#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACACA	31	hgsc.bcm.edu;broad.mit.edu	37	17	35580444	35580444	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr17:35580444C>T	ENST00000394406.2	-	28	3632	c.3442G>A	c.(3442-3444)Gca>Aca	p.A1148T	ACACA_ENST00000360679.3_Missense_Mutation_p.A1090T|ACACA_ENST00000353139.5_Missense_Mutation_p.A1185T|ACACA_ENST00000335166.5_Missense_Mutation_p.A1070T	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1148					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TCCAGAGCTGCCATCCTCACT	0.403																																					p.A1185T	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	.											.	ACACA	154	0			c.G3553A						.						200.0	179.0	186.0					17																	35580444		2203	4300	6503	SO:0001583	missense	31	exon28			GAGCTGCCATCCT	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.3442G>A	17.37:g.35580444C>T	ENSP00000377928:p.Ala1148Thr	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	37	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	C	34	5.404969	0.96051	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	5.71	5.71	0.89125	Acetyl-CoA carboxylase, central domain (1);	0.049621	0.85682	D	0.000000	D	0.83746	0.5321	M	0.92507	3.315	0.80722	D	1	P;P;P	0.49358	0.923;0.798;0.759	P;P;P	0.55749	0.783;0.615;0.48	D	0.86718	0.1940	10	0.59425	D	0.04	-13.555	18.0482	0.89340	0.0:1.0:0.0:0.0	.	1185;1148;1090	Q13085-4;Q13085;Q13085-2	.;ACACA_HUMAN;.	T	1185;1090;1148;1172;1070	ENSP00000344789:A1185T;ENSP00000353898:A1090T;ENSP00000377928:A1148T;ENSP00000335323:A1070T	ENSP00000335323:A1070T	A	-	1	0	ACACA	32654557	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.709000	0.92574	0.655000	0.94253	GCA	.		0.403	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
ANKRD66	100287718	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	46726569	46726569	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr6:46726569C>T	ENST00000565422.1	+	5	672	c.667C>T	c.(667-669)Ctt>Ttt	p.L223F	RP11-268F1.3_ENST00000438738.1_lincRNA|ANKRD66_ENST00000536046.1_Missense_Mutation_p.L194F	NM_001162435.2	NP_001155907.2	B4E2M5	ANR66_HUMAN	ankyrin repeat domain 66	223																	GGAGCTGTCTCTTCCTTCCCT	0.527																																					p.L223F		.											.	.	.	0			c.C667T						.						68.0	64.0	65.0					6																	46726569		692	1591	2283	SO:0001583	missense	100287718	exon5			CTGTCTCTTCCTT	AK304342	CCDS59024.1	6p12.3	2013-01-11			ENSG00000230062	ENSG00000230062		"""Ankyrin repeat domain containing"""	44669	protein-coding gene	gene with protein product							Standard	NM_001162435		Approved		uc011dwf.2	B4E2M5	OTTHUMG00000014791	ENST00000565422.1:c.667C>T	6.37:g.46726569C>T	ENSP00000454770:p.Leu223Phe	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	15.0	NM_001162435		Missense_Mutation	SNP	ENST00000565422.1	37	CCDS59024.1																																																																																			.		0.527	ANKRD66-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432045.1	NM_001162435	
APOB	338	hgsc.bcm.edu;broad.mit.edu	37	2	21233945	21233945	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr2:21233945delA	ENST00000233242.1	-	26	5922	c.5795delT	c.(5794-5796)ctgfs	p.L1933fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1933					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTTTCAACAGGAATTTGCT	0.458																																					p.L1932fs		.											.	APOB	175	0			c.5795delT						.						205.0	189.0	195.0					2																	21233945		2203	4300	6503	SO:0001589	frameshift_variant	338	exon26			TTCAACAGGAATT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5795delT	2.37:g.21233945delA	ENSP00000233242:p.Leu1933fs	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	13.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.458	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOL4	80832	broad.mit.edu;bcgsc.ca	37	22	36587462	36587462	+	Silent	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr22:36587462G>A	ENST00000352371.1	-	6	938	c.714C>T	c.(712-714)gcC>gcT	p.A238A	APOL4_ENST00000404685.3_3'UTR|APOL4_ENST00000479929.1_5'UTR|APOL4_ENST00000332987.1_Silent_p.A235A|APOL4_ENST00000405511.1_3'UTR|APOL4_ENST00000429038.2_3'UTR			Q9BPW4	APOL4_HUMAN	apolipoprotein L, 4	239					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	extracellular space (GO:0005615)	lipid binding (GO:0008289)	p.A238A(1)		lung(1)	1						TCATTTTTGTGGCTTCGTCAA	0.448																																					.		.											.	APOL4	90	1	Substitution - coding silent(1)	lung(1)	.						.						97.0	91.0	93.0					22																	36587462		2155	4281	6436	SO:0001819	synonymous_variant	80832	.			TTTTGTGGCTTCG	AF305226	CCDS74851.1, CCDS74852.1	22q11.2-q13.2	2013-01-24			ENSG00000100336	ENSG00000100336		"""Apolipoproteins"""	14867	protein-coding gene	gene with protein product		607254				11374903	Standard	NM_030643		Approved	APOLIV	uc003aox.3	Q9BPW4	OTTHUMG00000150630	ENST00000352371.1:c.714C>T	22.37:g.36587462G>A		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	5.0	.	Q9BQ37|Q9BXQ8	Silent	SNP	ENST00000352371.1	37																																																																																				.		0.448	APOL4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_145660	
AURKA	6790	broad.mit.edu;bcgsc.ca	37	20	54958068	54958068	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr20:54958068C>T	ENST00000347343.2	-	5	806	c.539G>A	c.(538-540)aGa>aAa	p.R180K	AURKA_ENST00000371356.2_Missense_Mutation_p.R180K|AURKA_ENST00000395909.4_Missense_Mutation_p.R180K|AURKA_ENST00000395911.1_Missense_Mutation_p.R180K|AURKA_ENST00000395914.1_Missense_Mutation_p.R180K|AURKA_ENST00000312783.6_Missense_Mutation_p.R180K|AURKA_ENST00000395915.3_Missense_Mutation_p.R180K|AURKA_ENST00000395907.1_Missense_Mutation_p.R180K|AURKA_ENST00000395913.3_Missense_Mutation_p.R180K	NM_003600.2	NP_003591.2	O14965	AURKA_HUMAN	aurora kinase A	180	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|anterior/posterior axis specification (GO:0009948)|centrosome localization (GO:0051642)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|negative regulation of spindle checkpoint (GO:0090233)|neuron projection extension (GO:1990138)|positive regulation of mitosis (GO:0045840)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein autophosphorylation (GO:0046777)|protein localization to centrosome (GO:0071539)|protein phosphorylation (GO:0006468)|regulation of centrosome cycle (GO:0046605)|regulation of protein stability (GO:0031647)|spindle assembly involved in female meiosis I (GO:0007057)|spindle stabilization (GO:0043146)	axon hillock (GO:0043203)|centrosome (GO:0005813)|cytosol (GO:0005829)|germinal vesicle (GO:0042585)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|lung(9)|ovary(2)|prostate(1)|skin(2)	22			Colorectal(105;0.202)			TTCTACTTCTCTTCTGAGCTG	0.443																																					p.R180K	Melanoma(34;439 1292 51416 52695)|GBM(144;1525 2517 48902 51835)|Esophageal Squamous(191;569 2880 14195 30540)	.											.	AURKA	1601	0			c.G539A						.						118.0	109.0	112.0					20																	54958068		2203	4300	6503	SO:0001583	missense	6790	exon5			ACTTCTCTTCTGA	BC001280	CCDS13451.1	20q13	2012-07-23	2003-07-21	2003-07-23	ENSG00000087586	ENSG00000087586		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11393	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 47"", ""Aurora-A kinase"""	603072	"""serine/threonine kinase 15"", "" serine/threonine kinase 6"""	STK15, STK6		9174055, 9771714	Standard	NM_003600		Approved	BTAK, AurA, STK7, ARK1, PPP1R47, AIK	uc002xxi.1	O14965	OTTHUMG00000032796	ENST00000347343.2:c.539G>A	20.37:g.54958068C>T	ENSP00000216911:p.Arg180Lys	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	7.0	NM_198437	E1P5F9|O60445|O75873|Q9BQD6|Q9UPG5	Missense_Mutation	SNP	ENST00000347343.2	37	CCDS13451.1	.	.	.	.	.	.	.	.	.	.	C	35	5.564478	0.96527	.	.	ENSG00000087586	ENST00000395909;ENST00000395914;ENST00000347343;ENST00000395915;ENST00000312783;ENST00000371356;ENST00000395913;ENST00000395911;ENST00000395907;ENST00000441357;ENST00000420474	T;T;T;T;T;T;T;T;T;T;T	0.23754	2.97;2.97;2.97;2.97;2.97;2.97;2.97;2.97;2.97;2.97;1.89	4.98	4.98	0.66077	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.44891	0.1315	L	0.41079	1.255	0.80722	D	1	D;D;P;D;D;D	0.89917	1.0;1.0;0.807;0.976;0.997;0.997	D;D;P;P;D;D	0.91635	0.999;0.999;0.585;0.901;0.977;0.977	T	0.42599	-0.9442	10	0.87932	D	0	-21.366	18.6266	0.91342	0.0:1.0:0.0:0.0	.	180;180;112;180;180;180	A3KFJ1;Q5QPD4;B4DX16;A3KFJ0;B2R6Z3;O14965	.;.;.;.;.;AURKA_HUMAN	K	180	ENSP00000379245:R180K;ENSP00000379250:R180K;ENSP00000216911:R180K;ENSP00000379251:R180K;ENSP00000321591:R180K;ENSP00000360407:R180K;ENSP00000379249:R180K;ENSP00000379247:R180K;ENSP00000379243:R180K;ENSP00000393452:R180K;ENSP00000388073:R180K	ENSP00000321591:R180K	R	-	2	0	AURKA	54391475	0.999000	0.42202	0.999000	0.59377	0.991000	0.79684	7.637000	0.83313	2.464000	0.83262	0.561000	0.74099	AGA	.		0.443	AURKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079804.3	NM_003600	
BAZ2B	29994	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	160310259	160310259	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr2:160310259T>G	ENST00000392783.2	-	4	694	c.199A>C	c.(199-201)Agt>Cgt	p.S67R	BAZ2B_ENST00000355831.2_Missense_Mutation_p.S67R|BAZ2B_ENST00000343439.5_Missense_Mutation_p.S67R|BAZ2B_ENST00000392782.1_Missense_Mutation_p.S67R	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	67					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GGGAAGGCACTCGACACTGTG	0.468																																					p.S67R		.											.	BAZ2B	94	0			c.A199C						.						81.0	77.0	78.0					2																	160310259		1891	4131	6022	SO:0001583	missense	29994	exon4			AGGCACTCGACAC	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.199A>C	2.37:g.160310259T>G	ENSP00000376534:p.Ser67Arg	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	10.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	T	18.34	3.602272	0.66445	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000437839	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.46	5.46	0.80206	.	.	.	.	.	T	0.56645	0.1999	L	0.56769	1.78	0.48632	D	0.999685	D;D;D	0.76494	0.994;0.999;0.998	D;D;D	0.83275	0.983;0.996;0.991	T	0.59878	-0.7371	9	0.87932	D	0	-7.7425	14.5001	0.67716	0.0:0.0:0.0:1.0	.	67;67;67	Q6MZK7;Q9UIF8-5;Q9UIF8	.;.;BAZ2B_HUMAN	R	67	ENSP00000376533:S67R;ENSP00000376534:S67R;ENSP00000348087:S67R;ENSP00000339670:S67R;ENSP00000415613:S67R	ENSP00000339670:S67R	S	-	1	0	BAZ2B	160018505	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.401000	0.66326	2.066000	0.61787	0.533000	0.62120	AGT	.		0.468	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
C20orf173	140873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34116559	34116559	+	Silent	SNP	G	G	A	rs547262885		TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr20:34116559G>A	ENST00000246199.2	-	2	578	c.300C>T	c.(298-300)aaC>aaT	p.N100N	C20orf173_ENST00000444723.1_Silent_p.N153N|C20orf173_ENST00000374345.4_Silent_p.N153N|RP3-477O4.5_ENST00000422009.1_RNA			Q96LM9	CT173_HUMAN	chromosome 20 open reading frame 173	100										haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						GGTCGATGTCGTTGCCAAGGC	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		18306	0.0		0.001	False		,,,				2504	0.0				p.N153N		.											.	.	.	0			c.C459T						.						29.0	27.0	28.0					20																	34116559		692	1591	2283	SO:0001819	synonymous_variant	140873	exon3			GATGTCGTTGCCA	AL121586	CCDS46594.1	20q11.22	2012-10-30			ENSG00000125975	ENSG00000125975			16166	protein-coding gene	gene with protein product							Standard	NM_001145350		Approved	dJ477O4.4	uc010zvf.1	Q96LM9	OTTHUMG00000032340	ENST00000246199.2:c.300C>T	20.37:g.34116559G>A		Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	9.0	NM_001145350	A6PVJ1|Q2M293|Q5JWS4|Q9H449	Silent	SNP	ENST00000246199.2	37																																																																																				.		0.602	C20orf173-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078874.6	NM_001145350	
C5orf51	285636	broad.mit.edu;bcgsc.ca	37	5	41904516	41904516	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr5:41904516G>A	ENST00000381647.2	+	1	66	c.47G>A	c.(46-48)gGg>gAg	p.G16E	C5orf51_ENST00000505931.2_Intron	NM_175921.4	NP_787117.3	A6NDU8	CE051_HUMAN	chromosome 5 open reading frame 51	16										endometrium(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GAAGAGCTCGGGGATCTGGCT	0.657																																					p.G16E		.											.	C5orf51	68	0			c.G47A						.						41.0	39.0	40.0					5																	41904516		2203	4300	6503	SO:0001583	missense	285636	exon1			AGCTCGGGGATCT	AL833916, AK094002	CCDS34151.1	5p13.1	2008-07-18			ENSG00000205765	ENSG00000205765			27750	protein-coding gene	gene with protein product						14702039	Standard	NM_175921		Approved	LOC285636	uc003jmo.3	A6NDU8	OTTHUMG00000162084	ENST00000381647.2:c.47G>A	5.37:g.41904516G>A	ENSP00000371061:p.Gly16Glu	Somatic	117.0	1.0		WXS	Illumina HiSeq	Phase_I	130.0	8.0	NM_175921	A2RRM9	Missense_Mutation	SNP	ENST00000381647.2	37	CCDS34151.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738507	0.89573	.	.	ENSG00000205765	ENST00000381647	T	0.35605	1.3	4.99	4.99	0.66335	.	0.058707	0.64402	D	0.000002	T	0.44498	0.1296	N	0.19112	0.55	0.43179	D	0.99499	D	0.89917	1.0	D	0.91635	0.999	T	0.41875	-0.9484	10	0.56958	D	0.05	-7.9608	13.9642	0.64199	0.0:0.0:1.0:0.0	.	16	A6NDU8	CE051_HUMAN	E	16	ENSP00000371061:G16E	ENSP00000371061:G16E	G	+	2	0	C5orf51	41940273	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.953000	0.56699	2.756000	0.94617	0.561000	0.74099	GGG	.		0.657	C5orf51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367144.1	NM_175921	
CACNA2D4	93589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	1949905	1949905	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr12:1949905C>T	ENST00000382722.5	-	26	2913	c.2551G>A	c.(2551-2553)Gcc>Acc	p.A851T	CACNA2D4_ENST00000586184.1_Splice_Site_p.A851T|CACNA2D4_ENST00000585732.1_Splice_Site_p.A712T|CACNA2D4_ENST00000588077.1_Splice_Site_p.A787T|CACNA2D4_ENST00000585708.1_Splice_Site_p.A787T|CACNA2D4_ENST00000587995.1_Splice_Site_p.A826T	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	851					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CCGTTCCTACCTGCAGCAATG	0.592																																					p.A851T	Colon(2;101 179 21030 23310 28141)	.											.	CACNA2D4	23	0			c.G2551A						.						69.0	75.0	73.0					12																	1949905		2157	4249	6406	SO:0001630	splice_region_variant	93589	exon26			TCCTACCTGCAGC	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2551+1G>A	12.37:g.1949905C>T		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	6.0	NM_172364	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	ENST00000382722.5	37	CCDS44785.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259698	0.80246	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.69926	-0.44	4.97	4.97	0.65823	.	0.146062	0.45126	N	0.000397	T	0.73697	0.3620	M	0.63428	1.95	0.58432	D	0.999994	P;P	0.49090	0.912;0.919	P;P	0.52159	0.691;0.543	T	0.74237	-0.3730	9	.	.	.	.	17.0724	0.86578	0.0:1.0:0.0:0.0	.	851;851	Q7Z3S7-2;Q7Z3S7	.;CA2D4_HUMAN	T	787;851;851	ENSP00000372169:A851T	.	A	-	1	0	CACNA2D4	1820166	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	7.172000	0.77604	2.319000	0.78375	0.555000	0.69702	GCC	.		0.592	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		Missense_Mutation
CARD16	114769	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	104912234	104912234	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr11:104912234G>A	ENST00000375706.2	-	3	504	c.487C>T	c.(487-489)Cgg>Tgg	p.R163W	CASP1_ENST00000415981.2_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000598974.1_Intron|CASP1_ENST00000593315.1_Intron	NM_001017534.1	NP_001017534.1	Q5EG05	CAR16_HUMAN	caspase recruitment domain family, member 16	163					regulation of apoptotic process (GO:0042981)		cysteine-type endopeptidase inhibitor activity (GO:0004869)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	11						CTCCAGAACCGCTCAATAAAA	0.383																																					p.R163W		.											.	CARD16	228	0			c.C487T						.						78.0	81.0	80.0					11																	104912234		2202	4299	6501	SO:0001583	missense	114769	exon3			AGAACCGCTCAAT		CCDS31661.1, CCDS41705.1	11q23	2008-09-15				ENSG00000204397			33701	protein-coding gene	gene with protein product		615680				11432859, 11536016	Standard	NM_052889		Approved	COP1, COP, PSEUDO-ICE		Q5EG05		ENST00000375706.2:c.487C>T	11.37:g.104912234G>A	ENSP00000364858:p.Arg163Trp	Somatic	113.0	1.0		WXS	Illumina HiSeq	Phase_I	120.0	12.0	NM_001017534	Q96RJ9	Missense_Mutation	SNP	ENST00000375706.2	37	CCDS31661.1	.	.	.	.	.	.	.	.	.	.	.	2.502	-0.315058	0.05422	.	.	ENSG00000204397	ENST00000375706	T	0.21543	2.0	1.36	-2.72	0.05968	.	0.205849	0.42964	U	0.000625	T	0.07143	0.0181	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19647	-1.0299	10	0.87932	D	0	.	0.1598	0.00102	0.3706:0.17:0.2078:0.2516	.	163	Q5EG05	CAR16_HUMAN	W	163	ENSP00000364858:R163W	ENSP00000364858:R163W	R	-	1	2	CARD16	104417444	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.109000	0.03309	-2.389000	0.00587	-0.671000	0.03813	CGG	.		0.383	CARD16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388147.1		
SOHLH2	54937	broad.mit.edu;bcgsc.ca	37	13	36747876	36747876	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr13:36747876C>A	ENST00000379881.3	-	9	1041	c.953G>T	c.(952-954)gGg>gTg	p.G318V	SOHLH2_ENST00000554962.1_Missense_Mutation_p.G395V|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.G395V	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	318					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		AGTGGAGCACCCATTCCAGCA	0.517																																					p.G395V		.											.	.	.	0			c.G1184T						.						122.0	110.0	114.0					13																	36747876		2203	4300	6503	SO:0001583	missense	100526761	exon14			GAGCACCCATTCC	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.953G>T	13.37:g.36747876C>A	ENSP00000369210:p.Gly318Val	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	5.0	NM_001198910	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	37	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.580430	0.00879	.	.	ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000511166	T;T;T	0.23147	1.92;1.93;1.93	5.8	1.75	0.24633	.	1.053850	0.07428	N	0.895227	T	0.07098	0.0180	N	0.00436	-1.5	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30387	-0.9980	10	0.28530	T	0.3	-0.1072	5.963	0.19310	0.5173:0.318:0.0:0.1647	.	395;318	B4DX90;Q9NX45	.;SOLH2_HUMAN	V	318;395;395	ENSP00000369210:G318V;ENSP00000451542:G395V;ENSP00000421868:G395V	ENSP00000421868:G395V	G	-	2	0	CCDC169-SOHLH2;SOHLH2	35645876	0.006000	0.16342	0.001000	0.08648	0.004000	0.04260	0.862000	0.27899	0.447000	0.26695	-0.388000	0.06559	GGG	.		0.517	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
CCDC88B	283234	broad.mit.edu;bcgsc.ca	37	11	64111617	64111617	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr11:64111617C>T	ENST00000356786.5	+	14	1648	c.1604C>T	c.(1603-1605)cCg>cTg	p.P535L	CCDC88B_ENST00000301897.4_5'Flank|CCDC88B_ENST00000463837.1_3'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	535						membrane (GO:0016020)		p.P535L(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTGGCTCCCCCGGCATTAGAC	0.632																																					p.P535L		.											.	CCDC88B	94	1	Substitution - Missense(1)	lung(1)	c.C1604T						.						59.0	66.0	63.0					11																	64111617		2201	4297	6498	SO:0001583	missense	283234	exon14			CTCCCCCGGCATT	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1604C>T	11.37:g.64111617C>T	ENSP00000349238:p.Pro535Leu	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_032251	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	.	.	.	.	.	.	.	.	.	.	N	6.829	0.522108	0.13066	.	.	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.22945	1.93	3.43	-2.13	0.07144	.	.	.	.	.	T	0.10165	0.0249	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.31336	-0.9947	9	0.26408	T	0.33	.	4.6361	0.12525	0.0:0.3135:0.1975:0.4889	.	535;184;535	B2RTU8;A6NC98-3;A6NC98	.;.;CC88B_HUMAN	L	535	ENSP00000349238:P535L	ENSP00000349238:P535L	P	+	2	0	CCDC88B	63868193	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.804000	0.01738	-0.439000	0.07222	-0.696000	0.03686	CCG	.		0.632	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251	
CD46	4179	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	207934716	207934716	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr1:207934716delT	ENST00000358170.2	+	5	754	c.598delT	c.(598-600)tttfs	p.F200fs	CD46_ENST00000322875.4_Frame_Shift_Del_p.F200fs|CD46_ENST00000354848.1_Frame_Shift_Del_p.F200fs|CD46_ENST00000480003.1_Frame_Shift_Del_p.F200fs|CD46_ENST00000367042.1_Frame_Shift_Del_p.F200fs|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000357714.1_Frame_Shift_Del_p.F200fs|CD46_ENST00000322918.5_Frame_Shift_Del_p.F200fs|CD46_ENST00000360212.2_Frame_Shift_Del_p.F200fs|CD46_ENST00000361067.1_Frame_Shift_Del_p.F200fs|CD46_ENST00000367041.1_Frame_Shift_Del_p.F200fs|CD46_ENST00000441839.2_Frame_Shift_Del_p.F200fs|CD46_ENST00000367047.1_Frame_Shift_Del_p.F137fs	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	200	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						ACCAGATCCATTTTCACTTAT	0.373																																					p.F200fs		.											.	CD46	963	0			c.598delT						.						152.0	130.0	137.0					1																	207934716		2203	4300	6503	SO:0001589	frameshift_variant	4179	exon5			GATCCATTTTCAC	BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.598delT	1.37:g.207934716delT	ENSP00000350893:p.Phe200fs	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	22.0	NM_172352	A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Frame_Shift_Del	DEL	ENST00000358170.2	37	CCDS1485.1																																																																																			.		0.373	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088588.3	NM_172361	
CD8B	926	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	87073896	87073896	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr2:87073896C>T	ENST00000390655.6	-	4	552	c.494G>A	c.(493-495)gGc>gAc	p.G165D	CD8B_ENST00000331469.2_Splice_Site_p.G165D|CD8B_ENST00000393759.2_Splice_Site_p.G165D|CD8B_ENST00000431506.2_Intron|CD8B_ENST00000349455.3_Intron|CD8B_ENST00000393761.2_Intron	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	165					immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						ACAAAGTGGGCCTGGAAAACA	0.522																																					p.G165D		.											.	CD8B	92	0			c.G494A						.						55.0	45.0	49.0					2																	87073896		2189	4282	6471	SO:0001630	splice_region_variant	926	exon4			AGTGGGCCTGGAA		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.494-1G>A	2.37:g.87073896C>T		Somatic	476.0	0.0		WXS	Illumina HiSeq	Phase_I	475.0	39.0	NM_004931	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Missense_Mutation	SNP	ENST00000390655.6	37	CCDS1997.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359465	0.61403	.	.	ENSG00000172116	ENST00000393759;ENST00000331469;ENST00000390655;ENST00000445248	.	.	.	4.91	3.09	0.35607	.	1.135780	0.06303	N	0.701217	T	0.74489	0.3723	M	0.78637	2.42	0.45899	D	0.998748	D;D;D;D	0.71674	0.995;0.995;0.998;0.997	P;P;D;D	0.68621	0.871;0.844;0.959;0.939	T	0.63400	-0.6646	9	0.87932	D	0	.	6.7554	0.23510	0.0:0.7255:0.1793:0.0952	.	165;165;165;165	Q53QL8;P10966;P10966-2;P10966-6	.;CD8B_HUMAN;.;.	D	165	.	ENSP00000331172:G165D	G	-	2	0	CD8B	86927407	0.659000	0.27411	0.586000	0.28679	0.009000	0.06853	0.714000	0.25808	0.776000	0.33473	0.655000	0.94253	GGC	.		0.522	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	NM_172099	Missense_Mutation
CPN1	1369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	101823465	101823465	+	Silent	SNP	G	G	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr10:101823465G>T	ENST00000370418.3	-	5	1028	c.777C>A	c.(775-777)tcC>tcA	p.S259S		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	259	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.S259S(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		CATGTGCATAGGAGTAGACCT	0.493																																					p.S259S		.											.	CPN1	227	1	Substitution - coding silent(1)	large_intestine(1)	c.C777A						.						100.0	91.0	94.0					10																	101823465		2203	4300	6503	SO:0001819	synonymous_variant	1369	exon5			TGCATAGGAGTAG	X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.777C>A	10.37:g.101823465G>T		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	10.0	NM_001308	B1AP59	Silent	SNP	ENST00000370418.3	37	CCDS7486.1																																																																																			.		0.493	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308	
CXCR4	7852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	136872511	136872511	+	Silent	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr2:136872511G>A	ENST00000241393.3	-	2	1091	c.987C>T	c.(985-987)ctC>ctT	p.L329L	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Silent_p.L333L	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	329					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TTCCTTTGGAGAGGATCTTGA	0.463																																					p.L333L		.											.	CXCR4	1082	0			c.C999T						.						266.0	252.0	256.0					2																	136872511		2203	4300	6503	SO:0001819	synonymous_variant	7852	exon1			TTTGGAGAGGATC	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.987C>T	2.37:g.136872511G>A		Somatic	176.0	0.0		WXS	Illumina HiSeq	Phase_I	218.0	24.0	NM_001008540	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Silent	SNP	ENST00000241393.3	37	CCDS46420.1																																																																																			.		0.463	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
DMAP1	55929	broad.mit.edu;ucsc.edu	37	1	44684852	44684852	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr1:44684852G>A	ENST00000372289.2	+	6	1108	c.845G>A	c.(844-846)cGg>cAg	p.R282Q	DMAP1_ENST00000361745.6_Missense_Mutation_p.R282Q|DMAP1_ENST00000315913.5_Missense_Mutation_p.R282Q|DMAP1_ENST00000488433.1_3'UTR	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	282					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					GCAGAGCAGCGGCGCACGGAA	0.622																																					p.R282Q		.											.	DMAP1	226	0			c.G845A						.						50.0	54.0	53.0					1																	44684852		2203	4300	6503	SO:0001583	missense	55929	exon7			AGCAGCGGCGCAC	AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.845G>A	1.37:g.44684852G>A	ENSP00000361363:p.Arg282Gln	Somatic	60.0	1.0		WXS	Illumina HiSeq	Phase_I	79.0	5.0	NM_001034023	A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	Missense_Mutation	SNP	ENST00000372289.2	37	CCDS509.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.565327	0.86439	.	.	ENSG00000178028	ENST00000361745;ENST00000446292;ENST00000315913;ENST00000372289	.	.	.	5.53	4.59	0.56863	DNA methyltransferase 1-associated 1 (2);	0.054891	0.64402	D	0.000002	T	0.48840	0.1522	L	0.43152	1.355	0.80722	D	1	D;D	0.56746	0.977;0.977	P;P	0.46320	0.512;0.512	T	0.40365	-0.9567	9	0.15499	T	0.54	-27.9783	16.144	0.81551	0.0:0.1339:0.8661:0.0	.	272;282	B4DQG8;Q9NPF5	.;DMAP1_HUMAN	Q	282	.	ENSP00000312697:R282Q	R	+	2	0	DMAP1	44457439	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.430000	0.97488	1.299000	0.44798	0.591000	0.81541	CGG	.		0.622	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020027.3	NM_019100	
DMXL2	23312	broad.mit.edu;ucsc.edu	37	15	51868294	51868294	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr15:51868294T>C	ENST00000251076.5	-	2	459	c.172A>G	c.(172-174)Atc>Gtc	p.I58V	DMXL2_ENST00000543779.2_Missense_Mutation_p.I58V|DMXL2_ENST00000560421.1_5'UTR|DMXL2_ENST00000449909.3_Missense_Mutation_p.I58V	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	58						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CTGACTTGGATGTTTCCATGC	0.333																																					p.I58V		.											.	DMXL2	99	0			c.A172G						.						150.0	139.0	143.0					15																	51868294		2195	4293	6488	SO:0001583	missense	23312	exon2			CTTGGATGTTTCC	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.172A>G	15.37:g.51868294T>C	ENSP00000251076:p.Ile58Val	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	4.0	NM_001174117	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	T	13.37	2.216195	0.39201	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.25250	1.96;1.96;1.81	5.32	5.32	0.75619	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.41236	0.1150	L	0.43923	1.385	0.29109	N	0.880967	D;D;P	0.67145	0.996;0.985;0.93	D;D;D	0.67548	0.946;0.952;0.919	T	0.27839	-1.0062	10	0.33940	T	0.23	.	15.2863	0.73831	0.0:0.0:0.0:1.0	.	58;58;58	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	V	58	ENSP00000251076:I58V;ENSP00000441858:I58V;ENSP00000400855:I58V	ENSP00000251076:I58V	I	-	1	0	DMXL2	49655586	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.997000	0.88414	2.012000	0.59069	0.528000	0.53228	ATC	.		0.333	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
DNAH12	201625	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	57488148	57488148	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr3:57488148G>T	ENST00000351747.2	-	10	1325	c.1145C>A	c.(1144-1146)aCa>aAa	p.T382K	DNAH12_ENST00000311202.6_Missense_Mutation_p.T382K|DNAH12_ENST00000389536.4_Missense_Mutation_p.T382K	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	382	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						AGGAAGTTCTGTGTCAAGATT	0.378																																					p.T382K		.											.	DNAH12	47	0			c.C1145A						.						224.0	199.0	207.0					3																	57488148		2203	4300	6503	SO:0001583	missense	201625	exon10			AGTTCTGTGTCAA	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.1145C>A	3.37:g.57488148G>T	ENSP00000295937:p.Thr382Lys	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	12.0	NM_198564	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	37		.	.	.	.	.	.	.	.	.	.	G	15.51	2.854469	0.51376	.	.	ENSG00000174844	ENST00000351747;ENST00000495027;ENST00000389536;ENST00000311202	T;T;T;T	0.23147	2.09;1.92;3.48;2.95	5.21	4.28	0.50868	.	0.315781	0.27591	N	0.018693	T	0.35740	0.0942	M	0.61703	1.905	0.80722	D	1	D;P	0.53745	0.962;0.651	P;B	0.49421	0.61;0.122	T	0.19778	-1.0295	10	0.62326	D	0.03	.	14.0674	0.64839	0.0:0.0:0.8505:0.1495	.	382;382	Q6ZR08-4;Q6ZR08	.;DYH12_HUMAN	K	382	ENSP00000295937:T382K;ENSP00000418137:T382K;ENSP00000374187:T382K;ENSP00000312554:T382K	ENSP00000312554:T382K	T	-	2	0	DNAH12	57463188	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.338000	0.65947	2.581000	0.87130	0.655000	0.94253	ACA	.		0.378	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
EPHA10	284656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	38227457	38227457	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr1:38227457G>A	ENST00000373048.4	-	3	469	c.470C>T	c.(469-471)gCg>gTg	p.A157V	EPHA10_ENST00000427468.2_Missense_Mutation_p.A157V|EPHA10_ENST00000319637.6_Missense_Mutation_p.A157V	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	157	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCTCTCGTCCGCCGCGATCGT	0.662																																					p.A157V		.											.	EPHA10	1246	0			c.C470T						.						27.0	33.0	31.0					1																	38227457		2195	4296	6491	SO:0001583	missense	284656	exon3			TCGTCCGCCGCGA	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.470C>T	1.37:g.38227457G>A	ENSP00000362139:p.Ala157Val	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	8.0	NM_001099439	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	37	CCDS41305.1	.	.	.	.	.	.	.	.	.	.	G	34	5.330075	0.95733	.	.	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	T;T;T	0.05925	3.37;3.37;3.37	4.75	4.75	0.60458	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.41500	D	0.000875	T	0.35770	0.0943	M	0.93197	3.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.965;0.998	T	0.50048	-0.8873	10	0.87932	D	0	.	17.2504	0.87041	0.0:0.0:1.0:0.0	.	157;157	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	V	157	ENSP00000397746:A157V;ENSP00000362139:A157V;ENSP00000316395:A157V	ENSP00000316395:A157V	A	-	2	0	EPHA10	38000044	1.000000	0.71417	0.630000	0.29268	0.966000	0.64601	9.511000	0.98006	2.598000	0.87819	0.643000	0.83706	GCG	.		0.662	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
FAM149B1	317662	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	74970149	74970149	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr10:74970149G>C	ENST00000242505.6	+	7	1025	c.851G>C	c.(850-852)aGc>aCc	p.S284T		NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	284										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						AAGGTTGTGAGCTGTATGGAG	0.388																																					p.S284T		.											.	.	.	0			c.G851C						.						287.0	231.0	248.0					10																	74970149		692	1591	2283	SO:0001583	missense	317662	exon7			TTGTGAGCTGTAT	AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.851G>C	10.37:g.74970149G>C	ENSP00000242505:p.Ser284Thr	Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	204.0	13.0	NM_173348	Q9Y2I0	Missense_Mutation	SNP	ENST00000242505.6	37	CCDS44435.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.85|10.85	1.465605|1.465605	0.26335|0.26335	.|.	.|.	ENSG00000138286|ENSG00000138286	ENST00000372955|ENST00000242505;ENST00000429173;ENST00000445951	.|T;T	.|0.30981	.|2.72;1.51	4.8|4.8	2.5|2.5	0.30297|0.30297	.|.	.|0.551335	.|0.21446	.|N	.|0.074414	T|T	0.16981|0.16981	0.0408|0.0408	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|P;P;B;B	.|0.35174	.|0.488;0.469;0.224;0.332	.|B;B;B;B	.|0.29598	.|0.093;0.104;0.048;0.076	T|T	0.05435|0.05435	-1.0885|-1.0885	5|10	.|0.45353	.|T	.|0.12	-0.2802|-0.2802	5.2283|5.2283	0.15408|0.15408	0.3001:0.0:0.6999:0.0|0.3001:0.0:0.6999:0.0	.|.	.|262;74;284;284	.|B4E0M2;B3KN32;Q96BN6;Q96BN6-2	.|.;.;F149B_HUMAN;.	P|T	225|284;74;79	.|ENSP00000242505:S284T;ENSP00000402293:S79T	.|ENSP00000242505:S284T	A|S	+|+	1|2	0|0	FAM149B1|FAM149B1	74640155|74640155	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.867000|0.867000	0.49689|0.49689	0.626000|0.626000	0.24492|0.24492	1.118000|1.118000	0.41863|0.41863	0.561000|0.561000	0.74099|0.74099	GCT|AGC	.		0.388	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145438.1	NM_173348	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	39264479	39264479	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr13:39264479C>G	ENST00000280481.7	+	1	3214	c.2998C>G	c.(2998-3000)Cca>Gca	p.P1000A		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1000					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CAATGGCATTCCAGCAGAGCA	0.438																																					p.P1000A		.											.	FREM2	100	0			c.C2998G						.						137.0	140.0	139.0					13																	39264479		2203	4300	6503	SO:0001583	missense	341640	exon1			GGCATTCCAGCAG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2998C>G	13.37:g.39264479C>G	ENSP00000280481:p.Pro1000Ala	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	13.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	9.052	0.992225	0.18966	.	.	ENSG00000150893	ENST00000280481	T	0.22539	1.95	5.79	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.28466	0.0704	M	0.81179	2.53	0.80722	D	1	B	0.32338	0.365	B	0.30401	0.115	T	0.05599	-1.0875	10	0.29301	T	0.29	.	14.9625	0.71166	0.0:0.9314:0.0:0.0686	.	1000	Q5SZK8	FREM2_HUMAN	A	1000	ENSP00000280481:P1000A	ENSP00000280481:P1000A	P	+	1	0	FREM2	38162479	1.000000	0.71417	0.997000	0.53966	0.586000	0.36452	4.942000	0.63547	1.461000	0.47929	0.650000	0.86243	CCA	.		0.438	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
GFPT2	9945	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	179780211	179780211	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr5:179780211C>T	ENST00000253778.8	-	1	176	c.7G>A	c.(7-9)Gga>Aga	p.G3R		NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	3	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	CGGCACTCACCGCACATCGTG	0.776																																					p.G3R		.											.	GFPT2	92	0			c.G7A						.						3.0	6.0	5.0					5																	179780211		1400	3242	4642	SO:0001630	splice_region_variant	9945	exon1			ACTCACCGCACAT	AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.7+1G>A	5.37:g.179780211C>T		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	7.0	NM_005110	Q53XM2|Q9BWS4	Missense_Mutation	SNP	ENST00000253778.8	37	CCDS43411.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449614	0.84101	.	.	ENSG00000131459	ENST00000253778	D	0.83506	-1.73	3.8	3.8	0.43715	Glutamine amidotransferase, type II (1);Glutamine amidotransferase, class-II (1);	0.000000	0.85682	D	0.000000	D	0.94265	0.8158	H	0.98833	4.345	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95435	0.8520	9	.	.	.	-14.9935	11.8895	0.52620	0.0:1.0:0.0:0.0	.	3	O94808	GFPT2_HUMAN	R	3	ENSP00000253778:G3R	.	G	-	1	0	GFPT2	179712817	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	2.086000	0.41643	2.066000	0.61787	0.555000	0.69702	GGA	.		0.776	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	NM_005110	Missense_Mutation
GPR137C	283554	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	53098899	53098899	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr14:53098899G>A	ENST00000321662.6	+	4	739	c.739G>A	c.(739-741)Gtc>Atc	p.V247I		NM_001099652.1	NP_001093122.1	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C	247						integral component of membrane (GO:0016021)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8	Breast(41;0.0716)					GTGCCAGACTGTCGTCGTGGG	0.378																																					p.V247I		.											.	GPR137C	68	0			c.G739A						.						159.0	159.0	159.0					14																	53098899		1896	4123	6019	SO:0001583	missense	283554	exon4			CAGACTGTCGTCG	BX647179	CCDS45106.1	14q22.1	2012-08-10				ENSG00000180998			25445	protein-coding gene	gene with protein product							Standard	NM_001099652		Approved	DKFZp762F0713, TM7SF1L2	uc001wzu.4	Q8N3F9		ENST00000321662.6:c.739G>A	14.37:g.53098899G>A	ENSP00000315106:p.Val247Ile	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	12.0	NM_001099652	Q86SM2	Missense_Mutation	SNP	ENST00000321662.6	37	CCDS45106.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.43|14.43	2.533958|2.533958	0.45073|0.45073	.|.	.|.	ENSG00000180998|ENSG00000180998	ENST00000542169|ENST00000321662	.|T	.|0.42513	.|0.97	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.155710	.|0.64402	.|D	.|0.000020	T|T	0.24431|0.24431	0.0592|0.0592	L|L	0.27053|0.27053	0.805|0.805	0.35697|0.35697	D|D	0.81531|0.81531	.|B;B	.|0.24721	.|0.11;0.11	.|B;B	.|0.20184	.|0.028;0.028	T|T	0.16305|0.16305	-1.0407|-1.0407	5|10	.|0.05620	.|T	.|0.96	-20.8916|-20.8916	9.6536|9.6536	0.39912|0.39912	0.0807:0.1451:0.7741:0.0|0.0807:0.1451:0.7741:0.0	.|.	.|247;76	.|Q8N3F9;B3KW22	.|G137C_HUMAN;.	Y|I	216|247	.|ENSP00000315106:V247I	.|ENSP00000315106:V247I	C|V	+|+	2|1	0|0	GPR137C|GPR137C	52168649|52168649	0.994000|0.994000	0.37717|0.37717	0.985000|0.985000	0.45067|0.45067	0.984000|0.984000	0.73092|0.73092	2.651000|2.651000	0.46674|0.46674	2.789000|2.789000	0.95967|0.95967	0.591000|0.591000	0.81541|0.81541	TGT|GTC	.		0.378	GPR137C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411685.1	XM_290615	
GRIA3	2892	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	122536848	122536848	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chrX:122536848C>A	ENST00000371251.1	+	8	1136	c.1084C>A	c.(1084-1086)Caa>Aaa	p.Q362K	GRIA3_ENST00000264357.5_Missense_Mutation_p.Q362K|GRIA3_ENST00000371256.5_Missense_Mutation_p.Q362K|GRIA3_ENST00000541091.1_Missense_Mutation_p.Q346K|GRIA3_ENST00000542149.1_Missense_Mutation_p.Q362K			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	362					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	CTACCAGGTGCAAGTACAAGG	0.378																																					p.Q362K		.											.	GRIA3	134	0			c.C1084A						.						133.0	135.0	134.0					X																	122536848		2203	4299	6502	SO:0001583	missense	2892	exon8			CAGGTGCAAGTAC	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1084C>A	X.37:g.122536848C>A	ENSP00000360297:p.Gln362Lys	Somatic	500.0	2.0		WXS	Illumina HiSeq	Phase_I	548.0	31.0	NM_000828	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987481	0.53934	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251;ENST00000541091	T;T;T;T;T	0.16457	2.34;2.34;2.34;2.34;2.34	5.55	5.55	0.83447	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.14098	0.0341	N	0.20685	0.6	0.80722	D	1	B;B;B	0.26258	0.008;0.145;0.12	B;B;B	0.22601	0.037;0.04;0.023	T	0.04693	-1.0933	10	0.66056	D	0.02	.	17.3778	0.87397	0.0:1.0:0.0:0.0	.	346;362;362	B7Z4C0;P42263;P42263-2	.;GRIA3_HUMAN;.	K	362;362;362;362;346	ENSP00000264357:Q362K;ENSP00000446146:Q362K;ENSP00000360302:Q362K;ENSP00000360297:Q362K;ENSP00000446440:Q346K	ENSP00000264357:Q362K	Q	+	1	0	GRIA3	122364529	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.317000	0.78254	0.594000	0.82650	CAA	.		0.378	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
GRM4	2914	broad.mit.edu;bcgsc.ca	37	6	34003577	34003577	+	Silent	SNP	A	A	G			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr6:34003577A>G	ENST00000538487.2	-	9	2753	c.2310T>C	c.(2308-2310)taT>taC	p.Y770Y	GRM4_ENST00000374181.4_Silent_p.Y770Y|GRM4_ENST00000374177.3_Silent_p.Y654Y|GRM4_ENST00000609222.1_Silent_p.Y637Y|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000535756.1_Silent_p.Y637Y|GRM4_ENST00000455714.2_Silent_p.Y630Y|GRM4_ENST00000544773.2_Silent_p.Y601Y	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	770					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TCTTGATGGCATACACGGTGC	0.597																																					p.Y770Y		.											.	GRM4	525	0			c.T2310C						.						116.0	83.0	94.0					6																	34003577		2203	4300	6503	SO:0001819	synonymous_variant	2914	exon9			GATGGCATACACG	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.2310T>C	6.37:g.34003577A>G		Somatic	102.0	1.0		WXS	Illumina HiSeq	Phase_I	173.0	11.0	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Silent	SNP	ENST00000538487.2	37	CCDS4787.1																																																																																			.		0.597	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
HHATL	57467	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	42738590	42738590	+	Missense_Mutation	SNP	C	C	T	rs202043526		TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr3:42738590C>T	ENST00000441594.1	-	8	1174	c.913G>A	c.(913-915)Gtc>Atc	p.V305I	HHATL_ENST00000310417.5_Missense_Mutation_p.V305I	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	305					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		CCAAAGAGGACGGCCGCCTTC	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18244	0.0		0.0	False		,,,				2504	0.0				p.V305I		.											.	HHATL	93	0			c.G913A						.						109.0	82.0	91.0					3																	42738590		2203	4300	6503	SO:0001583	missense	57467	exon8			AGAGGACGGCCGC	AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.913G>A	3.37:g.42738590C>T	ENSP00000405423:p.Val305Ile	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	7.0	NM_020707	Q8TBG3|Q9ULP7	Missense_Mutation	SNP	ENST00000441594.1	37	CCDS2704.1	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	c|c	12.75|12.75	2.031050|2.031050	0.35797|0.35797	.|.	.|.	ENSG00000010282|ENSG00000010282	ENST00000426666;ENST00000341477|ENST00000310417;ENST00000441594;ENST00000457462	.|T;T;T	.|0.71461	.|-0.57;-0.57;1.18	4.39|4.39	3.52|3.52	0.40303|0.40303	.|.	.|0.059808	.|0.64402	.|D	.|0.000002	T|T	0.68210|0.68210	0.2976|0.2976	M|M	0.86343|0.86343	2.81|2.81	0.80722|0.80722	D|D	1|1	.|P	.|0.48230	.|0.907	.|B	.|0.37144	.|0.242	T|T	0.69899|0.69899	-0.5020|-0.5020	6|10	0.30078|0.13470	T|T	0.28|0.59	-32.2517|-32.2517	12.7675|12.7675	0.57401|0.57401	0.0:0.9192:0.0:0.0808|0.0:0.9192:0.0:0.0808	.|.	.|305	.|Q9HCP6	.|HHATL_HUMAN	H|I	1;212|305;305;240	.|ENSP00000310621:V305I;ENSP00000405423:V305I;ENSP00000403787:V240I	ENSP00000341177:R212H|ENSP00000310621:V305I	R|V	-|-	2|1	0|0	HHATL|HHATL	42713594|42713594	0.995000|0.995000	0.38212|0.38212	0.731000|0.731000	0.30826|0.30826	0.515000|0.515000	0.34225|0.34225	3.257000|3.257000	0.51500|0.51500	0.978000|0.978000	0.38470|0.38470	-0.148000|-0.148000	0.13756|0.13756	CGT|GTC	C|1.000;T|0.000		0.622	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343627.1	NM_020707	
KIAA1210	57481	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	118250523	118250523	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chrX:118250523A>G	ENST00000402510.2	-	4	585	c.586T>C	c.(586-588)Tcc>Ccc	p.S196P		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	196										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TTGCTGCTGGACAAGCTCAGT	0.453																																					p.S196P		.											.	KIAA1210	67	0			c.T586C						.						189.0	165.0	173.0					X																	118250523		1965	4138	6103	SO:0001583	missense	57481	exon4			TGCTGGACAAGCT	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.586T>C	X.37:g.118250523A>G	ENSP00000384670:p.Ser196Pro	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	13.0	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	A	15.11	2.736729	0.49045	.	.	ENSG00000250423;ENSG00000241087	ENST00000402510;ENST00000420240	T	0.18810	2.19	5.14	3.98	0.46160	.	.	.	.	.	T	0.13798	0.0334	N	0.14661	0.345	0.09310	N	1	P	0.50710	0.938	P	0.44647	0.456	T	0.07790	-1.0754	9	0.44086	T	0.13	.	6.9514	0.24548	0.8942:0.0:0.1058:0.0	.	196	Q9ULL0	K1210_HUMAN	P	196;32	ENSP00000384670:S196P	ENSP00000396164:S32P	S	-	1	0	RP13-347D8.5;RP13-347D8.6	118134551	0.889000	0.30405	0.006000	0.13384	0.002000	0.02628	1.703000	0.37846	0.731000	0.32448	0.486000	0.48141	TCC	.		0.453	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
KLHL9	55958	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	21334572	21334572	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr9:21334572T>G	ENST00000359039.4	-	1	807	c.287A>C	c.(286-288)cAt>cCt	p.H96P	KLHL9_ENST00000537938.1_Missense_Mutation_p.H28P			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	96	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)				endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		GTTCACCCCATGAAGCTTAAT	0.383																																					p.H96P		.											.	KLHL9	94	0			c.A287C						.						138.0	128.0	132.0					9																	21334572		2203	4300	6503	SO:0001583	missense	55958	exon1			ACCCCATGAAGCT	AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.287A>C	9.37:g.21334572T>G	ENSP00000351933:p.His96Pro	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	193.0	14.0	NM_018847	Q8TCQ2	Missense_Mutation	SNP	ENST00000359039.4	37	CCDS6503.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.471571	0.43942	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	T;T	0.65549	-0.16;-0.16	5.49	5.49	0.81192	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.71643	0.3364	L	0.43598	1.365	0.80722	D	1	D	0.65815	0.995	D	0.70227	0.968	T	0.73260	-0.4039	10	0.56958	D	0.05	.	13.8561	0.63527	0.0:0.0:0.0:1.0	.	96	Q9P2J3	KLHL9_HUMAN	P	96;28	ENSP00000351933:H96P;ENSP00000437733:H28P	ENSP00000351933:H96P	H	-	2	0	KLHL9	21324572	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.217000	0.72218	2.222000	0.72286	0.533000	0.62120	CAT	.		0.383	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847	
KRT73	319101	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	53007536	53007536	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr12:53007536C>T	ENST00000305748.3	-	5	954	c.920G>A	c.(919-921)cGt>cAt	p.R307H	RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	307	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		ATACTGGGCACGGACCTCAGC	0.582																																					p.R307H		.											.	KRT73	157	0			c.G920A						.						144.0	121.0	129.0					12																	53007536		2203	4300	6503	SO:0001583	missense	319101	exon5			TGGGCACGGACCT	AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.920G>A	12.37:g.53007536C>T	ENSP00000307014:p.Arg307His	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	6.0	NM_175068	Q32MB2	Missense_Mutation	SNP	ENST00000305748.3	37	CCDS8834.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.199922	0.58126	.	.	ENSG00000186049	ENST00000305748;ENST00000552855	D;D	0.93307	-3.2;-3.2	5.07	4.16	0.48862	Filament (1);	0.000000	0.49916	D	0.000133	D	0.93789	0.8014	H	0.95745	3.715	0.09310	N	1	P	0.36633	0.562	B	0.36186	0.219	D	0.90605	0.4547	10	0.87932	D	0	.	4.0	0.09576	0.2031:0.6029:0.0:0.194	.	307	Q86Y46	K2C73_HUMAN	H	307;52	ENSP00000307014:R307H;ENSP00000449081:R52H	ENSP00000307014:R307H	R	-	2	0	KRT73	51293803	0.000000	0.05858	0.287000	0.24848	0.941000	0.58515	0.199000	0.17237	1.240000	0.43803	0.655000	0.94253	CGT	.		0.582	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068	
KSR2	283455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	118198839	118198839	+	Silent	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr12:118198839G>A	ENST00000339824.5	-	4	1690	c.963C>T	c.(961-963)cgC>cgT	p.R321R	KSR2_ENST00000425217.1_Silent_p.R292R			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	321					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCTCGTCCACGCGGTGCCCCA	0.677																																					p.R292R		.											.	KSR2	1449	0			c.C876T						.						44.0	54.0	51.0					12																	118198839		1973	4161	6134	SO:0001819	synonymous_variant	283455	exon4			GTCCACGCGGTGC	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.963C>T	12.37:g.118198839G>A		Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	7.0	NM_173598	A0PJT2|Q3B828|Q8N775	Silent	SNP	ENST00000339824.5	37																																																																																				.		0.677	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
LHPP	64077	broad.mit.edu;bcgsc.ca	37	10	126150438	126150438	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr10:126150438C>T	ENST00000368842.5	+	1	35	c.7C>T	c.(7-9)Ccg>Tcg	p.P3S	LHPP_ENST00000368839.1_Missense_Mutation_p.P3S|LHPP_ENST00000392757.4_Missense_Mutation_p.P3S	NM_022126.3	NP_071409.3	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic pyrophosphate phosphatase	3					phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|phosphohistidine phosphatase activity (GO:0008969)|protein homodimerization activity (GO:0042803)			large_intestine(2)|lung(2)	4		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		CGCCATGGCACCGTGGGGCAA	0.781																																					p.P3S	GBM(165;1980 2715 15999 18454)	.											.	LHPP	90	0			c.C7T						.						7.0	6.0	6.0					10																	126150438		1897	3801	5698	SO:0001583	missense	64077	exon1			ATGGCACCGTGGG	AB049629	CCDS7640.1, CCDS53587.1	10q26.2	2010-02-17			ENSG00000107902	ENSG00000107902	3.6.1.1		30042	protein-coding gene	gene with protein product						12801912, 16430861	Standard	NM_022126		Approved	HDHD2B	uc001lhs.2	Q9H008	OTTHUMG00000019214	ENST00000368842.5:c.7C>T	10.37:g.126150438C>T	ENSP00000357835:p.Pro3Ser	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	6.0	NM_022126	B3KP20|Q2TBE9|Q5VUV9|Q5VUW0	Missense_Mutation	SNP	ENST00000368842.5	37	CCDS7640.1	.	.	.	.	.	.	.	.	.	.	C	7.815	0.716618	0.15306	.	.	ENSG00000107902	ENST00000392757;ENST00000368842;ENST00000368839	T;T;T	0.28069	1.64;1.63;1.64	4.36	3.45	0.39498	.	0.460117	0.21417	N	0.074881	T	0.11965	0.0291	N	0.08118	0	0.20975	N	0.999813	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.0;0.0;0.001	T	0.26189	-1.0110	10	0.12103	T	0.63	-14.0177	4.447	0.11602	0.0884:0.1617:0.5973:0.1527	.	3;3;3	Q5T1Z0;Q9H008-2;Q9H008	.;.;LHPP_HUMAN	S	3	ENSP00000376512:P3S;ENSP00000357835:P3S;ENSP00000357832:P3S	ENSP00000357832:P3S	P	+	1	0	LHPP	126140428	0.032000	0.19561	0.965000	0.40720	0.019000	0.09904	0.443000	0.21644	1.184000	0.42957	-0.344000	0.07964	CCG	.		0.781	LHPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050870.1	NM_022126	
MAPK6	5597	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	52342240	52342240	+	Silent	SNP	T	T	G			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr15:52342240T>G	ENST00000261845.5	+	3	1413	c.606T>G	c.(604-606)ctT>ctG	p.L202L		NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	202	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CTCCACGTCTTTTACTTTCTC	0.363																																					p.L202L		.											.	MAPK6	1403	0			c.T606G						.						92.0	98.0	96.0					15																	52342240		2195	4293	6488	SO:0001819	synonymous_variant	5597	exon3			ACGTCTTTTACTT	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.606T>G	15.37:g.52342240T>G		Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	6.0	NM_002748	B2R945|B5BU65|Q68DH4|Q8IYN8	Silent	SNP	ENST00000261845.5	37	CCDS10147.1																																																																																			T|1.000;|0.000		0.363	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748	
MED27	9442	hgsc.bcm.edu;broad.mit.edu	37	9	134735980	134735980	+	Missense_Mutation	SNP	G	G	A	rs557626461	byFrequency	TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr9:134735980G>A	ENST00000292035.5	-	8	944	c.881C>T	c.(880-882)cCg>cTg	p.P294L	MED27_ENST00000357028.2_Missense_Mutation_p.P258L	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	294					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.P294L(4)|p.P294fs*>18(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		CCTCCATGTCGGGGGAAGGCC	0.597													G|||	40	0.00798722	0.003	0.0072	5008	,	,		18345	0.0		0.0169	False		,,,				2504	0.0143				p.P294L	Colon(41;784 923 6932 42329 52483)	.											.	MED27	69	5	Substitution - Missense(4)|Deletion - Frameshift(1)	endometrium(2)|kidney(2)|large_intestine(1)	c.C881T						.						30.0	29.0	29.0					9																	134735980		2203	4300	6503	SO:0001583	missense	9442	exon8			CATGTCGGGGGAA	AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.881C>T	9.37:g.134735980G>A	ENSP00000292035:p.Pro294Leu	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	7.0	NM_004269	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Missense_Mutation	SNP	ENST00000292035.5	37	CCDS6945.1	.	.	.	.	.	.	.	.	.	.	G	31	5.095595	0.94197	.	.	ENSG00000160563	ENST00000292035;ENST00000357028;ENST00000372184	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.84014	0.5379	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.992;1.0	D	0.86894	0.2050	9	0.87932	D	0	-0.1478	16.105	0.81213	0.0:0.0:1.0:0.0	.	258;294	Q6P2C8-2;Q6P2C8	.;MED27_HUMAN	L	294;220;258	.	ENSP00000292035:P294L	P	-	2	0	MED27	133725801	1.000000	0.71417	0.949000	0.38748	0.987000	0.75469	7.762000	0.85270	2.472000	0.83506	0.655000	0.94253	CCG	.		0.597	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1080902	1080902	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr11:1080902T>A	ENST00000441003.2	+	10	1313	c.1286T>A	c.(1285-1287)cTg>cAg	p.L429Q	MUC2_ENST00000359061.5_Missense_Mutation_p.L429Q	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	429	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TACGCTCTCCTGGGCGAGCTG	0.647																																					p.L429Q		.											.	MUC2	90	0			c.T1286A						.						58.0	66.0	63.0					11																	1080902		2080	4207	6287	SO:0001583	missense	4583	exon10			CTCTCCTGGGCGA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.1286T>A	11.37:g.1080902T>A	ENSP00000415183:p.Leu429Gln	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	7.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	T	10.23	1.292151	0.23564	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.61627	0.09;0.09	3.57	3.57	0.40892	.	0.000000	0.48286	U	0.000200	T	0.70509	0.3232	M	0.68593	2.085	0.34140	D	0.666289	D	0.56035	0.974	D	0.64877	0.93	T	0.80708	-0.1262	10	0.72032	D	0.01	.	12.305	0.54898	0.0:0.0:0.0:1.0	.	429	E7EUV1	.	Q	429	ENSP00000415183:L429Q;ENSP00000351956:L429Q	ENSP00000351956:L429Q	L	+	2	0	MUC2	1070902	1.000000	0.71417	0.977000	0.42913	0.174000	0.22865	3.746000	0.55127	1.513000	0.48852	0.358000	0.22013	CTG	.		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	29592318	29592318	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr17:29592318C>A	ENST00000358273.4	+	36	5179	c.4796C>A	c.(4795-4797)tCc>tAc	p.S1599Y	NF1_ENST00000356175.3_Missense_Mutation_p.S1578Y	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1599	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCTGGGACTTCCAAAGCTGGG	0.313			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.S1599Y		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	3353	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.C4796A	GRCh37	CM077303	NF1	M		.						66.0	68.0	67.0					17																	29592318		2203	4297	6500	SO:0001583	missense	4763	exon36	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	GGACTTCCAAAGC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4796C>A	17.37:g.29592318C>A	ENSP00000351015:p.Ser1599Tyr	Somatic	268.0	0.0		WXS	Illumina HiSeq	Phase_I	303.0	19.0	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887938	0.91814	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.60548	0.18;0.18;0.18	5.9	5.9	0.94986	Cellular retinaldehyde-binding/triple function, C-terminal (2);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79375	0.4435	M	0.79805	2.47	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.80578	-0.1320	10	0.87932	D	0	.	20.2789	0.98501	0.0:1.0:0.0:0.0	.	628;1578;1599	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	Y	1599;1578;1244	ENSP00000351015:S1599Y;ENSP00000348498:S1578Y;ENSP00000389907:S1244Y	ENSP00000348498:S1578Y	S	+	2	0	NF1	26616444	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.266000	0.78452	2.788000	0.95919	0.650000	0.86243	TCC	.		0.313	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
NAGLU	4669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40689487	40689487	+	Missense_Mutation	SNP	G	G	A	rs141018386		TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr17:40689487G>A	ENST00000225927.2	+	2	556	c.455G>A	c.(454-456)cGa>cAa	p.R152Q	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	152					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	CGCTGGGAGCGAGAGATAGAC	0.632																																					p.R152Q		.											.	NAGLU	90	0			c.G455A						.	G	GLN/ARG	0,4406		0,0,2203	132.0	115.0	121.0		455	-5.5	0.4	17	dbSNP_134	121	1,8599	1.2+/-3.3	0,1,4299	no	missense	NAGLU	NM_000263.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	152/744	40689487	1,13005	2203	4300	6503	SO:0001583	missense	4669	exon2			GGGAGCGAGAGAT		CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.455G>A	17.37:g.40689487G>A	ENSP00000225927:p.Arg152Gln	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	10.0	NM_000263		Missense_Mutation	SNP	ENST00000225927.2	37	CCDS11427.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587036	0.46110	0.0	1.16E-4	ENSG00000108784	ENST00000225927	D	0.98028	-4.67	4.3	-5.49	0.02584	Alpha-N-acetylglucosaminidase, tim-barrel domain (1);	0.744172	0.12823	N	0.436305	D	0.93363	0.7884	L	0.41356	1.27	0.09310	N	0.999996	P	0.35527	0.507	B	0.25614	0.062	T	0.82615	-0.0370	10	0.38643	T	0.18	-0.3759	15.2631	0.73640	0.3206:0.0:0.6794:0.0	.	152	P54802	ANAG_HUMAN	Q	152	ENSP00000225927:R152Q	ENSP00000225927:R152Q	R	+	2	0	NAGLU	37943013	0.000000	0.05858	0.438000	0.26821	0.987000	0.75469	0.127000	0.15790	-1.119000	0.02958	-0.291000	0.09656	CGA	G|1.000;A|0.000		0.632	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263	
NPTXR	23467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	39222683	39222683	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr22:39222683G>T	ENST00000333039.2	-	3	1043	c.920C>A	c.(919-921)gCc>gAc	p.A307D		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	307	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					CCGCACGCGGGCGTACATGTA	0.632																																					p.A307D	Pancreas(139;2521 3281 36965)	.											.	NPTXR	92	0			c.C920A						.						94.0	84.0	87.0					22																	39222683		2203	4300	6503	SO:0001583	missense	23467	exon3			ACGCGGGCGTACA	AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.920C>A	22.37:g.39222683G>T	ENSP00000327545:p.Ala307Asp	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	13.0	NM_014293		Missense_Mutation	SNP	ENST00000333039.2	37	CCDS33647.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872137	0.72180	.	.	ENSG00000221890	ENST00000333039	T	0.06528	3.29	4.64	2.48	0.30137	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.053901	0.64402	D	0.000001	T	0.29491	0.0735	M	0.88979	2.995	0.35904	D	0.830572	D	0.76494	0.999	D	0.72075	0.976	T	0.55068	-0.8198	9	0.72032	D	0.01	-39.9976	16.1083	0.81241	0.0:0.5096:0.4904:0.0	.	307	O95502	NPTXR_HUMAN	D	307	ENSP00000327545:A307D	ENSP00000327545:A307D	A	-	2	0	NPTXR	37552629	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.328000	0.33758	0.833000	0.34828	0.655000	0.94253	GCC	.		0.632	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318194.2	NM_014293	
OR2W5	441932	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	247655366	247655366	+	RNA	SNP	G	G	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr1:247655366G>T	ENST00000522351.1	+	0	997							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G313R(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			AAGGGGCTGGGGAGCCTCAAC	0.493																																					p.G313X		.											.	OR2W5	115	1	Substitution - Missense(1)	skin(1)	c.G937T						.						55.0	59.0	57.0					1																	247655366		2203	4300	6503			441932	exon1			GGCTGGGGAGCCT			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655366G>T		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	6.0	NM_001004698	B9EH85	Nonsense_Mutation	SNP	ENST00000522351.1	37																																																																																				.		0.493	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698	
OR51S1	119692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4869689	4869689	+	Silent	SNP	G	G	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr11:4869689G>T	ENST00000322101.2	-	1	825	c.750C>A	c.(748-750)gcC>gcA	p.A250A	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGAGAGGTGGGCAGCACAGG	0.512																																					p.A250A		.											.	OR51S1	72	0			c.C750A						.						97.0	83.0	88.0					11																	4869689		2201	4298	6499	SO:0001819	synonymous_variant	119692	exon1			GAGGTGGGCAGCA	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.750C>A	11.37:g.4869689G>T		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	13.0	NM_001004758	B9EGZ1|Q6IFI2	Silent	SNP	ENST00000322101.2	37	CCDS31362.1																																																																																			.		0.512	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758	
OXTR	5021	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	8809008	8809008	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr3:8809008G>A	ENST00000316793.3	-	3	1490	c.866C>T	c.(865-867)aCg>aTg	p.T289M	CAV3_ENST00000472766.1_Intron	NM_000916.3	NP_000907.2	P30559	OXYR_HUMAN	oxytocin receptor	289					cell surface receptor signaling pathway (GO:0007166)|digestive tract development (GO:0048565)|eating behavior (GO:0042755)|ERK1 and ERK2 cascade (GO:0070371)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|heart development (GO:0007507)|lactation (GO:0007595)|maternal behavior (GO:0042711)|maternal process involved in parturition (GO:0060137)|memory (GO:0007613)|muscle contraction (GO:0006936)|negative regulation of gastric acid secretion (GO:0060455)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of penile erection (GO:0060406)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of uterine smooth muscle contraction (GO:0070474)|response to amphetamine (GO:0001975)|response to anoxia (GO:0034059)|response to cocaine (GO:0042220)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|suckling behavior (GO:0001967)|telencephalon development (GO:0021537)	apical plasma membrane (GO:0016324)|cell-cell adherens junction (GO:0005913)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	oxytocin receptor activity (GO:0004990)|peptide hormone binding (GO:0017046)|vasopressin receptor activity (GO:0005000)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)|Oxytocin(DB00107)	GAAGAAAGGCGTCCAGCACAC	0.612																																					p.T289M		.											.	OXTR	68	0			c.C866T						.						46.0	40.0	42.0					3																	8809008		2203	4300	6503	SO:0001583	missense	5021	exon3			AAAGGCGTCCAGC		CCDS2570.1	3p25	2012-08-08			ENSG00000180914	ENSG00000180914		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	8529	protein-coding gene	gene with protein product		167055				1313946	Standard	NM_000916		Approved		uc003brc.3	P30559	OTTHUMG00000090537	ENST00000316793.3:c.866C>T	3.37:g.8809008G>A	ENSP00000324270:p.Thr289Met	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	9.0	NM_000916	Q15071	Missense_Mutation	SNP	ENST00000316793.3	37	CCDS2570.1	.	.	.	.	.	.	.	.	.	.	G	32	5.111847	0.94339	.	.	ENSG00000180914	ENST00000316793	T	0.72615	-0.67	4.97	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.81470	0.4829	M	0.76002	2.32	0.80722	D	1	D	0.62365	0.991	P	0.58077	0.832	D	0.84171	0.0434	10	0.72032	D	0.01	-40.8917	17.1817	0.86857	0.0:0.0:1.0:0.0	.	289	P30559	OXYR_HUMAN	M	289	ENSP00000324270:T289M	ENSP00000324270:T289M	T	-	2	0	OXTR	8784008	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.731000	0.98807	2.466000	0.83321	0.561000	0.74099	ACG	.		0.612	OXTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207061.2		
PCDHGB7	56099	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140799054	140799054	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr5:140799054G>T	ENST00000398594.2	+	1	1628	c.1628G>T	c.(1627-1629)aGc>aTc	p.S543I	PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_5'Flank	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	543	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGCGCTCAGCGCCAATGTG	0.711																																					p.S543I		.											.	PCDHGB7	29	0			c.G1628T						.						26.0	32.0	30.0					5																	140799054		2059	4181	6240	SO:0001583	missense	56099	exon1			CGCTCAGCGCCAA	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1628G>T	5.37:g.140799054G>T	ENSP00000381594:p.Ser543Ile	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	8.0	NM_018927	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	g	17.39	3.376355	0.61735	.	.	ENSG00000254122	ENST00000398594	T	0.55930	0.49	5.38	5.38	0.77491	Cadherin (4);Cadherin-like (1);	0.489979	0.14288	U	0.329061	T	0.67896	0.2942	M	0.75264	2.295	0.25114	N	0.990695	D;P	0.53151	0.958;0.907	P;P	0.58210	0.835;0.751	T	0.62609	-0.6818	10	0.87932	D	0	.	12.1429	0.54008	0.0793:0.0:0.9207:0.0	.	543;543	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	I	543	ENSP00000381594:S543I	ENSP00000381594:S543I	S	+	2	0	PCDHGB7	140779238	0.992000	0.36948	1.000000	0.80357	0.858000	0.48976	4.904000	0.63279	2.513000	0.84729	0.491000	0.48974	AGC	.		0.711	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
PCNXL2	80003	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	233394746	233394746	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr1:233394746C>G	ENST00000258229.9	-	5	1096	c.862G>C	c.(862-864)Gtc>Ctc	p.V288L	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	288						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GGACAACTGACAGGTTCTGGA	0.532																																					p.V288L		.											.	PCNXL2	91	0			c.G862C						.						60.0	62.0	62.0					1																	233394746		1941	4131	6072	SO:0001583	missense	80003	exon5			AACTGACAGGTTC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.862G>C	1.37:g.233394746C>G	ENSP00000258229:p.Val288Leu	Somatic	74.0	1.0		WXS	Illumina HiSeq	Phase_I	91.0	15.0	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	C	8.734	0.917301	0.17982	.	.	ENSG00000135749	ENST00000258229	T	0.62639	0.01	4.07	-5.21	0.02815	.	.	.	.	.	T	0.28599	0.0708	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.36578	-0.9742	9	0.02654	T	1	.	0.4453	0.00492	0.1818:0.2671:0.2099:0.3411	.	288	A6NKB5	PCX2_HUMAN	L	288	ENSP00000258229:V288L	ENSP00000258229:V288L	V	-	1	0	PCNXL2	231461369	0.000000	0.05858	0.000000	0.03702	0.428000	0.31595	-0.566000	0.05922	-0.810000	0.04375	-0.314000	0.08810	GTC	.		0.532	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
PNPLA6	10908	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	7615936	7615936	+	Silent	SNP	G	G	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr19:7615936G>A	ENST00000221249.6	+	20	2441	c.2010G>A	c.(2008-2010)acG>acA	p.T670T	PNPLA6_ENST00000414982.3_Silent_p.T718T|PNPLA6_ENST00000450331.3_Silent_p.T670T|PNPLA6_ENST00000600737.1_Silent_p.T709T|PNPLA6_ENST00000545201.2_Silent_p.T644T	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	709					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						TGCGCGACACGGAGCTGGCCA	0.706																																					p.T718T		.											.	PNPLA6	47	0			c.G2154A						.						5.0	6.0	5.0					19																	7615936		2021	3905	5926	SO:0001819	synonymous_variant	10908	exon19			CGACACGGAGCTG	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2010G>A	19.37:g.7615936G>A		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	7.0	NM_001166111	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	ENST00000221249.6	37	CCDS32891.1																																																																																			.		0.706	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
POLG	5428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	89866679	89866679	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr15:89866679C>A	ENST00000268124.5	-	13	2554	c.2221G>T	c.(2221-2223)Gac>Tac	p.D741Y	POLG_ENST00000442287.2_Missense_Mutation_p.D741Y	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	741					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			ATGTCCACGTCGTTGTAAGGT	0.582								DNA polymerases (catalytic subunits)																													p.D741Y	Colon(73;648 1203 11348 18386 27782)	.											.	POLG	228	0			c.G2221T						.						182.0	127.0	145.0					15																	89866679		2200	4299	6499	SO:0001583	missense	5428	exon13			CCACGTCGTTGTA	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.2221G>T	15.37:g.89866679C>A	ENSP00000268124:p.Asp741Tyr	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	4.0	NM_002693	Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890552	0.91889	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.97016	-4.21;-4.21	5.57	5.57	0.84162	DNA-directed DNA polymerase, family A, palm domain (1);	0.000000	0.85682	D	0.000000	D	0.97983	0.9336	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.98539	1.0631	10	0.72032	D	0.01	-15.7528	19.5413	0.95275	0.0:1.0:0.0:0.0	.	741	P54098	DPOG1_HUMAN	Y	741	ENSP00000268124:D741Y;ENSP00000399851:D741Y	ENSP00000268124:D741Y	D	-	1	0	POLG	87667683	1.000000	0.71417	0.763000	0.31416	0.953000	0.61014	7.649000	0.83500	2.640000	0.89533	0.650000	0.86243	GAC	.		0.582	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
PRKACA	5566	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14208612	14208612	+	Silent	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr19:14208612C>T	ENST00000308677.4	-	6	706	c.510G>A	c.(508-510)ccG>ccA	p.P170P	PRKACA_ENST00000350356.3_5'UTR|PRKACA_ENST00000590853.1_Intron|PRKACA_ENST00000589994.1_Silent_p.P162P	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						GCAGATTCTCCGGCTTCAGGT	0.627																																					p.P170P		.											.	PRKACA	978	0			c.G510A						.						78.0	76.0	76.0					19																	14208612		2203	4300	6503	SO:0001819	synonymous_variant	5566	exon6			ATTCTCCGGCTTC		CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.510G>A	19.37:g.14208612C>T		Somatic	100.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	10.0	NM_002730	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Silent	SNP	ENST00000308677.4	37	CCDS12304.1																																																																																			.		0.627	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459004.1	NM_002730	
PRKCA	5578	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	64800042	64800042	+	Missense_Mutation	SNP	G	G	A	rs141376042	byFrequency	TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr17:64800042G>A	ENST00000413366.3	+	17	1932	c.1906G>A	c.(1906-1908)Gtc>Atc	p.V636I		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	636	AGC-kinase C-terminal.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	AGGACAGCCCGTCTTAACACC	0.458													G|||	11	0.00219649	0.0076	0.0014	5008	,	,		19722	0.0		0.0	False		,,,				2504	0.0				p.V636I		.											.	PRKCA	1404	0			c.G1906A						.	G	ILE/VAL	36,4370	41.6+/-74.8	0,36,2167	155.0	130.0	139.0		1906	4.6	0.3	17	dbSNP_134	139	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PRKCA	NM_002737.2	29	0,37,6466	AA,AG,GG		0.0116,0.8171,0.2845	benign	636/673	64800042	37,12969	2203	4300	6503	SO:0001583	missense	5578	exon17			CAGCCCGTCTTAA		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1906G>A	17.37:g.64800042G>A	ENSP00000408695:p.Val636Ile	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	7.0	NM_002737	B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	37	CCDS11664.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	5.709	0.315270	0.10789	0.008171	1.16E-4	ENSG00000154229	ENST00000413366	T	0.53640	0.61	5.57	4.6	0.57074	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.393371	0.22732	N	0.056315	T	0.28234	0.0697	L	0.27975	0.815	0.32988	D	0.524532	B	0.02656	0.0	B	0.06405	0.002	T	0.37291	-0.9712	10	0.35671	T	0.21	.	14.3942	0.67001	0.0707:0.0:0.9293:0.0	.	636	P17252	KPCA_HUMAN	I	636	ENSP00000408695:V636I	ENSP00000408695:V636I	V	+	1	0	PRKCA	62230504	1.000000	0.71417	0.269000	0.24586	0.084000	0.17831	3.922000	0.56462	1.363000	0.46019	-0.136000	0.14681	GTC	G|0.998;A|0.002		0.458	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1		
SBK2	646643	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56042689	56042689	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr19:56042689G>T	ENST00000413299.1	-	3	314	c.277C>A	c.(277-279)Ctc>Atc	p.L93I	SBK2_ENST00000344158.3_Missense_Mutation_p.L93I	NM_001101401.2	NP_001094871.2	P0C263	SBK2_HUMAN	SH3 domain binding kinase family, member 2	93	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9						GGTTTCGGGAGCTGCTTCAGT	0.672																																					p.L93I		.											.	SBK2	68	0			c.C277A						.						31.0	38.0	36.0					19																	56042689		2108	4231	6339	SO:0001583	missense	646643	exon3			TCGGGAGCTGCTT		CCDS42631.1	19q13.42	2013-09-27	2013-09-27		ENSG00000187550	ENSG00000187550			34416	protein-coding gene	gene with protein product			"""SH3-binding domain kinase family, member 2"""				Standard	NM_001101401		Approved	SGK069	uc010ygc.2	P0C263	OTTHUMG00000155830	ENST00000413299.1:c.277C>A	19.37:g.56042689G>T	ENSP00000389015:p.Leu93Ile	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	4.0	NM_001101401		Missense_Mutation	SNP	ENST00000413299.1	37	CCDS42631.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.613675	0.66672	.	.	ENSG00000187550	ENST00000413299;ENST00000344158	T;T	0.51325	0.71;0.71	4.89	4.89	0.63831	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.069429	0.64402	D	0.000017	T	0.36991	0.0987	N	0.12443	0.215	0.36012	D	0.8381	P	0.42456	0.78	P	0.49252	0.604	T	0.39663	-0.9603	10	0.24483	T	0.36	-46.0173	11.0712	0.48004	0.0:0.0:0.8144:0.1856	.	93	P0C263	SBK2_HUMAN	I	93	ENSP00000389015:L93I;ENSP00000345044:L93I	ENSP00000345044:L93I	L	-	1	0	SBK2	60734501	0.052000	0.20516	1.000000	0.80357	0.707000	0.40811	0.305000	0.19254	2.415000	0.81967	0.561000	0.74099	CTC	.		0.672	SBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341919.1	NM_001101401	
SCAF4	57466	broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	33077755	33077755	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr21:33077755A>T	ENST00000286835.7	-	3	522	c.140T>A	c.(139-141)gTa>gAa	p.V47E	SCAF4_ENST00000434667.3_Intron|SCAF4_ENST00000399804.1_Missense_Mutation_p.V47E	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	47	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GAACTTTTCTACTATTTGAAC	0.234																																					p.V47E		.											.	SCAF4	90	0			c.T140A						.						33.0	37.0	35.0					21																	33077755		2159	4251	6410	SO:0001583	missense	57466	exon3			TTTTCTACTATTT	AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.140T>A	21.37:g.33077755A>T	ENSP00000286835:p.Val47Glu	Somatic	289.0	1.0		WXS	Illumina HiSeq	Phase_I	277.0	19.0	NM_020706	C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	ENST00000286835.7	37	CCDS33537.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825151	0.71143	.	.	ENSG00000156304	ENST00000286835;ENST00000399804	T;T	0.52983	0.64;0.64	6.17	6.17	0.99709	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);	0.000000	0.85682	D	0.000000	T	0.74230	0.3689	M	0.88105	2.93	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.996;0.998;0.996	T	0.79420	-0.1811	10	0.87932	D	0	-14.1181	15.8048	0.78491	1.0:0.0:0.0:0.0	.	47;47;47	Q0P607;O95104-2;O95104	.;.;SFR15_HUMAN	E	47	ENSP00000286835:V47E;ENSP00000382703:V47E	ENSP00000286835:V47E	V	-	2	0	SCAF4	31999626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.655000	0.91098	2.371000	0.80710	0.533000	0.62120	GTA	.		0.234	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000192659.1	XM_047889	
SCN3A	6328	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	165947139	165947139	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr2:165947139C>G	ENST00000360093.3	-	28	6015	c.5524G>C	c.(5524-5526)Gtc>Ctc	p.V1842L	SCN3A_ENST00000409101.3_Missense_Mutation_p.V1793L|SCN3A_ENST00000283254.7_Missense_Mutation_p.V1842L|SCN3A_ENST00000540861.1_Missense_Mutation_p.V325L|SCN3A_ENST00000465043.1_5'Flank|AC013463.2_ENST00000431341.1_RNA	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1842					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCACCACTGACCATGGGCAGA	0.463																																					p.V1842L		.											.	SCN3A	141	0			c.G5524C						.						100.0	99.0	99.0					2																	165947139		2203	4300	6503	SO:0001583	missense	6328	exon28			CACTGACCATGGG	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5524G>C	2.37:g.165947139C>G	ENSP00000353206:p.Val1842Leu	Somatic	229.0	0.0		WXS	Illumina HiSeq	Phase_I	269.0	22.0	NM_006922	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		.	.	.	.	.	.	.	.	.	.	C	22.8	4.334371	0.81801	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97016	-4.0;-4.0;-3.93;-4.21	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000019	D	0.98798	0.9595	H	0.94542	3.55	0.80722	D	1	P;B;D	0.67145	0.642;0.308;0.996	P;B;D	0.77004	0.898;0.335;0.989	D	0.99007	1.0813	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	1793;1793;1842	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	L	1842;1842;1793;325	ENSP00000353206:V1842L;ENSP00000283254:V1842L;ENSP00000386726:V1793L;ENSP00000439920:V325L	ENSP00000283254:V1842L	V	-	1	0	SCN3A	165655385	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	GTC	.		0.463	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
SESTD1	91404	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	179997118	179997118	+	Silent	SNP	T	T	C			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr2:179997118T>C	ENST00000428443.3	-	10	1201	c.885A>G	c.(883-885)caA>caG	p.Q295Q		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	295							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			GGGCTCTTAGTTGTTCTGATC	0.443																																					p.Q295Q		.											.	SESTD1	228	0			c.A885G						.						129.0	138.0	135.0					2																	179997118		2203	4300	6503	SO:0001819	synonymous_variant	91404	exon10			TCTTAGTTGTTCT	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.885A>G	2.37:g.179997118T>C		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	5.0	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Silent	SNP	ENST00000428443.3	37	CCDS33338.1																																																																																			.		0.443	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
SLC13A1	6561	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	122774465	122774465	+	Splice_Site	SNP	T	T	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr7:122774465T>A	ENST00000194130.2	-	8	970	c.931A>T	c.(931-933)Aat>Tat	p.N311Y	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	311					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TTTACTTACTTGAATCCTAGG	0.418																																					p.N311Y		.											.	SLC13A1	92	0			c.A931T						.						92.0	84.0	87.0					7																	122774465		2203	4300	6503	SO:0001630	splice_region_variant	6561	exon8			CTTACTTGAATCC		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.932+1A>T	7.37:g.122774465T>A		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	8.0	NM_022444	Q9H5Z0	Missense_Mutation	SNP	ENST00000194130.2	37	CCDS5786.1	.	.	.	.	.	.	.	.	.	.	T	18.22	3.574810	0.65878	.	.	ENSG00000081800	ENST00000194130	T	0.03035	4.07	6.04	0.868	0.19090	.	0.352689	0.35805	N	0.002978	T	0.15349	0.0370	M	0.85373	2.75	0.80722	D	1	D;D	0.60160	0.987;0.987	D;D	0.67900	0.954;0.954	T	0.00218	-1.1908	10	0.54805	T	0.06	.	9.2357	0.37464	0.0:0.3702:0.0:0.6298	.	311;311	A4D0X1;Q9BZW2	.;S13A1_HUMAN	Y	311	ENSP00000194130:N311Y	ENSP00000194130:N311Y	N	-	1	0	SLC13A1	122561701	0.998000	0.40836	0.998000	0.56505	0.961000	0.63080	0.286000	0.18902	-0.070000	0.12908	-0.376000	0.06991	AAT	.		0.418	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444	Missense_Mutation
SSPO	23145	broad.mit.edu;ucsc.edu	37	7	149520825	149520825	+	RNA	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr7:149520825C>T	ENST00000378016.2	+	0	13402							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCTGCTGGAGCAGGCTGGGGG	0.652																																					p.Q4468X		.											.	.	.	0			c.C13402T						.						11.0	14.0	13.0					7																	149520825		1963	4034	5997			23145	exon93			CTGGAGCAGGCTG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149520825C>T		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	6.0	NM_198455	Q76B61	Nonsense_Mutation	SNP	ENST00000378016.2	37																																																																																				.		0.652	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	113192621	113192621	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr9:113192621C>A	ENST00000401783.2	-	33	5799	c.5463G>T	c.(5461-5463)ttG>ttT	p.L1821F	SVEP1_ENST00000297826.5_5'Flank|SVEP1_ENST00000374469.1_Missense_Mutation_p.L1798F	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1821	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TTACTCCCATCAACTGGTATC	0.398																																					p.L1821F		.											.	SVEP1	75	0			c.G5463T						.						87.0	79.0	81.0					9																	113192621		1877	4114	5991	SO:0001583	missense	79987	exon33			TCCCATCAACTGG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.5463G>T	9.37:g.113192621C>A	ENSP00000384917:p.Leu1821Phe	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	12.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683181	0.47991	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	T;T	0.70749	-0.51;-0.51	5.27	4.34	0.51931	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.86883	0.6040	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88723	0.3231	10	0.51188	T	0.08	.	15.4306	0.75092	0.1391:0.8609:0.0:0.0	.	1821	Q4LDE5	SVEP1_HUMAN	F	1821;1798	ENSP00000384917:L1821F;ENSP00000363593:L1798F	ENSP00000363593:L1798F	L	-	3	2	SVEP1	112232442	0.909000	0.30893	0.958000	0.39756	0.548000	0.35241	1.564000	0.36375	2.735000	0.93741	0.655000	0.94253	TTG	.		0.398	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SYNGR1	9145	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	39746105	39746105	+	Silent	SNP	C	C	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr22:39746105C>A	ENST00000328933.5	+	1	105	c.90C>A	c.(88-90)gtC>gtA	p.V30V	SYNGR1_ENST00000216155.7_Silent_p.V30V|SYNGR1_ENST00000318801.4_Silent_p.V30V|SYNGR1_ENST00000406293.3_Silent_p.V30V	NM_004711.4	NP_004702.2	O43759	SNG1_HUMAN	synaptogyrin 1	30	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				protein targeting (GO:0006605)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle membrane (GO:0030672)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	7	Melanoma(58;0.04)					TCCTGCGCGTCGTGTCTTGGG	0.726																																					p.V30V		.											.	SYNGR1	90	0			c.C90A						.						9.0	10.0	10.0					22																	39746105		2130	4203	6333	SO:0001819	synonymous_variant	9145	exon1			GCGCGTCGTGTCT	AJ002303	CCDS13989.1, CCDS13990.1, CCDS13991.1	22q13	2008-06-10			ENSG00000100321	ENSG00000100321			11498	protein-coding gene	gene with protein product		603925				9760194, 10595519	Standard	NM_004711		Approved			O43759	OTTHUMG00000030978	ENST00000328933.5:c.90C>A	22.37:g.39746105C>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	5.0	NM_145731	A6NP69|A8K0E2|O43757|O43758|Q53Y02|Q96J56|Q9UGZ4	Silent	SNP	ENST00000328933.5	37	CCDS13989.1																																																																																			.		0.726	SYNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075866.2	NM_004711	
TKTL2	84076	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	164393857	164393857	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr4:164393857C>A	ENST00000280605.3	-	1	1190	c.1030G>T	c.(1030-1032)Ggt>Tgt	p.G344C		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	344						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ATCGTGTCACCACTCAGaaca	0.423																																					p.G344C		.											.	TKTL2	95	0			c.G1030T						.						119.0	116.0	117.0					4																	164393857		2203	4300	6503	SO:0001583	missense	84076	exon1			TGTCACCACTCAG	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.1030G>T	4.37:g.164393857C>A	ENSP00000280605:p.Gly344Cys	Somatic	91.0	1.0		WXS	Illumina HiSeq	Phase_I	126.0	10.0	NM_032136	A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	ENST00000280605.3	37	CCDS3805.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445804	0.43429	.	.	ENSG00000151005	ENST00000280605	T	0.44881	0.91	4.3	1.39	0.22231	Transketolase-like, pyrimidine-binding domain (2);	0.122548	0.53938	D	0.000043	T	0.57607	0.2065	M	0.77406	2.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55335	-0.8157	10	0.87932	D	0	-14.07	4.792	0.13254	0.1687:0.6233:0.0:0.2081	.	344	Q9H0I9	TKTL2_HUMAN	C	344	ENSP00000280605:G344C	ENSP00000280605:G344C	G	-	1	0	TKTL2	164613307	1.000000	0.71417	0.945000	0.38365	0.632000	0.37999	2.994000	0.49433	0.259000	0.21709	-0.345000	0.07892	GGT	.		0.423	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	179584040	179584040	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr2:179584040A>G	ENST00000591111.1	-	81	23350	c.23126T>C	c.(23125-23127)gTt>gCt	p.V7709A	TTN_ENST00000589042.1_Missense_Mutation_p.V8026A|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.V6782A			Q8WZ42	TITIN_HUMAN	titin	13252	Ig-like 59.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGCCCACTAACAATCTCATT	0.517																																					p.V8026A		.											.	TTN	636	0			c.T24077C						.						126.0	126.0	126.0					2																	179584040		1901	4116	6017	SO:0001583	missense	7273	exon83			CCACTAACAATCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23126T>C	2.37:g.179584040A>G	ENSP00000465570:p.Val7709Ala	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	7.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	10.28	1.305304	0.23736	.	.	ENSG00000155657	ENST00000342992	T	0.65178	-0.14	6.08	6.08	0.98989	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50599	0.1625	N	0.12502	0.225	0.25870	N	0.983712	B	0.15141	0.012	B	0.24701	0.055	T	0.52358	-0.8586	9	0.87932	D	0	.	16.6438	0.85155	1.0:0.0:0.0:0.0	.	7709	Q8WZ42	TITIN_HUMAN	A	6782	ENSP00000343764:V6782A	ENSP00000343764:V6782A	V	-	2	0	TTN	179292285	0.000000	0.05858	0.823000	0.32752	0.912000	0.54170	0.918000	0.28678	2.333000	0.79357	0.533000	0.62120	GTT	.		0.517	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZBTB40	9923	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	22838185	22838185	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr1:22838185A>C	ENST00000375647.4	+	11	2226	c.2019A>C	c.(2017-2019)gaA>gaC	p.E673D	ZBTB40_ENST00000374651.4_Missense_Mutation_p.E561D|ZBTB40_ENST00000404138.1_Missense_Mutation_p.E673D	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	673					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		TTACTAAGGAAGATGGAGAGA	0.428																																					p.E673D		.											.	ZBTB40	91	0			c.A2019C						.						50.0	49.0	49.0					1																	22838185		2203	4300	6503	SO:0001583	missense	9923	exon12			TAAGGAAGATGGA	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.2019A>C	1.37:g.22838185A>C	ENSP00000364798:p.Glu673Asp	Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	18.0	NM_001083621	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	CCDS224.1	.	.	.	.	.	.	.	.	.	.	A	13.19	2.164371	0.38217	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	D;D;D	0.82081	-1.57;-1.57;-1.57	5.23	-3.38	0.04883	.	0.000000	0.50627	D	0.000107	T	0.71651	0.3365	L	0.48642	1.525	0.09310	N	1	B;B	0.25609	0.13;0.079	B;B	0.24006	0.05;0.037	T	0.60414	-0.7268	10	0.51188	T	0.08	-7.6673	7.8705	0.29563	0.4598:0.1196:0.4205:0.0	.	561;673	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	D	673;673;561	ENSP00000384527:E673D;ENSP00000364798:E673D;ENSP00000363782:E561D	ENSP00000363782:E561D	E	+	3	2	ZBTB40	22710772	0.452000	0.25713	0.008000	0.14137	0.002000	0.02628	0.956000	0.29202	-0.588000	0.05882	-1.119000	0.02030	GAA	.		0.428	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
ZC3HAV1	56829	hgsc.bcm.edu;broad.mit.edu	37	7	138768681	138768681	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr7:138768681T>C	ENST00000242351.5	-	3	858	c.542A>G	c.(541-543)aAc>aGc	p.N181S	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.N181S|ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.N181S	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	181	N-terminal domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						AAAACGACAGTTCCCTCGGGT	0.542																																					p.N181S		.											.	ZC3HAV1	91	0			c.A542G						.						135.0	120.0	125.0					7																	138768681		2203	4300	6503	SO:0001583	missense	56829	exon3			CGACAGTTCCCTC	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.542A>G	7.37:g.138768681T>C	ENSP00000242351:p.Asn181Ser	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	4.0	NM_024625	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	37	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	T	12.27	1.887148	0.33348	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652	T;T;T	0.40756	1.02;1.02;1.02	4.77	2.3	0.28687	Zinc finger, CCCH-type (1);	0.675658	0.14201	N	0.334673	T	0.39332	0.1074	L	0.57536	1.79	0.09310	N	1	P;P	0.52316	0.952;0.816	P;B	0.45881	0.496;0.307	T	0.18903	-1.0322	10	0.39692	T	0.17	.	5.4739	0.16686	0.1743:0.0:0.1823:0.6434	.	181;181	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	S	181	ENSP00000242351:N181S;ENSP00000418385:N181S;ENSP00000419855:N181S	ENSP00000242351:N181S	N	-	2	0	ZC3HAV1	138419221	0.017000	0.18338	0.004000	0.12327	0.211000	0.24417	1.903000	0.39858	0.375000	0.24679	0.533000	0.62120	AAC	.		0.542	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
ZNF300	91975	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	150275398	150275398	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr5:150275398G>T	ENST00000274599.5	-	6	1823	c.1403C>A	c.(1402-1404)aCt>aAt	p.T468N	ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000446148.2_Missense_Mutation_p.T484N|ZNF300_ENST00000394226.2_Missense_Mutation_p.T468N|ZNF300_ENST00000418587.2_Missense_Mutation_p.T432N	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	468					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCACATTCAGTACATTCATA	0.413																																					p.T484N		.											.	ZNF300	92	0			c.C1451A						.						84.0	79.0	81.0					5																	150275398		2203	4300	6503	SO:0001583	missense	91975	exon7			CATTCAGTACATT	AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.1403C>A	5.37:g.150275398G>T	ENSP00000274599:p.Thr468Asn	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	5.0	NM_001172831	A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Missense_Mutation	SNP	ENST00000274599.5	37	CCDS4311.2	.	.	.	.	.	.	.	.	.	.	G	7.908	0.735880	0.15574	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	3.64	2.68	0.31781	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09555	0.0235	N	0.21240	0.645	0.09310	N	1	B	0.17465	0.022	B	0.15870	0.014	T	0.33163	-0.9879	9	0.08381	T	0.77	.	8.0772	0.30722	0.0:0.0:0.6383:0.3617	.	468	Q96RE9	ZN300_HUMAN	N	484;468;432;468	ENSP00000397178:T484N;ENSP00000274599:T468N;ENSP00000392593:T432N;ENSP00000377773:T468N	ENSP00000274599:T468N	T	-	2	0	ZNF300	150255591	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	-1.130000	0.03241	2.059000	0.61396	0.591000	0.81541	ACT	.		0.413	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_052860	
ZNF430	80264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	21216304	21216304	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr19:21216304G>T	ENST00000261560.5	+	3	320	c.139G>T	c.(139-141)Gag>Tag	p.E47*	ZNF430_ENST00000599548.1_Nonsense_Mutation_p.E47*|ZNF430_ENST00000595401.1_Nonsense_Mutation_p.E47*	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	47	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						ATTTTCTCTGGAGGAGTGGCA	0.443																																					p.E47X		.											.	ZNF430	516	0			c.G139T						.						115.0	119.0	118.0					19																	21216304		2203	4300	6503	SO:0001587	stop_gained	80264	exon3			TCTCTGGAGGAGT	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.139G>T	19.37:g.21216304G>T	ENSP00000261560:p.Glu47*	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	19.0	NM_025189	Q86V70	Nonsense_Mutation	SNP	ENST00000261560.5	37	CCDS32978.1	.	.	.	.	.	.	.	.	.	.	.	12.55	1.972866	0.34848	.	.	ENSG00000118620	ENST00000261560	.	.	.	0.916	0.916	0.19373	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	4.9698	0.14110	0.0:0.0:1.0:0.0	.	.	.	.	X	47	.	ENSP00000261560:E47X	E	+	1	0	ZNF430	21008144	0.782000	0.28689	0.090000	0.20809	0.093000	0.18481	0.998000	0.29744	0.300000	0.22699	0.305000	0.20034	GAG	.		0.443	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189	
ZNF517	340385	broad.mit.edu;mdanderson.org	37	8	146033060	146033060	+	Silent	SNP	C	C	T			TCGA-DD-A4NS-01A-11D-A30V-10	TCGA-DD-A4NS-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5abd0e3f-8431-4596-bc8a-f0a2a4b470b4	2c0ffc41-1663-4f25-8210-f48f55f1f30d	g.chr8:146033060C>T	ENST00000531720.1	+	4	804	c.759C>T	c.(757-759)cgC>cgT	p.R253R	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000359971.3_Silent_p.R253R|ZNF517_ENST00000525105.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			CCCACCACCGCGTCCACACCC	0.692																																					p.R253R		.											.	ZNF517	90	0			c.C759T						.						26.0	25.0	26.0					8																	146033060		2200	4297	6497	SO:0001819	synonymous_variant	340385	exon5			CCACCGCGTCCAC	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.759C>T	8.37:g.146033060C>T		Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	6.0	NM_213605		Silent	SNP	ENST00000531720.1	37	CCDS6434.1	.	.	.	.	.	.	.	.	.	.	C	6.446	0.450387	0.12223	.	.	ENSG00000197363	ENST00000529429	.	.	.	2.7	-3.46	0.04767	.	.	.	.	.	T	0.17916	0.0430	.	.	.	0.21652	N	0.999601	.	.	.	.	.	.	T	0.24657	-1.0154	4	.	.	.	.	1.5421	0.02557	0.5078:0.1667:0.1729:0.1526	.	.	.	.	V	220	.	.	A	+	2	0	ZNF517	146003864	0.000000	0.05858	0.003000	0.11579	0.780000	0.44128	-3.713000	0.00386	-0.757000	0.04697	-0.502000	0.04539	GCG	.		0.692	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
