Intron	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	911	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					ACTCGCCCACAGAGCCAAAAG	0.597																																					p.S911S	GBM(200;2113 3072 25865 52728)	.											.	EPHB4	1446	0			c.T2733A						.						32.0	31.0	31.0					7																	100402889		2203	4300	6503	SO:0001819	synonymous_variant	2050	exon16			GCCCACAGAGCCA	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2733T>A	7.37:g.100402889A>T		Somatic	222.0	1.0		WXS	Illumina HiSeq	Phase_I	193.0	13.0	NM_004444	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	37	CCDS5706.1																																																																																			.		0.597	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
FAM129C	199786	hgsc.bcm.edu;bcgsc.ca	37	19	17664297	17664297	+	Silent	SNP	A	A	G	rs199532721		TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr19:17664297A>G	ENST00000335393.4	+	16	2157	c.2019A>G	c.(2017-2019)gcA>gcG	p.A673A	FAM129C_ENST00000601861.1_Silent_p.A642A|FAM129C_ENST00000449408.2_Silent_p.A399A|COLGALT1_ENST00000252599.4_5'Flank	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	673										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						TTCAGCTTGCAGAGGGACTTT	0.512																																					p.A673A		.											.	FAM129C	90	0			c.A2019G						.						187.0	162.0	171.0					19																	17664297		2203	4300	6503	SO:0001819	synonymous_variant	199786	exon16			GCTTGCAGAGGGA	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.2019A>G	19.37:g.17664297A>G		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	5.0	NM_173544	B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Silent	SNP	ENST00000335393.4	37	CCDS12362.1																																																																																			A|1.000;C|0.000		0.512	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544	
HOXB1	3211	hgsc.bcm.edu;ucsc.edu	37	17	46608203	46608203	+	Missense_Mutation	SNP	A	A	G	rs12950537	byFrequency	TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr17:46608203A>G	ENST00000239174.6	-	1	156	c.64T>C	c.(64-66)Tac>Cac	p.Y22H	HOXB1_ENST00000577092.1_Missense_Mutation_p.Y22H	NM_002144.3	NP_002135.2	P14653	HXB1_HUMAN	homeobox B1	22					anatomical structure formation involved in morphogenesis (GO:0048646)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|multicellular organismal development (GO:0007275)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGGGCGCTGTAGGCGCTGGGT	0.637																																					p.Y22H		.											.	HOXB1	515	0			c.T64C						.						62.0	72.0	69.0					17																	46608203		2203	4300	6503	SO:0001583	missense	3211	exon1			CGCTGTAGGCGCT		CCDS32675.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120094	ENSG00000120094		"""Homeoboxes / ANTP class : HOXL subclass"""	5111	protein-coding gene	gene with protein product		142968	"""homeo box B1"""	HOX2, HOX2I		1973146, 1358459	Standard	NM_002144		Approved		uc002ink.1	P14653	OTTHUMG00000159929	ENST00000239174.6:c.64T>C	17.37:g.46608203A>G	ENSP00000355140:p.Tyr22His	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	13.0	NM_002144	Q4VB03	Missense_Mutation	SNP	ENST00000239174.6	37	CCDS32675.1	.	.	.	.	.	.	.	.	.	.	A	13.23	2.175400	0.38413	.	.	ENSG00000120094	ENST00000239174	D	0.89552	-2.53	5.7	3.46	0.39613	.	0.000000	0.41194	D	0.000931	D	0.85353	0.5677	L	0.57536	1.79	0.49389	D	0.999788	B	0.19200	0.034	B	0.17433	0.018	T	0.81389	-0.0955	10	0.52906	T	0.07	.	9.5897	0.39539	0.8551:0.0:0.1449:0.0	rs12950537	22	P14653	HXB1_HUMAN	H	22	ENSP00000355140:Y22H	ENSP00000355140:Y22H	Y	-	1	0	HOXB1	43963202	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.591000	0.53986	0.955000	0.37878	0.450000	0.29827	TAC	A|0.965;G|0.035		0.637	HOXB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358383.3		
HSD17B3	3293	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	99007649	99007649	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr9:99007649T>C	ENST00000375263.3	-	8	631	c.584A>G	c.(583-585)tAc>tGc	p.Y195C	HSD17B3_ENST00000375262.2_Missense_Mutation_p.Y195C|RP11-240L7.4_ENST00000448857.1_RNA|HSD17B3_ENST00000464104.1_5'UTR	NM_000197.1	NP_000188.1	P37058	DHB3_HUMAN	hydroxysteroid (17-beta) dehydrogenase 3	195					androgen biosynthetic process (GO:0006702)|male genitalia development (GO:0030539)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			breast(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)				GTACATGGAGTAGAGAGGCCA	0.463																																					p.Y195C		.											.	HSD17B3	90	0			c.A584G						.						151.0	139.0	143.0					9																	99007649		2203	4300	6503	SO:0001583	missense	3293	exon8			ATGGAGTAGAGAG		CCDS6716.1	9q22	2011-09-20			ENSG00000130948	ENSG00000130948	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5212	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 2"""	605573				8075637, 19027726	Standard	NM_000197		Approved	SDR12C2	uc004awa.1	P37058	OTTHUMG00000020292	ENST00000375263.3:c.584A>G	9.37:g.99007649T>C	ENSP00000364412:p.Tyr195Cys	Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	6.0	NM_000197	Q5U0Q6	Missense_Mutation	SNP	ENST00000375263.3	37	CCDS6716.1	.	.	.	.	.	.	.	.	.	.	T	14.79	2.640933	0.47153	.	.	ENSG00000130948	ENST00000375263;ENST00000375262	D;D	0.87571	-2.27;-2.27	5.01	3.84	0.44239	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.057949	0.64402	D	0.000001	D	0.87010	0.6071	N	0.24115	0.695	0.21473	N	0.999671	P;D	0.71674	0.946;0.998	P;D	0.68192	0.886;0.956	T	0.79050	-0.1962	10	0.66056	D	0.02	-14.3891	10.4102	0.44289	0.1467:0.0:0.0:0.8533	.	195;195	Q5U0Q6;P37058	.;DHB3_HUMAN	C	195	ENSP00000364412:Y195C;ENSP00000364411:Y195C	ENSP00000364411:Y195C	Y	-	2	0	HSD17B3	98047470	0.807000	0.29009	0.007000	0.13788	0.937000	0.57800	1.906000	0.39887	1.009000	0.39289	0.533000	0.62120	TAC	.		0.463	HSD17B3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053259.1	NM_000197	
IL1R1	3554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	102792895	102792895	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr2:102792895C>G	ENST00000410023.1	+	12	1704	c.1386C>G	c.(1384-1386)agC>agG	p.S462R	IL1R1_ENST00000424272.1_3'UTR|IL1R1_ENST00000409589.1_Intron|IL1R1_ENST00000233946.3_Missense_Mutation_p.S462R|AC007271.3_ENST00000428188.1_RNA|IL1R1_ENST00000409929.1_Missense_Mutation_p.S431R			P14778	IL1R1_HUMAN	interleukin 1 receptor, type I	462	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|interleukin-1-mediated signaling pathway (GO:0070498)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)|platelet-derived growth factor receptor binding (GO:0005161)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(2)|skin(3)	19					Anakinra(DB00026)	CAGGCTTCAGCTGGCTGGGTG	0.398																																					p.S462R		.											.	IL1R1	523	0			c.C1386G						.						64.0	63.0	63.0					2																	102792895		2203	4300	6503	SO:0001583	missense	3554	exon11			CTTCAGCTGGCTG	M27492	CCDS2055.1, CCDS74547.1	2q12	2013-01-29			ENSG00000115594	ENSG00000115594		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5993	protein-coding gene	gene with protein product		147810		IL1R, IL1RA		1833184, 10191101	Standard	XM_005263929		Approved	D2S1473, CD121A	uc002tbr.3	P14778	OTTHUMG00000130783	ENST00000410023.1:c.1386C>G	2.37:g.102792895C>G	ENSP00000386380:p.Ser462Arg	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	28.0	NM_000877	Q587I7	Missense_Mutation	SNP	ENST00000410023.1	37	CCDS2055.1	.	.	.	.	.	.	.	.	.	.	C	2.225	-0.377546	0.05000	.	.	ENSG00000115594	ENST00000409929;ENST00000410023;ENST00000233946	T;T;T	0.08193	3.12;3.12;3.12	5.61	1.51	0.23008	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.858674	0.11190	N	0.589973	T	0.04407	0.0121	N	0.14661	0.345	0.09310	N	1	B;B	0.17038	0.02;0.009	B;B	0.23716	0.048;0.02	T	0.47235	-0.9133	10	0.16896	T	0.51	.	4.4235	0.11492	0.1098:0.5981:0.1069:0.1852	.	431;462	B8ZZW4;P14778	.;IL1R1_HUMAN	R	431;462;462	ENSP00000386776:S431R;ENSP00000386380:S462R;ENSP00000233946:S462R	ENSP00000233946:S462R	S	+	3	2	IL1R1	102159327	0.000000	0.05858	0.007000	0.13788	0.086000	0.17979	0.157000	0.16402	0.730000	0.32425	-0.244000	0.11960	AGC	.		0.398	IL1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253299.1		
IL6ST	3572	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	55260056	55260067	+	In_Frame_Del	DEL	GACAAAATACAC	GACAAAATACAC	-			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	GACAAAATACAC	GACAAAATACAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr5:55260056_55260067delGACAAAATACAC	ENST00000381298.2	-	6	877_888	c.565_576delGTGTATTTTGTC	c.(565-576)gtgtattttgtcdel	p.VYFV189del	IL6ST_ENST00000381287.4_In_Frame_Del_p.VYFV189del|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000577363.1_5'UTR|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000381294.3_In_Frame_Del_p.VYFV189del|IL6ST_ENST00000336909.5_In_Frame_Del_p.VYFV189del|IL6ST_ENST00000396816.1_In_Frame_Del_p.CILS47del|IL6ST_ENST00000522633.2_In_Frame_Del_p.VYFV189del|IL6ST_ENST00000502326.3_In_Frame_Del_p.VYFV189del|IL6ST_ENST00000536319.1_In_Frame_Del_p.VYFV189del	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	189	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)	p.Y186_Y190delYSTVY(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				CTTCAATGTTGACAAAATACACAGTAGAATAA	0.373			O		hepatocellular ca																																p.189_192del		.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	290	1	Deletion - In frame(1)	liver(1)	c.565_576del						.																																			SO:0001651	inframe_deletion	3572	exon6			AATGTTGACAAAA	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.565_576delGTGTATTTTGTC	5.37:g.55260056_55260067delGACAAAATACAC	ENSP00000370698:p.Val189_Val192del	Somatic	211.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	13.0	NM_175767	A0N0L4|Q5FC04|Q9UQ41	In_Frame_Del	DEL	ENST00000381298.2	37	CCDS3971.1																																																																																			.		0.373	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
JAKMIP1	152789	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	6083468	6083468	+	Silent	SNP	T	T	C			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr4:6083468T>C	ENST00000282924.5	-	6	1454	c.969A>G	c.(967-969)cgA>cgG	p.R323R	JAKMIP1_ENST00000409831.1_Silent_p.R323R|JAKMIP1_ENST00000409021.3_Silent_p.R323R|JAKMIP1_ENST00000409371.3_Silent_p.R158R|JAKMIP1_ENST00000410077.2_Silent_p.R158R|JAKMIP1_ENST00000457227.2_5'UTR	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	323	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCTCGGTCTCTCGTGAGCGTT	0.537																																					p.R323R		.											.	JAKMIP1	292	0			c.A969G						.						96.0	94.0	95.0					4																	6083468		2203	4300	6503	SO:0001819	synonymous_variant	152789	exon6			GGTCTCTCGTGAG	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.969A>G	4.37:g.6083468T>C		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	5.0	NM_001099433	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Silent	SNP	ENST00000282924.5	37	CCDS3385.1																																																																																			.		0.537	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
KCTD8	386617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	44176930	44176930	+	Silent	SNP	C	C	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr4:44176930C>T	ENST00000360029.3	-	2	1582	c.1299G>A	c.(1297-1299)aaG>aaA	p.K433K		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	433					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						CCACACTTAGCTTCTCACAGA	0.418										HNSCC(17;0.042)																											p.K433K		.											.	KCTD8	92	0			c.G1299A						.						188.0	197.0	194.0					4																	44176930		2203	4300	6503	SO:0001819	synonymous_variant	386617	exon2			ACTTAGCTTCTCA	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1299G>A	4.37:g.44176930C>T		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	6.0	NM_198353	A2RU39	Silent	SNP	ENST00000360029.3	37	CCDS3467.1																																																																																			.		0.418	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
KIF1A	547	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	241697828	241697828	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr2:241697828G>T	ENST00000320389.7	-	25	2662	c.2504C>A	c.(2503-2505)aCc>aAc	p.T835N	KIF1A_ENST00000498729.2_Missense_Mutation_p.T844N	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	835					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GTCTCCGCCGGTCACCACGTT	0.637																																					p.T844N		.											.	KIF1A	91	0			c.C2531A						.						61.0	71.0	68.0					2																	241697828		2162	4260	6422	SO:0001583	missense	547	exon26			CCGCCGGTCACCA	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2504C>A	2.37:g.241697828G>T	ENSP00000322791:p.Thr835Asn	Somatic	262.0	0.0		WXS	Illumina HiSeq	Phase_I	206.0	15.0	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064681	0.76187	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.76060	-0.99;-0.99;-0.99	5.28	5.28	0.74379	.	0.059531	0.64402	U	0.000003	T	0.75613	0.3873	L	0.59436	1.845	0.80722	D	1	B;P;B	0.48764	0.182;0.915;0.07	B;P;B	0.45232	0.127;0.474;0.056	T	0.77281	-0.2646	10	0.45353	T	0.12	.	18.4813	0.90812	0.0:0.0:1.0:0.0	.	844;844;835	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	N	835;844;844;844	ENSP00000322791:T835N;ENSP00000438388:T844N;ENSP00000384231:T844N	ENSP00000322791:T835N	T	-	2	0	KIF1A	241346501	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	9.545000	0.98095	2.473000	0.83533	0.591000	0.81541	ACC	.		0.637	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
KLRK1	22914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	10541390	10541390	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr12:10541390C>T	ENST00000240618.6	-	2	160	c.20G>A	c.(19-21)cGg>cAg	p.R7Q	KLRK1_ENST00000540818.1_Missense_Mutation_p.R7Q|RP11-277P12.20_ENST00000500682.1_RNA|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	7					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TCGAGACCTCCGACCACGAAT	0.373																																					p.R7Q		.											.	.	.	0			c.G20A						.						103.0	94.0	97.0					12																	10541390		2203	4300	6503	SO:0001583	missense	0	exon7			GACCTCCGACCAC	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.20G>A	12.37:g.10541390C>T	ENSP00000240618:p.Arg7Gln	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	10.0	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	37	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761786	0.49468	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.01933	4.55;4.55	3.62	0.78	0.18556	.	0.444127	0.16886	N	0.195506	T	0.03263	0.0095	L	0.46157	1.445	0.09310	N	1	P;D	0.69078	0.454;0.997	B;P	0.50825	0.049;0.651	T	0.44329	-0.9335	10	0.33940	T	0.23	.	4.028	0.09697	0.0:0.5853:0.1952:0.2194	.	7;7	Q8WZ67;P26718	.;NKG2D_HUMAN	Q	7	ENSP00000240618:R7Q;ENSP00000446003:R7Q	ENSP00000240618:R7Q	R	-	2	0	KLRK1	10432657	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.393000	0.07305	0.164000	0.19529	-0.837000	0.03062	CGG	.		0.373	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
LDOC1L	84247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	44892793	44892793	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr22:44892793C>A	ENST00000341255.3	-	2	1153	c.644G>T	c.(643-645)gGg>gTg	p.G215V		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	215										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		TGGGCAAGGCCCCGTGCCCGC	0.637																																					p.G215V		.											.	LDOC1L	69	0			c.G644T						.						36.0	40.0	39.0					22																	44892793		2203	4300	6503	SO:0001583	missense	84247	exon2			CAAGGCCCCGTGC	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.644G>T	22.37:g.44892793C>A	ENSP00000340434:p.Gly215Val	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	14.0	NM_032287	Q6ZTR1	Missense_Mutation	SNP	ENST00000341255.3	37	CCDS33662.1	.	.	.	.	.	.	.	.	.	.	C	15.21	2.766037	0.49574	.	.	ENSG00000188636	ENST00000341255	T	0.18338	2.22	3.18	-0.452	0.12205	.	0.486110	0.16542	N	0.209910	T	0.06690	0.0171	N	0.08118	0	0.30495	N	0.771008	P	0.35077	0.483	B	0.29267	0.1	T	0.18524	-1.0334	10	0.72032	D	0.01	-5.4003	6.5729	0.22549	0.1869:0.3686:0.4446:0.0	.	215	Q6ICC9	LDOCL_HUMAN	V	215	ENSP00000340434:G215V	ENSP00000340434:G215V	G	-	2	0	LDOC1L	43271457	0.221000	0.23642	0.244000	0.24202	0.879000	0.50718	0.591000	0.23969	0.011000	0.14865	0.555000	0.69702	GGG	.		0.637	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	
KMT2C	58508	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	151927100	151927100	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr7:151927100C>A	ENST00000262189.6	-	18	3102	c.2884G>T	c.(2884-2886)Gtt>Ttt	p.V962F	KMT2C_ENST00000355193.2_Missense_Mutation_p.V962F	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	962					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CTGCCACAAACTACACACATA	0.343																																					p.V962F		.											.	MLL3	1398	0			c.G2884T						.						62.0	51.0	55.0					7																	151927100		2200	4278	6478	SO:0001583	missense	58508	exon18			CACAAACTACACA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2884G>T	7.37:g.151927100C>A	ENSP00000262189:p.Val962Phe	Somatic	1363.0	0.0		WXS	Illumina HiSeq	Phase_I	1095.0	50.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.19|19.19	3.779270|3.779270	0.70107|0.70107	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000418673|ENST00000262189;ENST00000355193	.|D;D	.|0.89270	.|-2.49;-2.49	4.67|4.67	4.67|4.67	0.58626|0.58626	.|Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	.|0.000000	.|0.37095	.|U	.|0.002259	D|D	0.93324|0.93324	0.7872|0.7872	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.94174|0.94174	0.7426|0.7426	5|10	.|0.87932	.|D	.|0	.|.	17.9348|17.9348	0.89009|0.89009	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|962;23	.|Q8NEZ4;Q8NEZ4-2	.|MLL3_HUMAN;.	I|F	117|962	.|ENSP00000262189:V962F;ENSP00000347325:V962F	.|ENSP00000262189:V962F	S|V	-|-	2|1	0|0	MLL3|MLL3	151558033|151558033	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.980000|0.980000	0.70556|0.70556	7.770000|7.770000	0.85390|0.85390	2.303000|2.303000	0.77524|0.77524	0.460000|0.460000	0.39030|0.39030	AGT|GTT	.		0.343	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MMS22L	253714	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	97711252	97711252	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr6:97711252T>C	ENST00000275053.4	-	9	1166	c.901A>G	c.(901-903)Att>Gtt	p.I301V	MMS22L_ENST00000369251.2_Missense_Mutation_p.I301V|MMS22L_ENST00000506256.1_5'UTR	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	301					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						AGAAGATGAATAAGTAGAACC	0.313																																					p.I301V		.											.	MMS22L	92	0			c.A901G						.						141.0	145.0	144.0					6																	97711252		2203	4295	6498	SO:0001583	missense	253714	exon9			GATGAATAAGTAG		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.901A>G	6.37:g.97711252T>C	ENSP00000275053:p.Ile301Val	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	6.0	NM_198468	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562964	0.45694	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.34275	1.37;1.37	5.66	5.66	0.87406	.	0.110324	0.64402	D	0.000012	T	0.22551	0.0544	L	0.60455	1.87	0.39667	D	0.970695	P;B	0.37731	0.607;0.42	B;B	0.36418	0.224;0.143	T	0.11446	-1.0587	10	0.54805	T	0.06	-4.5534	11.8369	0.52330	0.0:0.0:0.1461:0.8539	.	301;301	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	V	301	ENSP00000275053:I301V;ENSP00000358254:I301V	ENSP00000275053:I301V	I	-	1	0	MMS22L	97817973	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	3.821000	0.55700	2.154000	0.67381	0.402000	0.26972	ATT	.		0.313	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	
MZF1	7593	hgsc.bcm.edu;broad.mit.edu	37	19	59074590	59074612	+	Frame_Shift_Del	DEL	CCCCGCCCCCAGTGCTGGGGCGG	CCCCGCCCCCAGTGCTGGGGCGG	-	rs545452499|rs200541260|rs146251309|rs375810541		TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	CCCCGCCCCCAGTGCTGGGGCGG	CCCCGCCCCCAGTGCTGGGGCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr19:59074590_59074612delCCCCGCCCCCAGTGCTGGGGCGG	ENST00000215057.2	-	6	1592_1614	c.1032_1054delCCGCCCCAGCACTGGGGGCGGGG	c.(1030-1056)ggccgccccagcactgggggcggggtgfs	p.RPSTGGGV345fs	MZF1_ENST00000594234.1_Frame_Shift_Del_p.AAPALGAG263fs|MZF1_ENST00000599369.1_Frame_Shift_Del_p.RPSTGGGV345fs|AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000600534.1_RNA	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	345					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		CCCCTAACCACCCCGCCCCCAGTGCTGGGGCGGCCCCGGCTCC	0.682																																					p.344_352del		.											.	MZF1	91	0			c.1032_1054del						.																																			SO:0001589	frameshift_variant	7593	exon6			TAACCACCCCGCC	M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.1032_1054delCCGCCCCAGCACTGGGGGCGGGG	19.37:g.59074590_59074612delCCCCGCCCCCAGTGCTGGGGCGG	ENSP00000215057:p.Arg345fs	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	10.0	NM_198055	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Frame_Shift_Del	DEL	ENST00000215057.2	37	CCDS12988.1																																																																																			.		0.682	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467112.1	NM_198055	
NKAIN1	79570	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	31654558	31654558	+	Splice_Site	SNP	A	A	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr1:31654558A>T	ENST00000373736.2	-	7	622	c.616T>A	c.(616-618)Tcg>Acg	p.S206T	NKAIN1_ENST00000528449.1_5'Flank|NKAIN1_ENST00000263693.1_Splice_Site_p.S162T|NKAIN1_ENST00000398657.2_Splice_Site_p.S135T	NM_024522.2	NP_078798.2	Q4KMZ8	NKAI1_HUMAN	Na+/K+ transporting ATPase interacting 1	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|ovary(1)|prostate(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|Breast(348;0.141)|all_neural(195;0.146)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0184)|READ - Rectum adenocarcinoma(331;0.148)		GGCTACCCCGACCTGCGGGAA	0.701																																					p.S206T		.											.	NKAIN1	91	0			c.T616A						.						17.0	23.0	21.0					1																	31654558		2016	3954	5970	SO:0001630	splice_region_variant	79570	exon7			ACCCCGACCTGCG	AK022712	CCDS339.1, CCDS339.2	1p35.2	2010-06-25	2007-10-04	2007-10-04	ENSG00000084628	ENSG00000084628		"""Na+/K+ transporting ATPase interacting"""	25743	protein-coding gene	gene with protein product		612871	"""family with sequence similarity 77, member C"""	FAM77C		17606467	Standard	NM_024522		Approved	FLJ12650	uc010ogd.2	Q4KMZ8	OTTHUMG00000003788	ENST00000373736.2:c.615-1T>A	1.37:g.31654558A>T		Somatic	274.0	0.0		WXS	Illumina HiSeq	Phase_I	291.0	82.0	NM_024522	A2VDJ3|B7Z5F5|B7Z5W9|Q9H9M7	Missense_Mutation	SNP	ENST00000373736.2	37	CCDS339.2	.	.	.	.	.	.	.	.	.	.	A	10.65	1.408859	0.25378	.	.	ENSG00000084628	ENST00000373736;ENST00000263693;ENST00000398657	T;T;T	0.15952	2.38;2.38;2.38	4.29	3.14	0.36123	.	0.277557	0.29995	N	0.010670	T	0.05777	0.0151	N	0.02011	-0.69	0.39686	D	0.970977	B;B	0.15473	0.013;0.0	B;B	0.22880	0.042;0.003	T	0.29181	-1.0020	10	0.14252	T	0.57	-27.1254	8.0726	0.30697	0.7949:0.2051:0.0:0.0	.	206;135	Q4KMZ8;B7Z5F5	NKAI1_HUMAN;.	T	206;162;135	ENSP00000362841:S206T;ENSP00000263693:S162T;ENSP00000381650:S135T	ENSP00000263693:S162T	S	-	1	0	NKAIN1	31427145	1.000000	0.71417	0.997000	0.53966	0.237000	0.25408	1.852000	0.39348	0.774000	0.33427	0.459000	0.35465	TCG	.		0.701	NKAIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010655.2	NM_024522	Missense_Mutation
PDZD2	23037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	32074424	32074424	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr5:32074424G>T	ENST00000438447.1	+	18	3600	c.3212G>T	c.(3211-3213)gGa>gTa	p.G1071V	PDZD2_ENST00000282493.3_Missense_Mutation_p.G1071V			O15018	PDZD2_HUMAN	PDZ domain containing 2	1071					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGGAGCCCTGGAAGCTGGTGG	0.577																																					p.G1071V		.											.	PDZD2	563	0			c.G3212T						.						112.0	130.0	124.0					5																	32074424		2203	4300	6503	SO:0001583	missense	23037	exon17			GCCCTGGAAGCTG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3212G>T	5.37:g.32074424G>T	ENSP00000402033:p.Gly1071Val	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	14.0	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.852549	0.51270	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.06687	3.27;3.27	5.67	2.79	0.32731	.	0.433620	0.19808	N	0.105600	T	0.09423	0.0232	L	0.57536	1.79	0.20196	N	0.99993	P;B	0.42785	0.79;0.451	B;B	0.36719	0.231;0.086	T	0.10870	-1.0611	10	0.62326	D	0.03	.	10.6122	0.45429	0.0:0.2679:0.5935:0.1386	.	897;1071	B4E3P2;O15018	.;PDZD2_HUMAN	V	1071;873;1071	ENSP00000402033:G1071V;ENSP00000282493:G1071V	ENSP00000282493:G1071V	G	+	2	0	PDZD2	32110181	0.042000	0.20092	0.001000	0.08648	0.007000	0.05969	2.314000	0.43743	0.273000	0.22049	0.563000	0.77884	GGA	.		0.577	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
CTC-497E21.3	0	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	11	13032525	13032525	+	lincRNA	SNP	G	G	A			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr11:13032525G>A	ENST00000533002.1	-	0	0																											CGACATGTGGGTGGACCAGGC	0.632																																					p.V468M		.											.	.	.	0			c.G1402A						.						32.0	33.0	33.0					11																	13032525		1939	4131	6070			644943	exon1			ATGTGGGTGGACC																													11.37:g.13032525G>A		Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	240.0	69.0	NM_001080521		Missense_Mutation	SNP	ENST00000533002.1	37																																																																																				.		0.632	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
RBM20	282996	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	112541163	112541163	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr10:112541163C>A	ENST00000369519.3	+	2	854	c.796C>A	c.(796-798)Cac>Aac	p.H266N		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	266					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CTATGAAGGGCACTACAGCCA	0.557																																					p.H266N		.											.	.	.	0			c.C796A						.						45.0	46.0	46.0					10																	112541163		692	1591	2283	SO:0001583	missense	282996	exon2			GAAGGGCACTACA	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.796C>A	10.37:g.112541163C>A	ENSP00000358532:p.His266Asn	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	8.0	NM_001134363	A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	37	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.886105	0.33348	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	D	0.90069	-2.61	5.31	5.31	0.75309	.	.	.	.	.	D	0.83243	0.5212	L	0.29908	0.895	0.35737	D	0.818357	B	0.31125	0.309	B	0.24701	0.055	D	0.83610	0.0133	9	0.29301	T	0.29	.	18.9638	0.92687	0.0:1.0:0.0:0.0	.	266	Q5T481	RBM20_HUMAN	N	266	ENSP00000358532:H266N	ENSP00000358532:H266N	H	+	1	0	RBM20	112531153	0.995000	0.38212	0.998000	0.56505	0.361000	0.29550	1.834000	0.39171	2.478000	0.83669	0.467000	0.42956	CAC	.		0.557	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
SCAMP3	10067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155226183	155226183	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr1:155226183C>G	ENST00000302631.3	-	9	1032	c.925G>C	c.(925-927)Gcc>Ccc	p.A309P	FAM189B_ENST00000472550.1_5'Flank|SCAMP3_ENST00000472397.1_5'UTR|FAM189B_ENST00000361361.2_5'Flank|FAM189B_ENST00000368368.3_5'Flank|SCAMP3_ENST00000355379.3_Missense_Mutation_p.A283P|FAM189B_ENST00000350210.2_5'Flank	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	309					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGAAAGCTGGCACCTGTGCGG	0.572																																					p.A309P		.											.	SCAMP3	93	0			c.G925C						.						97.0	108.0	104.0					1																	155226183		2203	4300	6503	SO:0001583	missense	10067	exon9			AGCTGGCACCTGT	AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.925G>C	1.37:g.155226183C>G	ENSP00000307275:p.Ala309Pro	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	20.0	NM_005698	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Missense_Mutation	SNP	ENST00000302631.3	37	CCDS1105.1	.	.	.	.	.	.	.	.	.	.	C	35	5.570658	0.96540	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	T;T	0.20881	2.32;2.04	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.41650	0.1168	M	0.81341	2.54	0.80722	D	1	D;D;D	0.64830	0.99;0.994;0.994	D;D;P	0.66602	0.945;0.93;0.821	T	0.31724	-0.9933	10	0.87932	D	0	-12.5227	16.9918	0.86356	0.0:1.0:0.0:0.0	.	309;283;309	Q6FHJ5;O14828-2;O14828	.;.;SCAM3_HUMAN	P	309;283	ENSP00000307275:A309P;ENSP00000347540:A283P	ENSP00000307275:A309P	A	-	1	0	SCAMP3	153492807	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.629000	0.83207	2.880000	0.98712	0.655000	0.94253	GCC	.		0.572	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087399.1	NM_005698	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237947912	237947912	+	Silent	SNP	C	C	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr1:237947912C>T	ENST00000366574.2	+	90	13217	c.12900C>T	c.(12898-12900)agC>agT	p.S4300S	RYR2_ENST00000542537.1_Silent_p.S4284S|RYR2_ENST00000360064.6_Silent_p.S4306S|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4300					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCGTGGCCAGCGTTTTCAGAG	0.463																																					p.S4300S		.											.	RYR2	158	0			c.C12900T						.						73.0	72.0	73.0					1																	237947912		1913	4121	6034	SO:0001819	synonymous_variant	6262	exon90			GGCCAGCGTTTTC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12900C>T	1.37:g.237947912C>T		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	16.0	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																			.		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SLC13A3	64849	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	45242105	45242105	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr20:45242105G>C	ENST00000279027.4	-	2	389	c.371C>G	c.(370-372)cCg>cGg	p.P124R	SLC13A3_ENST00000495082.1_Missense_Mutation_p.P77R|SLC13A3_ENST00000413164.2_Missense_Mutation_p.P124R|SLC13A3_ENST00000290317.5_Missense_Mutation_p.P77R|SLC13A3_ENST00000396360.1_Missense_Mutation_p.P77R|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000372121.1_Missense_Mutation_p.P124R|SLC13A3_ENST00000417157.2_Missense_Mutation_p.P77R|SLC13A3_ENST00000339636.3_Missense_Mutation_p.P124R|SLC13A3_ENST00000472148.1_Missense_Mutation_p.P77R	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	124					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	TTACCTGGCCGGCTGGACTCC	0.567																																					p.P124R		.											.	SLC13A3	91	0			c.C371G						.						59.0	55.0	57.0					20																	45242105		2203	4300	6503	SO:0001583	missense	64849	exon2			CTGGCCGGCTGGA	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.371C>G	20.37:g.45242105G>C	ENSP00000279027:p.Pro124Arg	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	26.0	NM_022829	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	37	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	G	31	5.099054	0.94197	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915;ENST00000420568;ENST00000372121;ENST00000417157;ENST00000339636	T;T;T;T;T;T;T;T;T;T;T	0.03607	3.87;3.87;3.87;3.87;3.87;3.87;3.87;3.87;3.87;3.87;3.87	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.33059	0.0850	H	0.96048	3.76	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.44711	-0.9310	10	0.87932	D	0	-21.7825	20.8794	0.99867	0.0:0.0:1.0:0.0	.	124;77;77;77;124	B4DIR8;Q8WWT9-3;F6WI18;C9J4A3;Q8WWT9	.;.;.;.;S13A3_HUMAN	R	77;77;124;77;124;77;77;87;124;77;124	ENSP00000290317:P77R;ENSP00000379648:P77R;ENSP00000279027:P124R;ENSP00000420177:P77R;ENSP00000415852:P124R;ENSP00000419621:P77R;ENSP00000417784:P77R;ENSP00000395095:P87R;ENSP00000361193:P124R;ENSP00000397955:P77R;ENSP00000344912:P124R	ENSP00000279027:P124R	P	-	2	0	SLC13A3	44675512	1.000000	0.71417	0.979000	0.43373	0.972000	0.66771	9.813000	0.99286	2.941000	0.99782	0.655000	0.94253	CCG	.		0.567	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
SLC30A4	7782	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	45814342	45814342	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr15:45814342C>A	ENST00000261867.4	-	2	525	c.211G>T	c.(211-213)Gcc>Tcc	p.A71S	HMGN2P46_ENST00000409454.1_RNA|SLC30A4_ENST00000559667.1_5'UTR	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	71	Asp-rich (acidic).				regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		TCATCGTCGGCCTGGAGGGTC	0.552																																					p.A71S		.											.	SLC30A4	90	0			c.G211T						.						112.0	112.0	112.0					15																	45814342		2198	4298	6496	SO:0001583	missense	7782	exon2			CGTCGGCCTGGAG		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.211G>T	15.37:g.45814342C>A	ENSP00000261867:p.Ala71Ser	Somatic	176.0	1.0		WXS	Illumina HiSeq	Phase_I	124.0	30.0	NM_013309	Q8TC39	Missense_Mutation	SNP	ENST00000261867.4	37	CCDS10125.1	.	.	.	.	.	.	.	.	.	.	C	4.106	0.017783	0.07959	.	.	ENSG00000104154	ENST00000261867	T	0.62941	-0.01	5.1	2.04	0.26737	.	0.300990	0.31156	N	0.008149	T	0.30947	0.0781	N	0.08118	0	0.25678	N	0.985828	B	0.06786	0.001	B	0.04013	0.001	T	0.20240	-1.0281	10	0.06494	T	0.89	-3.7032	5.4096	0.16341	0.1323:0.5339:0.2575:0.0763	.	71	O14863	ZNT4_HUMAN	S	71	ENSP00000261867:A71S	ENSP00000261867:A71S	A	-	1	0	SLC30A4	43601634	0.997000	0.39634	0.980000	0.43619	0.059000	0.15707	1.283000	0.33237	0.552000	0.29026	-0.304000	0.09214	GCC	.		0.552	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1		
TAS2R20	259295	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	11150077	11150077	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr12:11150077A>G	ENST00000538986.1	-	1	397	c.398T>C	c.(397-399)gTg>gCg	p.V133A	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	133					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						AGACCCCAACACTATCACCAG	0.373																																					p.V133A		.											.	TAS2R20	90	0			c.T398C						.						118.0	108.0	111.0					12																	11150077		2203	4300	6503	SO:0001583	missense	259295	exon1			CCCAACACTATCA	AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.398T>C	12.37:g.11150077A>G	ENSP00000441624:p.Val133Ala	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	9.0	NM_176889	P59549|Q2HIZ4|Q496D8|Q645X9	Missense_Mutation	SNP	ENST00000538986.1	37	CCDS8639.1	.	.	.	.	.	.	.	.	.	.	A	9.802	1.180714	0.21787	.	.	ENSG00000255837	ENST00000538986	T	0.37411	1.2	2.93	2.93	0.34026	.	0.830641	0.09582	U	0.782738	T	0.25531	0.0621	N	0.22421	0.69	0.09310	N	1	B	0.23377	0.084	B	0.29524	0.103	T	0.27673	-1.0067	10	0.87932	D	0	.	4.7748	0.13173	0.8524:0.0:0.1476:0.0	.	133	P59543	T2R20_HUMAN	A	133	ENSP00000441624:V133A	ENSP00000441624:V133A	V	-	2	0	TAS2R20	11041344	0.001000	0.12720	0.004000	0.12327	0.002000	0.02628	1.455000	0.35190	1.349000	0.45751	0.482000	0.46254	GTG	.		0.373	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370130.2	NM_176889	
TMEM63A	9725	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	226047035	226047035	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr1:226047035A>G	ENST00000366835.3	-	15	1508	c.1238T>C	c.(1237-1239)aTc>aCc	p.I413T	TMEM63A_ENST00000474478.1_5'Flank	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	413					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					GAGGCCCTGGATAGAGAGGTT	0.572																																					p.I413T		.											.	TMEM63A	91	0			c.T1238C						.						76.0	75.0	75.0					1																	226047035		2203	4300	6503	SO:0001583	missense	9725	exon15			CCCTGGATAGAGA		CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1238T>C	1.37:g.226047035A>G	ENSP00000355800:p.Ile413Thr	Somatic	275.0	1.0		WXS	Illumina HiSeq	Phase_I	187.0	32.0	NM_014698	Q53GI7|Q5TE96|Q8N2U2	Missense_Mutation	SNP	ENST00000366835.3	37	CCDS31042.1	.	.	.	.	.	.	.	.	.	.	A	15.32	2.798776	0.50208	.	.	ENSG00000196187	ENST00000366835	T	0.34275	1.37	5.07	3.94	0.45596	Domain of unknown function DUF221 (1);	0.600559	0.18591	N	0.136721	T	0.40522	0.1120	M	0.78801	2.425	0.80722	D	1	B	0.06786	0.001	B	0.15052	0.012	T	0.30765	-0.9967	10	0.62326	D	0.03	-9.5905	10.6503	0.45645	0.924:0.0:0.076:0.0	.	413	O94886	TM63A_HUMAN	T	413	ENSP00000355800:I413T	ENSP00000355800:I413T	I	-	2	0	TMEM63A	224113658	1.000000	0.71417	0.851000	0.33527	0.997000	0.91878	7.309000	0.78937	0.793000	0.33875	0.459000	0.35465	ATC	.		0.572	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091154.2	NM_014698	
TUBA8	51807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18604415	18604415	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr22:18604415A>T	ENST00000330423.3	+	2	246	c.173A>T	c.(172-174)aAt>aTt	p.N58I	TUBA8_ENST00000316027.6_De_novo_Start_OutOfFrame	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	58					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						GAGACTGGCAATGGGAAGCAT	0.552																																					p.N58I		.											.	TUBA8	90	0			c.A173T						.						88.0	76.0	80.0					22																	18604415		2203	4300	6503	SO:0001583	missense	51807	exon2			CTGGCAATGGGAA	AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.173A>T	22.37:g.18604415A>T	ENSP00000333326:p.Asn58Ile	Somatic	248.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	56.0	NM_018943	B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Missense_Mutation	SNP	ENST00000330423.3	37	CCDS13751.1	.	.	.	.	.	.	.	.	.	.	A	13.94	2.386705	0.42308	.	.	ENSG00000183785	ENST00000330423;ENST00000416740	T;T	0.70164	-0.46;-0.46	5.06	3.92	0.45320	Tubulin/FtsZ, GTPase domain (4);	0.423476	0.26696	N	0.022964	T	0.66458	0.2791	M	0.81614	2.55	0.44728	D	0.997724	B;B;B	0.28783	0.0;0.019;0.222	B;B;B	0.29440	0.01;0.063;0.102	T	0.71009	-0.4716	10	0.72032	D	0.01	.	9.8108	0.40822	0.6205:0.3795:0.0:0.0	.	82;58;57	C9J2C0;Q9NY65;Q7Z3M3	.;TBA8_HUMAN;.	I	58;82	ENSP00000333326:N58I;ENSP00000412646:N82I	ENSP00000333326:N58I	N	+	2	0	TUBA8	16984415	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	4.519000	0.60517	2.030000	0.59900	0.459000	0.35465	AAT	.		0.552	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316232.3	NM_018943	
UNC13C	440279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	54914613	54914613	+	Silent	SNP	A	A	G			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr15:54914613A>G	ENST00000260323.11	+	30	6195	c.6195A>G	c.(6193-6195)gtA>gtG	p.V2065V	UNC13C_ENST00000537900.1_Silent_p.V2063V|UNC13C_ENST00000539562.2_5'UTR|UNC13C_ENST00000545554.1_Silent_p.V2065V	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2065	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AAGTCACTGTAAAAGGTATAC	0.408																																					p.V2065V		.											.	UNC13C	51	0			c.A6195G						.						86.0	85.0	85.0					15																	54914613		1900	4117	6017	SO:0001819	synonymous_variant	440279	exon29			CACTGTAAAAGGT	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6195A>G	15.37:g.54914613A>G		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	15.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	37	CCDS45264.1																																																																																			.		0.408	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
YEATS4	8089	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	69753774	69753774	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr12:69753774T>C	ENST00000247843.2	+	1	292	c.22T>C	c.(22-24)Ttt>Ctt	p.F8L	YEATS4_ENST00000548020.1_Missense_Mutation_p.F8L	NM_006530.2	NP_006521.1	O95619	YETS4_HUMAN	YEATS domain containing 4	8					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding transcription factor activity (GO:0003700)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(1)	5	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)			AATGGCCGAATTTGGGCCTGA	0.692																																					p.F8L		.											.	YEATS4	226	0			c.T22C						.						29.0	33.0	32.0					12																	69753774		2203	4300	6503	SO:0001583	missense	8089	exon1			GCCGAATTTGGGC	AJ245746	CCDS8990.1, CCDS73495.1	12q13-q15	2008-02-05				ENSG00000127337			24859	protein-coding gene	gene with protein product		602116				9302258, 11903063	Standard	XM_005269163		Approved	NuBI-1, GAS41, YAF9	uc001sux.3	O95619	OTTHUMG00000169358	ENST00000247843.2:c.22T>C	12.37:g.69753774T>C	ENSP00000247843:p.Phe8Leu	Somatic	159.0	1.0		WXS	Illumina HiSeq	Phase_I	155.0	44.0	NM_006530	Q9NQD0	Missense_Mutation	SNP	ENST00000247843.2	37	CCDS8990.1	.	.	.	.	.	.	.	.	.	.	T	29.6	5.016455	0.93404	.	.	ENSG00000127337	ENST00000247843;ENST00000548020;ENST00000552955	.	.	.	5.31	5.31	0.75309	.	0.046687	0.85682	D	0.000000	T	0.59702	0.2213	M	0.61703	1.905	0.80722	D	1	B	0.12013	0.005	B	0.11329	0.006	T	0.55939	-0.8061	8	.	.	.	-13.0446	15.4278	0.75069	0.0:0.0:0.0:1.0	.	8	O95619	YETS4_HUMAN	L	8	.	.	F	+	1	0	YEATS4	68040041	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.724000	0.74747	2.228000	0.72767	0.460000	0.39030	TTT	.		0.692	YEATS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403663.1	NM_006530	
ZNF267	10308	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31896503	31896503	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr16:31896503A>T	ENST00000300870.10	+	3	361	c.152A>T	c.(151-153)gAc>gTc	p.D51V	ZNF267_ENST00000394846.3_Missense_Mutation_p.D51V	NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	51	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						TCTAAGCCGGACCTGATCACC	0.403																																					p.D51V		.											.	ZNF267	138	0			c.A152T						.						59.0	58.0	58.0					16																	31896503		2197	4300	6497	SO:0001583	missense	10308	exon3			AGCCGGACCTGAT	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.152A>T	16.37:g.31896503A>T	ENSP00000300870:p.Asp51Val	Somatic	89.0	1.0		WXS	Illumina HiSeq	Phase_I	85.0	20.0	NM_003414	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	37	CCDS32440.1	.	.	.	.	.	.	.	.	.	.	a	8.559	0.877347	0.17395	.	.	ENSG00000185947	ENST00000300870	T	0.00976	5.48	0.675	-0.554	0.11811	Krueppel-associated box (3);	.	.	.	.	T	0.03220	0.0094	M	0.73217	2.22	0.09310	N	1	D	0.64830	0.994	D	0.65684	0.937	T	0.35500	-0.9786	8	0.66056	D	0.02	.	.	.	.	.	51	Q14586	ZN267_HUMAN	V	51	ENSP00000300870:D51V	ENSP00000300870:D51V	D	+	2	0	ZNF267	31804004	0.013000	0.17824	0.000000	0.03702	0.013000	0.08279	0.604000	0.24164	-0.263000	0.09378	0.402000	0.26972	GAC	.		0.403	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414	
ZNF280B	140883	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	22843497	22843497	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr22:22843497T>A	ENST00000406426.1	-	4	969	c.227A>T	c.(226-228)gAt>gTt	p.D76V	ZNF280B_ENST00000360412.2_Missense_Mutation_p.D76V			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	76					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TCTAAGGTGATCATACTTTTT	0.438																																					p.D76V		.											.	ZNF280B	70	0			c.A227T						.						173.0	155.0	161.0					22																	22843497		2203	4300	6503	SO:0001583	missense	140883	exon4			AGGTGATCATACT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.227A>T	22.37:g.22843497T>A	ENSP00000385998:p.Asp76Val	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	5.0	NM_080764		Missense_Mutation	SNP	ENST00000406426.1	37	CCDS13799.1	.	.	.	.	.	.	.	.	.	.	t	10.54	1.378456	0.24944	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	T;T	0.23147	1.92;1.92	4.55	1.37	0.22104	.	.	.	.	.	T	0.17408	0.0418	N	0.19112	0.55	0.09310	N	1	B	0.32010	0.351	B	0.37015	0.239	T	0.27434	-1.0074	9	0.72032	D	0.01	.	6.1309	0.20204	0.0:0.6848:0.0:0.3152	.	76	Q86YH2	Z280B_HUMAN	V	76	ENSP00000385998:D76V;ENSP00000353586:D76V	ENSP00000353586:D76V	D	-	2	0	ZNF280B	21173497	0.132000	0.22450	0.002000	0.10522	0.408000	0.30992	0.164000	0.16542	0.654000	0.30846	-0.221000	0.12465	GAT	.		0.438	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
ZNF362	149076	broad.mit.edu;bcgsc.ca	37	1	33745866	33745866	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr1:33745866T>A	ENST00000539719.1	+	5	661	c.491T>A	c.(490-492)aTc>aAc	p.I164N	ZNF362_ENST00000373428.5_Missense_Mutation_p.I164N	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CCCACCCTCATCTCAGGGATC	0.682																																					p.I164N	Pancreas(162;1431 2676 35353 38425)	.											.	ZNF362	68	0			c.T491A						.						76.0	70.0	72.0					1																	33745866		2203	4300	6503	SO:0001583	missense	149076	exon5			CCCTCATCTCAGG		CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.491T>A	1.37:g.33745866T>A	ENSP00000446335:p.Ile164Asn	Somatic	387.0	1.0		WXS	Illumina HiSeq	Phase_I	336.0	19.0	NM_152493	Q8WYU4	Missense_Mutation	SNP	ENST00000539719.1	37	CCDS377.1	.	.	.	.	.	.	.	.	.	.	T	19.74	3.884690	0.72410	.	.	ENSG00000160094	ENST00000483388;ENST00000539719;ENST00000373428	T;T	0.07908	3.15;3.15	6.03	6.03	0.97812	.	1.097530	0.07035	N	0.829110	T	0.12092	0.0294	L	0.43152	1.355	0.49051	D	0.999748	B	0.33073	0.396	B	0.34722	0.188	T	0.11743	-1.0575	10	0.38643	T	0.18	-28.0315	12.95	0.58394	0.0:0.0:0.0:1.0	.	164	Q5T0B9	ZN362_HUMAN	N	151;164;164	ENSP00000446335:I164N;ENSP00000362527:I164N	ENSP00000362527:I164N	I	+	2	0	ZNF362	33518453	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.621000	0.54210	2.308000	0.77769	0.533000	0.62120	ATC	.		0.682	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011857.2	NM_152493	
ZNF462	58499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	109687663	109687663	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NL-01A-11D-A28X-10	TCGA-DD-A4NL-11A-11D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d09e93b-51df-4683-a2fa-94c85cc1c0ab	04c60928-59b2-44bf-9d49-57bfbdd82528	g.chr9:109687663G>T	ENST00000277225.5	+	3	1759	c.1470G>T	c.(1468-1470)caG>caT	p.Q490H	ZNF462_ENST00000457913.1_Missense_Mutation_p.Q490H|ZNF462_ENST00000441147.2_5'Flank			Q96JM2	ZN462_HUMAN	zinc finger protein 462	490					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CTCACAAACAGTGTCACACGG	0.443																																					p.Q490H		.											.	ZNF462	95	0			c.G1470T						.						105.0	94.0	98.0					9																	109687663		2203	4300	6503	SO:0001583	missense	58499	exon3			CAAACAGTGTCAC	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.1470G>T	9.37:g.109687663G>T	ENSP00000277225:p.Gln490His	Somatic	236.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	47.0	NM_021224	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302067	0.40694	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.06371	3.31;3.76	5.69	5.69	0.88448	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.17831	0.0428	L	0.47716	1.5	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.81914	0.995;0.99	T	0.00229	-1.1898	9	.	.	.	.	13.3323	0.60495	0.0752:0.0:0.9248:0.0	.	490;490	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	H	490	ENSP00000277225:Q490H;ENSP00000414570:Q490H	.	Q	+	3	2	ZNF462	108727484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.764000	0.47613	2.681000	0.91329	0.561000	0.74099	CAG	.		0.443	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
