#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS10	81794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8651245	8651245	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr19:8651245G>C	ENST00000597188.1	-	21	2783	c.2513C>G	c.(2512-2514)tCg>tGg	p.S838W	ADAMTS10_ENST00000595838.1_Missense_Mutation_p.S325W|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.S838W	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	838	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						ACACTGGGCCGAGCACTTGGT	0.692											OREG0025221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S838W		.											.	ADAMTS10	229	0			c.C2513G						.						17.0	20.0	19.0					19																	8651245		2191	4286	6477	SO:0001583	missense	81794	exon21			TGGGCCGAGCACT	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.2513C>G	19.37:g.8651245G>C	ENSP00000471851:p.Ser838Trp	Somatic	122.0	0.0	81	WXS	Illumina HiSeq	Phase_I	144.0	39.0	NM_030957	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	37	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239168	0.79800	.	.	ENSG00000142303	ENST00000270328;ENST00000393912	T	0.69926	-0.44	4.64	4.64	0.57946	.	0.000000	0.64402	U	0.000004	D	0.87865	0.6285	H	0.96633	3.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.996	D	0.92340	0.5881	10	0.87932	D	0	.	16.503	0.84262	0.0:0.0:1.0:0.0	.	592;838;325	Q59FE5;Q9H324;E9PCI6	.;ATS10_HUMAN;.	W	838;592	ENSP00000270328:S838W	ENSP00000270328:S838W	S	-	2	0	ADAMTS10	8557245	1.000000	0.71417	0.928000	0.36995	0.926000	0.56050	8.982000	0.93471	2.117000	0.64856	0.561000	0.74099	TCG	.		0.692	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
AKAP13	11214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	86273887	86273887	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr15:86273887A>G	ENST00000394518.2	+	30	7326	c.7231A>G	c.(7231-7233)Aca>Gca	p.T2411A	AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000394510.2_Missense_Mutation_p.T656A|AKAP13_ENST00000361243.2_Missense_Mutation_p.T2415A	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2411	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CCGCTCCAACACAGAAGAGGC	0.488											OREG0023425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T2415A	Melanoma(94;603 1453 3280 32295 32951)	.											.	AKAP13	258	0			c.A7243G						.						113.0	106.0	108.0					15																	86273887		2202	4299	6501	SO:0001583	missense	11214	exon30			TCCAACACAGAAG	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.7231A>G	15.37:g.86273887A>G	ENSP00000378026:p.Thr2411Ala	Somatic	75.0	0.0	1243	WXS	Illumina HiSeq	Phase_I	73.0	15.0	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	A	17.90	3.501353	0.64298	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.23950	2.88;2.91;1.88	5.82	5.82	0.92795	.	.	.	.	.	T	0.45716	0.1356	M	0.73962	2.25	0.38306	D	0.943126	D;D	0.65815	0.991;0.995	P;P	0.62435	0.8;0.902	T	0.50524	-0.8818	9	0.40728	T	0.16	.	10.585	0.45278	0.8564:0.0:0.0:0.1436	.	2411;2415	Q12802;Q12802-2	AKP13_HUMAN;.	A	2415;2411;2414;2390;656	ENSP00000354718:T2415A;ENSP00000378026:T2411A;ENSP00000378018:T656A	ENSP00000354718:T2415A	T	+	1	0	AKAP13	84074891	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.947000	0.40293	2.227000	0.72691	0.528000	0.53228	ACA	.		0.488	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
ALDOA	226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30080632	30080632	+	Silent	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr16:30080632C>T	ENST00000566897.1	+	9	1698	c.546C>T	c.(544-546)ggC>ggT	p.G182G	ALDOA_ENST00000569545.1_Silent_p.G182G|ALDOA_ENST00000564595.2_Silent_p.G236G|ALDOA_ENST00000563060.2_Silent_p.G182G|ALDOA_ENST00000569798.1_Silent_p.G182G|ALDOA_ENST00000564546.1_Silent_p.G182G|ALDOA_ENST00000395248.1_Silent_p.G236G|ALDOA_ENST00000395240.3_Silent_p.G186G|ALDOA_ENST00000412304.2_Silent_p.G182G|ALDOA_ENST00000338110.5_Silent_p.G182G			P04075	ALDOA_HUMAN	aldolase A, fructose-bisphosphate	182					actin filament organization (GO:0007015)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homotetramerization (GO:0051289)|regulation of cell shape (GO:0008360)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|membrane (GO:0016020)|nucleus (GO:0005634)|platelet alpha granule lumen (GO:0031093)	actin binding (GO:0003779)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|tubulin binding (GO:0015631)			breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	17						TGCAGAATGGCATTGTGCCCA	0.567											OREG0023729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G236G		.											.	ALDOA	226	0			c.C708T						.						105.0	91.0	96.0					16																	30080632		2197	4300	6497	SO:0001819	synonymous_variant	226	exon7			GAATGGCATTGTG	X05236	CCDS10668.1, CCDS58450.1	16p11.2	2008-03-06			ENSG00000149925	ENSG00000149925	4.1.2.13		414	protein-coding gene	gene with protein product		103850				3570299	Standard	NM_000034		Approved		uc010veg.2	P04075	OTTHUMG00000132107	ENST00000566897.1:c.546C>T	16.37:g.30080632C>T		Somatic	96.0	0.0	814	WXS	Illumina HiSeq	Phase_I	60.0	18.0	NM_001243177	B4DXI7|Q6FH76|Q6FI10|Q96B15|Q9BWD9|Q9UCN2	Silent	SNP	ENST00000566897.1	37	CCDS10668.1																																																																																			.		0.567	ALDOA-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435360.1	NM_000034	
AMZ2	51321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	66252013	66252013	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr17:66252013A>G	ENST00000359904.3	+	6	2055	c.923A>G	c.(922-924)tAc>tGc	p.Y308C	AMZ2_ENST00000577985.1_Missense_Mutation_p.Y308C|AMZ2_ENST00000359783.4_Missense_Mutation_p.Y250C|AMZ2_ENST00000580753.1_Missense_Mutation_p.Y308C|AMZ2_ENST00000577866.1_Missense_Mutation_p.Y308C|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000392720.2_Missense_Mutation_p.Y308C|AMZ2_ENST00000577273.1_Intron	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	308							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTAGAAAGATACAAAGTAAGT	0.443																																					p.Y308C		.											.	AMZ2	22	0			c.A923G						.						40.0	41.0	40.0					17																	66252013		2203	4300	6503	SO:0001583	missense	51321	exon7			AAAGATACAAAGT	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.923A>G	17.37:g.66252013A>G	ENSP00000352976:p.Tyr308Cys	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	10.0	NM_001033572	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Missense_Mutation	SNP	ENST00000359904.3	37	CCDS11674.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.044477	0.55110	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	T;T;T	0.45668	0.89;0.89;0.89	3.64	3.64	0.41730	.	0.198641	0.33457	N	0.004899	T	0.59266	0.2181	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	0.997;1.0	P;D	0.87578	0.819;0.998	T	0.61983	-0.6950	10	0.59425	D	0.04	-1.9359	10.8589	0.46815	1.0:0.0:0.0:0.0	.	250;308	A6NLD9;Q86W34	.;AMZ2_HUMAN	C	308;250;308	ENSP00000352976:Y308C;ENSP00000352831:Y250C;ENSP00000376481:Y308C	ENSP00000352831:Y250C	Y	+	2	0	AMZ2	63763608	1.000000	0.71417	0.997000	0.53966	0.677000	0.39632	5.851000	0.69481	1.873000	0.54277	0.383000	0.25322	TAC	.		0.443	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448261.1	NM_016627	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	114279036	114279036	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr4:114279036C>G	ENST00000357077.4	+	38	9315	c.9262C>G	c.(9262-9264)Cca>Gca	p.P3088A	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.P3055A|ANK2_ENST00000394537.3_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3088					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGCTAGGACCCCAACTGAAGA	0.463																																					p.P3088A		.											.	ANK2	583	0			c.C9262G						.						56.0	57.0	57.0					4																	114279036		2203	4300	6503	SO:0001583	missense	287	exon38			AGGACCCCAACTG	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9262C>G	4.37:g.114279036C>G	ENSP00000349588:p.Pro3088Ala	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	15.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573287	0.65765	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	D;D;D	0.99803	-3.37;-3.4;-6.82	5.78	5.78	0.91487	.	0.000000	0.56097	D	0.000025	D	0.99739	0.9897	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.936;0.997	D	0.98691	1.0696	10	0.36615	T	0.2	.	20.0139	0.97470	0.0:1.0:0.0:0.0	.	3055;3088	Q01484;Q01484-4	ANK2_HUMAN;.	A	3088;3055;98	ENSP00000349588:P3088A;ENSP00000264366:P3055A;ENSP00000422498:P98A	ENSP00000264366:P3055A	P	+	1	0	ANK2	114498485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.999000	0.70665	2.724000	0.93272	0.563000	0.77884	CCA	.		0.463	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ANKIB1	54467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92027849	92027849	+	Silent	SNP	A	A	G	rs374467744		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:92027849A>G	ENST00000265742.3	+	20	3232	c.2856A>G	c.(2854-2856)tcA>tcG	p.S952S		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	952							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCTGTCCCTCATCTAGTGATC	0.493																																					p.S952S		.											.	ANKIB1	432	0			c.A2856G						.	A		1,4091		0,1,2045	128.0	126.0	127.0		2856	-3.5	1.0	7		127	0,8366		0,0,4183	no	coding-synonymous	ANKIB1	NM_019004.1		0,1,6228	GG,GA,AA		0.0,0.0244,0.0080		952/1090	92027849	1,12457	2046	4183	6229	SO:0001819	synonymous_variant	54467	exon20			TCCCTCATCTAGT	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2856A>G	7.37:g.92027849A>G		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	15.0	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Silent	SNP	ENST00000265742.3	37	CCDS47639.1																																																																																			.		0.493	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
ARHGEF37	389337	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	149003635	149003635	+	Missense_Mutation	SNP	C	C	T	rs369747296		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:149003635C>T	ENST00000333677.6	+	10	1559	c.1396C>T	c.(1396-1398)Cgg>Tgg	p.R466W		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	466						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						CGCACTGGGCCGGACGAGTAA	0.582																																					p.R466W		.											.	ARHGEF37	90	0			c.C1396T						.	C	TRP/ARG	1,4033		0,1,2016	87.0	95.0	93.0		1396	3.6	0.7	5		93	0,8354		0,0,4177	no	missense	ARHGEF37	NM_001001669.2	101	0,1,6193	TT,TC,CC		0.0,0.0248,0.0081	probably-damaging	466/676	149003635	1,12387	2017	4177	6194	SO:0001583	missense	389337	exon10			CTGGGCCGGACGA	BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.1396C>T	5.37:g.149003635C>T	ENSP00000328083:p.Arg466Trp	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	4.0	NM_001001669	Q6ZW51	Missense_Mutation	SNP	ENST00000333677.6	37	CCDS43385.1	.	.	.	.	.	.	.	.	.	.	C	9.603	1.129342	0.21041	2.48E-4	0.0	ENSG00000183111	ENST00000333677	T	0.55588	0.51	5.61	3.63	0.41609	.	0.561907	0.20007	N	0.101214	T	0.30198	0.0757	N	0.08118	0	0.09310	N	1	P	0.43431	0.807	B	0.36989	0.238	T	0.16276	-1.0408	10	0.66056	D	0.02	-0.9871	11.243	0.48980	0.1489:0.7226:0.1285:0.0	.	466	A1IGU5	ARH37_HUMAN	W	466	ENSP00000328083:R466W	ENSP00000328083:R466W	R	+	1	2	ARHGEF37	148983828	0.518000	0.26234	0.689000	0.30133	0.028000	0.11728	2.172000	0.42463	1.350000	0.45770	-0.315000	0.08773	CGG	.		0.582	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373763.1	NM_001001669	
ARID5B	84159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	63850753	63850753	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr10:63850753A>T	ENST00000279873.7	+	10	1941	c.1531A>T	c.(1531-1533)Aga>Tga	p.R511*	ARID5B_ENST00000309334.5_Nonsense_Mutation_p.R268*	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	511					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					CCTGGCATCCAGAGTAGACCC	0.517																																					p.R511X		.											.	ARID5B	94	0			c.A1531T						.						99.0	92.0	94.0					10																	63850753		2203	4300	6503	SO:0001587	stop_gained	84159	exon10			GCATCCAGAGTAG	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.1531A>T	10.37:g.63850753A>T	ENSP00000279873:p.Arg511*	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	16.0	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Nonsense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	A	35	5.450817	0.96205	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	.	.	.	5.57	-3.6	0.04570	.	0.645108	0.17256	N	0.180952	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-3.4989	9.4476	0.38706	0.2485:0.5697:0.1818:0.0	.	.	.	.	X	511;268	.	ENSP00000279873:R511X	R	+	1	2	ARID5B	63520759	0.000000	0.05858	0.041000	0.18516	0.413000	0.31143	-0.516000	0.06282	-0.417000	0.07461	-0.250000	0.11733	AGA	.		0.517	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
ARMC9	80210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	232079712	232079712	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:232079712C>T	ENST00000349938.4	+	4	540	c.346C>T	c.(346-348)Ccg>Tcg	p.P116S	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	116						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		TGTGGGGAGACCGGTGGGTTT	0.488																																					p.P116S		.											.	ARMC9	91	0			c.C346T						.						90.0	92.0	92.0					2																	232079712		2203	4300	6503	SO:0001583	missense	80210	exon4			GGGAGACCGGTGG	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.346C>T	2.37:g.232079712C>T	ENSP00000258417:p.Pro116Ser	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	34.0	NM_025139	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	ENST00000349938.4	37	CCDS2484.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.454981	0.43634	.	.	ENSG00000135931	ENST00000349938;ENST00000359743;ENST00000440107	T;T	0.42513	2.23;0.97	5.69	4.79	0.61399	.	0.534808	0.20762	N	0.086160	T	0.30008	0.0751	L	0.43152	1.355	0.80722	D	1	P	0.37276	0.589	B	0.33960	0.173	T	0.04029	-1.0983	10	0.09084	T	0.74	-17.1029	11.6365	0.51207	0.1389:0.7274:0.1337:0.0	.	116	Q7Z3E5	ARMC9_HUMAN	S	116	ENSP00000258417:P116S;ENSP00000387391:P116S	ENSP00000258417:P116S	P	+	1	0	ARMC9	231787956	0.996000	0.38824	0.994000	0.49952	0.714000	0.41099	3.835000	0.55805	2.666000	0.90696	0.650000	0.86243	CCG	.		0.488	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139	
ATG10	83734	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	81474399	81474399	+	Missense_Mutation	SNP	C	C	T	rs548892230		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:81474399C>T	ENST00000282185.3	+	5	740	c.446C>T	c.(445-447)aCg>aTg	p.T149M	ATG10_ENST00000458350.3_Missense_Mutation_p.T149M|ATG10_ENST00000514253.2_3'UTR|ATG10_ENST00000513634.1_Missense_Mutation_p.T149M	NM_031482.4	NP_113670.1	Q9H0Y0	ATG10_HUMAN	autophagy related 10	149					autophagy (GO:0006914)|autophagy in response to ER overload (GO:0034263)|positive regulation of protein modification process (GO:0031401)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|intracellular (GO:0005622)	Atg12 ligase activity (GO:0019777)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(2)	9		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		GACACTATTACGCAACAGGTT	0.433													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19557	0.0		0.0	False		,,,				2504	0.0				p.T149M		.											.	ATG10	90	0			c.C446T						.						180.0	156.0	164.0					5																	81474399		2203	4300	6503	SO:0001583	missense	83734	exon6			CTATTACGCAACA	AK024016	CCDS4057.1	5q14.1	2014-02-12	2012-06-06	2005-09-11	ENSG00000152348	ENSG00000152348			20315	protein-coding gene	gene with protein product		610800	"""APG10 autophagy 10-like (S. cerevisiae)"", ""ATG10 autophagy related 10 homolog (S. cerevisiae)"""	APG10L			Standard	NM_031482		Approved	DKFZP586I0418, FLJ13954	uc003khr.3	Q9H0Y0	OTTHUMG00000119041	ENST00000282185.3:c.446C>T	5.37:g.81474399C>T	ENSP00000282185:p.Thr149Met	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	11.0	NM_001131028	B2RE09|Q6PIX1|Q9H842	Missense_Mutation	SNP	ENST00000282185.3	37	CCDS4057.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431692	0.43122	.	.	ENSG00000152348	ENST00000282185;ENST00000458350;ENST00000513634	T;T;T	0.55413	1.58;1.58;0.52	5.37	3.55	0.40652	Autophagy-related protein 3 (1);	0.159978	0.53938	D	0.000049	T	0.74481	0.3722	M	0.90145	3.09	0.42169	D	0.991636	D;D	0.89917	1.0;0.996	D;P	0.75484	0.986;0.863	T	0.77672	-0.2500	10	0.87932	D	0	-3.6582	10.2806	0.43537	0.0:0.7898:0.1361:0.0741	.	149;149	D6RDX3;Q9H0Y0	.;ATG10_HUMAN	M	149	ENSP00000282185:T149M;ENSP00000404938:T149M;ENSP00000425225:T149M	ENSP00000282185:T149M	T	+	2	0	ATG10	81510155	0.996000	0.38824	0.685000	0.30070	0.300000	0.27592	3.737000	0.55060	0.725000	0.32318	0.305000	0.20034	ACG	.		0.433	ATG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239252.2	NM_001131028	
ATM	472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	108114704	108114704	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:108114704T>G	ENST00000452508.2	+	7	710	c.521T>G	c.(520-522)cTc>cGc	p.L174R	ATM_ENST00000278616.4_Missense_Mutation_p.L174R			Q13315	ATM_HUMAN	ATM serine/threonine kinase	174					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TACTTCAGGCTCTATCTGAAA	0.284			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.L174R		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	3419	0			c.T521G						.						67.0	60.0	62.0					11																	108114704		2200	4296	6496	SO:0001583	missense	472	exon6	Familial Cancer Database	AT, Louis-Bar syndrome	TCAGGCTCTATCT	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.521T>G	11.37:g.108114704T>G	ENSP00000388058:p.Leu174Arg	Somatic	287.0	0.0		WXS	Illumina HiSeq	Phase_I	288.0	67.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.062147	0.76187	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000527891;ENST00000452508	T;T;T;T	0.29655	4.28;4.55;1.56;4.55	5.59	5.59	0.84812	.	0.171971	0.41823	D	0.000816	T	0.51312	0.1667	M	0.66939	2.045	0.22737	N	0.998795	D	0.65815	0.995	P	0.61070	0.883	T	0.50320	-0.8842	10	0.72032	D	0.01	.	15.7702	0.78162	0.0:0.0:0.0:1.0	.	174	Q13315	ATM_HUMAN	R	174;174;119;174	ENSP00000435747:L174R;ENSP00000278616:L174R;ENSP00000433955:L119R;ENSP00000388058:L174R	ENSP00000278616:L174R	L	+	2	0	ATM	107619914	0.952000	0.32445	0.108000	0.21378	0.904000	0.53231	5.404000	0.66344	2.135000	0.66039	0.533000	0.62120	CTC	.		0.284	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
ATP2B4	493	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	203678582	203678582	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:203678582G>C	ENST00000357681.5	+	11	2834	c.1711G>C	c.(1711-1713)Gtg>Ctg	p.V571L	ATP2B4_ENST00000341360.2_Missense_Mutation_p.V571L|ATP2B4_ENST00000391954.2_Missense_Mutation_p.V571L|ATP2B4_ENST00000367219.3_Missense_Mutation_p.V559L|ATP2B4_ENST00000367218.3_Missense_Mutation_p.V571L	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	571					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CTTTAACTCAGTGCGCAAGTC	0.527																																					p.V571L		.											.	ATP2B4	517	0			c.G1711C						.						94.0	80.0	85.0					1																	203678582		2203	4300	6503	SO:0001583	missense	493	exon11			AACTCAGTGCGCA	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.1711G>C	1.37:g.203678582G>C	ENSP00000350310:p.Val571Leu	Somatic	149.0	2.0		WXS	Illumina HiSeq	Phase_I	244.0	35.0	NM_001001396	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	ENST00000357681.5	37	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.369204	0.61624	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.52	4.57	0.56435	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.278348	0.25613	N	0.029465	T	0.67373	0.2886	L	0.42632	1.34	0.48632	D	0.999682	B;B;B	0.29378	0.243;0.063;0.174	B;B;B	0.36378	0.223;0.045;0.171	T	0.67825	-0.5570	10	0.48119	T	0.1	-10.418	15.4055	0.74874	0.0:0.0:0.8604:0.1396	.	571;571;571	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	L	571;571;559;571;571	ENSP00000350310:V571L;ENSP00000356187:V571L;ENSP00000356188:V559L;ENSP00000375816:V571L;ENSP00000340930:V571L	ENSP00000340930:V571L	V	+	1	0	ATP2B4	201945205	0.846000	0.29590	0.981000	0.43875	0.960000	0.62799	3.609000	0.54117	2.590000	0.87494	0.563000	0.77884	GTG	.		0.527	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396	
ATP6V1A	523	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	113513944	113513952	+	In_Frame_Del	DEL	ATATCCAGC	ATATCCAGC	-			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	ATATCCAGC	ATATCCAGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr3:113513944_113513952delATATCCAGC	ENST00000273398.3	+	10	1227_1235	c.1119_1127delATATCCAGC	c.(1117-1128)ggatatccagcc>ggc	p.YPA374del	ATP6V1A_ENST00000538620.1_In_Frame_Del_p.YPA341del	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	374					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	CAGATAGTGGATATCCAGCCTATCTTGGT	0.431																																					p.373_376del		.											.	ATP6V1A	93	0			c.1119_1127del						.																																			SO:0001651	inframe_deletion	523	exon10			TAGTGGATATCCA	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.1119_1127delATATCCAGC	3.37:g.113513944_113513952delATATCCAGC	ENSP00000273398:p.Tyr374_Ala376del	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	15.0	NM_001690	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	In_Frame_Del	DEL	ENST00000273398.3	37	CCDS2976.1																																																																																			.		0.431	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690	
ATP7B	540	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	52542657	52542657	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr13:52542657G>C	ENST00000242839.4	-	4	1786	c.1630C>G	c.(1630-1632)Cag>Gag	p.Q544E	ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000400370.3_Intron|ATP7B_ENST00000542656.1_Intron|ATP7B_ENST00000418097.2_Missense_Mutation_p.Q544E|ATP7B_ENST00000448424.2_Missense_Mutation_p.Q544E|ATP7B_ENST00000400366.3_Missense_Mutation_p.Q433E|ATP7B_ENST00000344297.5_Missense_Mutation_p.Q544E	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	544	HMA 5. {ECO:0000255|PROSITE- ProRule:PRU00280}.				cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TGGATGAACTGAGCTATCTCG	0.542									Wilson disease																												p.Q544E		.											.	ATP7B	92	0			c.C1630G	GRCh37	CM970137	ATP7B	M		.						107.0	111.0	110.0					13																	52542657		2117	4225	6342	SO:0001583	missense	540	exon4	Familial Cancer Database		TGAACTGAGCTAT	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1630C>G	13.37:g.52542657G>C	ENSP00000242839:p.Gln544Glu	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	10.0	NM_000053	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	37	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.559770	0.00910	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000448424;ENST00000418097	D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66	5.68	4.83	0.62350	Heavy metal-associated domain, HMA (3);Heavy metal-associated domain, copper ion-binding (1);	0.307970	0.40908	N	0.001000	T	0.54743	0.1877	N	0.00894	-1.105	0.80722	D	1	B;B;B;B;P;B	0.36027	0.135;0.005;0.054;0.168;0.533;0.002	B;B;B;B;B;B	0.32090	0.066;0.003;0.041;0.017;0.14;0.008	T	0.66634	-0.5874	10	0.02654	T	1	-5.6891	16.0307	0.80574	0.0:0.0:0.8645:0.1355	.	544;544;544;433;544;544	E7ET55;B7ZLR4;F5H748;P35670-3;P35670-2;P35670	.;.;.;.;.;ATP7B_HUMAN	E	544;433;544;544;544	ENSP00000242839:Q544E;ENSP00000383217:Q433E;ENSP00000342559:Q544E;ENSP00000416738:Q544E;ENSP00000393343:Q544E	ENSP00000242839:Q544E	Q	-	1	0	ATP7B	51440658	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	3.134000	0.50538	1.406000	0.46857	0.655000	0.94253	CAG	.		0.542	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
ATP8B3	148229	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	1796715	1796715	+	Missense_Mutation	SNP	C	C	T	rs371318224		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr19:1796715C>T	ENST00000310127.6	-	16	1986	c.1748G>A	c.(1747-1749)cGc>cAc	p.R583H	ATP8B3_ENST00000539485.1_Missense_Mutation_p.R583H|ATP8B3_ENST00000525591.1_Missense_Mutation_p.R536H	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	583					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCACCTGGGCGCTCACGGGG	0.731																																					p.R583H		.											.	.	.	0			c.G1748A						.	C	HIS/ARG,HIS/ARG	0,4026		0,0,2013	20.0	25.0	24.0		1607,1748	1.5	0.0	19		24	1,8287		0,1,4143	no	missense,missense	ATP8B3	NM_001178002.1,NM_138813.2	29,29	0,1,6156	TT,TC,CC		0.0121,0.0,0.0081	benign,benign	536/1264,583/1301	1796715	1,12313	2013	4144	6157	SO:0001583	missense	148229	exon16			CCTGGGCGCTCAC	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1748G>A	19.37:g.1796715C>T	ENSP00000311336:p.Arg583His	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	18.0	NM_138813	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639464	0.29157	0.0	1.21E-4	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.63255	-0.03;-0.03;-0.03	3.63	1.46	0.22682	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	2.449250	0.02963	N	0.143364	T	0.41766	0.1173	N	0.04508	-0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.30031	-0.9992	10	0.36615	T	0.2	.	8.057	0.30610	0.0:0.7922:0.0:0.2078	.	583;536	O60423;Q7Z485	AT8B3_HUMAN;.	H	583;583;536	ENSP00000311336:R583H;ENSP00000443574:R583H;ENSP00000437115:R536H	ENSP00000311336:R583H	R	-	2	0	ATP8B3	1747715	0.887000	0.30362	0.021000	0.16686	0.010000	0.07245	0.470000	0.22084	0.243000	0.21327	-0.291000	0.09656	CGC	.		0.731	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
BAHCC1	57597	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	79428710	79428710	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr17:79428710G>A	ENST00000307745.7	+	30	7021	c.7021G>A	c.(7021-7023)Gac>Aac	p.D2341N	RP11-1055B8.8_ENST00000572590.1_RNA																							ctgctcctccGACAACGAGGA	0.682																																					.		.											.	BAHCC1	23	0			.						.						10.0	13.0	12.0					17																	79428710		2131	4195	6326	SO:0001583	missense	57597	.			TCCTCCGACAACG																												ENST00000307745.7:c.7021G>A	17.37:g.79428710G>A	ENSP00000303486:p.Asp2341Asn	Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	29.0	.		Missense_Mutation	SNP	ENST00000307745.7	37		.	.	.	.	.	.	.	.	.	.	G	26.2	4.716431	0.89205	.	.	ENSG00000171282	ENST00000307745	T	0.14516	2.5	4.76	4.76	0.60689	.	0.093131	0.43110	D	0.000609	T	0.32556	0.0833	M	0.72894	2.215	0.50813	D	0.999898	D;D	0.76494	0.997;0.999	P;P	0.59825	0.669;0.864	T	0.04128	-1.0975	10	0.38643	T	0.18	.	16.5253	0.84329	0.0:0.0:1.0:0.0	.	2341;2341	Q9P281;F8WBW8	BAHC1_HUMAN;.	N	2341	ENSP00000303486:D2341N	ENSP00000303486:D2341N	D	+	1	0	AC110285.1	77043305	0.868000	0.29978	0.873000	0.34254	0.969000	0.65631	2.871000	0.48459	2.179000	0.69175	0.491000	0.48974	GAC	.		0.682	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
BCL3	602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45260419	45260419	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr19:45260419G>A	ENST00000164227.5	+	4	909	c.665G>A	c.(664-666)cGa>cAa	p.R222Q		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	222					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				ACCTGCCTGCGAGCCCTGCTG	0.701			T	IGH@	CLL																																p.R222Q		.		Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	.	BCL3	848	0			c.G665A						.						9.0	8.0	8.0					19																	45260419		2159	4205	6364	SO:0001583	missense	602	exon4			GCCTGCGAGCCCT	M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.665G>A	19.37:g.45260419G>A	ENSP00000164227:p.Arg222Gln	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	5.0	NM_005178		Missense_Mutation	SNP	ENST00000164227.5	37	CCDS12642.2	.	.	.	.	.	.	.	.	.	.	G	14.51	2.557557	0.45590	.	.	ENSG00000069399	ENST00000403534;ENST00000164227	T	0.64991	-0.13	4.95	2.81	0.32909	Ankyrin repeat-containing domain (3);	0.198772	0.24980	N	0.034076	T	0.38719	0.1051	N	0.12182	0.205	0.25978	N	0.982419	B	0.21452	0.056	B	0.04013	0.001	T	0.25606	-1.0127	10	0.52906	T	0.07	0.0902	6.5726	0.22547	0.3004:0.0:0.6996:0.0	.	222	P20749	BCL3_HUMAN	Q	182;222	ENSP00000164227:R222Q	ENSP00000164227:R222Q	R	+	2	0	BCL3	49952259	0.995000	0.38212	1.000000	0.80357	0.802000	0.45316	1.953000	0.40352	0.481000	0.27557	0.305000	0.20034	CGA	.		0.701	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322976.1	NM_005178	
BLM	641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	91347543	91347543	+	Silent	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr15:91347543C>A	ENST00000355112.3	+	19	3823	c.3705C>A	c.(3703-3705)gtC>gtA	p.V1235V	BLM_ENST00000560136.1_3'UTR|BLM_ENST00000560509.1_Intron	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	1235	HRDC. {ECO:0000255|PROSITE- ProRule:PRU00328}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TTTTTGGTGTCCATTACTTCA	0.398			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.V1235V		.	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	BLM	664	0			c.C3705A						.						105.0	109.0	108.0					15																	91347543		2198	4298	6496	SO:0001819	synonymous_variant	641	exon19	Familial Cancer Database		TGGTGTCCATTAC	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.3705C>A	15.37:g.91347543C>A		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	41.0	NM_000057	Q52M96	Silent	SNP	ENST00000355112.3	37	CCDS10363.1																																																																																			.		0.398	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
C16orf96	342346	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4606653	4606653	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr16:4606653A>G	ENST00000444310.4	+	1	163	c.163A>G	c.(163-165)Acc>Gcc	p.T55A		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						CTTCCTGCAGACCTCGCAGGT	0.592																																					p.T55A		.											.	.	.	0			c.A163G						.						69.0	76.0	74.0					16																	4606653		692	1591	2283	SO:0001583	missense	342346	exon1			CTGCAGACCTCGC		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.163A>G	16.37:g.4606653A>G	ENSP00000415027:p.Thr55Ala	Somatic	66.0	1.0		WXS	Illumina HiSeq	Phase_I	50.0	10.0	NM_001145011		Missense_Mutation	SNP	ENST00000444310.4	37	CCDS53986.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.200493	0.38905	.	.	ENSG00000205832	ENST00000444310	.	.	.	5.22	-10.2	0.00374	.	0.916690	0.09185	N	0.836953	T	0.11965	0.0291	N	0.16307	0.4	0.09310	N	1	B	0.16396	0.017	B	0.10450	0.005	T	0.20042	-1.0287	9	0.08599	T	0.76	-5.3333	2.4977	0.04626	0.1607:0.2562:0.3802:0.2029	.	55	A6NNT2	CP096_HUMAN	A	55	.	ENSP00000415027:T55A	T	+	1	0	C16orf96	4546654	0.000000	0.05858	0.004000	0.12327	0.049000	0.14656	-1.249000	0.02888	-1.724000	0.01373	-1.089000	0.02181	ACC	.		0.592	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
C2CD2	25966	broad.mit.edu;bcgsc.ca	37	21	43309317	43309317	+	Silent	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr21:43309317G>T	ENST00000380486.3	-	14	2248	c.2007C>A	c.(2005-2007)ctC>ctA	p.L669L	C2CD2_ENST00000329623.7_Silent_p.L514L	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	669						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						GGATCCTGGTGAGGGTGATGC	0.582																																					p.L669L		.											.	C2CD2	91	0			c.C2007A						.						147.0	120.0	129.0					21																	43309317		2203	4300	6503	SO:0001819	synonymous_variant	25966	exon14			CCTGGTGAGGGTG	AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.2007C>A	21.37:g.43309317G>T		Somatic	100.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	5.0	NM_015500	Q5R2V7|Q6AHX8|Q9NSE6	Silent	SNP	ENST00000380486.3	37	CCDS42933.1	.	.	.	.	.	.	.	.	.	.	G	4.498	0.092377	0.08632	.	.	ENSG00000157617	ENST00000449165	.	.	.	5.19	2.08	0.27032	.	.	.	.	.	T	0.55337	0.1914	.	.	.	0.58432	D	0.999991	.	.	.	.	.	.	T	0.50939	-0.8768	4	.	.	.	-30.5502	7.4355	0.27154	0.1431:0.0:0.6233:0.2336	.	.	.	.	N	155	.	.	H	-	1	0	C2CD2	42182386	0.495000	0.26051	0.306000	0.25113	0.640000	0.38277	0.530000	0.23036	1.199000	0.43173	0.655000	0.94253	CAC	.		0.582	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195228.2	NM_015500	
C6orf62	81688	hgsc.bcm.edu;bcgsc.ca	37	6	24718827	24718828	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:24718827_24718828insT	ENST00000378119.4	-	1	2236_2237	c.69_70insA	c.(67-72)aaagaafs	p.E24fs	C6orf62_ENST00000378102.3_Intron|C6orf62_ENST00000540769.1_Intron	NM_030939.4	NP_112201.1	Q9GZU0	CF062_HUMAN	chromosome 6 open reading frame 62	24						intracellular (GO:0005622)				endometrium(2)|kidney(3)|large_intestine(2)|lung(3)	10						GCTAGAGATTCTTTTTTCTTTC	0.381																																					p.E24fs		.											.	C6orf62	90	0			c.70_71insA						.																																			SO:0001589	frameshift_variant	81688	exon1			GAGATTCTTTTTT	AL136632	CCDS4559.1	6p22.1	2011-12-13			ENSG00000112308	ENSG00000112308			20998	protein-coding gene	gene with protein product	"""HBV X-transactivated protein 12"""					11230166	Standard	NM_030939		Approved	FLJ12619, DKFZP564G182, XTP12	uc003nel.3	Q9GZU0	OTTHUMG00000014361	ENST00000378119.4:c.70dupA	6.37:g.24718833_24718833dupT	ENSP00000367359:p.Glu24fs	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	16.0	NM_030939	Q3LIB6|Q5JVZ2|Q5JVZ3|Q6IA63|Q9H1Z2	Frame_Shift_Ins	INS	ENST00000378119.4	37	CCDS4559.1																																																																																			.		0.381	C6orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040017.1	NM_030939	
C9orf9	11092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	135763682	135763682	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr9:135763682C>G	ENST00000372136.3	+	4	800	c.353C>G	c.(352-354)cCt>cGt	p.P118R	C9orf9_ENST00000350499.6_Missense_Mutation_p.P118R|C9orf9_ENST00000356311.5_Missense_Mutation_p.P118R			Q96E40	CI009_HUMAN	chromosome 9 open reading frame 9	118						cytoplasmic microtubule (GO:0005881)		p.?(1)		cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		TGCAGATACCCTCATGATGTG	0.607																																					p.P118R		.											.	C9orf9	90	1	Unknown(1)	bone(1)	c.C353G						.						89.0	75.0	80.0					9																	135763682		2203	4300	6503	SO:0001583	missense	11092	exon4			GATACCCTCATGA		CCDS6955.1	9q34.13	2012-03-06			ENSG00000165698	ENSG00000165698			1367	protein-coding gene	gene with protein product							Standard	NM_018956		Approved		uc004cby.1	Q96E40	OTTHUMG00000020847	ENST00000372136.3:c.353C>G	9.37:g.135763682C>G	ENSP00000361209:p.Pro118Arg	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	32.0	NM_018956	Q9UGQ0	Missense_Mutation	SNP	ENST00000372136.3	37		.	.	.	.	.	.	.	.	.	.	C	14.87	2.664676	0.47572	.	.	ENSG00000165698	ENST00000372136;ENST00000356311;ENST00000350499	T;T;T	0.66815	-0.23;-0.23;-0.23	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.81749	0.4888	M	0.73962	2.25	0.58432	D	0.999999	B;D	0.89917	0.202;1.0	B;D	0.97110	0.067;1.0	D	0.83929	0.0305	10	0.66056	D	0.02	-12.904	17.0347	0.86471	0.0:1.0:0.0:0.0	.	118;118	Q96E40-2;Q96E40	.;CI009_HUMAN	R	118	ENSP00000361209:P118R;ENSP00000348659:P118R;ENSP00000298546:P118R	ENSP00000298546:P118R	P	+	2	0	C9orf9	134753503	0.999000	0.42202	0.488000	0.27440	0.547000	0.35210	5.940000	0.70187	2.344000	0.79699	0.561000	0.74099	CCT	.		0.607	C9orf9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000054806.1	NM_018956	
CAMK2A	815	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	149631366	149631366	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:149631366A>G	ENST00000348628.6	-	9	1305	c.640T>C	c.(640-642)Tgg>Cgg	p.W214R	CAMK2A_ENST00000398376.3_Missense_Mutation_p.W214R	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	214	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCTCATCCCAGAACGGGGGG	0.602																																					p.W214R		.											.	CAMK2A	333	0			c.T640C						.						25.0	32.0	30.0					5																	149631366		2097	4255	6352	SO:0001583	missense	815	exon9			CATCCCAGAACGG	AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.640T>C	5.37:g.149631366A>G	ENSP00000261793:p.Trp214Arg	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	9.0	NM_171825	Q9UL21|Q9Y2H4|Q9Y352	Missense_Mutation	SNP	ENST00000348628.6	37	CCDS43386.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.797217	0.90538	.	.	ENSG00000070808	ENST00000348628;ENST00000398376	T;T	0.63417	-0.04;-0.04	5.67	5.67	0.87782	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.62938	0.2469	N	0.04686	-0.185	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.999;0.995	T	0.73000	-0.4120	10	0.87932	D	0	.	16.2045	0.82114	1.0:0.0:0.0:0.0	.	214;214;214	Q9UQM7-2;Q9UQM7;A8K161	.;KCC2A_HUMAN;.	R	214	ENSP00000261793:W214R;ENSP00000381412:W214R	ENSP00000261793:W214R	W	-	1	0	CAMK2A	149611559	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.238000	0.95380	2.288000	0.76882	0.533000	0.62120	TGG	.		0.602	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258869.2	NM_015981	
CAPZA1	829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	113192072	113192072	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:113192072C>G	ENST00000263168.3	+	3	808	c.136C>G	c.(136-138)Ctc>Gtc	p.L46V	CAPZA1_ENST00000476936.1_3'UTR	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1	46					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGACAATCTCCTCAGGGAAGG	0.368																																					p.L46V		.											.	CAPZA1	514	0			c.C136G						.						108.0	104.0	106.0					1																	113192072		2203	4300	6503	SO:0001583	missense	829	exon3			AATCTCCTCAGGG	U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.136C>G	1.37:g.113192072C>G	ENSP00000263168:p.Leu46Val	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	25.0	NM_006135	Q53FQ6|Q6FHD5	Missense_Mutation	SNP	ENST00000263168.3	37	CCDS30805.1	.	.	.	.	.	.	.	.	.	.	C	32	5.132222	0.94473	.	.	ENSG00000116489	ENST00000263168	.	.	.	5.39	5.39	0.77823	.	0.076847	0.52532	D	0.000063	T	0.77505	0.4140	M	0.71296	2.17	0.80722	D	1	P	0.41673	0.759	P	0.60609	0.877	T	0.77264	-0.2652	9	0.52906	T	0.07	-10.7109	18.7748	0.91907	0.0:1.0:0.0:0.0	.	46	P52907	CAZA1_HUMAN	V	46	.	ENSP00000263168:L46V	L	+	1	0	CAPZA1	112993595	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.771000	0.85420	2.524000	0.85096	0.591000	0.81541	CTC	.		0.368	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032567.2	NM_006135	
PRIMPOL	201973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	185606652	185606652	+	Splice_Site	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr4:185606652G>T	ENST00000314970.6	+	10	1619	c.1186G>T	c.(1186-1188)Gga>Tga	p.G396*	PRIMPOL_ENST00000512834.1_Splice_Site_p.G395*|PRIMPOL_ENST00000515774.1_Splice_Site_p.G267*|PRIMPOL_ENST00000503752.1_Splice_Site_p.G396*	NM_152683.2	NP_689896	Q96LW4	PRIPO_HUMAN	primase and polymerase (DNA-directed)	396					mitochondrial DNA replication (GO:0006264)|replication fork processing (GO:0031297)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA primase activity (GO:0003896)|DNA-directed DNA polymerase activity (GO:0003887)|manganese ion binding (GO:0030145)										CATTAAAGGAGGTAAAGTTAA	0.343																																					p.G396X		.											.	CCDC111	90	0			c.G1186T						.						185.0	180.0	182.0					4																	185606652		2203	4300	6503	SO:0001630	splice_region_variant	201973	exon10			AAAGGAGGTAAAG	AK057729	CCDS3837.1, CCDS75211.1, CCDS75212.1	4q35.1	2013-09-27	2013-09-27	2013-09-27	ENSG00000164306	ENSG00000164306			26575	protein-coding gene	gene with protein product		615421	"""coiled-coil domain containing 111"""	CCDC111		12477932	Standard	XM_005262814		Approved	FLJ33167	uc003iwk.2	Q96LW4	OTTHUMG00000160495	ENST00000314970.6:c.1186+1G>T	4.37:g.185606652G>T		Somatic	333.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	75.0	NM_152683	D3DP55|D6RDM1|Q5HYJ9	Nonsense_Mutation	SNP	ENST00000314970.6	37	CCDS3837.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182288	0.78677	.	.	ENSG00000164306	ENST00000314970;ENST00000515774;ENST00000503752;ENST00000512834;ENST00000508001	.	.	.	5.4	5.4	0.78164	.	0.055717	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-26.5288	12.6428	0.56718	0.0749:0.0:0.9251:0.0	.	.	.	.	X	396;267;396;395;70	.	ENSP00000313816:G396X	G	+	1	0	CCDC111	185843646	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	4.116000	0.57871	2.813000	0.96785	0.561000	0.74099	GGA	.		0.343	PRIMPOL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360827.1	NM_152683	Nonsense_Mutation
CCDC84	338657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118869172	118869172	+	Silent	SNP	T	T	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:118869172T>G	ENST00000334418.1	+	2	209	c.153T>G	c.(151-153)gcT>gcG	p.A51A	RP11-110I1.12_ENST00000526453.1_lincRNA	NM_198489.1	NP_940891.1	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84	51										breast(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		TCCGCGCCGCTCAGGTGGAGC	0.667																																					p.A51A		.											.	CCDC84	91	0			c.T153G						.						24.0	25.0	25.0					11																	118869172		2200	4295	6495	SO:0001819	synonymous_variant	338657	exon2			CGCCGCTCAGGTG	AB094093	CCDS8405.1	11q23.3	2006-03-13			ENSG00000186166	ENSG00000186166			30460	protein-coding gene	gene with protein product							Standard	NM_198489		Approved	DLNB14	uc001pul.3	Q86UT8	OTTHUMG00000166348	ENST00000334418.1:c.153T>G	11.37:g.118869172T>G		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	7.0	NM_198489		Silent	SNP	ENST00000334418.1	37	CCDS8405.1																																																																																			.		0.667	CCDC84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389315.1	NM_198489	
CDH15	1013	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	89258218	89258218	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr16:89258218C>T	ENST00000289746.2	+	10	1596	c.1531C>T	c.(1531-1533)Ccc>Tcc	p.P511S		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	511	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		TGAGGACCTGCCCCCCCACGG	0.731																																					p.P511S		.											.	CDH15	523	0			c.C1531T						.						9.0	12.0	11.0					16																	89258218		2085	4090	6175	SO:0001583	missense	1013	exon10			GACCTGCCCCCCC	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.1531C>T	16.37:g.89258218C>T	ENSP00000289746:p.Pro511Ser	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	10.0	NM_004933		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	.	.	.	.	.	.	.	.	.	.	C	14.82	2.648098	0.47258	.	.	ENSG00000129910	ENST00000289746	T	0.61510	0.1	4.47	4.47	0.54385	Cadherin (1);Cadherin-like (1);	0.000000	0.52532	U	0.000078	T	0.55924	0.1951	L	0.56280	1.765	0.39533	D	0.968694	P	0.51147	0.942	P	0.46389	0.515	T	0.57388	-0.7820	10	0.30078	T	0.28	.	12.494	0.55916	0.0:0.8301:0.1699:0.0	.	511	P55291	CAD15_HUMAN	S	511	ENSP00000289746:P511S	ENSP00000289746:P511S	P	+	1	0	CDH15	87785719	0.618000	0.27051	1.000000	0.80357	0.935000	0.57460	0.444000	0.21661	2.047000	0.60756	0.289000	0.19496	CCC	.		0.731	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933	
CERS2	29956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150939260	150939260	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:150939260T>C	ENST00000271688.6	-	9	1206	c.820A>G	c.(820-822)Atc>Gtc	p.I274V	CERS2_ENST00000368954.5_Missense_Mutation_p.I274V|CERS2_ENST00000345896.4_5'UTR|RP11-316M1.12_ENST00000560481.1_RNA|CERS2_ENST00000561294.1_Missense_Mutation_p.I265V|RP11-316M1.12_ENST00000561111.1_RNA	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	274	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AGTCGGGTGATGATAAAAACA	0.502																																					p.I274V		.											.	.	.	0			c.A820G						.						159.0	129.0	140.0					1																	150939260		2203	4300	6503	SO:0001583	missense	29956	exon9			GGGTGATGATAAA	AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.820A>G	1.37:g.150939260T>C	ENSP00000271688:p.Ile274Val	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	7.0	NM_022075	D3DV06|Q5SZE5|Q9HD96|Q9NW79	Missense_Mutation	SNP	ENST00000271688.6	37	CCDS973.1	.	.	.	.	.	.	.	.	.	.	T	4.842	0.156616	0.09236	.	.	ENSG00000143418	ENST00000368954;ENST00000271688;ENST00000345896;ENST00000368949	D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83	5.86	4.74	0.60224	TRAM/LAG1/CLN8 homology domain (3);	0.143849	0.50627	D	0.000116	T	0.36663	0.0975	N	0.02142	-0.665	0.46044	D	0.998836	B	0.06786	0.001	B	0.16289	0.015	T	0.53718	-0.8399	10	0.02654	T	1	-27.2827	4.482	0.11771	0.1483:0.1468:0.0:0.7049	.	274	Q96G23	CERS2_HUMAN	V	274;274;124;294	ENSP00000357950:I274V;ENSP00000271688:I274V;ENSP00000337842:I124V;ENSP00000357945:I294V	ENSP00000271688:I274V	I	-	1	0	CERS2	149205884	0.977000	0.34250	1.000000	0.80357	0.967000	0.64934	0.094000	0.15107	2.232000	0.73038	0.533000	0.62120	ATC	.		0.502	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084897.2	NM_022075	
CHPF2	54480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150935740	150935740	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:150935740T>A	ENST00000035307.2	+	4	3805	c.2292T>A	c.(2290-2292)ttT>ttA	p.F764L	CHPF2_ENST00000495645.1_Missense_Mutation_p.F756L|MIR671_ENST00000390183.1_RNA|RP4-548D19.3_ENST00000607902.1_RNA	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	764					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						TGGCTCTCTTTGAGCAGGAGC	0.617																																					p.F764L		.											.	CHPF2	91	0			c.T2292A						.						14.0	14.0	14.0					7																	150935740		2200	4298	6498	SO:0001583	missense	54480	exon4			TCTCTTTGAGCAG	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.2292T>A	7.37:g.150935740T>A	ENSP00000035307:p.Phe764Leu	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	6.0	NM_019015	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	.	.	.	.	.	.	.	.	.	.	T	18.04	3.534770	0.64972	.	.	ENSG00000033100	ENST00000495645;ENST00000035307	T;T	0.35236	1.32;1.34	4.51	-0.631	0.11526	.	0.000000	0.85682	D	0.000000	T	0.46870	0.1415	M	0.64997	1.995	0.58432	D	0.999998	D;D	0.67145	0.995;0.996	D;D	0.70935	0.963;0.971	T	0.44345	-0.9334	10	0.14656	T	0.56	-12.6072	10.0927	0.42456	0.0:0.188:0.0:0.812	.	764;756	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	L	756;764	ENSP00000418914:F756L;ENSP00000035307:F764L	ENSP00000035307:F764L	F	+	3	2	CHPF2	150566673	0.978000	0.34361	0.994000	0.49952	0.996000	0.88848	0.104000	0.15313	-0.187000	0.10516	0.533000	0.62120	TTT	.		0.617	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015	
CHSY3	337876	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	129520172	129520172	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:129520172T>A	ENST00000305031.4	+	3	1695	c.1337T>A	c.(1336-1338)cTg>cAg	p.L446Q	CHSY3_ENST00000507545.1_3'UTR	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	446					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		GACCAGCAGCTGGGAGTGATA	0.498																																					p.L446Q		.											.	CHSY3	25	0			c.T1337A						.						56.0	52.0	53.0					5																	129520172		2203	4300	6503	SO:0001583	missense	337876	exon3			AGCAGCTGGGAGT	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1337T>A	5.37:g.129520172T>A	ENSP00000302629:p.Leu446Gln	Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	7.0	NM_175856	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	37	CCDS34223.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.303751	0.81136	.	.	ENSG00000198108	ENST00000305031	T	0.21191	2.02	4.5	4.5	0.54988	.	0.000000	0.40302	N	0.001126	T	0.47930	0.1472	M	0.81942	2.565	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.51434	-0.8706	9	.	.	.	-2.2213	14.8652	0.70409	0.0:0.0:0.0:1.0	.	446	Q70JA7	CHSS3_HUMAN	Q	446	ENSP00000302629:L446Q	.	L	+	2	0	CHSY3	129548071	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.720000	0.84759	2.243000	0.73865	0.528000	0.53228	CTG	.		0.498	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
CLEC3B	7123	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	45077344	45077344	+	Silent	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr3:45077344G>A	ENST00000296130.4	+	3	717	c.537G>A	c.(535-537)gcG>gcA	p.A179A	RNU5B-3P_ENST00000516601.1_RNA|CLEC3B_ENST00000428034.1_Silent_p.A137A|CLEC3B_ENST00000490386.1_3'UTR	NM_003278.2	NP_003269.2	P05452	TETN_HUMAN	C-type lectin domain family 3, member B	179	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				bone mineralization (GO:0030282)|cellular response to organic substance (GO:0071310)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ossification (GO:0001503)|positive regulation of plasminogen activation (GO:0010756)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)|kringle domain binding (GO:0036143)			endometrium(1)|lung(3)	4				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	Tenecteplase(DB00031)	TGTCAGGCGCGGCCAACGGCA	0.677																																					p.A179A	GBM(139;1487 3263 30871)	.											.	CLEC3B	90	0			c.G537A						.						32.0	33.0	33.0					3																	45077344		2201	4295	6496	SO:0001819	synonymous_variant	7123	exon3			AGGCGCGGCCAAC		CCDS2726.1	3p22-p21.3	2010-04-27	2005-02-09	2005-02-09	ENSG00000163815	ENSG00000163815		"""C-type lectin domain containing"""	11891	protein-coding gene	gene with protein product		187520	"""tetranectin (plasminogen binding protein)"""	TNA			Standard	NM_003278		Approved	TN	uc003cok.4	P05452	OTTHUMG00000133087	ENST00000296130.4:c.537G>A	3.37:g.45077344G>A		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	14.0	NM_003278	Q6FGX6	Silent	SNP	ENST00000296130.4	37	CCDS2726.1																																																																																			.		0.677	CLEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256745.1	NM_003278	
CLGN	1047	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	141313515	141313531	+	Splice_Site	DEL	TGTATCTTTATGTTTTT	TGTATCTTTATGTTTTT	-	rs370853657		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	TGTATCTTTATGTTTTT	TGTATCTTTATGTTTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr4:141313515_141313531delTGTATCTTTATGTTTTT	ENST00000325617.5	-	13	1933_1949	c.1493_1509delAAAAACATAAAGATACA	c.(1492-1509)aaaaaacataaagataca>a	p.KKHKDT498fs	CLGN_ENST00000414773.1_Splice_Site_p.KKHKDT498fs|CLGN_ENST00000537281.1_Splice_Site_p.KKHKDT498fs	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	498					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)	p.K499K(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					TTTTATACTCTGTATCTTTATGTTTTTTCTGTGGTAG	0.318																																					p.498_503del		.											.	CLGN	93	1	Substitution - coding silent(1)	endometrium(1)	c.1493_1509del						.																																			SO:0001630	splice_region_variant	1047	exon14			ATACTCTGTATCT	D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.1492-1AAAAACATAAAGATACA>-	4.37:g.141313515_141313531delTGTATCTTTATGTTTTT		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	17.0	NM_001130675	B3KS90|B4DXV8|D3DNY8	Frame_Shift_Del	DEL	ENST00000325617.5	37	CCDS3751.1																																																																																			.		0.318	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257272.2	NM_004362	Frame_Shift_Del
COL4A4	1286	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	227963489	227963494	+	In_Frame_Del	DEL	AGGGAA	AGGGAA	-			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	AGGGAA	AGGGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:227963489_227963494delAGGGAA	ENST00000396625.3	-	19	1327_1332	c.1120_1125delTTCCCT	c.(1120-1125)ttccctdel	p.FP374del	COL4A4_ENST00000329662.7_In_Frame_Del_p.FP374del	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	374	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CATAGCGGCCAGGGAACCCTGGGTCC	0.51																																					p.374_375del		.											.	COL4A4	142	0			c.1120_1125del						.																																			SO:0001651	inframe_deletion	1286	exon19			GCGGCCAGGGAAC		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.1120_1125delTTCCCT	2.37:g.227963489_227963494delAGGGAA	ENSP00000379866:p.Phe374_Pro375del	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	20.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	In_Frame_Del	DEL	ENST00000396625.3	37	CCDS42828.1																																																																																			.		0.510	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
COL4A4	1286	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	227963497	227963499	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:227963497_227963499delCTG	ENST00000396625.3	-	19	1322_1324	c.1115_1117delCAG	c.(1114-1119)ccaggg>cgg	p.372_373PG>R	COL4A4_ENST00000329662.7_In_Frame_Del_p.372_373PG>R	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	372	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCAGGGAACCCTGGGTCCCCTGG	0.507																																					p.372_373del		.											.	COL4A4	142	0			c.1115_1117del						.																																			SO:0001651	inframe_deletion	1286	exon19			GGAACCCTGGGTC		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.1115_1117delCAG	2.37:g.227963497_227963499delCTG	ENSP00000379866:p.Pro372_Gly373delinsArg	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	20.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	In_Frame_Del	DEL	ENST00000396625.3	37	CCDS42828.1																																																																																			.		0.507	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	113519059	113519059	+	Splice_Site	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr8:113519059C>A	ENST00000297405.5	-	29	5001		c.e29-1		CSMD3_ENST00000352409.3_Splice_Site|CSMD3_ENST00000343508.3_Splice_Site|CSMD3_ENST00000455883.2_Splice_Site	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCACAGGGTGCTTTAATTTAA	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											.		.											.	CSMD3	1132	0			c.4445-1G>T						.						56.0	56.0	56.0					8																	113519059		2203	4300	6503	SO:0001630	splice_region_variant	114788	exon29			AGGGTGCTTTAAT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4757-1G>T	8.37:g.113519059C>A		Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	8.0	NM_052900	Q96PZ3	Splice_Site	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354384	0.82243	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4644	0.90750	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CSMD3	113588235	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.651000	0.83577	2.587000	0.87381	0.557000	0.71058	.	.		0.343	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	Intron
CYP2W1	54905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	1024648	1024648	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:1024648C>T	ENST00000308919.7	+	3	413	c.400C>T	c.(400-402)Cac>Tac	p.H134Y	CYP2W1_ENST00000340150.6_Missense_Mutation_p.H78Y	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	134					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GCGTGCCCTGCACAGCCTGGG	0.652																																					p.H134Y		.											.	CYP2W1	90	0			c.C400T						.						30.0	37.0	35.0					7																	1024648		2200	4299	6499	SO:0001583	missense	54905	exon3			GCCCTGCACAGCC	AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.400C>T	7.37:g.1024648C>T	ENSP00000310149:p.His134Tyr	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	9.0	NM_017781		Missense_Mutation	SNP	ENST00000308919.7	37	CCDS5319.2	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742044	0.49151	.	.	ENSG00000073067	ENST00000308919;ENST00000340150	T;T	0.79940	-1.32;-1.32	4.95	4.95	0.65309	.	0.152963	0.56097	D	0.000027	D	0.84593	0.5506	M	0.69823	2.125	0.27635	N	0.947918	P;P	0.51653	0.832;0.947	P;P	0.52454	0.699;0.699	T	0.80801	-0.1220	10	0.87932	D	0	.	13.1651	0.59567	0.1599:0.8401:0.0:0.0	.	78;134	A6NJ10;Q8TAV3	.;CP2W1_HUMAN	Y	134;78	ENSP00000310149:H134Y;ENSP00000344178:H78Y	ENSP00000310149:H134Y	H	+	1	0	CYP2W1	991174	1.000000	0.71417	0.648000	0.29521	0.043000	0.13939	1.956000	0.40382	2.290000	0.77057	0.491000	0.48974	CAC	.		0.652	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157249.1	NM_017781	
DCAF12L1	139170	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	125685427	125685427	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chrX:125685427C>T	ENST00000371126.1	-	1	1407	c.1165G>A	c.(1165-1167)Gcc>Acc	p.A389T		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	389										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						TCCAGGGTGGCGGAGGCTCTT	0.582																																					p.A389T		.											.	DCAF12L1	132	0			c.G1165A						.						51.0	53.0	52.0					X																	125685427		2203	4300	6503	SO:0001583	missense	139170	exon1			GGGTGGCGGAGGC	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1165G>A	X.37:g.125685427C>T	ENSP00000360167:p.Ala389Thr	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	8.0	NM_178470	Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	C	1.497	-0.552961	0.03996	.	.	ENSG00000198889	ENST00000371126	T	0.17528	2.27	3.47	-2.03	0.07365	.	0.735039	0.11199	N	0.589062	T	0.08537	0.0212	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.39354	-0.9618	10	0.18276	T	0.48	.	3.5022	0.07677	0.1608:0.262:0.4679:0.1093	.	389	Q5VU92	DC121_HUMAN	T	389	ENSP00000360167:A389T	ENSP00000360167:A389T	A	-	1	0	DCAF12L1	125513108	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.532000	0.06164	-0.653000	0.05401	-1.656000	0.00753	GCC	.		0.582	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470	
DEK	7913	hgsc.bcm.edu;bcgsc.ca	37	6	18264096	18264096	+	Missense_Mutation	SNP	C	C	G	rs147127829	byFrequency	TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:18264096C>G	ENST00000397239.3	-	2	570	c.123G>C	c.(121-123)gaG>gaC	p.E41D	DEK_ENST00000244776.7_Missense_Mutation_p.E41D	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	41	Asp/Glu-rich (highly acidic).				chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			cctcctcctcctcgtcgtcct	0.562			T	NUP214	AML								C|||	10	0.00199681	0.0068	0.0	5008	,	,		14423	0.0		0.0	False		,,,				2504	0.001				p.E41D		.		Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	.	DEK	658	0			c.G123C						.	-	ASP/GLU,ASP/GLU	8,4398	14.3+/-33.2	0,8,2195	43.0	47.0	45.0		123,123	-3.7	0.1	6	dbSNP_134	45	0,8600		0,0,4300	yes	missense,missense	DEK	NM_001134709.1,NM_003472.3	45,45	0,8,6495	GG,GC,CC		0.0,0.1816,0.0615	benign,benign	41/342,41/376	18264096	8,12998	2203	4300	6503	SO:0001583	missense	7913	exon2			CTCCTCCTCGTCG	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.123G>C	6.37:g.18264096C>G	ENSP00000380414:p.Glu41Asp	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	5.0	NM_003472	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	37	CCDS34344.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	6.267	0.417416	0.11870	0.001816	0.0	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000515742	T;T;T	0.51817	0.76;0.85;0.69	4.57	-3.65	0.04502	.	0.440668	0.20131	N	0.098587	T	0.09598	0.0236	L	0.48642	1.525	0.22880	N	0.998611	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38585	-0.9654	10	0.12766	T	0.61	-5.206	1.3254	0.02124	0.2162:0.3697:0.1081:0.306	.	41;41	B4DN37;P35659	.;DEK_HUMAN	D	41;41;46	ENSP00000380414:E41D;ENSP00000244776:E41D;ENSP00000423553:E46D	ENSP00000244776:E41D	E	-	3	2	DEK	18372075	0.003000	0.15002	0.050000	0.19076	0.529000	0.34654	-2.192000	0.01245	-1.460000	0.01911	-2.294000	0.00264	GAG	C|0.999;G|0.001		0.562	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039962.4		
DENND3	22898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142176419	142176419	+	Missense_Mutation	SNP	C	C	A	rs556706834		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr8:142176419C>A	ENST00000262585.2	+	12	1722	c.1444C>A	c.(1444-1446)Cct>Act	p.P482T	DENND3_ENST00000424248.1_Missense_Mutation_p.P430T|DENND3_ENST00000519811.1_Missense_Mutation_p.P562T	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	482					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			CATTGCCATGCCTGAGCTGGC	0.647													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17462	0.0		0.0	False		,,,				2504	0.0				p.P482T		.											.	DENND3	91	0			c.C1444A						.						86.0	89.0	88.0					8																	142176419		2203	4300	6503	SO:0001583	missense	22898	exon12			GCCATGCCTGAGC	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1444C>A	8.37:g.142176419C>A	ENSP00000262585:p.Pro482Thr	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	17.0	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	37	CCDS34947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.226|5.226	0.227146|0.227146	0.09916|0.09916	.|.	.|.	ENSG00000105339|ENSG00000105339	ENST00000518668|ENST00000262585;ENST00000424248;ENST00000519811	.|T;T;T	.|0.14893	.|2.93;2.47;2.92	4.74|4.74	3.86|3.86	0.44501|0.44501	.|.	.|0.603639	.|0.17555	.|N	.|0.170035	T|T	0.17195|0.17195	0.0413|0.0413	L|L	0.55481|0.55481	1.735|1.735	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.17465	.|0.013;0.022;0.013	.|B;B;B	.|0.15052	.|0.012;0.01;0.004	T|T	0.13098|0.13098	-1.0522|-1.0522	5|10	.|0.42905	.|T	.|0.14	-16.1658|-16.1658	9.6722|9.6722	0.40019|0.40019	0.1589:0.688:0.1532:0.0|0.1589:0.688:0.1532:0.0	.|.	.|562;430;482	.|E9PF32;A2RUS2-2;A2RUS2	.|.;.;DEND3_HUMAN	D|T	486|482;430;562	.|ENSP00000262585:P482T;ENSP00000410594:P430T;ENSP00000428714:P562T	.|ENSP00000262585:P482T	A|P	+|+	2|1	0|0	DENND3|DENND3	142245601|142245601	0.008000|0.008000	0.16893|0.16893	0.563000|0.563000	0.28383|0.28383	0.210000|0.210000	0.24377|0.24377	1.898000|1.898000	0.39809|0.39809	1.101000|1.101000	0.41535|0.41535	0.561000|0.561000	0.74099|0.74099	GCC|CCT	.		0.647	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
DHX29	54505	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	54586093	54586096	+	Frame_Shift_Del	DEL	TTGT	TTGT	-	rs150941078		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	TTGT	TTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:54586093_54586096delTTGT	ENST00000251636.5	-	7	1005_1008	c.857_860delACAA	c.(856-861)aacaagfs	p.NK286fs	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	286						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTGGCCTTGCTTGTTTTTTTCTAG	0.328																																					p.286_287del		.											.	DHX29	229	0			c.857_860del						.																																			SO:0001589	frameshift_variant	54505	exon7			CCTTGCTTGTTTT	AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.857_860delACAA	5.37:g.54586093_54586096delTTGT	ENSP00000251636:p.Asn286fs	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	25.0	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Frame_Shift_Del	DEL	ENST00000251636.5	37	CCDS34158.1																																																																																			.		0.328	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
DMTF1	9988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	86824435	86824435	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:86824435A>T	ENST00000394703.5	+	20	2825	c.2262A>T	c.(2260-2262)gaA>gaT	p.E754D	DMTF1_ENST00000413276.2_Missense_Mutation_p.E684D|DMTF1_ENST00000331242.7_Missense_Mutation_p.E754D|TMEM243_ENST00000481425.1_5'Flank|DMTF1_ENST00000414194.2_Missense_Mutation_p.E488D|DMTF1_ENST00000432937.2_Missense_Mutation_p.E666D	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	754	Interaction with CCND1, CCND2 and CCND3. {ECO:0000250}.|Required for transcriptional activation. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					AGGATGTCGAAGATTTGGTAA	0.373																																					p.E754D		.											.	DMTF1	91	0			c.A2262T						.						99.0	100.0	100.0					7																	86824435		2203	4299	6502	SO:0001583	missense	9988	exon18			TGTCGAAGATTTG	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.2262A>T	7.37:g.86824435A>T	ENSP00000378193:p.Glu754Asp	Somatic	212.0	0.0		WXS	Illumina HiSeq	Phase_I	280.0	51.0	NM_001142327	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Missense_Mutation	SNP	ENST00000394703.5	37	CCDS5601.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.88|19.88	3.909500|3.909500	0.72868|0.72868	.|.	.|.	ENSG00000135164|ENSG00000135164	ENST00000331242;ENST00000413276;ENST00000432937;ENST00000394703;ENST00000414194|ENST00000454008	T;T;T;T;T|.	0.60672|.	0.37;0.17;0.37;0.37;0.37|.	6.16|6.16	-0.765|-0.765	0.11023|0.11023	.|.	0.077540|.	0.53938|.	D|.	0.000041|.	T|.	0.37865|.	0.1019|.	L|L	0.27053|0.27053	0.805|0.805	0.35370|0.35370	D|D	0.788953|0.788953	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|.	0.37888|.	-0.9686|.	10|.	0.87932|.	D|.	0|.	-6.7269|-6.7269	6.5106|6.5106	0.22220|0.22220	0.4747:0.1254:0.3999:0.0|0.4747:0.1254:0.3999:0.0	.|.	754|.	Q9Y222|.	DMTF1_HUMAN|.	D|X	754;684;666;754;488|174	ENSP00000332171:E754D;ENSP00000402627:E684D;ENSP00000412532:E666D;ENSP00000378193:E754D;ENSP00000415910:E488D|.	ENSP00000332171:E754D|.	E|R	+|+	3|1	2|2	DMTF1|DMTF1	86662371|86662371	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.991000|0.991000	0.79684|0.79684	0.616000|0.616000	0.24344|0.24344	-0.042000|-0.042000	0.13535|0.13535	-0.248000|-0.248000	0.11899|0.11899	GAA|AGA	.		0.373	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5	NM_021145	
DNAJC13	23317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132175649	132175649	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr3:132175649G>T	ENST00000260818.6	+	12	1570	c.1322G>T	c.(1321-1323)gGt>gTt	p.G441V	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	441					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TCCAAAGCTGGTTTCCTGGCT	0.428																																					p.G441V		.											.	DNAJC13	272	0			c.G1322T						.						88.0	84.0	85.0					3																	132175649		2203	4300	6503	SO:0001583	missense	23317	exon12			AAGCTGGTTTCCT	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.1322G>T	3.37:g.132175649G>T	ENSP00000260818:p.Gly441Val	Somatic	200.0	0.0		WXS	Illumina HiSeq	Phase_I	226.0	42.0	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773652	0.90108	.	.	ENSG00000138246	ENST00000260818	T	0.30448	1.53	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.64159	0.2573	M	0.86651	2.83	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.68961	-0.5271	10	0.72032	D	0.01	.	19.8546	0.96752	0.0:0.0:1.0:0.0	.	441;108;441	A7E2Y5;Q8N7A5;O75165	.;.;DJC13_HUMAN	V	441	ENSP00000260818:G441V	ENSP00000260818:G441V	G	+	2	0	DNAJC13	133658339	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.593000	0.98250	2.697000	0.92050	0.655000	0.94253	GGT	.		0.428	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
DPP6	1804	hgsc.bcm.edu;broad.mit.edu	37	7	153750014	153750014	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:153750014G>A	ENST00000377770.3	+	1	250	c.109G>A	c.(109-111)Ggc>Agc	p.G37S	DPP6_ENST00000406326.1_Missense_Mutation_p.G37S|DPP6_ENST00000404039.1_Intron|AC006019.3_ENST00000425591.1_RNA			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	37					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CGAGGAGGACGGCGGCGCAGG	0.791																																					p.G37S	NSCLC(125;1384 1783 2490 7422 34254)	.											.	DPP6	652	0			c.G109A						.						6.0	8.0	7.0					7																	153750014		680	1560	2240	SO:0001583	missense	1804	exon1			GAGGACGGCGGCG	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.109G>A	7.37:g.153750014G>A	ENSP00000367001:p.Gly37Ser	Somatic	10.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	8.0	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	37		.	.	.	.	.	.	.	.	.	.	G	3.393	-0.123880	0.06795	.	.	ENSG00000130226	ENST00000406326;ENST00000377770	T	0.16073	2.37	2.73	1.78	0.24846	.	.	.	.	.	T	0.07728	0.0194	.	.	.	0.22489	N	0.999058	B;B	0.34181	0.0;0.44	B;B	0.22753	0.001;0.041	T	0.29088	-1.0023	8	0.19147	T	0.46	.	7.7391	0.28831	0.1396:0.0:0.8604:0.0	.	37;37	P42658;Q8IYG9	DPP6_HUMAN;.	S	37	ENSP00000367001:G37S	ENSP00000367001:G37S	G	+	1	0	DPP6	153380947	0.983000	0.35010	0.465000	0.27155	0.023000	0.10783	2.289000	0.43523	1.225000	0.43566	0.549000	0.68633	GGC	.		0.791	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	41459179	41459179	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr21:41459179T>A	ENST00000400454.1	-	22	4363	c.3886A>T	c.(3886-3888)Act>Tct	p.T1296S		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1296	Ig-like C2-type 10.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CATGGAGTAGTCACTGTCCCA	0.488																																					p.T1296S	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.A3886T						.						150.0	145.0	147.0					21																	41459179		2004	4169	6173	SO:0001583	missense	1826	exon22			GAGTAGTCACTGT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3886A>T	21.37:g.41459179T>A	ENSP00000383303:p.Thr1296Ser	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	14.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.074264	0.76415	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.28255	1.62;1.62	4.71	4.71	0.59529	Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.43411	0.1246	L	0.35854	1.095	0.36078	D	0.842614	D	0.76494	0.999	D	0.69654	0.965	T	0.50734	-0.8793	10	0.37606	T	0.19	.	14.5076	0.67762	0.0:0.0:0.0:1.0	.	1296	O60469	DSCAM_HUMAN	S	1296;1048	ENSP00000383303:T1296S;ENSP00000385342:T1048S	ENSP00000383303:T1296S	T	-	1	0	DSCAM	40381049	1.000000	0.71417	0.975000	0.42487	0.988000	0.76386	5.963000	0.70372	1.879000	0.54435	0.460000	0.39030	ACT	.		0.488	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	41684133	41684133	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr21:41684133T>C	ENST00000400454.1	-	9	2414	c.1937A>G	c.(1936-1938)gAc>gGc	p.D646G		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	646	Ig-like C2-type 7.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GTCAATATTGTCAATGGTCAC	0.552																																					p.D646G	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.A1937G						.						78.0	79.0	78.0					21																	41684133		1919	4145	6064	SO:0001583	missense	1826	exon9			ATATTGTCAATGG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1937A>G	21.37:g.41684133T>C	ENSP00000383303:p.Asp646Gly	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	36.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546234	0.86022	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.68025	-0.3;-0.3	5.55	5.55	0.83447	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73760	0.3628	L	0.39020	1.185	0.58432	D	0.999995	D	0.76494	0.999	D	0.85130	0.997	T	0.70630	-0.4819	10	0.25751	T	0.34	.	15.6935	0.77473	0.0:0.0:0.0:1.0	.	646	O60469	DSCAM_HUMAN	G	646;398	ENSP00000383303:D646G;ENSP00000385342:D398G	ENSP00000383303:D646G	D	-	2	0	DSCAM	40606003	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.937000	0.87672	2.098000	0.63641	0.460000	0.39030	GAC	.		0.552	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
DUSP27	92235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167095928	167095928	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:167095928G>T	ENST00000361200.2	+	6	1726	c.1560G>T	c.(1558-1560)gaG>gaT	p.E520D	DUSP27_ENST00000443333.1_Missense_Mutation_p.E520D|DUSP27_ENST00000271385.5_Missense_Mutation_p.E520D|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	520					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AGGATGATGAGGACAGCGTGG	0.562																																					p.E520D		.											.	DUSP27	71	0			c.G1560T						.						78.0	72.0	74.0					1																	167095928		2203	4300	6503	SO:0001583	missense	92235	exon5			TGATGAGGACAGC	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1560G>T	1.37:g.167095928G>T	ENSP00000354483:p.Glu520Asp	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	56.0	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	G	5.098	0.203777	0.09704	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03772	3.81;3.81;3.81	5.14	4.22	0.49857	.	0.429052	0.20866	N	0.084252	T	0.03305	0.0096	M	0.67953	2.075	0.29504	N	0.854695	P	0.43633	0.813	B	0.37047	0.24	T	0.10706	-1.0618	10	0.72032	D	0.01	-8.8605	15.6302	0.76904	0.0:0.1379:0.8621:0.0	.	520	Q5VZP5	DUS27_HUMAN	D	520	ENSP00000354483:E520D;ENSP00000271385:E520D;ENSP00000404874:E520D	ENSP00000271385:E520D	E	+	3	2	DUSP27	165362552	0.998000	0.40836	0.015000	0.15790	0.001000	0.01503	0.442000	0.21628	1.128000	0.42052	-0.189000	0.12847	GAG	.		0.562	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
DYNC2H1	79659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	103060527	103060527	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:103060527G>C	ENST00000375735.2	+	45	7563	c.7419G>C	c.(7417-7419)atG>atC	p.M2473I	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.M2473I	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2473	AAA 3. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CAGGATCTATGGTACAAGTGT	0.323																																					p.M2473I		.											.	DYNC2H1	68	0			c.G7419C						.						121.0	123.0	122.0					11																	103060527		1820	4069	5889	SO:0001583	missense	79659	exon45			ATCTATGGTACAA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.7419G>C	11.37:g.103060527G>C	ENSP00000364887:p.Met2473Ile	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	11.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267076	0.40095	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.39229	1.09;1.09	5.46	5.46	0.80206	.	.	.	.	.	T	0.44644	0.1303	L	0.55743	1.74	0.47183	D	0.999347	B;P	0.35383	0.201;0.498	B;B	0.36666	0.17;0.23	T	0.34229	-0.9837	9	0.40728	T	0.16	.	19.6629	0.95879	0.0:0.0:1.0:0.0	.	2473;2473	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	I	2473	ENSP00000364887:M2473I;ENSP00000381167:M2473I	ENSP00000364887:M2473I	M	+	3	0	DYNC2H1	102565737	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.791000	0.69045	2.726000	0.93360	0.655000	0.94253	ATG	.		0.323	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
DYNC2H1	79659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	103229042	103229042	+	Silent	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:103229042T>C	ENST00000375735.2	+	83	12255	c.12111T>C	c.(12109-12111)tcT>tcC	p.S4037S	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Silent_p.S4044S	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4037					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AAATCTGGTCTAATGAACTTT	0.358																																					p.S4044S		.											.	DYNC2H1	68	0			c.T12132C						.						80.0	70.0	73.0					11																	103229042		1835	4085	5920	SO:0001819	synonymous_variant	79659	exon84			CTGGTCTAATGAA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.12111T>C	11.37:g.103229042T>C		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	7.0	NM_001080463	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	CCDS53701.1																																																																																			.		0.358	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
EEPD1	80820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	36336619	36336619	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:36336619A>G	ENST00000242108.4	+	7	2051	c.1333A>G	c.(1333-1335)Atc>Gtc	p.I445V	EEPD1_ENST00000534978.1_Missense_Mutation_p.I445V	NM_030636.2	NP_085139.2	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family domain containing 1	445					DNA repair (GO:0006281)		DNA binding (GO:0003677)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|skin(1)	18						GGATGTCATTATCTTAGGGGA	0.463																																					p.I445V		.											.	EEPD1	68	0			c.A1333G						.						87.0	83.0	84.0					7																	36336619		2203	4300	6503	SO:0001583	missense	80820	exon7			GTCATTATCTTAG	AK027386	CCDS34619.1	7p14.2	2007-12-07	2007-12-07		ENSG00000122547	ENSG00000122547			22223	protein-coding gene	gene with protein product							Standard	NM_030636		Approved	KIAA1706	uc003tfa.3	Q7L9B9	OTTHUMG00000154904	ENST00000242108.4:c.1333A>G	7.37:g.36336619A>G	ENSP00000242108:p.Ile445Val	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	20.0	NM_030636	Q96K64|Q9C0F7	Missense_Mutation	SNP	ENST00000242108.4	37	CCDS34619.1	.	.	.	.	.	.	.	.	.	.	A	0.048	-1.259691	0.01445	.	.	ENSG00000122547	ENST00000242108;ENST00000534978	D;D	0.94931	-3.56;-3.56	5.1	0.158	0.14942	Endonuclease/exonuclease/phosphatase (2);	0.293466	0.37348	N	0.002140	T	0.81098	0.4752	N	0.03177	-0.4	0.19300	N	0.999979	B	0.02656	0.0	B	0.06405	0.002	T	0.70029	-0.4984	10	0.22706	T	0.39	-3.6303	4.57	0.12205	0.5198:0.1599:0.3203:0.0	.	445	Q7L9B9	EEPD1_HUMAN	V	445	ENSP00000242108:I445V;ENSP00000442692:I445V	ENSP00000242108:I445V	I	+	1	0	EEPD1	36303144	0.761000	0.28439	0.162000	0.22713	0.748000	0.42578	1.270000	0.33086	0.221000	0.20879	0.459000	0.35465	ATC	.		0.463	EEPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337602.1	NM_030636	
ELOVL2	54898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	10995354	10995354	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:10995354T>G	ENST00000354666.3	-	5	474	c.391A>C	c.(391-393)Att>Ctt	p.I131L		NM_017770.3	NP_060240.3	Q9NXB9	ELOV2_HUMAN	ELOVL fatty acid elongase 2	131					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	fatty acid elongase activity (GO:0009922)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(2)	14	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			ACGAAGAAAATTGTGTCCAGG	0.388																																					p.I131L		.											.	ELOVL2	90	0			c.A391C						.						112.0	107.0	109.0					6																	10995354		2203	4300	6503	SO:0001583	missense	54898	exon5			AGAAAATTGTGTC	AK000341	CCDS4518.1	6p24.1	2011-05-25	2011-05-25		ENSG00000197977	ENSG00000197977			14416	protein-coding gene	gene with protein product		611814	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2"""			12371743, 16564093	Standard	NM_017770		Approved	Ssc2	uc003mzp.4	Q9NXB9	OTTHUMG00000014252	ENST00000354666.3:c.391A>C	6.37:g.10995354T>G	ENSP00000346693:p.Ile131Leu	Somatic	247.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	51.0	NM_017770	Q6P9E1|Q86W94	Missense_Mutation	SNP	ENST00000354666.3	37	CCDS4518.1	.	.	.	.	.	.	.	.	.	.	T	13.32	2.201007	0.38905	.	.	ENSG00000197977	ENST00000354666	T	0.20881	2.04	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.08935	0.0221	L	0.31120	0.905	0.50813	D	0.999892	B	0.10296	0.003	B	0.15052	0.012	T	0.07849	-1.0751	10	0.33940	T	0.23	-2.1704	16.0707	0.80928	0.0:0.0:0.0:1.0	.	131	Q9NXB9	ELOV2_HUMAN	L	131	ENSP00000346693:I131L	ENSP00000346693:I131L	I	-	1	0	ELOVL2	11103340	1.000000	0.71417	0.907000	0.35723	0.860000	0.49131	4.140000	0.58031	2.194000	0.70268	0.533000	0.62120	ATT	.		0.388	ELOVL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039849.1		
EGFL8	80864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32134918	32134918	+	Missense_Mutation	SNP	C	C	A	rs370079247		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:32134918C>A	ENST00000395512.1	+	6	590	c.485C>A	c.(484-486)aCg>aAg	p.T162K	EGFL8_ENST00000333845.6_Missense_Mutation_p.T162K|PPT2-EGFL8_ENST00000422437.1_3'UTR|AGPAT1_ENST00000490711.1_5'Flank			Q99944	EGFL8_HUMAN	EGF-like-domain, multiple 8	162	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	10						TGTTTTAATACGGCAGGCAGC	0.612																																					p.T162K		.											.	EGFL8	90	0			c.C485A						.						111.0	125.0	120.0					6																	32134918		1507	2707	4214	SO:0001583	missense	80864	exon6			TTAATACGGCAGG	U89336	CCDS4743.1	6p21	2010-06-25	2003-05-21	2003-05-23	ENSG00000241404	ENSG00000241404			13944	protein-coding gene	gene with protein product		609897	"""chromosome 6 open reading frame 8"""	C6orf8			Standard	NM_030652		Approved	NG3		Q99944	OTTHUMG00000031222	ENST00000395512.1:c.485C>A	6.37:g.32134918C>A	ENSP00000378888:p.Thr162Lys	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	19.0	NM_030652	B0S884|G5E9Q0|Q5JP23|Q5SSX3|Q8IV30	Missense_Mutation	SNP	ENST00000395512.1	37	CCDS4743.1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123419	0.56613	.	.	ENSG00000241404	ENST00000333845;ENST00000395512	D;D	0.92495	-3.05;-3.05	5.35	4.49	0.54785	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.94348	0.8183	M	0.80028	2.48	0.53005	D	0.999962	D	0.89917	1.0	D	0.75484	0.986	D	0.94832	0.7997	9	0.87932	D	0	-10.1396	9.8427	0.41008	0.0:0.9078:0.0:0.0922	.	162	Q99944	EGFL8_HUMAN	K	162	ENSP00000333380:T162K;ENSP00000378888:T162K	ENSP00000333380:T162K	T	+	2	0	EGFL8	32242896	0.997000	0.39634	0.529000	0.27951	0.125000	0.20455	4.688000	0.61715	1.497000	0.48584	0.591000	0.81541	ACG	.		0.612	EGFL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076463.3	NM_030652	
ERCC6	2074	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	50669432	50669432	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr10:50669432G>A	ENST00000355832.5	-	19	4027	c.3949C>T	c.(3949-3951)Cac>Tac	p.H1317Y	RP11-123B3.2_ENST00000423283.1_RNA|ERCC6_ENST00000542458.1_Missense_Mutation_p.H687Y|ERCC6_ENST00000465653.1_5'UTR	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	1317					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						ATCCCCCTGTGGCCAGTCCAG	0.537								Direct reversal of damage;Nucleotide excision repair (NER)																													p.Q1317X		.											.	ERCC6	1153	0			c.C3949T						.						65.0	61.0	62.0					10																	50669432		2203	4300	6503	SO:0001583	missense	2074	exon19			CCCTGTGGCCAGT	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.3949C>T	10.37:g.50669432G>A	ENSP00000348089:p.His1317Tyr	Somatic	57.0	1.0		WXS	Illumina HiSeq	Phase_I	39.0	11.0	NM_000124	D3DX94|Q5W0L9	Nonsense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228579	0.39399	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	D;T	0.82619	-1.63;-1.37	5.2	4.17	0.49024	.	.	.	.	.	T	0.78104	0.4231	M	0.68317	2.08	0.23376	N	0.997805	B;B	0.31931	0.347;0.347	B;B	0.25759	0.063;0.063	T	0.70502	-0.4854	9	0.52906	T	0.07	-9.8567	7.2214	0.25990	0.0:0.2325:0.4568:0.3107	.	1317;694	Q03468;Q59FF6	ERCC6_HUMAN;.	Y	1317;694;687	ENSP00000348089:H1317Y;ENSP00000445134:H687Y	ENSP00000348089:H1317Y	H	-	1	0	ERCC6	50339438	0.954000	0.32549	0.995000	0.50966	0.996000	0.88848	1.608000	0.36847	2.578000	0.87016	0.655000	0.94253	CAC	.		0.537	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
F8	2157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	154158630	154158630	+	Silent	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chrX:154158630T>C	ENST00000360256.4	-	14	3635	c.3435A>G	c.(3433-3435)ccA>ccG	p.P1145P		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1145	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CTAATTGCTTTGGACTGGGGC	0.413																																					p.P1145P		.											.	F8	182	0			c.A3435G						.						65.0	69.0	67.0					X																	154158630		2201	4297	6498	SO:0001819	synonymous_variant	2157	exon14			TTGCTTTGGACTG	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3435A>G	X.37:g.154158630T>C		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	18.0	NM_000132	Q14286|Q5HY69	Silent	SNP	ENST00000360256.4	37	CCDS35457.1																																																																																			.		0.413	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
FAM101B	359845	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	293163	293163	+	Missense_Mutation	SNP	C	C	T	rs550861769		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr17:293163C>T	ENST00000329099.4	-	2	226	c.227G>A	c.(226-228)cGc>cAc	p.R76H		NM_182705.2	NP_874364.1	Q8N5W9	F101B_HUMAN	family with sequence similarity 101, member B	146					actin cytoskeleton organization (GO:0030036)|epithelial to mesenchymal transition (GO:0001837)	actin cytoskeleton (GO:0015629)	filamin binding (GO:0031005)			breast(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)|urinary_tract(1)	13		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)		CTTGTAGTTGCGCCACGTGCC	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		15016	0.0		0.0	False		,,,				2504	0.001				.		.											.	.	.	0			.						.						61.0	68.0	66.0					17																	293163		2183	4264	6447	SO:0001583	missense	359845	.			TAGTTGCGCCACG			17p13	2008-10-23			ENSG00000183688	ENSG00000183688			28705	protein-coding gene	gene with protein product		615928				12477932	Standard	NM_182705		Approved	MGC45871	uc002frj.3	Q8N5W9	OTTHUMG00000132483	ENST00000329099.4:c.227G>A	17.37:g.293163C>T	ENSP00000331915:p.Arg76His	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	20.0	.		Missense_Mutation	SNP	ENST00000329099.4	37		.	.	.	.	.	.	.	.	.	.	C	24.7	4.556129	0.86231	.	.	ENSG00000183688	ENST00000329099	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.82632	0.5079	M	0.79123	2.44	0.46499	D	0.999076	D	0.89917	1.0	D	0.69824	0.966	D	0.83799	0.0235	8	0.87932	D	0	-8.6556	19.1767	0.93605	0.0:1.0:0.0:0.0	.	146	Q8N5W9	F101B_HUMAN	H	76	.	ENSP00000331915:R76H	R	-	2	0	FAM101B	293391	1.000000	0.71417	1.000000	0.80357	0.329000	0.28539	7.487000	0.81328	2.861000	0.98227	0.650000	0.86243	CGC	.		0.657	FAM101B-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255652.1	NM_182705	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80039092	80039092	+	Silent	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr17:80039092T>C	ENST00000306749.2	-	38	6761	c.6543A>G	c.(6541-6543)caA>caG	p.Q2181Q	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2181					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGAGCGTGAGTTGCCGCACCT	0.697																																					p.Q2181Q	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.A6543G						.						26.0	23.0	24.0					17																	80039092		2190	4279	6469	SO:0001819	synonymous_variant	2194	exon38			CGTGAGTTGCCGC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6543A>G	17.37:g.80039092T>C		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	16.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	37	CCDS11801.1																																																																																			.		0.697	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FASN	2194	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	80050583	80050583	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr17:80050583G>A	ENST00000306749.2	-	7	1102	c.884C>T	c.(883-885)aCa>aTa	p.T295I		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	295	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CTTGGTGCCTGTGCCGTGGGC	0.642																																					p.T295I	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.C884T						.						19.0	20.0	20.0					17																	80050583		2172	4285	6457	SO:0001583	missense	2194	exon7			GTGCCTGTGCCGT	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.884C>T	17.37:g.80050583G>A	ENSP00000304592:p.Thr295Ile	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	8.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	g	15.90	2.968067	0.53614	.	.	ENSG00000169710	ENST00000306749	T	0.63913	-0.07	4.88	3.91	0.45181	Beta-ketoacyl synthase, C-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.84795	0.5551	H	0.97983	4.12	0.47862	D	0.99953	D	0.89917	1.0	D	0.97110	1.0	D	0.86776	0.1976	10	0.87932	D	0	-20.5389	9.0973	0.36647	0.0792:0.1463:0.7744:0.0	.	295	P49327	FAS_HUMAN	I	295	ENSP00000304592:T295I	ENSP00000304592:T295I	T	-	2	0	FASN	77643872	1.000000	0.71417	0.846000	0.33378	0.307000	0.27823	9.339000	0.96797	1.046000	0.40249	-0.457000	0.05445	ACA	.		0.642	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FAT2	2196	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150947398	150947398	+	Silent	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:150947398A>T	ENST00000261800.5	-	1	1107	c.1095T>A	c.(1093-1095)gcT>gcA	p.A365A		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	365	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCTGTAAACAGCCTTCTCGA	0.542																																					p.A365A		.											.	FAT2	96	0			c.T1095A						.						70.0	75.0	73.0					5																	150947398		2203	4300	6503	SO:0001819	synonymous_variant	2196	exon1			GTAAACAGCCTTC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1095T>A	5.37:g.150947398A>T		Somatic	173.0	1.0		WXS	Illumina HiSeq	Phase_I	207.0	40.0	NM_001447	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1																																																																																			.		0.542	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
FN1	2335	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	216226796	216226796	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:216226796G>A	ENST00000359671.1	-	44	7250	c.6985C>T	c.(6985-6987)Cgc>Tgc	p.R2329C	FN1_ENST00000421182.1_Missense_Mutation_p.R2183C|FN1_ENST00000357867.4_Missense_Mutation_p.R2119C|FN1_ENST00000446046.1_Missense_Mutation_p.R2273C|FN1_ENST00000356005.4_Missense_Mutation_p.R2239C|FN1_ENST00000354785.4_Missense_Mutation_p.R2420C|FN1_ENST00000323926.6_Missense_Mutation_p.R2389C|FN1_ENST00000336916.4_Missense_Mutation_p.R2298C|FN1_ENST00000432072.2_Missense_Mutation_p.R2210C|FN1_ENST00000346544.3_Missense_Mutation_p.R2154C|FN1_ENST00000357009.2_3'UTR|FN1_ENST00000345488.5_Missense_Mutation_p.R2127C|FN1_ENST00000443816.1_Missense_Mutation_p.R2208C			P02751	FINC_HUMAN	fibronectin 1	2329	Fibrin-binding 2.|Fibronectin type-I 12. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TTGTCACAGCGCCAGCCCTGA	0.468																																					p.R2420C		.											.	FN1	584	0			c.C7258T						.						84.0	75.0	78.0					2																	216226796		2203	4300	6503	SO:0001583	missense	2335	exon45			CACAGCGCCAGCC		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.6985C>T	2.37:g.216226796G>A	ENSP00000352696:p.Arg2329Cys	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	4.0	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	G	23.3	4.404063	0.83230	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.97	5.97	0.96955	Fibronectin, type I (4);Complement control module (1);	0.083446	0.48767	D	0.000177	T	0.63873	0.2548	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.91635	0.942;0.988;0.942;0.998;0.999;0.997;0.999;0.998;0.998;0.999;0.999	T	0.64241	-0.6454	10	0.87932	D	0	.	15.1754	0.72907	0.0:0.0:0.859:0.141	.	2210;2389;2119;2239;2273;2298;2330;2183;2208;2420;2329	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15;P02751	.;.;.;.;.;.;.;.;.;.;FINC_HUMAN	C	2183;2389;2298;2119;2420;2330;2329;2154;2127;2273;2208;2210;2239;1046	ENSP00000394423:R2183C;ENSP00000323534:R2389C;ENSP00000338200:R2298C;ENSP00000350534:R2119C;ENSP00000346839:R2420C;ENSP00000352696:R2329C;ENSP00000265312:R2154C;ENSP00000273049:R2127C;ENSP00000410422:R2273C;ENSP00000415018:R2208C;ENSP00000399538:R2210C;ENSP00000348285:R2239C;ENSP00000416139:R1046C	ENSP00000265313:R2330C	R	-	1	0	FN1	215935041	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.076000	0.57591	2.834000	0.97654	0.650000	0.86243	CGC	.		0.468	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
GRAP2	9402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	40366916	40366916	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr22:40366916G>A	ENST00000344138.4	+	8	1084	c.821G>A	c.(820-822)cGg>cAg	p.R274Q	GRAP2_ENST00000399090.2_Missense_Mutation_p.R161Q|GRAP2_ENST00000540310.1_Missense_Mutation_p.R208Q|GRAP2_ENST00000543252.1_Missense_Mutation_p.R234Q|GRAP2_ENST00000544756.1_Missense_Mutation_p.R202Q|GRAP2_ENST00000407075.3_Missense_Mutation_p.R274Q	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	274	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						CAGCGAGTGCGGTGGGCCCGG	0.642																																					p.R274Q		.											.	GRAP2	227	0			c.G821A						.						40.0	42.0	41.0					22																	40366916		2203	4300	6503	SO:0001583	missense	9402	exon8			GAGTGCGGTGGGC	AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.821G>A	22.37:g.40366916G>A	ENSP00000339186:p.Arg274Gln	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	10.0	NM_004810	B7Z8I3|O43726|Q9NRB7	Missense_Mutation	SNP	ENST00000344138.4	37	CCDS13999.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711173	0.68730	.	.	ENSG00000100351	ENST00000344138;ENST00000543252;ENST00000544006;ENST00000540310;ENST00000544756;ENST00000399090;ENST00000407075	T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55	5.38	5.38	0.77491	Src homology-3 domain (4);	0.744037	0.13093	N	0.414356	T	0.33235	0.0856	N	0.25426	0.745	0.29898	N	0.824618	P;D;D;D;D	0.71674	0.861;0.998;0.971;0.994;0.998	B;P;P;P;P	0.54140	0.073;0.743;0.725;0.557;0.743	T	0.04495	-1.0947	10	0.13853	T	0.58	-35.3168	14.9114	0.70761	0.0:0.0:0.8479:0.1521	.	161;274;208;248;274	B7Z8I3;Q6FI14;F5H548;B7Z8F8;O75791	.;.;.;.;GRAP2_HUMAN	Q	274;234;248;208;202;161;274	ENSP00000339186:R274Q;ENSP00000446350:R234Q;ENSP00000444734:R208Q;ENSP00000442195:R202Q;ENSP00000382040:R161Q;ENSP00000385607:R274Q	ENSP00000339186:R274Q	R	+	2	0	GRAP2	38696862	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	3.098000	0.50259	2.513000	0.84729	0.557000	0.71058	CGG	.		0.642	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321295.1	NM_004810	
GRIN2D	2906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48945414	48945414	+	Silent	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr19:48945414C>T	ENST00000263269.3	+	12	2536	c.2448C>T	c.(2446-2448)atC>atT	p.I816I		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	816					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.I816I(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TAGATGAGATCGAGATGCTGG	0.557																																					p.I816I		.											.	GRIN2D	156	1	Substitution - coding silent(1)	large_intestine(1)	c.C2448T						.						106.0	105.0	105.0					19																	48945414		2203	4300	6503	SO:0001819	synonymous_variant	2906	exon12			TGAGATCGAGATG	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2448C>T	19.37:g.48945414C>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	9.0	NM_000836		Silent	SNP	ENST00000263269.3	37	CCDS12719.1																																																																																			.		0.557	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
HIST1H4J	8363	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	27791909	27791909	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:27791909G>A	ENST00000355057.1	+	1	26	c.7G>A	c.(7-9)Ggc>Agc	p.G3S		NM_021968.3	NP_068803.1	P62805	H4_HUMAN	histone cluster 1, H4j	3					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			lung(2)|ovary(1)|pancreas(1)	4						CGTCATGTCTGGCCGCGGCAA	0.607																																					p.G3S		.											.	HIST1H4J	92	0			c.G7A						.						17.0	23.0	21.0					6																	27791909		1929	4165	6094	SO:0001583	missense	8363	exon1			ATGTCTGGCCGCG	J00188	CCDS4630.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197238	ENSG00000197238		"""Histones / Replication-dependent"""	4785	protein-coding gene	gene with protein product		602826	"""H4 histone family, member E"", ""histone 1, H4j"""	H4FE		6265100, 9439656, 12408966	Standard	NM_021968		Approved	H4/e, H4F2iv	uc003njp.3	P62805	OTTHUMG00000014487	ENST00000355057.1:c.7G>A	6.37:g.27791909G>A	ENSP00000347168:p.Gly3Ser	Somatic	317.0	1.0		WXS	Illumina HiSeq	Phase_I	245.0	57.0	NM_021968	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000355057.1	37	CCDS4630.1	.	.	.	.	.	.	.	.	.	.	.	16.89	3.247519	0.59103	.	.	ENSG00000197238	ENST00000355057	.	.	.	3.77	3.77	0.43336	.	0.000000	0.64402	U	0.000001	T	0.66684	0.2814	.	.	.	0.47778	D	0.999517	.	.	.	.	.	.	T	0.72603	-0.4243	6	0.87932	D	0	.	13.6149	0.62101	0.0:0.0:1.0:0.0	.	.	.	.	S	3	.	ENSP00000347168:G3S	G	+	1	0	HIST1H4J	27899888	1.000000	0.71417	0.507000	0.27676	0.353000	0.29299	9.241000	0.95402	2.038000	0.60285	0.484000	0.47621	GGC	.		0.607	HIST1H4J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040155.1	NM_021968	
IQSEC3	440073	hgsc.bcm.edu;bcgsc.ca	37	12	274692	274692	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr12:274692G>C	ENST00000538872.1	+	10	2920	c.2802G>C	c.(2800-2802)gaG>gaC	p.E934D	IQSEC3_ENST00000326261.4_Missense_Mutation_p.E934D|IQSEC3_ENST00000382841.2_Missense_Mutation_p.E631D|RP11-598F7.5_ENST00000540136.1_RNA|RP11-598F7.6_ENST00000537295.1_lincRNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	934	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		AGCTCTTTGAGAACGAGTGTA	0.498																																					p.E934D		.											.	IQSEC3	560	0			c.G2802C						.						143.0	133.0	137.0					12																	274692		2203	4300	6503	SO:0001583	missense	440073	exon10			CTTTGAGAACGAG	AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.2802G>C	12.37:g.274692G>C	ENSP00000437554:p.Glu934Asp	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	6.0	NM_001170738	A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	ENST00000538872.1	37	CCDS53728.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.594755	0.66219	.	.	ENSG00000120645	ENST00000538872;ENST00000326261;ENST00000382841	T;T;T	0.52057	0.68;0.68;0.68	4.87	4.87	0.63330	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.50205	0.1602	M	0.69185	2.1	0.80722	D	1	B;B	0.16603	0.002;0.018	B;B	0.17098	0.012;0.017	T	0.49312	-0.8953	10	0.45353	T	0.12	.	18.5623	0.91105	0.0:0.0:1.0:0.0	.	934;631	Q9UPP2;Q9UPP2-2	IQEC3_HUMAN;.	D	934;934;631	ENSP00000437554:E934D;ENSP00000315662:E934D;ENSP00000372292:E631D	ENSP00000315662:E934D	E	+	3	2	IQSEC3	144953	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.377000	0.66184	2.684000	0.91462	0.650000	0.86243	GAG	.		0.498	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902	
IQSEC3	440073	hgsc.bcm.edu;bcgsc.ca	37	12	274696	274696	+	Missense_Mutation	SNP	G	G	C	rs547194479	byFrequency	TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr12:274696G>C	ENST00000538872.1	+	10	2924	c.2806G>C	c.(2806-2808)Gag>Cag	p.E936Q	IQSEC3_ENST00000326261.4_Missense_Mutation_p.E936Q|IQSEC3_ENST00000382841.2_Missense_Mutation_p.E633Q|RP11-598F7.5_ENST00000540136.1_RNA|RP11-598F7.6_ENST00000537295.1_lincRNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	936	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CTTTGAGAACGAGTGTAAGTC	0.502																																					p.E936Q		.											.	IQSEC3	560	0			c.G2806C						.						135.0	126.0	129.0					12																	274696		2203	4300	6503	SO:0001583	missense	440073	exon10			GAGAACGAGTGTA	AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.2806G>C	12.37:g.274696G>C	ENSP00000437554:p.Glu936Gln	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	7.0	NM_001170738	A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	ENST00000538872.1	37	CCDS53728.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.661075	0.47572	.	.	ENSG00000120645	ENST00000538872;ENST00000326261;ENST00000382841	T;T;T	0.32515	1.45;1.45;1.45	4.87	4.87	0.63330	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.101640	0.64402	D	0.000003	T	0.32823	0.0842	L	0.52011	1.625	0.80722	D	1	B;B	0.31413	0.322;0.134	B;B	0.36608	0.229;0.191	T	0.06356	-1.0831	10	0.13470	T	0.59	.	18.5623	0.91105	0.0:0.0:1.0:0.0	.	936;633	Q9UPP2;Q9UPP2-2	IQEC3_HUMAN;.	Q	936;936;633	ENSP00000437554:E936Q;ENSP00000315662:E936Q;ENSP00000372292:E633Q	ENSP00000315662:E936Q	E	+	1	0	IQSEC3	144957	1.000000	0.71417	0.991000	0.47740	0.951000	0.60555	5.361000	0.66092	2.684000	0.91462	0.650000	0.86243	GAG	.		0.502	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902	
ITGBL1	9358	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	102345029	102345029	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr13:102345029C>A	ENST00000376180.3	+	8	1329	c.1110C>A	c.(1108-1110)gaC>gaA	p.D370E	ITGBL1_ENST00000376162.3_Missense_Mutation_p.D277E|ITGBL1_ENST00000545560.2_Missense_Mutation_p.D229E	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	370	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)				breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCTGTGAAGACCTCGATGGTG	0.488																																					p.D370E		.											.	ITGBL1	92	0			c.C1110A						.						291.0	229.0	250.0					13																	102345029		2203	4300	6503	SO:0001583	missense	9358	exon8			TGAAGACCTCGAT	AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.1110C>A	13.37:g.102345029C>A	ENSP00000365351:p.Asp370Glu	Somatic	136.0	2.0		WXS	Illumina HiSeq	Phase_I	98.0	27.0	NM_004791	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Missense_Mutation	SNP	ENST00000376180.3	37	CCDS9499.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.182329	0.38511	.	.	ENSG00000198542	ENST00000376180;ENST00000537118;ENST00000539955;ENST00000545560;ENST00000376162	T;T;T	0.68025	-0.3;-0.3;-0.3	5.51	2.72	0.32119	.	0.407574	0.31577	N	0.007405	T	0.51432	0.1674	L	0.42487	1.325	0.30495	N	0.770962	B;B	0.28713	0.22;0.045	B;B	0.32211	0.074;0.142	T	0.46386	-0.9195	10	0.06236	T	0.91	.	8.5892	0.33677	0.0:0.7627:0.0:0.2373	.	229;370	B3KTP1;O95965	.;ITGBL_HUMAN	E	370;278;229;229;277	ENSP00000365351:D370E;ENSP00000439903:D229E;ENSP00000365332:D277E	ENSP00000365332:D277E	D	+	3	2	ITGBL1	101143030	0.866000	0.29940	0.652000	0.29579	0.533000	0.34776	0.094000	0.15107	0.770000	0.33336	0.655000	0.94253	GAC	.		0.488	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	
IRS2	8660	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	110436226	110436226	+	Silent	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr13:110436226G>A	ENST00000375856.3	-	1	2689	c.2175C>T	c.(2173-2175)ggC>ggT	p.G725G		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	725					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			CCTTGTAGCCGCCCCCGCTCG	0.736																																					p.G725G	Melanoma(100;613 2409 40847)	.											.	IRS2	1334	0			c.C2175T						.						10.0	6.0	7.0					13																	110436226		1742	3572	5314	SO:0001819	synonymous_variant	8660	exon1			GTAGCCGCCCCCG	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.2175C>T	13.37:g.110436226G>A		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	5.0	NM_003749	Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	ENST00000375856.3	37	CCDS9510.1																																																																																			.		0.736	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
KCNH8	131096	broad.mit.edu;bcgsc.ca	37	3	19574931	19574931	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr3:19574931G>A	ENST00000328405.2	+	16	2930	c.2664G>A	c.(2662-2664)atG>atA	p.M888I		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	888					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						GTAAAGACATGAGAAATGTGA	0.463																																					p.M888I	NSCLC(124;1625 1765 8018 24930 42026)	.											.	KCNH8	524	0			c.G2664A						.						110.0	97.0	101.0					3																	19574931		2203	4300	6503	SO:0001583	missense	131096	exon16			AGACATGAGAAAT	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2664G>A	3.37:g.19574931G>A	ENSP00000328813:p.Met888Ile	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	6.0	NM_144633	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116800	0.37339	.	.	ENSG00000183960	ENST00000328405	D	0.98649	-5.05	5.68	4.8	0.61643	.	0.206555	0.22902	U	0.054260	D	0.96744	0.8937	L	0.48642	1.525	0.80722	D	1	B	0.09022	0.002	B	0.14578	0.011	D	0.95299	0.8402	9	.	.	.	.	14.5042	0.67741	0.0706:0.0:0.9294:0.0	.	888	Q96L42	KCNH8_HUMAN	I	888	ENSP00000328813:M888I	.	M	+	3	0	KCNH8	19549935	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	5.432000	0.66514	1.386000	0.46466	0.655000	0.94253	ATG	.		0.463	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
KCNU1	157855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	36666269	36666269	+	Silent	SNP	A	A	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr8:36666269A>C	ENST00000399881.3	+	7	727	c.690A>C	c.(688-690)atA>atC	p.I230I		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	230					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TGCTGTCAATAATTCTCAGTA	0.433																																					p.I230I		.											.	KCNU1	23	0			c.A690C						.						138.0	132.0	134.0					8																	36666269		1897	4126	6023	SO:0001819	synonymous_variant	157855	exon7			GTCAATAATTCTC	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.690A>C	8.37:g.36666269A>C		Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	12.0	NM_001031836		Silent	SNP	ENST00000399881.3	37	CCDS55220.1																																																																																			.		0.433	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
KCP	375616	broad.mit.edu;mdanderson.org	37	7	128520499	128520499	+	RNA	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:128520499A>T	ENST00000476647.2	-	0	3742							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						CCCGCCATGCAGGAGCAGCTG	0.662											OREG0018300	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	KCP	68	0			.						.						11.0	16.0	15.0					7																	128520499		686	1581	2267			375616	.			CCATGCAGGAGCA	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128520499A>T		Somatic	125.0	0.0	1565	WXS	Illumina HiSeq	Phase_I	178.0	16.0	.	Q8NBE0	RNA	SNP	ENST00000476647.2	37																																																																																				.		0.662	KCP-006	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000403051.1	NM_199349	
KIAA0430	9665	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	15727524	15727524	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr16:15727524C>T	ENST00000396368.3	-	5	1389	c.1183G>A	c.(1183-1185)Gac>Aac	p.D395N	KIAA0430_ENST00000602337.1_Missense_Mutation_p.D392N|KIAA0430_ENST00000344181.3_Missense_Mutation_p.D217N|KIAA0430_ENST00000551742.1_Missense_Mutation_p.D395N|KIAA0430_ENST00000540441.2_Missense_Mutation_p.D395N|KIAA0430_ENST00000548025.1_Missense_Mutation_p.D392N	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	395	NYN.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TTACTGATGTCACATACACAG	0.378																																					p.D395N		.											.	KIAA0430	90	0			c.G1183A						.						94.0	89.0	90.0					16																	15727524		1816	4081	5897	SO:0001583	missense	9665	exon5			TGATGTCACATAC	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.1183G>A	16.37:g.15727524C>T	ENSP00000379654:p.Asp395Asn	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	7.0	NM_014647	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	37	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	C	34	5.404170	0.96051	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	5.43	5.43	0.79202	Domain of unknown function DUF88 (1);	0.000000	0.85682	D	0.000000	D	0.84575	0.5502	M	0.85945	2.785	0.43793	D	0.996338	D;D;D;D	0.89917	0.986;1.0;1.0;0.989	D;D;D;D	0.91635	0.96;0.999;0.999;0.957	D	0.86455	0.1775	9	0.87932	D	0	.	19.5914	0.95514	0.0:1.0:0.0:0.0	.	394;392;391;394	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	N	395;395;394;217;392;395;395	.	ENSP00000315718:D394N	D	-	1	0	KIAA0430	15635025	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.210000	0.77924	2.720000	0.93068	0.591000	0.81541	GAC	.		0.378	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	
L1CAM	3897	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153133461	153133461	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chrX:153133461A>G	ENST00000370060.1	-	15	2009	c.1820T>C	c.(1819-1821)tTg>tCg	p.L607S	L1CAM_ENST00000361981.3_Missense_Mutation_p.L602S|L1CAM_ENST00000370057.3_Missense_Mutation_p.L607S|L1CAM_ENST00000543994.1_Missense_Mutation_p.L609S|L1CAM_ENST00000370055.1_Missense_Mutation_p.L602S|L1CAM_ENST00000361699.4_Missense_Mutation_p.L607S|L1CAM_ENST00000538883.1_Missense_Mutation_p.L609S	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	607	Ig-like C2-type 6.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCCACCACCAAGAGCTGTGC	0.637																																					p.L607S		.											.	L1CAM	138	0			c.T1820C						.						75.0	65.0	68.0					X																	153133461		2203	4300	6503	SO:0001583	missense	3897	exon14			ACCACCAAGAGCT	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.1820T>C	X.37:g.153133461A>G	ENSP00000359077:p.Leu607Ser	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	8.0	NM_000425	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.34|10.34	1.324014|1.324014	0.24080|0.24080	.|.	.|.	ENSG00000198910|ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699|ENST00000455590	T;T;T;T;T;T;T|.	0.65732|.	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17|.	5.53|5.53	5.53|5.53	0.82687|0.82687	Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.295217|.	0.23811|.	N|.	0.044334|.	T|T	0.40196|0.40196	0.1107|0.1107	N|N	0.21194|0.21194	0.64|0.64	0.33199|0.33199	D|D	0.55193|0.55193	B;P;B|.	0.35139|.	0.078;0.486;0.096|.	B;B;B|.	0.37239|.	0.031;0.244;0.052|.	T|T	0.52764|0.52764	-0.8532|-0.8532	10|5	0.37606|.	T|.	0.19|.	.|.	12.492|12.492	0.55905|0.55905	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	602;607;607|.	G3XAF4;P32004-2;P32004|.	.;.;L1CAM_HUMAN|.	S|R	607;609;607;609;602;602;607|65	ENSP00000359077:L607S;ENSP00000438430:L609S;ENSP00000359074:L607S;ENSP00000439645:L609S;ENSP00000354712:L602S;ENSP00000359072:L602S;ENSP00000355380:L607S|.	ENSP00000355380:L607S|.	L|W	-|-	2|1	0|0	L1CAM|L1CAM	152786655|152786655	0.010000|0.010000	0.17322|0.17322	0.937000|0.937000	0.37676|0.37676	0.874000|0.874000	0.50279|0.50279	0.728000|0.728000	0.26013|0.26013	1.856000|1.856000	0.53863|0.53863	0.430000|0.430000	0.28490|0.28490	TTG|TGG	.		0.637	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
LETMD1	25875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51442826	51442826	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr12:51442826G>T	ENST00000262055.4	+	2	171	c.132G>T	c.(130-132)aaG>aaT	p.K44N	LETMD1_ENST00000550929.1_5'UTR|LETMD1_ENST00000380123.2_Missense_Mutation_p.K44N|LETMD1_ENST00000552739.1_Intron|LETMD1_ENST00000547008.1_Missense_Mutation_p.K44N|LETMD1_ENST00000548516.1_3'UTR|LETMD1_ENST00000418425.2_Missense_Mutation_p.K44N	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	44	Required and sufficient for mitochondrial import.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						GGTCTTCAAAGCTTCACCTTT	0.448																																					p.K44N		.											.	LETMD1	90	0			c.G132T						.						107.0	100.0	102.0					12																	51442826		2203	4300	6503	SO:0001583	missense	25875	exon2			TTCAAAGCTTCAC	AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.132G>T	12.37:g.51442826G>T	ENSP00000262055:p.Lys44Asn	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	20.0	NM_001243689	A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Missense_Mutation	SNP	ENST00000262055.4	37	CCDS8806.1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.853884	0.71719	.	.	ENSG00000050426	ENST00000551477;ENST00000262055;ENST00000550442;ENST00000549340;ENST00000548209;ENST00000548251;ENST00000380123;ENST00000548401;ENST00000418425;ENST00000448283;ENST00000547008	T;T;T;T;T;T;T;T;T;T	0.52057	0.75;0.75;0.76;0.72;0.68;0.72;0.75;0.81;0.76;0.74	4.86	4.86	0.63082	.	0.273309	0.26503	N	0.024003	T	0.45716	0.1356	N	0.24115	0.695	0.30737	N	0.7466	D;P;B;P;B;B	0.57571	0.98;0.904;0.18;0.904;0.275;0.361	P;B;B;P;B;B	0.57152	0.814;0.398;0.149;0.494;0.224;0.205	T	0.47509	-0.9112	10	0.51188	T	0.08	-4.302	9.288	0.37769	0.0958:0.0:0.9042:0.0	.	44;44;44;44;44;44	B7Z9A7;F8VVQ3;B3KXK7;F8W6J0;F8W1Z2;Q6P1Q0	.;.;.;.;.;LTMD1_HUMAN	N	11;44;44;44;44;44;44;51;44;44;44	ENSP00000446862:K11N;ENSP00000262055:K44N;ENSP00000448110:K44N;ENSP00000449896:K44N;ENSP00000450275:K44N;ENSP00000447166:K44N;ENSP00000369466:K44N;ENSP00000450082:K51N;ENSP00000389903:K44N;ENSP00000447419:K44N	ENSP00000262055:K44N	K	+	3	2	LETMD1	49729093	0.995000	0.38212	1.000000	0.80357	0.981000	0.71138	1.498000	0.35660	2.685000	0.91497	0.655000	0.94253	AAG	.		0.448	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404710.1	NM_015416	
ELMOD1	55531	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	107463045	107463045	+	Intron	SNP	A	A	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:107463045A>C	ENST00000265840.7	+	1	180				ELMOD1_ENST00000443271.2_Intron|ELMOD1_ENST00000529675.1_Splice_Site|AP000889.3_ENST00000600612.1_Splice_Site|ELMOD1_ENST00000531234.1_Intron	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1						phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		CCCACCACCTAGGAAAATACG	0.473																																					.		.											.	.	.	0			c.258-2A>C						.						71.0	70.0	70.0					11																	107463045		1924	4127	6051	SO:0001627	intron_variant	0	exon2			CCACCTAGGAAAA	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.-86+910A>C	11.37:g.107463045A>C		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	15.0	NR_028328	B4E167|G5E9S5|Q9NPW3	RNA	SNP	ENST00000265840.7	37	CCDS44723.1																																																																																			.		0.473	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389406.1	NM_018712	
LRRTM1	347730	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	80529902	80529902	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:80529902G>T	ENST00000295057.3	-	2	1699	c.1043C>A	c.(1042-1044)gCa>gAa	p.A348E	LRRTM1_ENST00000409148.1_Missense_Mutation_p.A348E|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000496558.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	348	LRRCT.				exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CTCGCCCTGTGCGTACTCCGG	0.677										HNSCC(69;0.2)																											p.A348E		.											.	LRRTM1	73	0			c.C1043A						.						22.0	21.0	21.0					2																	80529902		2203	4300	6503	SO:0001583	missense	347730	exon2			CCCTGTGCGTACT	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1043C>A	2.37:g.80529902G>T	ENSP00000295057:p.Ala348Glu	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	18.0	NM_178839	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520072	0.64747	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.41400	1.0;1.0	5.32	5.32	0.75619	.	0.000000	0.85682	U	0.000000	T	0.61837	0.2379	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.60172	-0.7315	9	.	.	.	.	18.995	0.92809	0.0:0.0:1.0:0.0	.	348	Q86UE6	LRRT1_HUMAN	E	348	ENSP00000295057:A348E;ENSP00000386646:A348E	.	A	-	2	0	LRRTM1	80383413	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	6.798000	0.75155	2.452000	0.82932	0.655000	0.94253	GCA	.		0.677	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
MAPK6	5597	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	52356857	52356857	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr15:52356857A>G	ENST00000261845.5	+	6	2633	c.1826A>G	c.(1825-1827)cAg>cGg	p.Q609R	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	609					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		TTCATAAATCAGTTTTGTGAG	0.403																																					p.Q609R		.											.	MAPK6	1403	0			c.A1826G						.						76.0	76.0	76.0					15																	52356857		2195	4293	6488	SO:0001583	missense	5597	exon6			TAAATCAGTTTTG	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.1826A>G	15.37:g.52356857A>G	ENSP00000261845:p.Gln609Arg	Somatic	381.0	0.0		WXS	Illumina HiSeq	Phase_I	379.0	22.0	NM_002748	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	ENST00000261845.5	37	CCDS10147.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.215528	0.39102	.	.	ENSG00000069956	ENST00000261845	T	0.72051	-0.62	5.27	5.27	0.74061	.	0.100405	0.64402	D	0.000001	T	0.62307	0.2417	L	0.32530	0.975	0.53688	D	0.999979	B	0.19200	0.034	B	0.14578	0.011	T	0.61574	-0.7035	10	0.87932	D	0	-7.1715	15.3381	0.74273	1.0:0.0:0.0:0.0	.	609	Q16659	MK06_HUMAN	R	609	ENSP00000261845:Q609R	ENSP00000261845:Q609R	Q	+	2	0	MAPK6	50144149	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.710000	0.91388	2.052000	0.61016	0.444000	0.29173	CAG	.		0.403	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748	
MAN2A2	4122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	91448631	91448631	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr15:91448631A>G	ENST00000559717.1	+	3	742	c.283A>G	c.(283-285)Aat>Gat	p.N95D	MAN2A2_ENST00000360468.3_Missense_Mutation_p.N95D|MAN2A2_ENST00000431652.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	95					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CTACACGGTCAATGGCTCCTG	0.632																																					p.N95D		.											.	MAN2A2	136	0			c.A283G						.						41.0	47.0	45.0					15																	91448631		2198	4298	6496	SO:0001583	missense	4122	exon2			ACGGTCAATGGCT	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.283A>G	15.37:g.91448631A>G	ENSP00000452948:p.Asn95Asp	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	6.0	NM_006122	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	A	15.99	2.996855	0.54147	.	.	ENSG00000196547	ENST00000360468	T	0.77489	-1.1	6.0	6.0	0.97389	.	0.125481	0.64402	D	0.000001	T	0.79441	0.4446	L	0.43152	1.355	0.80722	D	1	D;P	0.54047	0.964;0.804	P;P	0.52881	0.712;0.519	T	0.77222	-0.2667	10	0.30854	T	0.27	-30.6061	16.2335	0.82360	1.0:0.0:0.0:0.0	.	95;95	P49641-1;P49641	.;MA2A2_HUMAN	D	95	ENSP00000353655:N95D	ENSP00000353655:N95D	N	+	1	0	MAN2A2	89249635	1.000000	0.71417	0.713000	0.30519	0.723000	0.41478	9.140000	0.94607	2.313000	0.78055	0.454000	0.30748	AAT	.		0.632	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
MAST3	23031	hgsc.bcm.edu;broad.mit.edu	37	19	18255828	18255828	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr19:18255828G>C	ENST00000262811.6	+	23	2741	c.2741G>C	c.(2740-2742)gGc>gCc	p.G914A	AC007192.6_ENST00000600364.2_RNA	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	914	Ser-rich.						ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						GGCAGCGGCGGCCCCCTCATG	0.687																																					p.G914A		.											.	MAST3	502	0			c.G2741C						.						16.0	23.0	21.0					19																	18255828		1920	4113	6033	SO:0001583	missense	23031	exon23			GCGGCGGCCCCCT	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.2741G>C	19.37:g.18255828G>C	ENSP00000262811:p.Gly914Ala	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	5.0	NM_015016	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	CCDS46014.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584252	0.46110	.	.	ENSG00000099308	ENST00000262811	T	0.65732	-0.17	4.48	4.48	0.54585	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.69851	0.3157	M	0.67953	2.075	0.34127	D	0.664846	D	0.60160	0.987	P	0.54401	0.751	T	0.75698	-0.3227	10	0.21014	T	0.42	-33.24	16.1214	0.81359	0.0:0.0:1.0:0.0	.	914	O60307	MAST3_HUMAN	A	914	ENSP00000262811:G914A	ENSP00000262811:G914A	G	+	2	0	MAST3	18116828	1.000000	0.71417	0.997000	0.53966	0.559000	0.35586	4.891000	0.63185	2.060000	0.61445	0.313000	0.20887	GGC	.		0.687	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150	
MFGE8	4240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	89443027	89443027	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr15:89443027A>T	ENST00000566497.1	-	7	947	c.886T>A	c.(886-888)Tcg>Acg	p.S296T	MFGE8_ENST00000539437.1_Missense_Mutation_p.S288T|MFGE8_ENST00000268151.7_Intron|MFGE8_ENST00000542878.1_Missense_Mutation_p.S252T|MFGE8_ENST00000268150.8_Missense_Mutation_p.S296T			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	296	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					ACCTCCTTCGAGGAGCCCAGG	0.512																																					p.S296T		.											.	MFGE8	91	0			c.T886A						.						56.0	48.0	51.0					15																	89443027		2200	4299	6499	SO:0001583	missense	4240	exon7			CCTTCGAGGAGCC	U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.886T>A	15.37:g.89443027A>T	ENSP00000456281:p.Ser296Thr	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	20.0	NM_005928	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Missense_Mutation	SNP	ENST00000566497.1	37	CCDS10347.1	.	.	.	.	.	.	.	.	.	.	G	4.783	0.145606	0.09134	.	.	ENSG00000140545	ENST00000268150;ENST00000539437;ENST00000542878	D;D;D	0.98044	-4.68;-4.68;-4.68	5.03	1.97	0.26223	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.373344	0.29707	N	0.011406	D	0.86451	0.5936	N	0.00991	-1.07	0.09310	N	1	B;B;B;B	0.12013	0.0;0.005;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.79176	-0.1911	10	0.08599	T	0.76	-7.7452	4.9386	0.13954	0.0733:0.1292:0.5304:0.2671	.	288;252;288;296	B3KTQ2;F5GZN3;F5H7N9;Q08431	.;.;.;MFGM_HUMAN	T	296;288;252	ENSP00000268150:S296T;ENSP00000442386:S288T;ENSP00000444332:S252T	ENSP00000268150:S296T	S	-	1	0	MFGE8	87244031	0.083000	0.21467	0.000000	0.03702	0.100000	0.18952	1.776000	0.38594	-0.084000	0.12595	-0.330000	0.08379	TCG	.		0.512	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000432804.1	NM_005928	
MFN1	55669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	179096495	179096495	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr3:179096495G>A	ENST00000471841.1	+	14	1681	c.1555G>A	c.(1555-1557)Gat>Aat	p.D519N	MFN1_ENST00000280653.7_Intron|MFN1_ENST00000263969.5_Missense_Mutation_p.D519N	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	519					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TTTTCAAGAGGATATTGTATT	0.388																																					p.D519N		.											.	MFN1	155	0			c.G1555A						.						106.0	103.0	104.0					3																	179096495		2203	4300	6503	SO:0001583	missense	55669	exon14			CAAGAGGATATTG	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.1555G>A	3.37:g.179096495G>A	ENSP00000420617:p.Asp519Asn	Somatic	262.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	28.0	NM_033540	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	37	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974223	0.53720	.	.	ENSG00000171109	ENST00000471841;ENST00000263969	T;T	0.61859	0.07;0.07	5.16	5.16	0.70880	.	0.088248	0.85682	D	0.000000	T	0.50854	0.1640	L	0.36672	1.1	0.80722	D	1	B;B	0.26318	0.146;0.146	B;B	0.21708	0.036;0.036	T	0.49881	-0.8892	10	0.51188	T	0.08	-21.1106	18.6527	0.91437	0.0:0.0:1.0:0.0	.	547;519	Q4AEJ4;Q8IWA4	.;MFN1_HUMAN	N	519	ENSP00000420617:D519N;ENSP00000263969:D519N	ENSP00000263969:D519N	D	+	1	0	MFN1	180579189	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.982000	0.63825	2.405000	0.81733	0.591000	0.81541	GAT	.		0.388	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
MFI2	4241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	196744154	196744154	+	Silent	SNP	C	C	T	rs375237562		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr3:196744154C>T	ENST00000296350.5	-	7	833	c.720G>A	c.(718-720)acG>acA	p.T240T		NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	240	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		AGGAGGGAAGCGTCTTCCCTG	0.677																																					p.T240T		.											.	MFI2	90	0			c.G720A						.	C		1,4363		0,1,2181	13.0	12.0	13.0		720	-7.1	0.4	3		13	0,8518		0,0,4259	no	coding-synonymous	MFI2	NM_005929.5		0,1,6440	TT,TC,CC		0.0,0.0229,0.0078		240/739	196744154	1,12881	2182	4259	6441	SO:0001819	synonymous_variant	4241	exon7			GGGAAGCGTCTTC		CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.720G>A	3.37:g.196744154C>T		Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	27.0	NM_005929	Q9BQE2	Silent	SNP	ENST00000296350.5	37	CCDS3325.1																																																																																			.		0.677	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340458.1		
MMP13	4322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	102826222	102826222	+	Splice_Site	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:102826222G>A	ENST00000260302.3	-	2	149	c.121C>T	c.(121-123)Cgc>Tgc	p.R41C	MMP13_ENST00000340273.4_Splice_Site_p.R41C	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	41					bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	CTCAGGTAGCGCTAGAAAAGA	0.453																																					p.R41C		.											.	MMP13	229	0			c.C121T						.						154.0	148.0	150.0					11																	102826222		2202	4299	6501	SO:0001630	splice_region_variant	4322	exon2			GGTAGCGCTAGAA	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.121-1C>T	11.37:g.102826222G>A		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	19.0	NM_002427	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	37	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560338	0.27827	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.38722	1.12;1.12	5.67	2.22	0.28083	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	2.203110	0.01394	N	0.013347	T	0.59348	0.2187	L	0.52905	1.665	0.80722	D	1	P	0.43542	0.81	P	0.52386	0.697	T	0.47433	-0.9118	10	0.72032	D	0.01	.	15.4179	0.74987	0.0:0.0:0.5576:0.4424	.	41	P45452	MMP13_HUMAN	C	41	ENSP00000260302:R41C;ENSP00000339672:R41C	ENSP00000260302:R41C	R	-	1	0	MMP13	102331432	0.008000	0.16893	0.447000	0.26932	0.044000	0.14063	0.014000	0.13333	0.808000	0.34231	0.655000	0.94253	CGC	.		0.453	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427	Missense_Mutation
MPP7	143098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	28378706	28378706	+	Silent	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr10:28378706T>C	ENST00000375732.1	-	12	1276	c.1017A>G	c.(1015-1017)gaA>gaG	p.E339E	MPP7_ENST00000445954.2_Silent_p.E214E|MPP7_ENST00000540098.1_Silent_p.E339E|MPP7_ENST00000337532.5_Silent_p.E339E|MPP7_ENST00000375719.3_Silent_p.E339E			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	339					establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						TCTTCTTGCATTCATACATGG	0.333																																					p.E339E		.											.	MPP7	45	0			c.A1017G						.						284.0	229.0	247.0					10																	28378706		2203	4300	6503	SO:0001819	synonymous_variant	143098	exon14			CTTGCATTCATAC	BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.1017A>G	10.37:g.28378706T>C		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	11.0	NM_173496	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Silent	SNP	ENST00000375732.1	37	CCDS7158.1																																																																																			.		0.333	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	
MUC2	4583	broad.mit.edu;mdanderson.org	37	11	1093134	1093134	+	Silent	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:1093134C>A	ENST00000441003.2	+	30	4980	c.4953C>A	c.(4951-4953)acC>acA	p.T1651T	MUC2_ENST00000359061.5_Silent_p.T1618T|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	agaccccaaccacgacaccca	0.627																																					p.T1651T		.											.	MUC2	90	0			c.C4953A						.						102.0	166.0	144.0					11																	1093134		1800	3370	5170	SO:0001819	synonymous_variant	4583	exon30			CCCAACCACGACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4953C>A	11.37:g.1093134C>A		Somatic	37.0	1.0		WXS	Illumina HiSeq	Phase_I	46.0	8.0	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MYBPC2	4606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50958840	50958840	+	Silent	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr19:50958840T>C	ENST00000357701.5	+	20	2328	c.2277T>C	c.(2275-2277)ccT>ccC	p.P759P		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	759	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		AGTGGAGGCCTCCGAACAGGA	0.592																																					p.P759P		.											.	MYBPC2	67	0			c.T2277C						.						87.0	91.0	90.0					19																	50958840		2018	4186	6204	SO:0001819	synonymous_variant	4606	exon20			GAGGCCTCCGAAC		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2277T>C	19.37:g.50958840T>C		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	7.0	NM_004533	A1L4G9	Silent	SNP	ENST00000357701.5	37	CCDS46152.1																																																																																			.		0.592	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
NBAS	51594	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	15492192	15492192	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:15492192C>T	ENST00000281513.5	-	35	4128	c.4103G>A	c.(4102-4104)aGa>aAa	p.R1368K	NBAS_ENST00000441750.1_Missense_Mutation_p.R1248K	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1368					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GAAATTCACTCTTTGATAAAG	0.338																																					p.R1368K		.											.	NBAS	94	0			c.G4103A						.						91.0	85.0	87.0					2																	15492192		2203	4300	6503	SO:0001583	missense	51594	exon35			TTCACTCTTTGAT	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.4103G>A	2.37:g.15492192C>T	ENSP00000281513:p.Arg1368Lys	Somatic	81.0	1.0		WXS	Illumina HiSeq	Phase_I	63.0	15.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.579|7.579	0.668342|0.668342	0.14776|0.14776	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000442506|ENST00000441750;ENST00000281513	.|T;T	.|0.16324	.|2.35;2.35	5.68|5.68	2.4|2.4	0.29515|0.29515	.|Secretory pathway Sec39 (1);	.|0.262616	.|0.42420	.|N	.|0.000707	T|T	0.09686|0.09686	0.0238|0.0238	N|N	0.22421|0.22421	0.69|0.69	0.21652|0.21652	N|N	0.999609|0.999609	.|B;B	.|0.24963	.|0.115;0.001	.|B;B	.|0.18561	.|0.022;0.003	T|T	0.22452|0.22452	-1.0216|-1.0216	5|10	.|0.87932	.|D	.|0	.|.	5.1342|5.1342	0.14926|0.14926	0.0:0.525:0.2677:0.2073|0.0:0.525:0.2677:0.2073	.|.	.|1248;1368	.|A2RRP1-2;A2RRP1	.|.;NBAS_HUMAN	K|K	416|1248;1368	.|ENSP00000413201:R1248K;ENSP00000281513:R1368K	.|ENSP00000281513:R1368K	E|R	-|-	1|2	0|0	NBAS|NBAS	15409643|15409643	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.458000|1.458000	0.35223|0.35223	0.558000|0.558000	0.29135|0.29135	-0.126000|-0.126000	0.14955|0.14955	GAG|AGA	.		0.338	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
NHP2	55651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	177577899	177577899	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:177577899G>A	ENST00000274606.3	-	3	475	c.326C>T	c.(325-327)cCc>cTc	p.P109L	NHP2_ENST00000314397.4_Intron	NM_017838.3	NP_060308.1	Q9NX24	NHP2_HUMAN	NHP2 ribonucleoprotein	109					rRNA pseudouridine synthesis (GO:0031118)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|kidney(1)|ovary(2)	4						CGTCTTAGAGGGGATATAGAC	0.537																																					p.P109L		.											.	NHP2	90	0			c.C326T						.						263.0	246.0	252.0					5																	177577899		2203	4300	6503	SO:0001583	missense	55651	exon3			TTAGAGGGGATAT	AF161404	CCDS4432.1, CCDS34308.1	5q35.3	2014-09-17	2012-12-10	2008-10-13	ENSG00000145912	ENSG00000145912			14377	protein-coding gene	gene with protein product		606470	"""nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)"", ""NHP2 ribonucleoprotein homolog (yeast)"""	NOLA2		11074001	Standard	NM_017838		Approved	FLJ20479	uc003mir.2	Q9NX24	OTTHUMG00000130886	ENST00000274606.3:c.326C>T	5.37:g.177577899G>A	ENSP00000274606:p.Pro109Leu	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	11.0	NM_017838	A6NKY8|Q9P095	Missense_Mutation	SNP	ENST00000274606.3	37	CCDS4432.1	.	.	.	.	.	.	.	.	.	.	g	19.81	3.896177	0.72639	.	.	ENSG00000145912	ENST00000274606;ENST00000502263;ENST00000514354;ENST00000511078	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.22	5.22	0.72569	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	T	0.75722	0.3888	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80281	-0.1448	10	0.87932	D	0	-12.0937	16.2705	0.82616	0.0:0.0:1.0:0.0	.	109	Q9NX24	NHP2_HUMAN	L	109;62;109;109	ENSP00000274606:P109L;ENSP00000431126:P62L;ENSP00000423803:P109L;ENSP00000423849:P109L	ENSP00000274606:P109L	P	-	2	0	NHP2	177510505	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	9.283000	0.95860	2.419000	0.82065	0.563000	0.77884	CCC	.		0.537	NHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253471.1	NM_017838	
NOV	4856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	120430376	120430376	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr8:120430376A>G	ENST00000259526.3	+	3	616	c.389A>G	c.(388-390)cAg>cGg	p.Q130R	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	0	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			TGCAAATTCCAGTGCACCTGC	0.527																																					p.Q130R		.											.	NOV	228	0			c.A389G						.						91.0	92.0	92.0					8																	120430376		2203	4300	6503	SO:0001583	missense	4856	exon3			AATTCCAGTGCAC	X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.389A>G	8.37:g.120430376A>G	ENSP00000259526:p.Gln130Arg	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	28.0	NM_002514		Missense_Mutation	SNP	ENST00000259526.3	37	CCDS6328.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.800907	0.50315	.	.	ENSG00000136999	ENST00000259526	T	0.72282	-0.64	5.51	1.56	0.23342	von Willebrand factor, type C (4);	0.437543	0.27072	N	0.021070	T	0.62612	0.2442	L	0.48218	1.51	0.31879	N	0.618705	P	0.36354	0.549	B	0.37650	0.255	T	0.65747	-0.6093	10	0.54805	T	0.06	-5.1154	10.8333	0.46673	0.6409:0.0:0.0:0.3591	.	130	P48745	NOV_HUMAN	R	130	ENSP00000259526:Q130R	ENSP00000259526:Q130R	Q	+	2	0	NOV	120499557	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.551000	0.53698	0.101000	0.17610	0.459000	0.35465	CAG	.		0.527	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381301.1	NM_002514	
NUDT12	83594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	102886634	102886634	+	Silent	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:102886634G>A	ENST00000230792.2	-	7	1413	c.1317C>T	c.(1315-1317)ttC>ttT	p.F439F	NUDT12_ENST00000507423.1_Silent_p.F421F	NM_031438.2	NP_113626.1	Q9BQG2	NUD12_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 12	439	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				NAD catabolic process (GO:0019677)|NADP catabolic process (GO:0006742)	nucleus (GO:0005634)|peroxisome (GO:0005777)	metal ion binding (GO:0046872)|NAD+ diphosphatase activity (GO:0000210)|NADH pyrophosphatase activity (GO:0035529)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|urinary_tract(1)	12		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		GTGGCACAAAGAATGCCTGCT	0.358																																					p.F439F		.											.	NUDT12	90	0			c.C1317T						.						108.0	108.0	108.0					5																	102886634		2203	4300	6503	SO:0001819	synonymous_variant	83594	exon7			CACAAAGAATGCC	AL136592	CCDS4096.1, CCDS75284.1	5q15	2013-01-10			ENSG00000112874	ENSG00000112874		"""Nudix motif containing"", ""Ankyrin repeat domain containing"""	18826	protein-coding gene	gene with protein product	"""nucleoside diphosphate linked moiety X-type motif 12"""	609232				11230166	Standard	XM_005272095		Approved	DKFZP761I172	uc003koi.3	Q9BQG2	OTTHUMG00000128739	ENST00000230792.2:c.1317C>T	5.37:g.102886634G>A		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	25.0	NM_031438	B3KUW2|Q8TAL7	Silent	SNP	ENST00000230792.2	37	CCDS4096.1																																																																																			.		0.358	NUDT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250650.1	NM_031438	
NUP205	23165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	135303347	135303347	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:135303347A>C	ENST00000285968.6	+	28	3985	c.3959A>C	c.(3958-3960)gAt>gCt	p.D1320A		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1320					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						GATGTGCATGATAAGGTGACG	0.363																																					p.D1320A		.											.	NUP205	207	0			c.A3959C						.						151.0	135.0	140.0					7																	135303347		2203	4300	6503	SO:0001583	missense	23165	exon28			TGCATGATAAGGT	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3959A>C	7.37:g.135303347A>C	ENSP00000285968:p.Asp1320Ala	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	11.0	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.468936	0.43839	.	.	ENSG00000155561	ENST00000285968	T	0.28666	1.6	5.46	5.46	0.80206	.	0.045120	0.85682	D	0.000000	T	0.28566	0.0707	L	0.47716	1.5	0.80722	D	1	B	0.30146	0.27	B	0.34931	0.192	T	0.04593	-1.0940	10	0.06757	T	0.87	-35.4076	15.5256	0.75901	1.0:0.0:0.0:0.0	.	1320	Q92621	NU205_HUMAN	A	1320	ENSP00000285968:D1320A	ENSP00000285968:D1320A	D	+	2	0	NUP205	134953887	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.942000	0.92970	2.068000	0.61886	0.383000	0.25322	GAT	.		0.363	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
NXPH4	11247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57619424	57619424	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr12:57619424T>C	ENST00000349394.5	+	2	996	c.821T>C	c.(820-822)tTc>tCc	p.F274S	Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	274	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						GCCAAGCCCTTCAAAGTCATC	0.577																																					p.F274S		.											.	NXPH4	68	0			c.T821C						.						58.0	65.0	62.0					12																	57619424		2203	4300	6503	SO:0001583	missense	11247	exon2			AGCCCTTCAAAGT	AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.821T>C	12.37:g.57619424T>C	ENSP00000333593:p.Phe274Ser	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	18.0	NM_007224	A8K4I4|Q7Z6L3|Q8N462	Missense_Mutation	SNP	ENST00000349394.5	37	CCDS8933.1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490594	0.64074	.	.	ENSG00000182379	ENST00000349394	.	.	.	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.69904	0.3163	L	0.54323	1.7	0.58432	D	0.999996	D	0.76494	0.999	D	0.83275	0.996	T	0.73164	-0.4069	9	0.87932	D	0	-19.2694	12.3172	0.54964	0.0:0.0:0.0:1.0	.	274	O95158	NXPH4_HUMAN	S	274	.	ENSP00000333593:F274S	F	+	2	0	NXPH4	55905691	1.000000	0.71417	1.000000	0.80357	0.428000	0.31595	7.635000	0.83286	1.744000	0.51775	0.460000	0.39030	TTC	.		0.577	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412474.1	NM_007224	
NYAP1	222950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100086033	100086033	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:100086033G>C	ENST00000300179.2	+	4	848	c.689G>C	c.(688-690)aGt>aCt	p.S230T	NYAP1_ENST00000423930.1_Missense_Mutation_p.S230T|NYAP1_ENST00000454988.1_Missense_Mutation_p.S173T	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	230					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GGAGGACGAAGTGGAGGAGGC	0.647																																					p.S230T		.											.	.	.	0			c.G689C						.						23.0	29.0	27.0					7																	100086033		2177	4262	6439	SO:0001583	missense	222950	exon4			GACGAAGTGGAGG	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.689G>C	7.37:g.100086033G>C	ENSP00000300179:p.Ser230Thr	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	20.0	NM_173564	Q6U9Y3|Q8N1V0	Missense_Mutation	SNP	ENST00000300179.2	37	CCDS5696.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.027215	0.35797	.	.	ENSG00000166924	ENST00000300179;ENST00000423930;ENST00000454988	T;T;T	0.29142	1.58;1.58;1.58	5.14	4.24	0.50183	.	0.208186	0.34291	N	0.004094	T	0.19446	0.0467	N	0.19112	0.55	0.27520	N	0.951423	B;B	0.13145	0.007;0.007	B;B	0.18263	0.021;0.021	T	0.13899	-1.0492	10	0.27082	T	0.32	-0.3675	10.8102	0.46543	0.0:0.0:0.8105:0.1894	.	173;230	C9JS30;Q6ZVC0	.;CG051_HUMAN	T	230;230;173	ENSP00000300179:S230T;ENSP00000411861:S230T;ENSP00000394424:S173T	ENSP00000300179:S230T	S	+	2	0	C7orf51	99923969	0.998000	0.40836	0.997000	0.53966	0.972000	0.66771	1.155000	0.31700	1.124000	0.41980	0.407000	0.27541	AGT	.		0.647	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
OPLAH	26873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	145113709	145113709	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr8:145113709C>T	ENST00000426825.1	-	5	635	c.554G>A	c.(553-555)cGc>cAc	p.R185H	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	185					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGCCAGGCTGCGGATGCCTCG	0.677																																					p.R185H		.											.	OPLAH	68	0			c.G554A						.						21.0	27.0	25.0					8																	145113709		2094	4196	6290	SO:0001583	missense	26873	exon5			AGGCTGCGGATGC	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.554G>A	8.37:g.145113709C>T	ENSP00000475943:p.Arg185His	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	14.0	NM_017570	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37		.	.	.	.	.	.	.	.	.	.	C	15.51	2.855781	0.51376	.	.	ENSG00000178814	ENST00000426825	.	.	.	4.68	3.79	0.43588	Hydantoinaseoxoprolinase, N-terminal (1);	0.194195	0.43747	N	0.000535	T	0.40347	0.1113	.	.	.	0.34227	D	0.676085	B	0.09022	0.002	B	0.08055	0.003	T	0.48246	-0.9052	7	0.62326	D	0.03	.	6.6775	0.23102	0.0:0.7773:0.0:0.2227	.	185	O14841	OPLA_HUMAN	H	185	.	ENSP00000412071:R185H	R	-	2	0	OPLAH	145185697	0.987000	0.35691	0.999000	0.59377	0.944000	0.59088	0.567000	0.23608	0.948000	0.37687	0.561000	0.74099	CGC	.		0.677	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
OR13D1	286365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	107457351	107457351	+	Silent	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr9:107457351C>T	ENST00000318763.5	+	1	692	c.649C>T	c.(649-651)Cta>Tta	p.L217L		NM_001004484.1	NP_001004484.1	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D, member 1	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(10)|ovary(1)|prostate(2)|skin(2)	19						TTTGGCCCTTCTAAAACTTGT	0.368																																					p.L217L		.											.	OR13D1	70	0			c.C649T						.						187.0	178.0	181.0					9																	107457351		2203	4300	6503	SO:0001819	synonymous_variant	286365	exon1			GCCCTTCTAAAAC		CCDS35094.1	9q31.1	2013-09-24			ENSG00000179055	ENSG00000179055		"""GPCR / Class A : Olfactory receptors"""	14695	protein-coding gene	gene with protein product							Standard	NM_001004484		Approved		uc011lvs.2	Q8NGV5	OTTHUMG00000020412	ENST00000318763.5:c.649C>T	9.37:g.107457351C>T		Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	35.0	NM_001004484	B9EIS1|Q6IFL1	Silent	SNP	ENST00000318763.5	37	CCDS35094.1																																																																																			.		0.368	OR13D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053483.1		
OR4M1	441670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20248815	20248815	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr14:20248815A>G	ENST00000315957.4	+	1	415	c.334A>G	c.(334-336)Atg>Gtg	p.M112V		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGCTTCGGAGATGTTCTTGCT	0.478																																					p.M112V		.											.	OR4M1	68	0			c.A334G						.						240.0	253.0	248.0					14																	20248815		2203	4300	6503	SO:0001583	missense	441670	exon1			TCGGAGATGTTCT		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.334A>G	14.37:g.20248815A>G	ENSP00000319654:p.Met112Val	Somatic	237.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	25.0	NM_001005500	B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	2.302	-0.360033	0.05103	.	.	ENSG00000176299	ENST00000315957	T	0.00384	7.6	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000014	T	0.00210	0.0006	L	0.33093	0.98	0.25478	N	0.987765	B	0.34015	0.435	B	0.27608	0.081	T	0.40794	-0.9544	10	0.17832	T	0.49	-21.4932	8.1327	0.31037	0.7956:0.2044:0.0:0.0	.	112	Q8NGD0	OR4M1_HUMAN	V	112	ENSP00000319654:M112V	ENSP00000319654:M112V	M	+	1	0	OR4M1	19318655	0.001000	0.12720	1.000000	0.80357	0.945000	0.59286	0.100000	0.15231	1.949000	0.56562	0.414000	0.27820	ATG	.		0.478	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
OR5D18	219438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55587564	55587564	+	Silent	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:55587564A>T	ENST00000333976.4	+	1	479	c.459A>T	c.(457-459)ggA>ggT	p.G153G		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				ATGCCTGGGGAGTCTCATGTT	0.473																																					p.G153G		.											.	OR5D18	71	0			c.A459T						.						193.0	181.0	185.0					11																	55587564		2200	4296	6496	SO:0001819	synonymous_variant	219438	exon1			CTGGGGAGTCTCA	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.459A>T	11.37:g.55587564A>T		Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	29.0	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Silent	SNP	ENST00000333976.4	37	CCDS31510.1																																																																																			.		0.473	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
OR8K1	390157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56113645	56113645	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:56113645C>A	ENST00000279783.2	+	1	225	c.131C>A	c.(130-132)aCa>aAa	p.T44K		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					TATCTGGTCACAGTGATAGGC	0.458										HNSCC(65;0.19)																											p.T44K		.											.	OR8K1	70	0			c.C131A						.						152.0	134.0	140.0					11																	56113645		2201	4296	6497	SO:0001583	missense	390157	exon1			TGGTCACAGTGAT	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.131C>A	11.37:g.56113645C>A	ENSP00000279783:p.Thr44Lys	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	25.0	NM_001002907	B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	ENST00000279783.2	37	CCDS31528.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190884	0.38707	.	.	ENSG00000150261	ENST00000279783	T	0.00509	6.91	5.09	4.18	0.49190	.	0.000000	0.52532	D	0.000075	T	0.01730	0.0055	M	0.92412	3.305	0.09310	N	1	D	0.62365	0.991	P	0.58210	0.835	T	0.15780	-1.0425	10	0.87932	D	0	-13.1605	9.3771	0.38290	0.0:0.8404:0.0:0.1596	.	44	Q8NGG5	OR8K1_HUMAN	K	44	ENSP00000279783:T44K	ENSP00000279783:T44K	T	+	2	0	OR8K1	55870221	0.012000	0.17670	0.007000	0.13788	0.159000	0.22180	1.706000	0.37878	2.344000	0.79699	0.549000	0.68633	ACA	.		0.458	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907	
OTP	23440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	76932919	76932919	+	Silent	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:76932919C>A	ENST00000306422.3	-	2	1312	c.174G>T	c.(172-174)ctG>ctT	p.L58L	OTP_ENST00000515716.1_5'Flank	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	58					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		CCTCCCCGGGCAGCAGAGTGG	0.726																																					p.L58L		.											.	OTP	69	0			c.G174T						.						15.0	18.0	17.0					5																	76932919		2200	4295	6495	SO:0001819	synonymous_variant	23440	exon2			CCCGGGCAGCAGA		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.174G>T	5.37:g.76932919C>A		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	13.0	NM_032109		Silent	SNP	ENST00000306422.3	37	CCDS4039.1																																																																																			.		0.726	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220016.2		
OTUD7B	56957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	149915759	149915759	+	Silent	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:149915759G>A	ENST00000369135.4	-	12	2823	c.2529C>T	c.(2527-2529)ttC>ttT	p.F843F		NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	843					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			CACCCGTTCAGAACCTGTGCA	0.512																																					p.F843F		.											.	OTUD7B	502	0			c.C2529T						.						96.0	99.0	98.0					1																	149915759		1973	4144	6117	SO:0001819	synonymous_variant	56957	exon12			CGTTCAGAACCTG	AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.2529C>T	1.37:g.149915759G>A		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	8.0	NM_020205	B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Silent	SNP	ENST00000369135.4	37	CCDS41389.1																																																																																			.		0.512	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034146.3	NM_020205	
PCDH1	5097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	141244054	141244054	+	Silent	SNP	C	C	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:141244054C>G	ENST00000394536.3	-	3	1981	c.1842G>C	c.(1840-1842)ctG>ctC	p.L614L	PCDH1_ENST00000287008.3_Silent_p.L614L|PCDH1_ENST00000456271.1_Silent_p.L602L|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000536585.1_Silent_p.L592L|PCDH1_ENST00000503492.1_Intron	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	614	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TGTAGCCACTCAGCATAAATT	0.552																																					p.L614L	Ovarian(132;1609 1739 4190 14731 45037)	.											.	PCDH1	95	0			c.G1842C						.						82.0	76.0	78.0					5																	141244054		2203	4300	6503	SO:0001819	synonymous_variant	5097	exon3			GCCACTCAGCATA	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1842G>C	5.37:g.141244054C>G		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	8.0	NM_032420	Q8IUP2	Silent	SNP	ENST00000394536.3	37	CCDS43375.1																																																																																			.		0.552	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	82764470	82764470	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:82764470G>C	ENST00000333891.9	-	3	2733	c.2396C>G	c.(2395-2397)tCt>tGt	p.S799C	PCLO_ENST00000423517.2_Missense_Mutation_p.S799C	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GGGTTTGGCAGAGTCTGTTTT	0.413																																					p.S799C		.											.	PCLO	29	0			c.C2396G						.						199.0	183.0	188.0					7																	82764470		1868	4104	5972	SO:0001583	missense	27445	exon3			TTGGCAGAGTCTG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2396C>G	7.37:g.82764470G>C	ENSP00000334319:p.Ser799Cys	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	234.0	15.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	5.104	0.204815	0.09704	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17213	2.29;2.29	5.91	5.03	0.67393	.	.	.	.	.	T	0.19644	0.0472	L	0.27053	0.805	0.09310	N	1	P;P	0.51351	0.944;0.944	P;P	0.50192	0.634;0.634	T	0.07177	-1.0786	9	0.87932	D	0	.	11.3693	0.49690	0.1887:0.0:0.8113:0.0	.	799;799	Q9Y6V0-5;Q9Y6V0-6	.;.	C	745;799;799	ENSP00000334319:S799C;ENSP00000388393:S799C	ENSP00000334319:S799C	S	-	2	0	PCLO	82602406	0.486000	0.25980	0.896000	0.35187	0.857000	0.48899	0.956000	0.29202	1.510000	0.48803	0.650000	0.86243	TCT	.		0.413	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
POLR2B	5431	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	4	57889912	57889912	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr4:57889912C>T	ENST00000381227.1	+	21	3264	c.2851C>T	c.(2851-2853)Caa>Taa	p.Q951*	POLR2B_ENST00000431623.2_Nonsense_Mutation_p.Q876*|POLR2B_ENST00000314595.5_Nonsense_Mutation_p.Q951*|POLR2B_ENST00000441246.2_Nonsense_Mutation_p.Q944*			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	951					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					TCAGTATAGACAAGAGGTAGG	0.338																																					p.Q951X		.											.	POLR2B	92	0			c.C2851T						.						84.0	82.0	82.0					4																	57889912		2203	4300	6503	SO:0001587	stop_gained	5431	exon20			TATAGACAAGAGG		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2851C>T	4.37:g.57889912C>T	ENSP00000370625:p.Gln951*	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	16.0	NM_000938	A8K1A8|Q8IZ61	Nonsense_Mutation	SNP	ENST00000381227.1	37	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	C	42	9.519498	0.99193	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.3953	0.60849	0.0:0.9285:0.0:0.0715	.	.	.	.	X	951;876;944;951	.	ENSP00000312735:Q951X	Q	+	1	0	POLR2B	57584669	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.779000	0.85648	2.771000	0.95319	0.563000	0.77884	CAA	.		0.338	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
POU3F4	5456	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	82763684	82763684	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chrX:82763684C>T	ENST00000373200.2	+	1	416	c.352C>T	c.(352-354)Ccg>Tcg	p.P118S	RP3-326L13.2_ENST00000607095.1_RNA|RP3-326L13.3_ENST00000607789.1_lincRNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	118					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						GGGGGCCAGCCCGGCACCGAA	0.652																																					p.P118S		.											.	POU3F4	131	0			c.C352T						.						34.0	33.0	33.0					X																	82763684		2198	4297	6495	SO:0001583	missense	5456	exon1			GCCAGCCCGGCAC	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.352C>T	X.37:g.82763684C>T	ENSP00000362296:p.Pro118Ser	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	8.0	NM_000307	B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885601	0.33255	.	.	ENSG00000196767	ENST00000373200	D	0.84298	-1.83	5.01	5.01	0.66863	.	0.234157	0.34411	N	0.003984	T	0.71434	0.3339	N	0.08118	0	0.58432	D	0.999993	B	0.22211	0.066	B	0.20184	0.028	T	0.67432	-0.5672	10	0.23891	T	0.37	.	14.9378	0.70970	0.0:1.0:0.0:0.0	.	118	P49335	PO3F4_HUMAN	S	118	ENSP00000362296:P118S	ENSP00000362296:P118S	P	+	1	0	POU3F4	82650340	1.000000	0.71417	0.876000	0.34364	0.674000	0.39518	2.554000	0.45845	2.201000	0.70794	0.525000	0.51046	CCG	.		0.652	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307	
PROS1	5627	ucsc.edu;bcgsc.ca	37	3	93611955	93611955	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr3:93611955T>C	ENST00000394236.3	-	10	1293	c.977A>G	c.(976-978)gAa>gGa	p.E326G	PROS1_ENST00000407433.1_Missense_Mutation_p.E195G	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	326	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	GAAATCAAATTCTGCTGAAAA	0.383																																					p.E326G		.											.	PROS1	153	0			c.A977G						.						42.0	41.0	41.0					3																	93611955		2203	4300	6503	SO:0001583	missense	5627	exon10			TCAAATTCTGCTG		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.977A>G	3.37:g.93611955T>C	ENSP00000377783:p.Glu326Gly	Somatic	393.0	2.0		WXS	Illumina HiSeq	.	364.0	79.0	NM_000313	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.075261	0.55646	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	T;T	0.79653	-1.29;-1.29	4.47	4.47	0.54385	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.000000	0.85682	D	0.000000	D	0.84969	0.5590	M	0.85945	2.785	0.58432	D	0.999991	D	0.56035	0.974	P	0.47981	0.563	D	0.88107	0.2823	10	0.72032	D	0.01	.	13.9186	0.63916	0.0:0.0:0.0:1.0	.	326	P07225	PROS_HUMAN	G	326;195	ENSP00000377783:E326G;ENSP00000385794:E195G	ENSP00000377783:E326G	E	-	2	0	PROS1	95094645	0.998000	0.40836	0.990000	0.47175	0.578000	0.36192	2.365000	0.44196	1.886000	0.54624	0.477000	0.44152	GAA	.		0.383	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313	
PRRG3	79057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	150869170	150869170	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chrX:150869170C>A	ENST00000370353.3	+	4	751	c.361C>A	c.(361-363)Cta>Ata	p.L121I	PRRG3_ENST00000538575.1_Missense_Mutation_p.L121I|PRRG3_ENST00000370354.1_3'UTR			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	121						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					GAACCGGTACCTAGCCAGTCG	0.632																																					p.L121I		.											.	PRRG3	134	0			c.C361A						.						81.0	82.0	82.0					X																	150869170		2203	4300	6503	SO:0001583	missense	79057	exon4			CGGTACCTAGCCA	AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.361C>A	X.37:g.150869170C>A	ENSP00000359378:p.Leu121Ile	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	11.0	NM_024082	A1A523|A1A575|Q8N2N6	Missense_Mutation	SNP	ENST00000370353.3	37	CCDS14699.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.581062	0.65992	.	.	ENSG00000130032	ENST00000538575;ENST00000370353	D;D	0.98474	-4.95;-4.95	4.91	3.09	0.35607	.	0.000000	0.64402	D	0.000015	D	0.97529	0.9191	L	0.40543	1.245	0.37655	D	0.922546	D	0.76494	0.999	D	0.78314	0.991	D	0.96110	0.9076	10	0.23302	T	0.38	-9.5887	9.5138	0.39093	0.0:0.8048:0.0:0.1952	.	121	Q9BZD7	TMG3_HUMAN	I	121	ENSP00000440217:L121I;ENSP00000359378:L121I	ENSP00000359378:L121I	L	+	1	2	PRRG3	150619826	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.003000	0.40844	0.980000	0.38523	0.529000	0.55759	CTA	.		0.632	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060880.1	NM_024082	
PSG11	5680	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43529163	43529163	+	Missense_Mutation	SNP	A	A	G	rs1058223	byFrequency	TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr19:43529163A>G	ENST00000401740.1	-	2	213	c.110T>C	c.(109-111)aTg>aCg	p.M37T	PSG11_ENST00000306322.7_Intron|PSG11_ENST00000320078.7_Missense_Mutation_p.M37T|PSG11_ENST00000403486.1_Intron			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	37	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				GGCTTCAATCATGACTTGGGC	0.463																																					p.M37T		.											.	.	.	0			c.T110C						.						198.0	201.0	200.0					19																	43529163		2200	4295	6495	SO:0001583	missense	5680	exon2			TCAATCATGACTT	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.110T>C	19.37:g.43529163A>G	ENSP00000384995:p.Met37Thr	Somatic	175.0	2.0		WXS	Illumina HiSeq	.	235.0	53.0	NM_002785	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	37	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	g	0.001	-2.920349	0.00055	.	.	ENSG00000243130	ENST00000320078;ENST00000401740	T;T	0.01287	5.05;5.05	0.929	0.929	0.19449	Immunoglobulin-like fold (1);	.	.	.	.	T	0.00384	0.0012	N	0.00282	-1.705	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45352	-0.9267	9	0.02654	T	1	.	3.4752	0.07582	0.2985:0.0:0.7015:0.0	rs1058223	37	Q9UQ72	PSG11_HUMAN	T	37	ENSP00000319140:M37T;ENSP00000384995:M37T	ENSP00000319140:M37T	M	-	2	0	PSG11	48221003	0.000000	0.05858	0.008000	0.14137	0.016000	0.09150	-0.248000	0.08854	-0.028000	0.13850	-1.160000	0.01791	ATG	A|0.300;G|0.700		0.463	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785	
PXDN	7837	broad.mit.edu;bcgsc.ca	37	2	1653324	1653324	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:1653324G>A	ENST00000252804.4	-	17	2278	c.2228C>T	c.(2227-2229)aCg>aTg	p.T743M		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	743					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GCCGTCGTGCGTCCGGTACTT	0.607																																					p.T743M		.											.	PXDN	166	0			c.C2228T						.						109.0	118.0	115.0					2																	1653324		2074	4206	6280	SO:0001583	missense	7837	exon17			TCGTGCGTCCGGT	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2228C>T	2.37:g.1653324G>A	ENSP00000252804:p.Thr743Met	Somatic	118.0	1.0		WXS	Illumina HiSeq	Phase_I	89.0	6.0	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285283	0.59867	.	.	ENSG00000130508	ENST00000252804	T	0.76316	-1.01	5.63	5.63	0.86233	.	0.054165	0.85682	D	0.000000	D	0.91784	0.7401	H	0.94698	3.57	0.58432	D	0.999996	D	0.89917	1.0	D	0.74023	0.982	D	0.93527	0.6866	10	0.87932	D	0	-37.0103	19.7328	0.96190	0.0:0.0:1.0:0.0	.	743	Q92626	PXDN_HUMAN	M	743	ENSP00000252804:T743M	ENSP00000252804:T743M	T	-	2	0	PXDN	1632331	1.000000	0.71417	0.494000	0.27515	0.506000	0.33950	5.598000	0.67585	2.661000	0.90470	0.558000	0.71614	ACG	.		0.607	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
RAB1A	5861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	65331882	65331882	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:65331882G>T	ENST00000409784.3	-	2	272	c.82C>A	c.(82-84)Ctt>Att	p.L28I	RAB1A_ENST00000409892.1_Missense_Mutation_p.L28I|RAB1A_ENST00000398529.3_Missense_Mutation_p.L28I|RAB1A_ENST00000260638.8_Missense_Mutation_p.L28I|RAB1A_ENST00000409751.1_Missense_Mutation_p.L28I|RAB1A_ENST00000494188.1_5'UTR|RAB1A_ENST00000356214.7_Missense_Mutation_p.L28I	NM_004161.4	NP_004152.1	P62820	RAB1A_HUMAN	RAB1A, member RAS oncogene family	28					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cargo loading into COPII-coated vesicle (GO:0090110)|cell migration (GO:0016477)|defense response to bacterium (GO:0042742)|endocytosis (GO:0006897)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|growth hormone secretion (GO:0030252)|GTP catabolic process (GO:0006184)|interleukin-8 secretion (GO:0072606)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|positive regulation of glycoprotein metabolic process (GO:1903020)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle transport along microtubule (GO:0047496)|vesicle-mediated transport (GO:0016192)|virion assembly (GO:0019068)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|melanosome (GO:0042470)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|lung(3)|prostate(1)	6						AACCTAAGAAGAAGGCAAGAC	0.299																																					p.L28I		.											.	RAB1A	227	0			c.C82A						.						37.0	34.0	35.0					2																	65331882		1855	4108	5963	SO:0001583	missense	5861	exon2			TAAGAAGAAGGCA	M28209	CCDS46305.1, CCDS46306.1	2p14	2008-02-05		2002-03-17	ENSG00000138069	ENSG00000138069		"""RAB, member RAS oncogene"""	9758	protein-coding gene	gene with protein product	"""Rab GTPase YPT1 homolog (yeast)"""	179508		RAB1		2501306	Standard	NM_004161		Approved	YPT1	uc002sdm.3	P62820	OTTHUMG00000152725	ENST00000409784.3:c.82C>A	2.37:g.65331882G>T	ENSP00000387286:p.Leu28Ile	Somatic	728.0	1.0		WXS	Illumina HiSeq	Phase_I	597.0	148.0	NM_004161	P11476|Q6FIE7|Q96N61|Q9Y3T2	Missense_Mutation	SNP	ENST00000409784.3	37	CCDS46306.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923165	0.92319	.	.	ENSG00000138069	ENST00000409784;ENST00000409892;ENST00000409751;ENST00000398529;ENST00000260638;ENST00000356214	T;T;T;T;T;T	0.81330	-1.28;-1.48;-1.48;-1.28;-1.28;-1.28	5.81	5.81	0.92471	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85575	0.5728	L	0.31157	0.91	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;0.99;1.0;0.958	D;P;D;D	0.97110	1.0;0.859;0.999;0.94	D	0.86690	0.1922	10	0.87932	D	0	.	19.6699	0.95907	0.0:0.0:1.0:0.0	.	28;28;28;28	B7Z8M7;P62820-2;P62820-3;P62820	.;.;.;RAB1A_HUMAN	I	28	ENSP00000387286:L28I;ENSP00000386451:L28I;ENSP00000386672:L28I;ENSP00000381540:L28I;ENSP00000260638:L28I;ENSP00000348546:L28I	ENSP00000260638:L28I	L	-	1	0	RAB1A	65185386	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	9.000000	0.93564	2.759000	0.94783	0.591000	0.81541	CTT	.		0.299	RAB1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327572.1	NM_004161	
RBP7	116362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	10068317	10068317	+	Silent	SNP	A	A	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:10068317A>C	ENST00000294435.7	+	3	382	c.339A>C	c.(337-339)ggA>ggC	p.G113G		NM_052960.2	NP_443192.1	Q96R05	RET7_HUMAN	retinol binding protein 7, cellular	113						cytoplasm (GO:0005737)	retinal binding (GO:0016918)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(1)	2		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	GGATCGAAGGAGACAAACTCC	0.463																																					p.G113G		.											.	RBP7	90	0			c.A339C						.						99.0	89.0	93.0					1																	10068317		2203	4300	6503	SO:0001819	synonymous_variant	116362	exon3			CGAAGGAGACAAA	AF399927	CCDS109.1	1p36.22	2013-03-01			ENSG00000162444	ENSG00000162444		"""Fatty acid binding protein family"""	30316	protein-coding gene	gene with protein product		608604				12177003	Standard	NM_052960		Approved	CRBPIV	uc001aqq.3	Q96R05	OTTHUMG00000001798	ENST00000294435.7:c.339A>C	1.37:g.10068317A>C		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	11.0	NM_052960	B2R517|Q5SWJ4	Silent	SNP	ENST00000294435.7	37	CCDS109.1																																																																																			.		0.463	RBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005027.2	NM_052960	
RET	5979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	43598063	43598063	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr10:43598063A>G	ENST00000355710.3	+	3	843	c.611A>G	c.(610-612)tAc>tGc	p.Y204C	RET_ENST00000340058.5_Missense_Mutation_p.Y204C	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	204	Cadherin. {ECO:0000255|PROSITE- ProRule:PRU00043}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	AGCGTGGCCTACAGGCTCCTG	0.632		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.Y204C	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	.	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	RET	4507	0			c.A611G						.						59.0	47.0	51.0					10																	43598063		2203	4300	6503	SO:0001583	missense	5979	exon3	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	TGGCCTACAGGCT	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.611A>G	10.37:g.43598063A>G	ENSP00000347942:p.Tyr204Cys	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	6.0	NM_020975	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	37	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.444954	0.63178	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	D;D	0.88896	-2.44;-2.44	5.09	5.09	0.68999	Cadherin (4);Cadherin-like (1);	0.059166	0.64402	D	0.000001	D	0.91181	0.7222	L	0.38175	1.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.99	D	0.92236	0.5796	10	0.87932	D	0	.	13.8546	0.63519	1.0:0.0:0.0:0.0	.	204;204	P07949;P07949-2	RET_HUMAN;.	C	204	ENSP00000347942:Y204C;ENSP00000344798:Y204C	ENSP00000344798:Y204C	Y	+	2	0	RET	42918069	1.000000	0.71417	0.460000	0.27093	0.688000	0.40055	7.274000	0.78538	1.910000	0.55303	0.533000	0.62120	TAC	.		0.632	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975	
RFPL4B	442247	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	112671285	112671285	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:112671285T>A	ENST00000441065.2	+	3	687	c.375T>A	c.(373-375)gaT>gaA	p.D125E	RP11-506B6.6_ENST00000587816.1_RNA|RP11-506B6.6_ENST00000590673.1_RNA|RP11-506B6.6_ENST00000585611.1_RNA	NM_001013734.2	NP_001013756.2	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	125	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	14		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		TCCACCACGATCTGACAAAAG	0.537																																					p.D125E		.											.	RFPL4B	68	0			c.T375A						.						72.0	75.0	74.0					6																	112671285		2203	4300	6503	SO:0001583	missense	442247	exon3			CCACGATCTGACA	AK122906	CCDS34515.1	6q21	2007-04-24			ENSG00000251258	ENSG00000251258		"""RING-type (C3HC4) zinc fingers"""	33264	protein-coding gene	gene with protein product							Standard	NM_001013734		Approved	RNF211	uc003pvx.1	Q6ZWI9	OTTHUMG00000015390	ENST00000441065.2:c.375T>A	6.37:g.112671285T>A	ENSP00000423391:p.Asp125Glu	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	5.0	NM_001013734	A2RU91	Missense_Mutation	SNP	ENST00000441065.2	37	CCDS34515.1	.	.	.	.	.	.	.	.	.	.	T	10.51	1.369974	0.24771	.	.	ENSG00000251258	ENST00000441065	T	0.61510	0.1	4.14	-0.604	0.11626	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	1.740060	0.03871	N	0.275586	T	0.22244	0.0536	L	0.45470	1.425	0.09310	N	1	B	0.20261	0.043	B	0.15870	0.014	T	0.03394	-1.1041	10	0.18710	T	0.47	.	3.6165	0.08079	0.3124:0.4484:0.0:0.2392	.	125	Q6ZWI9	RFPLB_HUMAN	E	125	ENSP00000423391:D125E	ENSP00000423391:D125E	D	+	3	2	RFPL4B	112777978	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.492000	0.06467	-0.117000	0.11872	-0.146000	0.13790	GAT	.		0.537	RFPL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041885.2	NM_001013734	
RHOT1	55288	hgsc.bcm.edu;broad.mit.edu	37	17	30469471	30469476	+	5'UTR	DEL	CCGCCG	CCGCCG	-	rs560388277	byFrequency	TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	CCGCCG	CCGCCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr17:30469471_30469476delCCGCCG	ENST00000333942.6	+	0	0_4				RHOT1_ENST00000358365.3_5'Flank|RHOT1_ENST00000545287.2_5'Flank|RHOT1_ENST00000394692.2_5'Flank|RHOT1_ENST00000583994.1_5'Flank|AC090616.2_ENST00000398832.2_In_Frame_Del_p.RR88del|RHOT1_ENST00000581094.1_5'Flank|RHOT1_ENST00000354266.3_5'Flank	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1						cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				gccgtcgtccccgccgccgccgccgc	0.816																																					.		.											.	RHOT1	93	0			.						.																																			SO:0001623	5_prime_UTR_variant	55288	.			TCGTCCCCGCCGC	AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.-236CCGCCG>-	17.37:g.30469477_30469482delCCGCCG		Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	13.0	.	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Splice_Site	DEL	ENST00000333942.6	37	CCDS32612.1																																																																																			.		0.816	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	NM_018307	
RIF1	55183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152293757	152293757	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:152293757C>T	ENST00000243326.5	+	12	1858	c.1375C>T	c.(1375-1377)Cca>Tca	p.P459S	RIF1_ENST00000444746.2_Missense_Mutation_p.P459S|RIF1_ENST00000453091.2_Missense_Mutation_p.P459S|RIF1_ENST00000430328.2_Missense_Mutation_p.P459S|RIF1_ENST00000433166.2_3'UTR|RIF1_ENST00000428287.2_Missense_Mutation_p.P459S			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		CCTTTCAGAGCCATTGGAACA	0.323																																					p.P459S		.											.	RIF1	300	0			c.C1375T						.						95.0	92.0	93.0					2																	152293757		2203	4300	6503	SO:0001583	missense	55183	exon13			TCAGAGCCATTGG	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.1375C>T	2.37:g.152293757C>T	ENSP00000243326:p.Pro459Ser	Somatic	200.0	0.0		WXS	Illumina HiSeq	Phase_I	181.0	45.0	NM_018151	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.28|14.28	2.487081|2.487081	0.44249|0.44249	.|.	.|.	ENSG00000080345|ENSG00000080345	ENST00000414861|ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	.|T;T;T;T;T	.|0.15139	.|2.46;2.45;2.45;2.46;2.45	5.58|5.58	2.73|2.73	0.32206|0.32206	.|.	.|0.101682	.|0.64402	.|D	.|0.000002	T|T	0.31451|0.31451	0.0797|0.0797	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.998;0.987	.|P;P	.|0.57468	.|0.821;0.799	T|T	0.02821|0.02821	-1.1106|-1.1106	5|10	.|0.66056	.|D	.|0.02	-2.3659|-2.3659	10.9002|10.9002	0.47047|0.47047	0.0:0.688:0.2447:0.0673|0.0:0.688:0.2447:0.0673	.|.	.|459;459	.|Q5UIP0;Q5UIP0-2	.|RIF1_HUMAN;.	V|S	450|459	.|ENSP00000390181:P459S;ENSP00000414615:P459S;ENSP00000415691:P459S;ENSP00000243326:P459S;ENSP00000416123:P459S	.|ENSP00000243326:P459S	A|P	+|+	2|1	0|0	RIF1|RIF1	152002003|152002003	1.000000|1.000000	0.71417|0.71417	0.725000|0.725000	0.30721|0.30721	0.018000|0.018000	0.09664|0.09664	3.656000|3.656000	0.54467|0.54467	0.368000|0.368000	0.24481|0.24481	-0.262000|-0.262000	0.10625|0.10625	GCC|CCA	.		0.323	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
RNF19A	25897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	101271389	101271389	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr8:101271389C>A	ENST00000519449.1	-	11	2228	c.1912G>T	c.(1912-1914)Gat>Tat	p.D638Y	RNF19A_ENST00000523255.1_5'UTR|RNF19A_ENST00000341084.2_Missense_Mutation_p.D638Y	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	638					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			GCACTGCCATCATCCACACTA	0.483											OREG0018897	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D638Y		.											.	RNF19A	229	0			c.G1912T						.						138.0	118.0	125.0					8																	101271389		2203	4300	6503	SO:0001583	missense	25897	exon11			TGCCATCATCCAC	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1912G>T	8.37:g.101271389C>A	ENSP00000428968:p.Asp638Tyr	Somatic	39.0	0.0	1357	WXS	Illumina HiSeq	Phase_I	39.0	4.0	NM_015435	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	37	CCDS6286.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.944196	0.92593	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.85955	-2.05;-2.05	5.74	5.74	0.90152	.	0.048021	0.85682	D	0.000000	D	0.86732	0.6003	L	0.56769	1.78	0.80722	D	1	P	0.48407	0.91	P	0.45946	0.498	D	0.88038	0.2779	10	0.87932	D	0	.	19.5387	0.95266	0.0:1.0:0.0:0.0	.	638	Q9NV58	RN19A_HUMAN	Y	638	ENSP00000428968:D638Y;ENSP00000342667:D638Y	ENSP00000342667:D638Y	D	-	1	0	RNF19A	101340565	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.708000	0.92522	0.585000	0.79938	GAT	.		0.483	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435	
RNF212	285498	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	1107222	1107222	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr4:1107222A>T	ENST00000433731.2	-	1	92	c.31T>A	c.(31-33)Ttc>Atc	p.F11I	RNF212_ENST00000333673.5_Missense_Mutation_p.F11I|TMED11P_ENST00000502630.1_RNA|RP11-20I20.2_ENST00000504969.1_RNA|RNF212_ENST00000505730.1_5'UTR|RNF212_ENST00000382968.5_Missense_Mutation_p.F11I			Q495C1	RN212_HUMAN	ring finger protein 212	11					chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		GGCGGCTGGAAGCAGCGATTA	0.687																																					p.F11I		.											.	RNF212	68	0			c.T31A						.						48.0	38.0	41.0					4																	1107222		2194	4297	6491	SO:0001583	missense	285498	exon1			GCTGGAAGCAGCG	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.31T>A	4.37:g.1107222A>T	ENSP00000389709:p.Phe11Ile	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	28.0	NM_194439	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	Missense_Mutation	SNP	ENST00000433731.2	37	CCDS46996.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.594779	0.46318	.	.	ENSG00000178222	ENST00000382968;ENST00000433731;ENST00000333673	D;D;D	0.93488	-3.23;-3.23;-3.23	4.43	4.43	0.53597	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.090520	0.42172	U	0.000760	D	0.93710	0.7990	M	0.66378	2.025	0.36717	D	0.880991	P;P;P;P	0.50819	0.728;0.936;0.939;0.728	B;P;P;B	0.53912	0.297;0.737;0.503;0.277	D	0.94489	0.7700	10	0.52906	T	0.07	.	8.1528	0.31152	0.9022:0.0:0.0978:0.0	.	11;11;11;11	Q495C1-2;C9J8N0;Q495C1;Q495C1-5	.;.;RN212_HUMAN;.	I	11	ENSP00000372428:F11I;ENSP00000389709:F11I;ENSP00000327481:F11I	ENSP00000327481:F11I	F	-	1	0	RNF212	1097222	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	3.091000	0.50199	1.745000	0.51790	0.477000	0.44152	TTC	.		0.687	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359124.2	NM_194439	
SDF4	51150	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	1152909	1152909	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:1152909C>T	ENST00000360001.6	-	7	1334	c.1072G>A	c.(1072-1074)Gtg>Atg	p.V358M	SDF4_ENST00000263741.7_3'UTR			Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4	358	Necessary for intracellular retention in Golgi apparatus lumen. {ECO:0000250}.				calcium ion-dependent exocytosis (GO:0017156)|cerebellum development (GO:0021549)|fat cell differentiation (GO:0045444)|response to ethanol (GO:0045471)|UV protection (GO:0009650)|zymogen granule exocytosis (GO:0070625)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|late endosome (GO:0005770)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		TCCTCGTGCACGCTGCGCGCG	0.716																																					p.V358M		.											.	SDF4	154	0			c.G1072A						.						49.0	51.0	51.0					1																	1152909		2203	4298	6501	SO:0001583	missense	51150	exon7			CGTGCACGCTGCG		CCDS12.1, CCDS30553.1	1p36.33	2013-01-10			ENSG00000078808	ENSG00000078808		"""EF-hand domain containing"""	24188	protein-coding gene	gene with protein product	"""calcium binding protein"""	614282				9254016, 8609160	Standard	NM_016176		Approved	Cab45	uc001adh.4	Q9BRK5	OTTHUMG00000001812	ENST00000360001.6:c.1072G>A	1.37:g.1152909C>T	ENSP00000353094:p.Val358Met	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	18.0	NM_016176	B1AME5|B1AME6|B2RDF1|B4DSM1|Q53G52|Q53HQ9|Q8NBQ3|Q96AA1|Q9NZP7|Q9UN53	Missense_Mutation	SNP	ENST00000360001.6	37	CCDS30553.1	.	.	.	.	.	.	.	.	.	.	c	24.8	4.571569	0.86542	.	.	ENSG00000078808	ENST00000360001	T	0.09255	3.0	4.9	4.9	0.64082	.	0.181870	0.47093	D	0.000244	T	0.27419	0.0673	L	0.51422	1.61	0.80722	D	1	D	0.76494	0.999	D	0.66979	0.948	T	0.00525	-1.1689	10	0.59425	D	0.04	-34.0199	17.2576	0.87062	0.0:1.0:0.0:0.0	.	358	Q9BRK5	CAB45_HUMAN	M	358	ENSP00000353094:V358M	ENSP00000353094:V358M	V	-	1	0	SDF4	1142772	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	7.313000	0.78978	2.546000	0.85860	0.550000	0.68814	GTG	.		0.716	SDF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005064.1	NM_016176	
RRP15	51018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	218475635	218475635	+	Splice_Site	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:218475635G>A	ENST00000366932.3	+	2	169		c.e2-1		RRP15_ENST00000491428.1_Splice_Site	NM_016052.3	NP_057136.2	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog (S. cerevisiae)							mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)			ACBD6/RRP15(2)	NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		TGGTTCTATAGGAAGCTGTGG	0.463																																					.		.											.	RRP15	90	0			c.140-1G>A						.						97.0	100.0	99.0					1																	218475635		2203	4300	6503	SO:0001630	splice_region_variant	51018	exon2			TCTATAGGAAGCT		CCDS1520.2	1q41	2008-02-05			ENSG00000067533	ENSG00000067533			24255	protein-coding gene	gene with protein product		611193	"""KIAA0507"""	KIAA0507		15769876	Standard	NM_016052		Approved	CGI-115	uc001hlj.3	Q9Y3B9	OTTHUMG00000039494	ENST00000366932.3:c.140-1G>A	1.37:g.218475635G>A		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	20.0	NM_016052		Splice_Site	SNP	ENST00000366932.3	37	CCDS1520.2	.	.	.	.	.	.	.	.	.	.	G	15.96	2.987556	0.53934	.	.	ENSG00000067533	ENST00000366932	.	.	.	5.87	2.94	0.34122	.	.	.	.	.	.	.	.	.	.	.	0.20196	N	0.999927	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.3529	0.11163	0.3228:0.0:0.5304:0.1468	.	.	.	.	.	-1	.	.	.	+	.	.	RRP15	216542258	0.985000	0.35326	0.012000	0.15200	0.873000	0.50193	1.527000	0.35975	0.369000	0.24510	0.650000	0.86243	.	.		0.463	RRP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095284.1	NM_016052	Intron
SEC13	6396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10347279	10347279	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr3:10347279G>A	ENST00000350697.3	-	6	673	c.548C>T	c.(547-549)gCa>gTa	p.A183V	SEC13_ENST00000383801.2_Missense_Mutation_p.A229V|SEC13_ENST00000397117.1_Missense_Mutation_p.A169V|SEC13_ENST00000337354.4_Missense_Mutation_p.A186V|SEC13_ENST00000397109.3_Missense_Mutation_p.A169V|SEC13_ENST00000492602.1_5'Flank	NM_183352.1	NP_899195.1	P55735	SEC13_HUMAN	SEC13 homolog (S. cerevisiae)	183					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17						GCCACCTGATGCAAACCTCTT	0.527																																					p.A183V		.											.	SEC13	91	0			c.C548T						.						187.0	161.0	170.0					3																	10347279		2203	4300	6503	SO:0001583	missense	6396	exon6			CCTGATGCAAACC		CCDS2599.1, CCDS46751.1, CCDS63540.1	3p25-p24	2013-01-10	2006-11-07	2006-11-07	ENSG00000157020	ENSG00000157020		"""WD repeat domain containing"""	10697	protein-coding gene	gene with protein product		600152	"""SEC13 (S. cerevisiae)-like 1"", ""SEC13-like 1 (S. cerevisiae)"""	D3S1231E, SEC13L1		7987303	Standard	NM_183352		Approved	SEC13R, npp-20	uc003bvn.3	P55735	OTTHUMG00000128671	ENST00000350697.3:c.548C>T	3.37:g.10347279G>A	ENSP00000312122:p.Ala183Val	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	17.0	NM_183352	A8MV37|B4DXJ1|Q5BJF0|Q9BRM6|Q9BUG7	Missense_Mutation	SNP	ENST00000350697.3	37	CCDS2599.1	.	.	.	.	.	.	.	.	.	.	G	8.715	0.913082	0.17907	.	.	ENSG00000157020	ENST00000397109;ENST00000337354;ENST00000350697;ENST00000397117;ENST00000383801	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.67	5.67	0.87782	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.058088	0.64402	D	0.000001	T	0.25901	0.0631	N	0.00815	-1.16	0.49299	D	0.999777	B;B;B;B	0.13594	0.004;0.002;0.008;0.001	B;B;B;B	0.09377	0.003;0.004;0.003;0.002	T	0.41680	-0.9495	10	0.02654	T	1	.	10.6655	0.45728	0.0864:0.0:0.9136:0.0	.	183;169;229;183	E9PHR5;A8MXL6;B4DXJ1;P55735	.;.;.;SEC13_HUMAN	V	169;186;183;169;229	ENSP00000380298:A169V;ENSP00000336566:A186V;ENSP00000312122:A183V;ENSP00000380306:A169V;ENSP00000373312:A229V	ENSP00000336566:A186V	A	-	2	0	SEC13	10322279	1.000000	0.71417	0.957000	0.39632	0.991000	0.79684	7.355000	0.79434	2.676000	0.91093	0.655000	0.94253	GCA	.		0.527	SEC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250563.3		
SEMA3A	10371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	83643565	83643565	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:83643565G>T	ENST00000265362.4	-	7	1084	c.770C>A	c.(769-771)tCt>tAt	p.S257Y	SEMA3A_ENST00000436949.1_Missense_Mutation_p.S257Y	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	257	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						AGCTTTTCCAGAGTGTTCTCC	0.388																																					p.S257Y		.											.	SEMA3A	156	0			c.C770A						.						117.0	113.0	114.0					7																	83643565		2203	4300	6503	SO:0001583	missense	10371	exon7			TTTCCAGAGTGTT	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.770C>A	7.37:g.83643565G>T	ENSP00000265362:p.Ser257Tyr	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	13.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101745	0.56183	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.11495	2.77;2.77	5.6	5.6	0.85130	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.255154	0.43919	D	0.000502	T	0.06962	0.0177	N	0.05158	-0.105	0.39145	D	0.962115	B	0.29136	0.234	B	0.34779	0.189	T	0.12400	-1.0549	10	0.02654	T	1	.	19.615	0.95630	0.0:0.0:1.0:0.0	.	257	Q14563	SEM3A_HUMAN	Y	257	ENSP00000265362:S257Y;ENSP00000415260:S257Y	ENSP00000265362:S257Y	S	-	2	0	SEMA3A	83481501	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.293000	0.72731	2.630000	0.89119	0.655000	0.94253	TCT	.		0.388	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SERPINE2	5270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	224866553	224866553	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:224866553A>G	ENST00000258405.4	-	2	307	c.65T>C	c.(64-66)tTc>tCc	p.F22S	SERPINE2_ENST00000447280.2_Missense_Mutation_p.F34S|SERPINE2_ENST00000409304.1_Missense_Mutation_p.F22S|SERPINE2_ENST00000409840.3_Missense_Mutation_p.F22S	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	22					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CAGAGGATTGAAGTGGGAGCA	0.527																																					p.F34S		.											.	SERPINE2	290	0			c.T101C						.						109.0	118.0	115.0					2																	224866553		2203	4300	6503	SO:0001583	missense	5270	exon2			GGATTGAAGTGGG	M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.65T>C	2.37:g.224866553A>G	ENSP00000258405:p.Phe22Ser	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	6.0	NM_001136530	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	ENST00000258405.4	37	CCDS2460.1	.	.	.	.	.	.	.	.	.	.	A	3.031	-0.199725	0.06219	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738;ENST00000454956;ENST00000423446	D;T;D;D;T;D	0.84298	-1.82;-0.76;-1.82;-1.83;-1.45;-1.57	5.17	3.99	0.46301	Serpin domain (1);	0.526968	0.21920	N	0.067161	T	0.67401	0.2889	N	0.08118	0	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.12837	0.008;0.008	T	0.53472	-0.8434	10	0.25106	T	0.35	.	6.8299	0.23905	0.7909:0.0:0.0736:0.1355	.	34;22	B4DIF2;P07093	.;GDN_HUMAN	S	22;22;22;34;22;22;22	ENSP00000386412:F22S;ENSP00000258405:F22S;ENSP00000386969:F22S;ENSP00000415786:F34S;ENSP00000408452:F22S;ENSP00000399655:F22S	ENSP00000258405:F22S	F	-	2	0	SERPINE2	224574797	0.987000	0.35691	0.246000	0.24233	0.156000	0.22039	2.471000	0.45127	0.875000	0.35847	0.533000	0.62120	TTC	.		0.527	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	
SFI1	9814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32007130	32007130	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr22:32007130C>T	ENST00000400288.2	+	23	2361	c.2256C>T	c.(2254-2256)ggC>ggT	p.G752G	SFI1_ENST00000400289.1_Splice_Site_p.G670G|SFI1_ENST00000443011.1_Splice_Site_p.G599G|SFI1_ENST00000414585.1_Splice_Site_p.G599G|SFI1_ENST00000443326.1_Splice_Site_p.G670G|SFI1_ENST00000540643.1_Splice_Site_p.G697G|SFI1_ENST00000432498.1_Splice_Site_p.G721G	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	752					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						CTGCCTTAGGCTGTCTGCGGA	0.577																																					p.G752G		.											.	SFI1	90	0			c.C2256T						.						80.0	86.0	84.0					22																	32007130		2163	4273	6436	SO:0001630	splice_region_variant	9814	exon23			CTTAGGCTGTCTG	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2255-1C>T	22.37:g.32007130C>T		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	14.0	NM_001007467	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Silent	SNP	ENST00000400288.2	37	CCDS43004.1																																																																																			.		0.577	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	Silent
SHANK2	22941	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	70332701	70332701	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr11:70332701C>T	ENST00000423696.2	-	15	2596	c.2560G>A	c.(2560-2562)Gga>Aga	p.G854R	SHANK2_ENST00000449833.2_Missense_Mutation_p.G638R|SHANK2_ENST00000409161.1_Missense_Mutation_p.G637R|SHANK2_ENST00000338508.4_Missense_Mutation_p.G1234R			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	854					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CCTTTGGGTCCCTGTTGAGAC	0.607																																					p.G645R		.											.	SHANK2	94	0			c.G1933A						.						62.0	71.0	68.0					11																	70332701		2200	4294	6494	SO:0001583	missense	22941	exon10			TGGGTCCCTGTTG	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2560G>A	11.37:g.70332701C>T	ENSP00000394536:p.Gly854Arg	Somatic	68.0	1.0		WXS	Illumina HiSeq	Phase_I	79.0	14.0	NM_133266	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		.	.	.	.	.	.	.	.	.	.	C	3.721	-0.057526	0.07317	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	4.88	3.96	0.45880	.	0.299408	0.26582	U	0.023575	T	0.46229	0.1382	M	0.66939	2.045	0.09310	N	0.999998	P;P;P	0.52170	0.846;0.951;0.887	B;P;P	0.50896	0.372;0.653;0.576	T	0.38628	-0.9652	10	0.44086	T	0.13	.	5.8648	0.18768	0.2945:0.5794:0.0:0.1261	.	854;1233;638	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	R	638;637;512;1234;854;872;857	ENSP00000399423:G638R;ENSP00000386491:G637R;ENSP00000402944:G512R;ENSP00000345193:G1234R;ENSP00000394536:G854R;ENSP00000294018:G857R	ENSP00000294018:G857R	G	-	1	0	SHANK2	70010349	0.999000	0.42202	0.961000	0.40146	0.073000	0.16967	2.168000	0.42424	1.026000	0.39733	-0.310000	0.09108	GGA	.		0.607	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
SLC17A2	10246	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	25917287	25917287	+	Silent	SNP	T	T	C	rs200248053		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:25917287T>C	ENST00000265425.3	-	6	698	c.678A>G	c.(676-678)ctA>ctG	p.L226L	SLC17A2_ENST00000360488.3_Silent_p.L226L|SLC17A2_ENST00000377850.3_Silent_p.L226L			O00624	NPT3_HUMAN	solute carrier family 17, member 2	226					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						CTGTGAACCATAGGAGACAGC	0.468													T|||	1	0.000199681	0.0008	0.0	5008	,	,		21542	0.0		0.0	False		,,,				2504	0.0				p.L226L		.											.	SLC17A2	91	0			c.A678G						.						130.0	110.0	117.0					6																	25917287		2203	4300	6503	SO:0001819	synonymous_variant	10246	exon7			GAACCATAGGAGA	U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.678A>G	6.37:g.25917287T>C		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	4.0	NM_005835	A6NK81|A6NLD6|Q5TB84|Q76P85	Silent	SNP	ENST00000265425.3	37																																																																																				T|0.999;C|0.000		0.468	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040075.1		
SLC39A10	57181	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	196599744	196599744	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:196599744T>G	ENST00000409086.3	+	10	2750	c.2475T>G	c.(2473-2475)atT>atG	p.I825M	DNAH7_ENST00000484183.1_5'Flank|SLC39A10_ENST00000541054.1_Missense_Mutation_p.I375M|SLC39A10_ENST00000359634.5_Missense_Mutation_p.I825M	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	825					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			AAGATAAAATTGTGTTTGACA	0.403																																					p.I825M		.											.	SLC39A10	92	0			c.T2475G						.						215.0	201.0	206.0					2																	196599744		2203	4300	6503	SO:0001583	missense	57181	exon10			TAAAATTGTGTTT		CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.2475T>G	2.37:g.196599744T>G	ENSP00000386766:p.Ile825Met	Somatic	219.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	17.0	NM_020342	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	37	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	T	15.01	2.706087	0.48412	.	.	ENSG00000196950	ENST00000409086;ENST00000359634;ENST00000541054	T;T;T	0.77229	-0.79;-0.79;-1.08	5.39	1.65	0.23941	.	0.000000	0.85682	D	0.000000	D	0.84924	0.5580	M	0.88704	2.975	0.49582	D	0.999806	D	0.54772	0.968	P	0.60541	0.876	T	0.81673	-0.0826	10	0.87932	D	0	.	4.4538	0.11633	0.2159:0.2185:0.0:0.5656	.	825	Q9ULF5	S39AA_HUMAN	M	825;825;375	ENSP00000386766:I825M;ENSP00000352655:I825M;ENSP00000437787:I375M	ENSP00000352655:I825M	I	+	3	3	SLC39A10	196307989	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	0.514000	0.22786	0.134000	0.18681	0.528000	0.53228	ATT	.		0.403	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1	XM_047707	
SLC6A18	348932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	1245974	1245974	+	Silent	SNP	C	C	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:1245974C>G	ENST00000324642.3	+	12	1791	c.1668C>G	c.(1666-1668)ccC>ccG	p.P556P		NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	556					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			AGCTGTTCCCCTCGCGTCAGG	0.701																																					p.P556P		.											.	SLC6A18	91	0			c.C1668G						.						20.0	22.0	21.0					5																	1245974		2200	4298	6498	SO:0001819	synonymous_variant	348932	exon12			GTTCCCCTCGCGT	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.1668C>G	5.37:g.1245974C>G		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	20.0	NM_182632		Silent	SNP	ENST00000324642.3	37	CCDS3860.1																																																																																			.		0.701	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206728.3	NM_182632	
SLIT1	6585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	98762480	98762480	+	Missense_Mutation	SNP	C	C	T	rs373006664		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr10:98762480C>T	ENST00000266058.4	-	35	4380	c.4135G>A	c.(4135-4137)Ggc>Agc	p.G1379S	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.G1379S	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	1379	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		TGGCAGGGGCCGTCAGCGGGC	0.667																																					p.G1379S		.											.	SLIT1	94	0			c.G4135A						.	C	SER/GLY	0,4402		0,0,2201	16.0	19.0	18.0		4135	1.6	0.6	10		18	1,8577		0,1,4288	no	missense	SLIT1	NM_003061.2	56	0,1,6489	TT,TC,CC		0.0117,0.0,0.0077	benign	1379/1535	98762480	1,12979	2201	4289	6490	SO:0001583	missense	6585	exon35			AGGGGCCGTCAGC	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.4135G>A	10.37:g.98762480C>T	ENSP00000266058:p.Gly1379Ser	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	7.0	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	C	6.957	0.546543	0.13312	0.0	1.17E-4	ENSG00000187122	ENST00000266058;ENST00000371070	T;T	0.80214	-1.35;-1.32	4.75	1.64	0.23874	Epidermal growth factor-like, type 3 (1);	0.218174	0.45606	D	0.000354	T	0.54498	0.1862	N	0.11064	0.09	0.32073	N	0.594182	B	0.33073	0.396	B	0.19666	0.026	T	0.60515	-0.7248	10	0.59425	D	0.04	.	4.3557	0.11178	0.142:0.5864:0.1388:0.1327	.	1379	O75093	SLIT1_HUMAN	S	1379	ENSP00000266058:G1379S;ENSP00000360109:G1379S	ENSP00000266058:G1379S	G	-	1	0	SLIT1	98752470	0.858000	0.29795	0.562000	0.28370	0.006000	0.05464	1.503000	0.35715	1.157000	0.42530	0.561000	0.74099	GGC	.		0.667	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
SLIT1	6585	broad.mit.edu;mdanderson.org	37	10	98945408	98945408	+	Silent	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr10:98945408C>T	ENST00000266058.4	-	1	269	c.24G>A	c.(22-24)ggG>ggA	p.G8G	SLIT1_ENST00000456008.2_5'UTR|SLIT1_ENST00000371041.3_Silent_p.G8G|ARHGAP19-SLIT1_ENST00000453547.2_Intron|SLIT1_ENST00000371070.4_Silent_p.G8G	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	8					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CCGCCGAGGACCCCCACCCGG	0.771																																					p.G8G		.											.	SLIT1	94	0			c.G24A						.						3.0	5.0	5.0					10																	98945408		1702	3405	5107	SO:0001819	synonymous_variant	6585	exon1			CGAGGACCCCCAC	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.24G>A	10.37:g.98945408C>T		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	4.0	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Silent	SNP	ENST00000266058.4	37	CCDS7453.1																																																																																			.		0.771	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
SLITRK4	139065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	142717871	142717871	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chrX:142717871G>T	ENST00000381779.4	-	2	1279	c.1054C>A	c.(1054-1056)Cct>Act	p.P352T	SLITRK4_ENST00000356928.1_Missense_Mutation_p.P352T|SLITRK4_ENST00000338017.4_Missense_Mutation_p.P352T	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	352	LRRNT.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					AAATCTGAAGGGTGTGTTTTG	0.463																																					p.P352T		.											.	SLITRK4	193	0			c.C1054A						.						117.0	104.0	109.0					X																	142717871		2203	4300	6503	SO:0001583	missense	139065	exon2			CTGAAGGGTGTGT	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1054C>A	X.37:g.142717871G>T	ENSP00000371198:p.Pro352Thr	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	37.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	G	4.472	0.087565	0.08583	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.39997	1.05;1.05;1.05	5.57	5.57	0.84162	Leucine-rich repeat-containing N-terminal (1);	0.058314	0.64402	D	0.000001	T	0.37785	0.1016	L	0.47716	1.5	0.80722	D	1	P	0.37612	0.602	B	0.37239	0.244	T	0.12553	-1.0543	10	0.14252	T	0.57	-5.9646	17.1846	0.86863	0.0:0.0:1.0:0.0	.	352	Q8IW52	SLIK4_HUMAN	T	352	ENSP00000371198:P352T;ENSP00000349400:P352T;ENSP00000336627:P352T	ENSP00000336627:P352T	P	-	1	0	SLITRK4	142545537	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.004000	0.57068	2.466000	0.83321	0.594000	0.82650	CCT	.		0.463	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
SMG5	23381	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	156237933	156237933	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:156237933A>G	ENST00000361813.5	-	9	1025	c.881T>C	c.(880-882)cTg>cCg	p.L294P	SMG5_ENST00000489907.2_5'Flank|SMG5_ENST00000368267.5_Missense_Mutation_p.L294P	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	294					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					GAGGCTTTGCAGATACATAAA	0.458																																					p.L294P		.											.	SMG5	231	0			c.T881C						.						164.0	147.0	153.0					1																	156237933		2203	4300	6503	SO:0001583	missense	23381	exon9			CTTTGCAGATACA	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.881T>C	1.37:g.156237933A>G	ENSP00000355261:p.Leu294Pro	Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	11.0	NM_015327	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563934	0.86335	.	.	ENSG00000198952	ENST00000361813;ENST00000368267	T;T	0.49139	0.79;0.79	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.64371	0.2592	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70400	-0.4882	10	0.87932	D	0	-21.4449	14.5756	0.68243	1.0:0.0:0.0:0.0	.	294	Q9UPR3	SMG5_HUMAN	P	294	ENSP00000355261:L294P;ENSP00000357250:L294P	ENSP00000355261:L294P	L	-	2	0	SMG5	154504557	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.077000	0.94016	2.311000	0.77944	0.533000	0.62120	CTG	.		0.458	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
SMG6	23293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	2200545	2200545	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr17:2200545G>A	ENST00000263073.6	-	4	2193	c.2143C>T	c.(2143-2145)Cgc>Tgc	p.R715C	SMG6_ENST00000544865.1_Missense_Mutation_p.R684C	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	715					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						ACTGTCTTGCGTAATGGCTTG	0.393																																					p.R715C	Melanoma(59;28 1088 11621 25887 46638 50814)	.											.	SMG6	228	0			c.C2143T						.						123.0	128.0	126.0					17																	2200545		2203	4300	6503	SO:0001583	missense	23293	exon4			TCTTGCGTAATGG	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.2143C>T	17.37:g.2200545G>A	ENSP00000263073:p.Arg715Cys	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	19.0	NM_017575	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	ENST00000263073.6	37	CCDS11016.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033763	0.75504	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	T;T	0.17054	2.3;2.3	5.08	4.02	0.46733	Telomerase activating protein Est1 (1);	0.062472	0.64402	D	0.000004	T	0.34600	0.0903	M	0.72894	2.215	0.80722	D	1	D	0.71674	0.998	P	0.55871	0.786	T	0.22138	-1.0225	10	0.56958	D	0.05	-0.1579	15.8667	0.79071	0.0:0.0:0.7849:0.2151	.	715	Q86US8	EST1A_HUMAN	C	715;684	ENSP00000263073:R715C;ENSP00000443920:R684C	ENSP00000263073:R715C	R	-	1	0	SMG6	2147295	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.264000	0.58859	2.341000	0.79615	0.455000	0.32223	CGC	.		0.393	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3		
SNX11	29916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	46196421	46196421	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr17:46196421T>A	ENST00000393405.2	+	7	766	c.412T>A	c.(412-414)Tgt>Agt	p.C138S	SNX11_ENST00000439357.2_Missense_Mutation_p.C77S|SNX11_ENST00000359238.2_Missense_Mutation_p.C138S|SNX11_ENST00000582104.1_Missense_Mutation_p.C130S|SNX11_ENST00000580219.1_Missense_Mutation_p.C130S|SNX11_ENST00000452859.2_De_novo_Start_OutOfFrame	NM_152244.1	NP_689450.1	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	138	Important for membrane trafficking.				intracellular protein transport (GO:0006886)|vesicle organization (GO:0016050)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol phosphate binding (GO:1901981)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	14						GATAGAAGCCTGTGTCCAGGG	0.537																																					p.C138S		.											.	SNX11	226	0			c.T412A						.						152.0	122.0	133.0					17																	46196421		2203	4300	6503	SO:0001583	missense	29916	exon6			GAAGCCTGTGTCC	AF121861	CCDS11526.1	17q21.32	2011-05-03			ENSG00000002919	ENSG00000002919		"""Sorting nexins"""	14975	protein-coding gene	gene with protein product		614906					Standard	NM_013323		Approved		uc002ing.1	Q9Y5W9		ENST00000393405.2:c.412T>A	17.37:g.46196421T>A	ENSP00000377059:p.Cys138Ser	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	7.0	NM_013323	B3KRL6|B4DPY5|D3DTV0|Q53YC0|Q9H885	Missense_Mutation	SNP	ENST00000393405.2	37	CCDS11526.1	.	.	.	.	.	.	.	.	.	.	T	29.7	5.025526	0.93518	.	.	ENSG00000002919	ENST00000393405;ENST00000439357;ENST00000359238	T;T	0.66099	-0.19;-0.19	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.77651	0.4162	M	0.70595	2.14	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.994;0.994	T	0.79685	-0.1700	10	0.59425	D	0.04	-14.464	14.6096	0.68507	0.0:0.0:0.0:1.0	.	77;130;138	B4DKH7;B4DPY5;Q9Y5W9	.;.;SNX11_HUMAN	S	138;77;138	ENSP00000377059:C138S;ENSP00000352175:C138S	ENSP00000352175:C138S	C	+	1	0	SNX11	43551420	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.599000	0.82757	2.101000	0.63845	0.459000	0.35465	TGT	.		0.537	SNX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443423.1		
STK17B	9262	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	197008292	197008292	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:197008292T>C	ENST00000263955.4	-	5	885	c.599A>G	c.(598-600)gAa>gGa	p.E200G	STK17B_ENST00000409228.1_Missense_Mutation_p.E200G	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	200	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			ACCTAAATATTCTGGTGTTCC	0.333																																					p.E200G		.											.	STK17B	334	0			c.A599G						.						72.0	78.0	76.0					2																	197008292		2201	4300	6501	SO:0001583	missense	9262	exon5			AAATATTCTGGTG	AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.599A>G	2.37:g.197008292T>C	ENSP00000263955:p.Glu200Gly	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	9.0	NM_004226		Missense_Mutation	SNP	ENST00000263955.4	37	CCDS2315.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.849540	0.91277	.	.	ENSG00000081320	ENST00000263955;ENST00000409228	T;T	0.66995	-0.24;-0.24	5.29	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000103	T	0.72301	0.3443	L	0.28608	0.87	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	T	0.76107	-0.3080	10	0.87932	D	0	.	15.3814	0.74658	0.0:0.0:0.0:1.0	.	200	O94768	ST17B_HUMAN	G	200	ENSP00000263955:E200G;ENSP00000386853:E200G	ENSP00000263955:E200G	E	-	2	0	STK17B	196716537	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.843000	0.86859	2.216000	0.71823	0.533000	0.62120	GAA	.		0.333	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256092.2		
STX6	10228	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	180953892	180953892	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:180953892G>C	ENST00000258301.5	-	7	849	c.612C>G	c.(610-612)ttC>ttG	p.F204L	STX6_ENST00000469135.1_5'UTR|STX6_ENST00000542060.1_Missense_Mutation_p.F103L	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6	204	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						ATTCGTGAGAGAAATCTTCCA	0.473																																					p.F204L		.											.	STX6	91	0			c.C612G						.						75.0	72.0	73.0					1																	180953892		2203	4300	6503	SO:0001583	missense	10228	exon7			GTGAGAGAAATCT	AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.612C>G	1.37:g.180953892G>C	ENSP00000258301:p.Phe204Leu	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	4.0	NM_005819	B2R652|B4DR17|Q5VY08|Q6FH83	Missense_Mutation	SNP	ENST00000258301.5	37	CCDS1341.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.327195	0.24080	.	.	ENSG00000135823	ENST00000258301;ENST00000542060	.	.	.	5.7	2.85	0.33270	Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	0.000000	0.85682	D	0.000000	T	0.23054	0.0557	N	0.05012	-0.13	0.54753	D	0.999981	B;B	0.20550	0.046;0.005	B;B	0.24269	0.028;0.052	T	0.23583	-1.0184	8	0.15499	T	0.54	-19.2894	8.6398	0.33970	0.3598:0.0:0.6402:0.0	.	103;204	B4DR17;O43752	.;STX6_HUMAN	L	204;103	.	ENSP00000258301:F204L	F	-	3	2	STX6	179220515	1.000000	0.71417	0.990000	0.47175	0.459000	0.32528	0.953000	0.29162	0.357000	0.24183	-0.768000	0.03414	TTC	.		0.473	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085143.1	NM_005819	
SUPT4H1	6827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56423671	56423671	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr17:56423671A>T	ENST00000225504.3	-	5	356	c.290T>A	c.(289-291)aTc>aAc	p.I97N	BZRAP1-AS1_ENST00000580515.1_RNA|BZRAP1-AS1_ENST00000580633.1_RNA|SUPT4H1_ENST00000577396.1_Missense_Mutation_p.I56N|BZRAP1-AS1_ENST00000580022.1_RNA|SUPT4H1_ENST00000580947.1_Missense_Mutation_p.I97N|BZRAP1-AS1_ENST00000578025.1_RNA|SUPT4H1_ENST00000581540.1_Missense_Mutation_p.I88N|BZRAP1-AS1_ENST00000582348.1_RNA|BZRAP1-AS1_ENST00000583841.1_RNA|BZRAP1-AS1_ENST00000579527.1_RNA|BZRAP1-AS1_ENST00000585236.1_RNA|BZRAP1-AS1_ENST00000578334.1_RNA|BZRAP1-AS1_ENST00000579859.1_RNA|BZRAP1-AS1_ENST00000583826.1_RNA	NM_003168.1	NP_003159.1	P63272	SPT4H_HUMAN	suppressor of Ty 4 homolog 1 (S. cerevisiae)	97				QGIVRELKSRGVAYKSRDTAIKT -> HAKDSRSNVNKYEP RESSEGHDTCLASLFHSLRHSNSLFAL (in Ref. 3; BAC85230). {ECO:0000305}.	chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			large_intestine(2)|skin(2)	4	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTCCCGCACGATTCCTGAAGC	0.498																																					p.I97N	NSCLC(25;723 896 19867 29219 40028)	.											.	SUPT4H1	182	0			c.T290A						.						111.0	99.0	103.0					17																	56423671		2203	4300	6503	SO:0001583	missense	6827	exon5			CGCACGATTCCTG	U38817	CCDS11606.1	17q22	2014-06-23	2001-11-28		ENSG00000213246	ENSG00000213246			11467	protein-coding gene	gene with protein product		603555	"""suppressor of Ty (S.cerevisiae) 4 homolog 1"""	SUPT4H		8786137	Standard	NM_003168		Approved	SPT4H	uc002iwe.2	P63272	OTTHUMG00000178926	ENST00000225504.3:c.290T>A	17.37:g.56423671A>T	ENSP00000225504:p.Ile97Asn	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	13.0	NM_003168	B2R4X8|D3DTZ4|Q16550|Q62387|Q6ZP89	Missense_Mutation	SNP	ENST00000225504.3	37	CCDS11606.1	.	.	.	.	.	.	.	.	.	.	A	12.08	1.830407	0.32329	.	.	ENSG00000213246	ENST00000225504	.	.	.	5.13	4.05	0.47172	.	0.072634	0.56097	U	0.000037	T	0.63450	0.2512	M	0.80982	2.52	0.58432	D	0.999999	P	0.42248	0.774	P	0.46275	0.51	T	0.65853	-0.6067	9	0.87932	D	0	-13.693	8.0717	0.30693	0.9073:0.0:0.0927:0.0	.	97	P63272	SPT4H_HUMAN	N	97	.	ENSP00000225504:I97N	I	-	2	0	SUPT4H1	53778670	1.000000	0.71417	0.933000	0.37362	0.857000	0.48899	8.102000	0.89548	0.907000	0.36646	-0.361000	0.07541	ATC	.		0.498	SUPT4H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444000.1	NM_003168	
TBL2	26608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	72985569	72985569	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:72985569C>A	ENST00000305632.5	-	6	1069	c.828G>T	c.(826-828)aaG>aaT	p.K276N	TBL2_ENST00000459913.1_5'UTR|TBL2_ENST00000432538.1_Missense_Mutation_p.K240N	NM_012453.2	NP_036585.1	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	276							poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	19		Lung NSC(55;0.0659)|all_lung(88;0.152)				CGGAGTGGCCCTTTAGTTCGA	0.562																																					p.K276N		.											.	TBL2	90	0			c.G828T						.						83.0	70.0	75.0					7																	72985569		2203	4300	6503	SO:0001583	missense	26608	exon6			GTGGCCCTTTAGT	AF056183	CCDS5551.1	7q11.23	2013-01-10			ENSG00000106638	ENSG00000106638		"""WD repeat domain containing"""	11586	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 13"""	605842				9860302, 10575226	Standard	XM_006715923		Approved	WS-betaTRP, WBSCR13, DKFZP43N024	uc003tyh.3	Q9Y4P3	OTTHUMG00000023427	ENST00000305632.5:c.828G>T	7.37:g.72985569C>A	ENSP00000307260:p.Lys276Asn	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	27.0	NM_012453	Q9UQE2	Missense_Mutation	SNP	ENST00000305632.5	37	CCDS5551.1	.	.	.	.	.	.	.	.	.	.	C	19.65	3.866768	0.72065	.	.	ENSG00000106638	ENST00000305632;ENST00000541783;ENST00000432538	T;T	0.60920	0.15;0.15	5.31	4.43	0.53597	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.128449	0.64402	D	0.000002	T	0.63780	0.2540	L	0.28649	0.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.66114	-0.6004	10	0.59425	D	0.04	-30.5027	11.7691	0.51947	0.0:0.9151:0.0:0.0849	.	240;276	E9PF19;Q9Y4P3	.;TBL2_HUMAN	N	276;276;240	ENSP00000307260:K276N;ENSP00000413979:K240N	ENSP00000307260:K276N	K	-	3	2	TBL2	72623505	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	1.301000	0.33447	1.483000	0.48342	0.561000	0.74099	AAG	.		0.562	TBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252233.3	NM_012453	
TCF7L2	6934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	114912183	114912183	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr10:114912183C>A	ENST00000355995.4	+	11	1760	c.1253C>A	c.(1252-1254)tCc>tAc	p.S418Y	TCF7L2_ENST00000543371.1_Missense_Mutation_p.S418Y|TCF7L2_ENST00000545257.1_Missense_Mutation_p.S418Y|TCF7L2_ENST00000538897.1_Missense_Mutation_p.S418Y|TCF7L2_ENST00000355717.4_Missense_Mutation_p.S442Y|TCF7L2_ENST00000369386.1_Missense_Mutation_p.S61Y|TCF7L2_ENST00000536810.1_Missense_Mutation_p.S418Y|TCF7L2_ENST00000369397.4_Missense_Mutation_p.S395Y|TCF7L2_ENST00000534894.1_Missense_Mutation_p.S418Y|TCF7L2_ENST00000542695.1_Missense_Mutation_p.S134Y|TCF7L2_ENST00000369389.1_Missense_Mutation_p.S129Y|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000352065.5_Missense_Mutation_p.S395Y			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	418					blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CCCGGCTGGTCCGCGCGGGAT	0.537			T	VTI1A	colorectal																																p.S442Y		.		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	TCF7L2	586	0			c.C1325A						.						116.0	123.0	120.0					10																	114912183		2203	4300	6503	SO:0001583	missense	6934	exon11			GCTGGTCCGCGCG	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1253C>A	10.37:g.114912183C>A	ENSP00000348274:p.Ser418Tyr	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	7.0	NM_001146283	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	c	29.3	4.996220	0.93167	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000352065;ENST00000542695;ENST00000369389;ENST00000277945;ENST00000369386	D;D;D;D;D;D;D;D;D;D;D;D	0.99394	-5.28;-5.29;-5.28;-5.29;-5.77;-5.81;-5.82;-5.3;-5.8;-5.22;-5.69;-5.73	5.66	5.66	0.87406	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (3);	0.053561	0.85682	D	0.000000	D	0.99527	0.9831	M	0.88105	2.93	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.991;0.999;1.0;1.0;0.999;1.0;1.0;1.0;1.0;0.999;1.0;1.0;0.999;1.0;1.0;0.992;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.983;0.996;0.962;0.999;0.999;0.999;0.998;0.998;1.0;0.998;0.997;0.981;0.999;0.999;0.997;0.999;0.998;0.953;1.0	D	0.98595	1.0656	10	0.87932	D	0	-23.4883	19.7439	0.96243	0.0:1.0:0.0:0.0	.	275;235;317;418;289;333;391;395;395;361;418;395;395;400;442;395;418;391;395	B4DJZ2;B7Z9Z6;B4DWD5;Q9NQB0;C6ZRK4;C6ZRJ6;C6ZRJ9;F8W742;B4DRJ8;C6ZRK2;B9X074;C6ZRJ8;C6ZRK1;C6ZRJ7;F8W7T5;C6ZRK5;Q9NQB0-7;Q9NQB0-10;Q6FHW4	.;.;.;TF7L2_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	Y	418;418;418;418;442;418;418;395;395;134;129;135;61	ENSP00000348274:S418Y;ENSP00000440547:S418Y;ENSP00000444972:S418Y;ENSP00000446238:S418Y;ENSP00000347949:S442Y;ENSP00000446172:S418Y;ENSP00000443626:S418Y;ENSP00000358404:S395Y;ENSP00000344823:S395Y;ENSP00000443883:S134Y;ENSP00000358396:S129Y;ENSP00000277945:S135Y	ENSP00000277945:S135Y	S	+	2	0	TCF7L2	114902173	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.669000	0.90835	0.655000	0.94253	TCC	.		0.537	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
TENM2	57451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	167625964	167625964	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:167625964G>A	ENST00000518659.1	+	16	3046	c.3007G>A	c.(3007-3009)Gcc>Acc	p.A1003T	TENM2_ENST00000520394.1_Missense_Mutation_p.A771T|TENM2_ENST00000545108.1_Missense_Mutation_p.A1003T|TENM2_ENST00000519204.1_Missense_Mutation_p.A882T|TENM2_ENST00000403607.2_Missense_Mutation_p.A827T	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1003					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CAGCTTTTACGCCATGGACAC	0.567																																					p.A994T		.											.	.	.	0			c.G2980A						.						76.0	81.0	79.0					5																	167625964		2103	4225	6328	SO:0001583	missense	57451	exon16			TTTTACGCCATGG	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.3007G>A	5.37:g.167625964G>A	ENSP00000429430:p.Ala1003Thr	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	21.0	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	G	33	5.211900	0.95069	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.12465	2.68;2.68;2.68;2.68;2.68	5.52	5.52	0.82312	Carboxypeptidase-like, regulatory domain (1);	0.096845	0.64402	D	0.000001	T	0.32585	0.0834	L	0.44542	1.39	0.58432	D	0.999999	D;D;D	0.89917	0.994;0.99;1.0	P;P;D	0.79108	0.806;0.645;0.992	T	0.01149	-1.1436	10	0.59425	D	0.04	.	19.4325	0.94776	0.0:0.0:1.0:0.0	.	1003;1003;771	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	T	1003;1003;882;771;827	ENSP00000429430:A1003T;ENSP00000438635:A1003T;ENSP00000428964:A882T;ENSP00000427874:A771T;ENSP00000384905:A827T	ENSP00000384905:A827T	A	+	1	0	ODZ2	167558542	1.000000	0.71417	0.961000	0.40146	0.831000	0.47069	9.869000	0.99810	2.593000	0.87608	0.563000	0.77884	GCC	.		0.567	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TFAP2B	7021	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	50791246	50791246	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:50791246T>G	ENST00000393655.3	+	2	377	c.208T>G	c.(208-210)Ttc>Gtc	p.F70V	TFAP2B_ENST00000263046.4_Missense_Mutation_p.F79V|TFAP2B_ENST00000489228.1_3'UTR	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	70	Gln/Pro-rich (transactivation domain).				aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					GCCGCCCTACTTCCCACCCCC	0.692																																					p.F70V	Pancreas(116;1373 2332 5475 10752)	.											.	TFAP2B	90	0			c.T208G						.						45.0	52.0	50.0					6																	50791246		2203	4300	6503	SO:0001583	missense	7021	exon2			CCCTACTTCCCAC	X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.208T>G	6.37:g.50791246T>G	ENSP00000377265:p.Phe70Val	Somatic	168.0	1.0		WXS	Illumina HiSeq	Phase_I	136.0	35.0	NM_003221	Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Missense_Mutation	SNP	ENST00000393655.3	37	CCDS4934.2	.	.	.	.	.	.	.	.	.	.	T	33	5.225943	0.95173	.	.	ENSG00000008196	ENST00000393655;ENST00000344788;ENST00000263046	D;D;D	0.86769	-2.17;-2.17;-2.17	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.84938	0.5583	M	0.87097	2.86	0.80722	D	1	B	0.24186	0.099	B	0.19946	0.027	D	0.85670	0.1294	10	0.62326	D	0.03	-12.3207	15.2022	0.73150	0.0:0.0:0.0:1.0	.	70	Q92481	AP2B_HUMAN	V	70;68;79	ENSP00000377265:F70V;ENSP00000342252:F68V;ENSP00000263046:F79V	ENSP00000263046:F79V	F	+	1	0	TFAP2B	50899205	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.882000	0.87258	2.008000	0.58898	0.460000	0.39030	TTC	.		0.692	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040886.3	NM_003221	
TIAM2	26230	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	155458347	155458347	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:155458347A>T	ENST00000461783.3	+	7	2504	c.1231A>T	c.(1231-1233)Agt>Tgt	p.S411C	TIAM2_ENST00000456144.1_Missense_Mutation_p.S411C|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000360366.4_Missense_Mutation_p.S411C|TIAM2_ENST00000529824.2_Missense_Mutation_p.S411C|TIAM2_ENST00000318981.5_Missense_Mutation_p.S411C			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	411					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CTACTTTGACAGTCGCTCTGA	0.522																																					p.S411C		.											.	TIAM2	93	0			c.A1231T						.						95.0	86.0	89.0					6																	155458347		2203	4300	6503	SO:0001583	missense	26230	exon4			TTTGACAGTCGCT		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1231A>T	6.37:g.155458347A>T	ENSP00000437188:p.Ser411Cys	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	6.0	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.051869	0.55218	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.11821	2.82;2.74;2.82;2.82;2.79;2.82	6.08	4.85	0.62838	.	0.085587	0.85682	D	0.000000	T	0.06325	0.0163	L	0.51914	1.62	0.80722	D	1	B	0.12013	0.005	B	0.14023	0.01	T	0.07214	-1.0784	10	0.87932	D	0	.	7.4374	0.27164	0.8027:0.0:0.0686:0.1288	.	411	Q8IVF5	TIAM2_HUMAN	C	411;657;411;411;411;411;411	ENSP00000437188:S411C;ENSP00000434901:S411C;ENSP00000407746:S411C;ENSP00000327315:S411C;ENSP00000353528:S411C;ENSP00000433348:S411C	ENSP00000327315:S411C	S	+	1	0	TIAM2	155500039	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.670000	0.68088	2.333000	0.79357	0.533000	0.62120	AGT	.		0.522	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
TLE6	79816	broad.mit.edu;bcgsc.ca	37	19	2991926	2991926	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr19:2991926C>T	ENST00000246112.4	+	14	1531	c.1330C>T	c.(1330-1332)Cgg>Tgg	p.R444W	TLE6_ENST00000452088.1_Missense_Mutation_p.R321W	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	444					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCCTGTCTGCGGTGCTGGGA	0.587																																					p.R444W		.											.	TLE6	91	0			c.C1330T						.						88.0	76.0	80.0					19																	2991926		2203	4300	6503	SO:0001583	missense	79816	exon14			TGTCTGCGGTGCT	AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.1330C>T	19.37:g.2991926C>T	ENSP00000246112:p.Arg444Trp	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	5.0	NM_001143986	J3KMZ1	Missense_Mutation	SNP	ENST00000246112.4	37	CCDS45910.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745867	0.69418	.	.	ENSG00000104953	ENST00000447920;ENST00000246112;ENST00000452088;ENST00000441927	T;T	0.13901	2.55;2.55	3.09	3.09	0.35607	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.	.	.	.	T	0.41949	0.1181	M	0.91612	3.225	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.49485	-0.8935	9	0.87932	D	0	.	9.8977	0.41329	0.0:1.0:0.0:0.0	.	444;302;321;321	C9JGZ7;Q9Y6S1;Q9H808;Q6PJM9	.;.;TLE6_HUMAN;.	W	444;444;321;321	ENSP00000246112:R444W;ENSP00000406893:R321W	ENSP00000246112:R444W	R	+	1	2	TLE6	2942926	1.000000	0.71417	0.998000	0.56505	0.742000	0.42306	4.117000	0.57877	2.052000	0.61016	0.462000	0.41574	CGG	.		0.587	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345996.3	NM_024760	
TMEM132B	114795	broad.mit.edu;ucsc.edu;bcgsc.ca|broad.mit.edu;ucsc.edu	37	12	125834659	125834660	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr12:125834659_125834660GG>TT	ENST00000299308.3	+	2	722_723	c.714_715GG>TT	c.(712-717)tgGGag>tgTTag	p.238_239WE>C*		NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	238						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AAGGCAAGTGGGAGAACAATAT	0.594																																					p.W238C|p.E239X		.											.	TMEM132B	185	0			c.G714T|c.G715T						.																																			SO:0001587	stop_gained	114795	exon2			CAAGTGGGAGAAC|AAGTGGGAGAACA	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		Exception_encountered	12.37:g.125834659_125834660delinsTT	ENSP00000299308:p.W238_E239delinsC*	Somatic	74.0	1.0		WXS	Illumina HiSeq	Phase_I	56.0	8.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000299308.3	37	CCDS41859.1																																																																																			.		0.594	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
TMEM63C	57156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	77705090	77705090	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr14:77705090A>T	ENST00000298351.4	+	10	849	c.705A>T	c.(703-705)gaA>gaT	p.E235D		NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	235					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		AAGACCCAGAACTCATCATTA	0.483																																					p.E235D		.											.	.	.	0			c.A705T						.						97.0	94.0	95.0					14																	77705090		1964	4141	6105	SO:0001583	missense	57156	exon10			CCCAGAACTCATC		CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.705A>T	14.37:g.77705090A>T	ENSP00000298351:p.Glu235Asp	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	24.0	NM_020431	B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Missense_Mutation	SNP	ENST00000298351.4	37	CCDS45141.1	.	.	.	.	.	.	.	.	.	.	A	13.81	2.348893	0.41599	.	.	ENSG00000165548	ENST00000298351	T	0.20463	2.07	4.94	-4.97	0.03029	.	0.331422	0.32120	N	0.006553	T	0.13243	0.0321	L	0.50333	1.59	0.21147	N	0.99977	B	0.09022	0.002	B	0.10450	0.005	T	0.13710	-1.0499	10	0.34782	T	0.22	-8.5149	5.5631	0.17154	0.2506:0.112:0.527:0.1104	.	235	Q9P1W3	TM63C_HUMAN	D	235	ENSP00000298351:E235D	ENSP00000298351:E235D	E	+	3	2	TMEM63C	76774843	0.290000	0.24343	0.737000	0.30932	0.883000	0.51084	-0.363000	0.07593	-0.753000	0.04721	0.459000	0.35465	GAA	.		0.483	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414193.1		
TNN	63923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175052888	175052888	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:175052888C>G	ENST00000239462.4	+	5	1164	c.1051C>G	c.(1051-1053)Ctt>Gtt	p.L351V		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	351	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGCCCTAGACCTTGCTGTGCT	0.547																																					p.L351V		.											.	TNN	138	0			c.C1051G						.						65.0	57.0	60.0					1																	175052888		2203	4300	6503	SO:0001583	missense	63923	exon5			CTAGACCTTGCTG	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1051C>G	1.37:g.175052888C>G	ENSP00000239462:p.Leu351Val	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	16.0	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	6.488	0.458310	0.12342	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.53423	0.62	5.52	2.41	0.29592	Fibronectin, type III (2);	0.670270	0.15048	N	0.283455	T	0.36908	0.0984	L	0.47190	1.495	0.09310	N	1	B;B	0.14805	0.011;0.002	B;B	0.15052	0.012;0.002	T	0.20940	-1.0260	10	0.13853	T	0.58	.	10.6207	0.45478	0.2013:0.5042:0.2945:0.0	.	351;351	B3KXB6;Q9UQP3	.;TENN_HUMAN	V	351	ENSP00000239462:L351V	ENSP00000239462:L351V	L	+	1	0	TNN	173319511	0.129000	0.22400	0.938000	0.37757	0.178000	0.23041	1.007000	0.29860	1.273000	0.44346	0.591000	0.81541	CTT	.		0.547	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
TNS3	64759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	47342556	47342556	+	Missense_Mutation	SNP	G	G	A	rs199534852		TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:47342556G>A	ENST00000398879.1	-	22	3815	c.3449C>T	c.(3448-3450)cCt>cTt	p.P1150L	TNS3_ENST00000355730.3_Missense_Mutation_p.P910L|TNS3_ENST00000311160.9_Missense_Mutation_p.P1150L			Q68CZ2	TENS3_HUMAN	tensin 3	1150					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						ACCTGGCAGAGGTGAGGCCGC	0.582																																					p.P1150L		.											.	TNS3	94	0			c.C3449T						.	G	LEU/PRO	0,3944		0,0,1972	79.0	87.0	84.0		3449	4.7	0.1	7		84	4,8284		0,4,4140	yes	missense	TNS3	NM_022748.11	98	0,4,6112	AA,AG,GG		0.0483,0.0,0.0327	possibly-damaging	1150/1446	47342556	4,12228	1972	4144	6116	SO:0001583	missense	64759	exon22			GGCAGAGGTGAGG	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3449C>T	7.37:g.47342556G>A	ENSP00000381854:p.Pro1150Leu	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	22.0	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	37	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	G	14.86	2.661588	0.47572	0.0	4.83E-4	ENSG00000136205	ENST00000311160;ENST00000398879;ENST00000355730;ENST00000545849	D;D;D	0.94537	-2.98;-2.98;-3.45	5.56	4.65	0.58169	.	0.000000	0.64402	U	0.000014	D	0.89051	0.6605	L	0.40543	1.245	0.80722	D	1	B	0.19331	0.035	B	0.19946	0.027	T	0.81579	-0.0868	10	0.12766	T	0.61	-9.5304	7.5532	0.27808	0.2022:0.0:0.7978:0.0	.	1150	Q68CZ2	TENS3_HUMAN	L	1150;1150;910;606	ENSP00000312143:P1150L;ENSP00000381854:P1150L;ENSP00000347968:P910L	ENSP00000312143:P1150L	P	-	2	0	TNS3	47309081	1.000000	0.71417	0.066000	0.19879	0.225000	0.24961	4.173000	0.58249	1.265000	0.44215	0.484000	0.47621	CCT	G|0.999;A|0.001		0.582	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
TRRAP	8295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	98580989	98580989	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:98580989G>A	ENST00000359863.4	+	59	9117	c.8908G>A	c.(8908-8910)Gtg>Atg	p.V2970M	TRRAP_ENST00000355540.3_Missense_Mutation_p.V2952M|TRRAP_ENST00000446306.3_Missense_Mutation_p.V2952M	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2970	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CATGAAGACGGTGGTGAAGAC	0.542																																					p.V2970M		.											.	TRRAP	923	0			c.G8908A						.						188.0	138.0	155.0					7																	98580989		2203	4300	6503	SO:0001583	missense	8295	exon59			AAGACGGTGGTGA	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.8908G>A	7.37:g.98580989G>A	ENSP00000352925:p.Val2970Met	Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	37.0	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564408	0.86335	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.69435	-0.4;-0.4	5.48	5.48	0.80851	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.000000	0.85682	D	0.000000	T	0.79305	0.4423	L	0.56199	1.76	0.80722	D	1	D;D;D	0.67145	0.994;0.996;0.995	D;D;D	0.69142	0.937;0.95;0.962	T	0.80703	-0.1264	10	0.87932	D	0	.	19.3398	0.94336	0.0:0.0:1.0:0.0	.	2952;2691;2970	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	M	2970;2952;2951	ENSP00000352925:V2970M;ENSP00000347733:V2952M	ENSP00000347733:V2952M	V	+	1	0	TRRAP	98418925	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	8.062000	0.89475	2.571000	0.86741	0.650000	0.86243	GTG	.		0.542	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
URM1	81605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131151593	131151593	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr9:131151593G>T	ENST00000452446.1	+	4	304	c.242G>T	c.(241-243)aGt>aTt	p.S81I	URM1_ENST00000372853.4_Intron|RP11-339B21.11_ENST00000609303.1_lincRNA|URM1_ENST00000372850.1_3'UTR|URM1_ENST00000483206.1_3'UTR	NM_001135947.2	NP_001129419.1			ubiquitin related modifier 1											cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						CTACTGGTCAGTACCTTGGGG	0.587																																					p.S81I		.											.	URM1	90	0			c.G242T						.						89.0	81.0	84.0					9																	131151593		2203	4300	6503	SO:0001583	missense	81605	exon4			TGGTCAGTACCTT	AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000452446.1:c.242G>T	9.37:g.131151593G>T	ENSP00000412922:p.Ser81Ile	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	13.0	NM_001135947		Missense_Mutation	SNP	ENST00000452446.1	37	CCDS48035.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306487	0.81247	.	.	ENSG00000167118	ENST00000452446	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	T	0.79534	0.4462	.	.	.	0.36006	D	0.837751	D	0.76494	0.999	D	0.72075	0.976	T	0.82010	-0.0669	6	.	.	.	.	19.1191	0.93355	0.0:0.0:1.0:0.0	.	81	Q9BTM9-2	.	I	81	.	.	S	+	2	0	URM1	130191414	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.960000	0.87893	2.837000	0.97791	0.655000	0.94253	AGT	.		0.587	URM1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_030914	
USP1	7398	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	62914231	62914231	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr1:62914231T>C	ENST00000339950.4	+	8	2331	c.1516T>C	c.(1516-1518)Tgt>Cgt	p.C506R	USP1_ENST00000371146.1_Missense_Mutation_p.C506R	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	506	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		TAAATATTTCTGTGAAAACTG	0.363																																					p.C506R	Ovarian(122;1846 2315 3982 19504)	.											.	USP1	659	0			c.T1516C						.						104.0	111.0	108.0					1																	62914231		2203	4300	6503	SO:0001583	missense	7398	exon8			TATTTCTGTGAAA		CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.1516T>C	1.37:g.62914231T>C	ENSP00000343526:p.Cys506Arg	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	19.0	NM_001017415	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	ENST00000339950.4	37	CCDS621.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.422471	0.83559	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	D;D	0.81739	-1.53;-1.53	5.95	5.95	0.96441	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.91590	0.7343	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92951	0.6380	10	0.66056	D	0.02	-11.9458	16.4237	0.83790	0.0:0.0:0.0:1.0	.	506	O94782	UBP1_HUMAN	R	506	ENSP00000360188:C506R;ENSP00000343526:C506R	ENSP00000343526:C506R	C	+	1	0	USP1	62686819	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.665000	0.83852	2.279000	0.76181	0.533000	0.62120	TGT	.		0.363	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024881.1	NM_001017415	
USP4	7375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49316327	49316327	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr3:49316327A>G	ENST00000265560.4	-	21	2699	c.2653T>C	c.(2653-2655)Tat>Cat	p.Y885H	C3orf62_ENST00000343010.3_5'Flank|USP4_ENST00000351842.4_Missense_Mutation_p.Y838H	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	885	USP.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		TTCTTCGCATATGCAGTGTCT	0.413																																					p.Y885H		.											.	USP4	660	0			c.T2653C						.						228.0	208.0	215.0					3																	49316327		2203	4300	6503	SO:0001583	missense	7375	exon21			TCGCATATGCAGT	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.2653T>C	3.37:g.49316327A>G	ENSP00000265560:p.Tyr885His	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	7.0	NM_003363	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	37	CCDS2793.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463226	0.84425	.	.	ENSG00000114316	ENST00000351842;ENST00000265560	T;T	0.03580	3.88;3.88	5.45	5.45	0.79879	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.17023	0.0409	M	0.79614	2.46	0.80722	D	1	D;D	0.61697	0.99;0.987	D;D	0.66716	0.946;0.912	T	0.00395	-1.1766	10	0.41790	T	0.15	-18.2772	14.6366	0.68694	1.0:0.0:0.0:0.0	.	838;885	Q13107-2;Q13107	.;UBP4_HUMAN	H	838;885	ENSP00000341028:Y838H;ENSP00000265560:Y885H	ENSP00000265560:Y885H	Y	-	1	0	USP4	49291331	1.000000	0.71417	0.986000	0.45419	0.852000	0.48524	6.276000	0.72601	2.189000	0.69895	0.533000	0.62120	TAT	.		0.413	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
USP6NL	9712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	11505005	11505005	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr10:11505005T>G	ENST00000609104.1	-	15	2316	c.1922A>C	c.(1921-1923)aAc>aCc	p.N641T	USP6NL_ENST00000379237.2_Missense_Mutation_p.N664T|USP6NL_ENST00000277575.5_Missense_Mutation_p.N658T	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	641					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						TTTGGGAGAGTTTCCGTGGTA	0.552																																					p.N658T		.											.	USP6NL	628	0			c.A1973C						.						36.0	37.0	37.0					10																	11505005		1943	4127	6070	SO:0001583	missense	9712	exon14			GGAGAGTTTCCGT	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1922A>C	10.37:g.11505005T>G	ENSP00000476462:p.Asn641Thr	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	6.0	NM_001080491	A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	ENST00000609104.1	37	CCDS53492.1	.	.	.	.	.	.	.	.	.	.	T	9.517	1.107347	0.20714	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.05996	3.36;3.38	6.04	-2.8	0.05823	.	0.246334	0.35124	N	0.003438	T	0.05960	0.0155	L	0.48642	1.525	0.09310	N	1	B;P	0.35575	0.376;0.51	B;B	0.32864	0.115;0.154	T	0.22556	-1.0213	10	0.62326	D	0.03	.	13.0109	0.58731	0.0:0.398:0.0:0.602	.	641;658	Q92738;Q92738-2	US6NL_HUMAN;.	T	641;658;641	ENSP00000277575:N658T;ENSP00000368539:N641T	ENSP00000277575:N658T	N	-	2	0	USP6NL	11545011	0.238000	0.23825	0.000000	0.03702	0.026000	0.11368	0.090000	0.15025	-0.355000	0.08199	0.460000	0.39030	AAC	.		0.552	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046764.3	NM_014688	
VPS13C	54832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	62146685	62146685	+	Silent	SNP	T	T	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr15:62146685T>G	ENST00000261517.5	-	85	11306	c.11233A>C	c.(11233-11235)Aga>Cga	p.R3745R	RP11-16B9.1_ENST00000559251.1_RNA|VPS13C_ENST00000249837.3_Silent_p.R3702R	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						CTGAGAAGTCTCACTGATGAC	0.408																																					p.R3745R		.											.	VPS13C	92	0			c.A11233C						.						216.0	192.0	200.0					15																	62146685		2203	4300	6503	SO:0001819	synonymous_variant	54832	exon85			GAAGTCTCACTGA	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.11233A>C	15.37:g.62146685T>G		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	28.0	NM_020821		Silent	SNP	ENST00000261517.5	37	CCDS32257.1																																																																																			.		0.408	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
VPS16	64601	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	2842263	2842263	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr20:2842263G>T	ENST00000380445.3	+	9	884	c.812G>T	c.(811-813)tGc>tTc	p.C271F	VPS16_ENST00000380443.3_5'Flank|VPS16_ENST00000380469.3_Missense_Mutation_p.C271F|VPS16_ENST00000481812.2_3'UTR|PTPRA_ENST00000380393.3_5'Flank	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	271					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						GCTCACAGGTGCAGCCGTCCT	0.587																																					p.C271F		.											.	VPS16	94	0			c.G812T						.						46.0	46.0	46.0					20																	2842263		2203	4300	6503	SO:0001583	missense	64601	exon9			ACAGGTGCAGCCG	AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.812G>T	20.37:g.2842263G>T	ENSP00000369810:p.Cys271Phe	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	7.0	NM_022575	Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Missense_Mutation	SNP	ENST00000380445.3	37	CCDS13036.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400284	0.83120	.	.	ENSG00000215305	ENST00000380445;ENST00000380469;ENST00000453689;ENST00000417508	T;T	0.61158	0.33;0.13	5.77	5.77	0.91146	Vps16, N-terminal (1);	0.043169	0.85682	D	0.000000	T	0.80341	0.4605	M	0.90759	3.145	0.80722	D	1	D;D	0.69078	0.997;0.96	D;P	0.78314	0.991;0.813	D	0.83844	0.0259	10	0.87932	D	0	-17.6955	15.4896	0.75593	0.0:0.0:1.0:0.0	.	271;271	Q9H269-2;Q9H269	.;VPS16_HUMAN	F	271;271;153;153	ENSP00000369810:C271F;ENSP00000369836:C271F	ENSP00000369810:C271F	C	+	2	0	VPS16	2790263	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.954000	0.87848	2.745000	0.94114	0.609000	0.83330	TGC	.		0.587	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077658.2	NM_022575	
WDR31	114987	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	116085393	116085393	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr9:116085393G>A	ENST00000374193.4	-	6	613	c.367C>T	c.(367-369)Cgt>Tgt	p.R123C	WDR31_ENST00000374195.3_5'UTR|WDR31_ENST00000341761.4_Missense_Mutation_p.R122C|WDR31_ENST00000461942.1_5'UTR	NM_001012361.2|NM_145241.3	NP_001012361.1|NP_660284.1	Q8NA23	WDR31_HUMAN	WD repeat domain 31	123										NS(1)|large_intestine(1)|lung(2)|prostate(2)	6						ATCCTGTCACGAGAGGCACTG	0.517																																					p.R123C		.											.	WDR31	90	0			c.C367T						.						107.0	94.0	99.0					9																	116085393		2203	4300	6503	SO:0001583	missense	114987	exon6			TGTCACGAGAGGC	BC012352	CCDS6792.1, CCDS35110.1	9q33.1	2013-01-09			ENSG00000148225	ENSG00000148225		"""WD repeat domain containing"""	21421	protein-coding gene	gene with protein product	"""similar to spermatid WD-repeat protein"""						Standard	NM_145241		Approved	FLJ35921	uc004bhb.3	Q8NA23	OTTHUMG00000020525	ENST00000374193.4:c.367C>T	9.37:g.116085393G>A	ENSP00000363308:p.Arg123Cys	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	5.0	NM_001012361	Q5W0T9|Q96EG8	Missense_Mutation	SNP	ENST00000374193.4	37	CCDS35110.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428593	0.83667	.	.	ENSG00000148225	ENST00000374193;ENST00000341761;ENST00000465979	T;T;T	0.63096	-0.02;-0.02;-0.02	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.68091	0.2963	N	0.25789	0.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65817	-0.6076	10	0.38643	T	0.18	-16.237	14.4843	0.67606	0.0:0.0:0.8533:0.1467	.	123;122	Q8NA23;Q8NA23-2	WDR31_HUMAN;.	C	123;122;55	ENSP00000363308:R123C;ENSP00000345027:R122C;ENSP00000419246:R55C	ENSP00000345027:R122C	R	-	1	0	WDR31	115125214	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.224000	0.65288	2.894000	0.99253	0.655000	0.94253	CGT	.		0.517	WDR31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053734.2	NM_145241	
XKR4	114786	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	56015167	56015167	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr8:56015167C>A	ENST00000327381.6	+	1	219	c.119C>A	c.(118-120)tCg>tAg	p.S40*		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	40						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GGCTTGCCGTCGGGGTCGGGA	0.721																																					p.S40X		.											.	XKR4	92	0			c.C119A						.						15.0	17.0	16.0					8																	56015167		2200	4295	6495	SO:0001587	stop_gained	114786	exon1			TGCCGTCGGGGTC	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.119C>A	8.37:g.56015167C>A	ENSP00000328326:p.Ser40*	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	22.0	NM_052898	Q96PZ8	Nonsense_Mutation	SNP	ENST00000327381.6	37	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	C	38	6.888451	0.97912	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	.	.	.	3.22	3.22	0.36961	.	3.456440	0.01806	N	0.033169	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-8.716	11.9643	0.53025	0.0:1.0:0.0:0.0	.	.	.	.	X	40	.	ENSP00000328326:S40X	S	+	2	0	XKR4	56177721	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.546000	0.36179	1.649000	0.50652	0.549000	0.68633	TCG	.		0.721	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
YME1L1	10730	broad.mit.edu;bcgsc.ca	37	10	27434519	27434519	+	Splice_Site	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr10:27434519G>T	ENST00000326799.3	-	4	488	c.340C>A	c.(340-342)Cct>Act	p.P114T	YME1L1_ENST00000477432.1_3'UTR|YME1L1_ENST00000376016.3_Splice_Site_p.P57T|YME1L1_ENST00000375972.3_Splice_Site_p.P57T	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	114					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						TTAAGTGAAGGCTGTAAAAGA	0.318																																					p.P114T		.											.	YME1L1	91	0			c.C340A						.						78.0	83.0	82.0					10																	27434519		2203	4300	6503	SO:0001630	splice_region_variant	10730	exon4			GTGAAGGCTGTAA	AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.340-1C>A	10.37:g.27434519G>T		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	5.0	NM_139312	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	ENST00000326799.3	37	CCDS7152.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548556	0.45383	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000427324;ENST00000396296	D;D;D	0.93189	-3.03;-3.18;-3.18	5.34	2.45	0.29901	Peptidase M41, FtsH (1);	0.251728	0.47455	D	0.000235	D	0.83723	0.5316	N	0.08118	0	0.28161	N	0.928964	P;B;B	0.35745	0.518;0.101;0.398	B;B;B	0.37144	0.197;0.098;0.242	T	0.77854	-0.2433	10	0.66056	D	0.02	-4.1049	7.053	0.25083	0.2156:0.1263:0.6582:0.0	.	57;57;114	B4DNM1;Q96TA2-2;Q96TA2	.;.;YMEL1_HUMAN	T	57;114;114;57;57;49	ENSP00000365184:P57T;ENSP00000318480:P114T;ENSP00000365139:P57T	ENSP00000318480:P114T	P	-	1	0	YME1L1	27474525	1.000000	0.71417	0.993000	0.49108	0.983000	0.72400	1.699000	0.37804	0.258000	0.21686	0.586000	0.80456	CCT	.		0.318	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1	NM_139312	Missense_Mutation
ZFP14	57677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36831783	36831783	+	Silent	SNP	C	C	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr19:36831783C>T	ENST00000270001.7	-	5	1060	c.945G>A	c.(943-945)aaG>aaA	p.K315K		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					TCCCACATTCCTTACATTCAT	0.418																																					p.K315K		.											.	ZFP14	91	0			c.G945A						.						97.0	99.0	99.0					19																	36831783		2203	4300	6503	SO:0001819	synonymous_variant	57677	exon5			ACATTCCTTACAT	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.945G>A	19.37:g.36831783C>T		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	16.0	NM_020917	A7MD23	Silent	SNP	ENST00000270001.7	37	CCDS33002.1																																																																																			.		0.418	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917	
ZFYVE16	9765	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	79733274	79733274	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:79733274A>G	ENST00000338008.5	+	3	950	c.770A>G	c.(769-771)cAt>cGt	p.H257R	ZFYVE16_ENST00000510158.1_Missense_Mutation_p.H257R|ZFYVE16_ENST00000505560.1_Missense_Mutation_p.H257R	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	257					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		AAAATGTTTCATGCCAAAGAC	0.353																																					p.H257R	Melanoma(150;1452 1854 16018 17851 37292)	.											.	ZFYVE16	90	0			c.A770G						.						61.0	65.0	63.0					5																	79733274		2202	4299	6501	SO:0001583	missense	9765	exon4			TGTTTCATGCCAA	AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.770A>G	5.37:g.79733274A>G	ENSP00000337159:p.His257Arg	Somatic	224.0	0.0		WXS	Illumina HiSeq	Phase_I	250.0	16.0	NM_001105251	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	ENST00000338008.5	37	CCDS4050.1	.	.	.	.	.	.	.	.	.	.	A	8.051	0.765996	0.15983	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.36878	1.23;1.23;1.23	5.09	5.09	0.68999	.	0.341252	0.25138	N	0.032844	T	0.20577	0.0495	N	0.14661	0.345	0.09310	N	1	B;B	0.14805	0.002;0.011	B;B	0.17433	0.018;0.008	T	0.12993	-1.0526	10	0.24483	T	0.36	-0.7872	8.8365	0.35115	0.9135:0.0:0.0865:0.0	.	257;257	Q7Z3T8-3;Q7Z3T8	.;ZFY16_HUMAN	R	257	ENSP00000337159:H257R;ENSP00000423663:H257R;ENSP00000426848:H257R	ENSP00000337159:H257R	H	+	2	0	ZFYVE16	79769030	0.940000	0.31905	0.783000	0.31826	0.422000	0.31414	1.322000	0.33689	2.044000	0.60594	0.383000	0.25322	CAT	.		0.353	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733	
ZFP62	643836	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	180276368	180276368	+	Silent	SNP	A	A	C			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr5:180276368A>C	ENST00000502412.1	-	2	2184	c.2127T>G	c.(2125-2127)gcT>gcG	p.A709A	ZFP62_ENST00000359141.6_Silent_p.A649A|ZFP62_ENST00000506377.1_Intron|ZFP62_ENST00000512132.1_Silent_p.A676A	NM_001172638.1	NP_001166109.1	Q8NB50	ZFP62_HUMAN	ZFP62 zinc finger protein	709					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(2)|pancreas(1)	4	all_cancers(89;4.01e-05)|all_epithelial(37;4.69e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00469)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGAGAAAAAAGCTTTTCCAC	0.433																																					p.A709A		.											.	.	.	0			c.T2127G						.						118.0	113.0	115.0					5																	180276368		692	1591	2283	SO:0001819	synonymous_variant	643836	exon2			GAAAAAAGCTTTT	AK002206	CCDS47357.1, CCDS47357.2, CCDS54955.1	5q35.3	2013-01-08	2012-11-27			ENSG00000196670		"""Zinc fingers, C2H2-type"""	23241	protein-coding gene	gene with protein product		610281	"""zinc finger protein 62 homolog (mouse)"", ""zinc finger protein 62"""			8808410	Standard	NM_152283		Approved	FLJ34231, ZET, ZNF755	uc011dhf.2	Q8NB50		ENST00000502412.1:c.2127T>G	5.37:g.180276368A>C		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	8.0	NM_001172638	B4DIP6|B4E0N3|B5MDX6|B7ZVZ2|B9EIP6|E9PFT8|J3QTA9	Silent	SNP	ENST00000502412.1	37	CCDS54955.1																																																																																			.		0.433	ZFP62-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368386.2	NM_152283	
ZNF212	7988	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	148949877	148949877	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:148949877G>A	ENST00000335870.2	+	4	750	c.622G>A	c.(622-624)Gcc>Acc	p.A208T		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	208	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			TCCTGGTGGTGCCCACCCAGG	0.572																																					p.A208T		.											.	ZNF212	91	0			c.G622A						.						127.0	109.0	115.0					7																	148949877		2203	4300	6503	SO:0001583	missense	7988	exon4			GGTGGTGCCCACC	U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.622G>A	7.37:g.148949877G>A	ENSP00000338572:p.Ala208Thr	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	7.0	NM_012256	B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	ENST00000335870.2	37	CCDS5896.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.62|12.62	1.991895|1.991895	0.35131|0.35131	.|.	.|.	ENSG00000170260|ENSG00000170260	ENST00000335870|ENST00000481584	T|.	0.06528|.	3.29|.	5.62|5.62	3.35|3.35	0.38373|0.38373	Krueppel-associated box (1);|.	0.618014|.	0.14384|.	N|.	0.322953|.	T|T	0.16557|0.16557	0.0398|0.0398	N|N	0.08118|0.08118	0|0	0.24072|0.24072	N|N	0.995976|0.995976	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.19031|0.19031	-1.0318|-1.0318	10|5	0.09843|.	T|.	0.71|.	-2.1678|-2.1678	4.8945|4.8945	0.13744|0.13744	0.1658:0.2599:0.5743:0.0|0.1658:0.2599:0.5743:0.0	.|.	208|.	Q9UDV6|.	ZN212_HUMAN|.	T|Y	208|121	ENSP00000338572:A208T|.	ENSP00000338572:A208T|.	A|C	+|+	1|2	0|0	ZNF212|ZNF212	148580810|148580810	0.497000|0.497000	0.26067|0.26067	0.805000|0.805000	0.32314|0.32314	0.990000|0.990000	0.78478|0.78478	1.395000|1.395000	0.34520|0.34520	1.033000|1.033000	0.39918|0.39918	0.655000|0.655000	0.94253|0.94253	GCC|TGC	.		0.572	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352710.1	NM_012256	
ZNF385B	151126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	180348008	180348008	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr2:180348008C>A	ENST00000410066.1	-	6	1264	c.661G>T	c.(661-663)Gac>Tac	p.D221Y	ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000336917.5_Missense_Mutation_p.D119Y|ZNF385B_ENST00000409343.1_Missense_Mutation_p.D145Y|ZNF385B_ENST00000409692.1_Missense_Mutation_p.D119Y	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	221	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			CCTGATTTGTCAGAGTTGTTG	0.458																																					p.D221Y	Colon(155;204 2491 32774 51842)	.											.	ZNF385B	23	0			c.G661T						.						284.0	230.0	249.0					2																	180348008		2203	4300	6503	SO:0001583	missense	151126	exon6			ATTTGTCAGAGTT	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.661G>T	2.37:g.180348008C>A	ENSP00000386845:p.Asp221Tyr	Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	190.0	54.0	NM_152520	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	ENST00000410066.1	37	CCDS33339.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804859	0.70682	.	.	ENSG00000144331	ENST00000410066;ENST00000336917;ENST00000409343;ENST00000409692;ENST00000457304	T;T;T;T;T	0.33216	1.42;1.43;1.42;1.43;1.43	5.93	5.93	0.95920	.	1.465370	0.03449	N	0.210371	T	0.59390	0.2190	L	0.56769	1.78	0.53688	D	0.999973	D;D	0.65815	0.991;0.995	P;D	0.64410	0.843;0.925	T	0.30822	-0.9965	10	0.59425	D	0.04	-11.8835	18.5086	0.90907	0.0:1.0:0.0:0.0	.	221;145	Q569K4;Q569K4-2	Z385B_HUMAN;.	Y	221;119;145;119;119	ENSP00000386845:D221Y;ENSP00000338225:D119Y;ENSP00000386379:D145Y;ENSP00000386507:D119Y;ENSP00000394038:D119Y	ENSP00000338225:D119Y	D	-	1	0	ZNF385B	180056253	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.889000	0.56212	2.802000	0.96397	0.561000	0.74099	GAC	.		0.458	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520	
ZNF469	84627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	88502140	88502140	+	Silent	SNP	G	G	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr16:88502140G>A	ENST00000437464.1	+	2	8178	c.8178G>A	c.(8176-8178)ggG>ggA	p.G2726G	ZNF469_ENST00000565624.1_Silent_p.G2754G	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2726					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CGGCAAGGGGGTTCTGGGGAC	0.632																																					p.G2726G		.											.	.	.	0			c.G8178A						.						62.0	82.0	76.0					16																	88502140		692	1591	2283	SO:0001819	synonymous_variant	84627	exon2			AAGGGGGTTCTGG	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.8178G>A	16.37:g.88502140G>A		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	19.0	NM_001127464		Silent	SNP	ENST00000437464.1	37	CCDS45544.1																																																																																			.		0.632	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF76	7629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35255576	35255576	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr6:35255576G>T	ENST00000373953.3	+	5	652	c.386G>T	c.(385-387)gGc>gTc	p.G129V	ZNF76_ENST00000440666.2_Missense_Mutation_p.G103V|ZNF76_ENST00000339411.5_Missense_Mutation_p.G129V	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	129					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						GATGATGAGGGCTTCAGTGCA	0.617																																					p.G129V	Esophageal Squamous(52;92 1039 20612 23956 34676)	.											.	ZNF76	90	0			c.G386T						.						99.0	87.0	91.0					6																	35255576		2203	4300	6503	SO:0001583	missense	7629	exon5			ATGAGGGCTTCAG	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.386G>T	6.37:g.35255576G>T	ENSP00000363064:p.Gly129Val	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	13.0	NM_003427	Q9BQB2	Missense_Mutation	SNP	ENST00000373953.3	37	CCDS4801.1	.	.	.	.	.	.	.	.	.	.	G	9.776	1.174081	0.21704	.	.	ENSG00000065029	ENST00000469195;ENST00000448999;ENST00000373953;ENST00000417184;ENST00000440666;ENST00000339411	T;T;T;T	0.09630	2.98;2.96;2.96;2.98	5.04	4.14	0.48551	.	0.171412	0.28161	N	0.016370	T	0.10078	0.0247	N	0.14661	0.345	0.58432	D	0.999996	P;D;B;B	0.76494	0.804;0.999;0.137;0.1	B;D;B;B	0.73380	0.255;0.98;0.093;0.046	T	0.24977	-1.0145	10	0.42905	T	0.14	.	13.8538	0.63513	0.0:0.2034:0.7966:0.0	.	129;129;129;129	B7Z851;B7Z991;P36508-2;P36508	.;.;.;ZNF76_HUMAN	V	129;129;129;129;103;129	ENSP00000419106:G129V;ENSP00000363064:G129V;ENSP00000392243:G103V;ENSP00000344097:G129V	ENSP00000229405:G129V	G	+	2	0	ZNF76	35363554	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	2.355000	0.44107	2.615000	0.88500	0.563000	0.77884	GGC	.		0.617	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040279.2	NM_003427	
ZNF804B	219578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	88964910	88964910	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr7:88964910C>A	ENST00000333190.4	+	4	3223	c.2614C>A	c.(2614-2616)Caa>Aaa	p.Q872K		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	872							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CAAGAGAAATCAAGAGTCTTT	0.423										HNSCC(36;0.09)																											p.Q872K		.											.	ZNF804B	101	0			c.C2614A						.						60.0	62.0	61.0					7																	88964910		2203	4299	6502	SO:0001583	missense	219578	exon4			AGAAATCAAGAGT	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2614C>A	7.37:g.88964910C>A	ENSP00000329638:p.Gln872Lys	Somatic	193.0	0.0		WXS	Illumina HiSeq	Phase_I	273.0	35.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.733857	0.00687	.	.	ENSG00000182348	ENST00000333190	T	0.05382	3.45	4.95	3.13	0.36017	.	1.061480	0.07264	N	0.867883	T	0.04907	0.0132	L	0.32530	0.975	0.09310	N	1	B	0.18741	0.03	B	0.18561	0.022	T	0.45498	-0.9257	10	0.02654	T	1	0.2361	6.2299	0.20728	0.1174:0.5008:0.3094:0.0724	.	872	A4D1E1	Z804B_HUMAN	K	872	ENSP00000329638:Q872K	ENSP00000329638:Q872K	Q	+	1	0	ZNF804B	88802846	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	-0.431000	0.06965	0.691000	0.31592	-0.122000	0.15005	CAA	.		0.423	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
VPS16	64601	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	2842264	2842265	+	Missense_Mutation	DNP	CA	CA	TT			TCGA-DD-A4NV-01A-11D-A30V-10	TCGA-DD-A4NV-10A-01D-A30V-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3e5656c7-1284-4d60-92d5-12b88c3cb840	812b8551-4906-486e-84de-08451638352a	g.chr20:2842264_2842265CA>TT	ENST00000380445.3	+	9	885_886	c.813_814CA>TT	c.(811-816)tgCAgc>tgTTgc	p.S272C	VPS16_ENST00000380443.3_5'Flank|VPS16_ENST00000380469.3_Missense_Mutation_p.S272C|VPS16_ENST00000481812.2_3'UTR|PTPRA_ENST00000380393.3_5'Flank	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	272					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						CTCACAGGTGCAGCCGTCCTCG	0.589																																					p.S272C		.											.	.	.	0			.						.																																			SO:0001583	missense	64601	.			CAGGTGCAGCCGT	AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	Exception_encountered	20.37:g.2842264_2842265delinsTT	ENSP00000369810:p.Ser272Cys	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	7.0	.	Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Missense_Mutation	DNP	ENST00000380445.3	37	CCDS13036.1																																																																																			.		0.589	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077658.2	NM_022575	
