#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADPRH	141	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	119306620	119306620	+	Silent	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:119306620G>A	ENST00000478399.1	+	4	2374	c.969G>A	c.(967-969)gtG>gtA	p.V323V	ADPRH_ENST00000357003.3_Silent_p.V323V|ADPRH_ENST00000465513.1_Silent_p.V323V|ADPRH_ENST00000478927.1_Silent_p.V323V|ADPRH_ENST00000471850.1_3'UTR			P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase	323					cellular protein modification process (GO:0006464)|protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			breast(1)|kidney(1)|lung(10)|ovary(1)	13		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		TTAAAGGAGTGAGTCCCTCCA	0.478																																					p.V323V	GBM(133;579 1804 5989 9967 40052)	.											.	ADPRH	91	0			c.G969A						.						77.0	79.0	78.0					3																	119306620		2203	4300	6503	SO:0001819	synonymous_variant	141	exon5			AGGAGTGAGTCCC	L13291	CCDS2990.1	3q13.31-q13.33	2004-02-27			ENSG00000144843	ENSG00000144843			269	protein-coding gene	gene with protein product		603081				8349667, 12070318	Standard	NM_001125		Approved	ARH1	uc003ecs.3	P54922	OTTHUMG00000159420	ENST00000478399.1:c.969G>A	3.37:g.119306620G>A		Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	115.0	59.0	NM_001125	B2R8H1|D3DN83	Silent	SNP	ENST00000478399.1	37	CCDS2990.1																																																																																			.		0.478	ADPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355199.1	NM_001125	
AGT	183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	230846423	230846423	+	Silent	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:230846423A>G	ENST00000366667.4	-	2	388	c.174T>C	c.(172-174)aaT>aaC	p.N58N	RP11-99J16__A.2_ENST00000412344.1_RNA	NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	58				N -> D (in Ref. 7; AA sequence). {ECO:0000305}.	activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GCTTCCCGGCATTGGCCTTTG	0.587																																					p.N58N		.											.	AGT	226	0			c.T174C						.						88.0	89.0	89.0					1																	230846423		2203	4300	6503	SO:0001819	synonymous_variant	183	exon2			CCCGGCATTGGCC	K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.174T>C	1.37:g.230846423A>G		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	43.0	NM_000029	Q16358|Q16359|Q96F91	Silent	SNP	ENST00000366667.4	37	CCDS1585.1																																																																																			.		0.587	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1	NM_000029	
AHCTF1	25909	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	247024551	247024551	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:247024551C>A	ENST00000391829.2	-	29	3905	c.3782G>T	c.(3781-3783)tGt>tTt	p.C1261F	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Missense_Mutation_p.C1270F|AHCTF1_ENST00000366508.1_Missense_Mutation_p.C1296F			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1261	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TGGAACTGCACATTTTTTAGG	0.363																																					p.C1270F	Colon(145;197 1800 4745 15099 26333)	.											.	AHCTF1	97	0			c.G3809T						.						29.0	29.0	29.0					1																	247024551		2203	4294	6497	SO:0001583	missense	25909	exon29			ACTGCACATTTTT		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3782G>T	1.37:g.247024551C>A	ENSP00000375705:p.Cys1261Phe	Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	426.0	120.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		.	.	.	.	.	.	.	.	.	.	C	1.149	-0.647290	0.03506	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.32272	1.46;1.47;1.47	5.8	3.81	0.43845	.	0.085601	0.51477	D	0.000091	T	0.16300	0.0392	L	0.42245	1.32	0.21473	N	0.999677	P;B;B	0.37122	0.583;0.023;0.003	B;B;B	0.32090	0.14;0.015;0.003	T	0.08932	-1.0698	10	0.09338	T	0.73	-11.0283	2.1624	0.03828	0.1609:0.513:0.1553:0.1708	.	122;1296;1261	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	F	1296;1270;1261	ENSP00000355464:C1296F;ENSP00000355465:C1270F;ENSP00000375705:C1261F	ENSP00000355465:C1270F	C	-	2	0	AHCTF1	245091174	0.002000	0.14202	0.566000	0.28421	0.008000	0.06430	-0.462000	0.06704	1.586000	0.49944	0.603000	0.83216	TGT	.		0.363	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
AP2B1	163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33935332	33935332	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:33935332A>G	ENST00000262325.7	+	5	1004	c.451A>G	c.(451-453)Atc>Gtc	p.I151V	AP2B1_ENST00000312678.8_Missense_Mutation_p.I151V|AP2B1_ENST00000538556.1_Missense_Mutation_p.I94V|AP2B1_ENST00000589344.1_Missense_Mutation_p.I151V|AP2B1_ENST00000592545.1_Missense_Mutation_p.I113V|AP2B1_ENST00000537622.2_Missense_Mutation_p.I151V	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	151					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		ACTCCATGATATCAATGCCCA	0.438																																					p.I151V		.											.	AP2B1	91	0			c.A451G						.						105.0	107.0	106.0					17																	33935332		2203	4300	6503	SO:0001583	missense	163	exon5			CATGATATCAATG	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.451A>G	17.37:g.33935332A>G	ENSP00000262325:p.Ile151Val	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	110.0	NM_001282	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	A	16.69	3.192840	0.58017	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	5.41	5.41	0.78517	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.093693	0.64402	D	0.000001	T	0.26159	0.0638	L	0.46567	1.45	0.80722	D	1	B;B;B	0.25441	0.126;0.0;0.0	B;B;B	0.26517	0.07;0.002;0.0	T	0.03051	-1.1078	10	0.44086	T	0.13	-1.0476	14.6718	0.68951	1.0:0.0:0.0:0.0	.	113;151;151	B4DWG4;P63010;P63010-2	.;AP2B1_HUMAN;.	V	151;151;94;151	ENSP00000262325:I151V;ENSP00000314414:I151V;ENSP00000440563:I94V;ENSP00000437413:I151V	ENSP00000262325:I151V	I	+	1	0	AP2B1	30959445	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.239000	0.95389	2.060000	0.61445	0.529000	0.55759	ATC	.		0.438	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		
APH1B	83464	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	63571457	63571457	+	Silent	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr15:63571457C>T	ENST00000261879.5	+	2	281	c.211C>T	c.(211-213)Ctg>Ttg	p.L71L	APH1B_ENST00000380343.4_Silent_p.L71L	NM_001145646.1|NM_031301.3	NP_001139118.1|NP_112591.2	Q8WW43	APH1B_HUMAN	APH1B gamma secretase subunit	71					apoptotic signaling pathway (GO:0097190)|membrane protein intracellular domain proteolysis (GO:0031293)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)	peptidase activity (GO:0008233)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	12						ACAGAAATATCTGCTGATCTT	0.378																																					p.L71L		.											.	APH1B	658	0			c.C211T						.						167.0	159.0	162.0					15																	63571457		2203	4300	6503	SO:0001819	synonymous_variant	83464	exon2			AAATATCTGCTGA	AY358698	CCDS10184.1, CCDS45276.1	15q22.2	2013-05-01	2013-05-01		ENSG00000138613	ENSG00000138613			24080	protein-coding gene	gene with protein product		607630	"""anterior pharynx defective 1 homolog B (C. elegans)"""			12110170, 11230166	Standard	NM_031301		Approved	PSFL, APH-1B, DKFZp564D0372	uc002ama.3	Q8WW43	OTTHUMG00000132863	ENST00000261879.5:c.211C>T	15.37:g.63571457C>T		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	14.0	NM_001145646	A8K589|Q564N3|Q6UWQ1|Q9H0S0	Silent	SNP	ENST00000261879.5	37	CCDS10184.1																																																																																			.		0.378	APH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256337.1	NM_031301	
ASH1L	55870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155448114	155448114	+	Missense_Mutation	SNP	C	C	G	rs370694359		TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:155448114C>G	ENST00000368346.3	-	3	5186	c.4547G>C	c.(4546-4548)cGc>cCc	p.R1516P	ASH1L_ENST00000392403.3_Missense_Mutation_p.R1516P			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1516					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AAATCTATAGCGCTTCAAAGA	0.473																																					p.R1516P		.											.	ASH1L	234	0			c.G4547C						.						116.0	110.0	112.0					1																	155448114		2203	4300	6503	SO:0001583	missense	55870	exon3			CTATAGCGCTTCA	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.4547G>C	1.37:g.155448114C>G	ENSP00000357330:p.Arg1516Pro	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	50.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	C	19.77	3.889713	0.72524	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.90004	-2.6;-2.6	5.44	5.44	0.79542	.	0.059137	0.64402	D	0.000004	D	0.87900	0.6294	N	0.14661	0.345	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.68943	0.916;0.961	D	0.89763	0.3948	10	0.59425	D	0.04	.	19.0495	0.93038	0.0:1.0:0.0:0.0	.	1516;1516	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	P	1516	ENSP00000357330:R1516P;ENSP00000376204:R1516P	ENSP00000357330:R1516P	R	-	2	0	ASH1L	153714738	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.155000	0.58131	2.832000	0.97577	0.655000	0.94253	CGC	.		0.473	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
ASXL3	80816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	31319755	31319755	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr18:31319755A>T	ENST00000269197.5	+	11	2387	c.2387A>T	c.(2386-2388)aAc>aTc	p.N796I		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	796					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CTGGGAGAGAACCTTACCTCC	0.478																																					p.N796I		.											.	ASXL3	49	0			c.A2387T						.						35.0	35.0	35.0					18																	31319755		1901	4127	6028	SO:0001583	missense	80816	exon11			GAGAGAACCTTAC	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2387A>T	18.37:g.31319755A>T	ENSP00000269197:p.Asn796Ile	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	17.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	A	9.442	1.088313	0.20390	.	.	ENSG00000141431	ENST00000269197	T	0.15487	2.42	6.04	0.701	0.18104	.	0.826812	0.11358	N	0.572259	T	0.10680	0.0261	N	0.14661	0.345	0.23396	N	0.997763	B	0.34103	0.437	B	0.32289	0.143	T	0.21965	-1.0230	10	0.51188	T	0.08	.	12.3714	0.55256	0.3687:0.0:0.6313:0.0	.	796	Q9C0F0	ASXL3_HUMAN	I	796	ENSP00000269197:N796I	ENSP00000269197:N796I	N	+	2	0	ASXL3	29573753	0.989000	0.36119	0.025000	0.17156	0.543000	0.35085	1.020000	0.30027	-0.151000	0.11176	0.460000	0.39030	AAC	.		0.478	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
C1orf106	55765	broad.mit.edu;bcgsc.ca	37	1	200870192	200870194	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	AGG	AGG	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:200870192_200870194delAGG	ENST00000367342.4	+	5	880_882	c.680_682delAGG	c.(679-684)caggag>cag	p.E229del	C1orf106_ENST00000413687.2_In_Frame_Del_p.E144del	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	229										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						TCCATGCTGCAGGAGGAGAAGAA	0.69																																					p.241_242del		.											.	C1orf106	93	0			c.722_724del						.																																			SO:0001651	inframe_deletion	55765	exon5			TGCTGCAGGAGGA	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.680_682delAGG	1.37:g.200870195_200870197delAGG	ENSP00000356311:p.Glu229del	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	7.0	NM_018265	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	In_Frame_Del	DEL	ENST00000367342.4	37																																																																																				.		0.690	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
C1QB	713	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22987600	22987600	+	Silent	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:22987600C>T	ENST00000314933.6	+	3	615	c.483C>T	c.(481-483)acC>acT	p.T161T	C1QB_ENST00000509305.1_Silent_p.T159T	NM_000491.3	NP_000482.3	P02746	C1QB_HUMAN	complement component 1, q subcomponent, B chain	161	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|inner ear development (GO:0048839)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|complement component C1 complex (GO:0005602)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(1)|lung(9)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.06e-27)|Colorectal(126;1.58e-07)|GBM - Glioblastoma multiforme(114;6.72e-06)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000551)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GCAAGTTCACCTGCAAGGTGC	0.597																																					p.T161T		.											.	C1QB	153	0			c.C483T						.						109.0	98.0	101.0					1																	22987600		2203	4300	6503	SO:0001819	synonymous_variant	713	exon3			GTTCACCTGCAAG	X03084	CCDS228.1	1p36.3-p34.1	2014-09-17	2006-02-09		ENSG00000173369	ENSG00000173369		"""Complement system"""	1242	protein-coding gene	gene with protein product		120570	"""complement component 1, q subcomponent, beta polypeptide"""			1537612	Standard	XM_005245982		Approved		uc001bgd.3	P02746	OTTHUMG00000002896	ENST00000314933.6:c.483C>T	1.37:g.22987600C>T		Somatic	121.0	1.0		WXS	Illumina HiSeq	Phase_I	157.0	72.0	NM_000491	Q5T959|Q96H17	Silent	SNP	ENST00000314933.6	37	CCDS228.1																																																																																			.		0.597	C1QB-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_000491	
C1orf87	127795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	60520924	60520924	+	Silent	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:60520924G>A	ENST00000371201.3	-	3	401	c.294C>T	c.(292-294)aaC>aaT	p.N98N	C1orf87_ENST00000450089.2_Silent_p.N98N	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	98							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GTAGTTTCTGGTTGTTTTCTG	0.388																																					p.N98N	NSCLC(75;811 1386 4923 13371 51772)	.											.	C1orf87	154	0			c.C294T						.						342.0	322.0	329.0					1																	60520924		2203	4300	6503	SO:0001819	synonymous_variant	127795	exon3			TTTCTGGTTGTTT	AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.294C>T	1.37:g.60520924G>A		Somatic	228.0	0.0		WXS	Illumina HiSeq	Phase_I	233.0	104.0	NM_152377	Q6ZU07|Q8IVS0	Silent	SNP	ENST00000371201.3	37	CCDS614.1																																																																																			.		0.388	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024943.1	NM_152377	
OSER1	51526	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	42826241	42826248	+	Frame_Shift_Del	DEL	GCTTTTGT	GCTTTTGT	-	rs142485619		TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	GCTTTTGT	GCTTTTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr20:42826241_42826248delGCTTTTGT	ENST00000372970.2	-	6	503_510	c.323_330delACAAAAGC	c.(322-330)cacaaaagcfs	p.HKS108fs	OSER1_ENST00000255174.2_Frame_Shift_Del_p.HKS108fs			Q9NX31	OSER1_HUMAN	oxidative stress responsive serine-rich 1	108					cellular response to hydrogen peroxide (GO:0070301)												AGTCAGTCTGGCTTTTGTGCTTGAGTTG	0.476																																					p.108_110del		.											.	C20orf111	90	0			c.323_330del						.																																			SO:0001589	frameshift_variant	51526	exon4			AGTCTGGCTTTTG	AL035447	CCDS13327.1	20q13.11	2013-05-17	2013-05-17	2013-05-17	ENSG00000132823	ENSG00000132823			16105	protein-coding gene	gene with protein product	"""peroxide-inducible transcript 1"", ""oxidative stress-responsive 1"""		"""chromosome 20 open reading frame 111"""	C20orf111		17148688	Standard	NM_016470		Approved	dJ1183I21.1, HSPC207, Perit1, Osr1		Q9NX31	OTTHUMG00000032518	ENST00000372970.2:c.323_330delACAAAAGC	20.37:g.42826241_42826248delGCTTTTGT	ENSP00000362061:p.His108fs	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	37.0	NM_016470	B2RCK4|O95912|Q9NZ84|Q9P0R8	Frame_Shift_Del	DEL	ENST00000372970.2	37	CCDS13327.1																																																																																			.		0.476	OSER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079334.2	NM_016470	
C4orf51	646603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	146648100	146648100	+	Silent	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr4:146648100A>G	ENST00000438731.1	+	3	345	c.345A>G	c.(343-345)tcA>tcG	p.S115S		NM_001080531.1	NP_001074000.1	C9J302	CD051_HUMAN	chromosome 4 open reading frame 51	115										haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	6						TTAAAAAGTCATTTGATGTCA	0.353																																					p.S115S		.											.	.	.	0			c.A345G						.						142.0	133.0	135.0					4																	146648100		1855	4110	5965	SO:0001819	synonymous_variant	646603	exon3			AAAGTCATTTGAT		CCDS47140.1	4q31.21	2009-09-09			ENSG00000237136	ENSG00000237136			37264	protein-coding gene	gene with protein product							Standard	NM_001080531		Approved		uc003ikk.3	C9J302	OTTHUMG00000161367	ENST00000438731.1:c.345A>G	4.37:g.146648100A>G		Somatic	260.0	0.0		WXS	Illumina HiSeq	Phase_I	510.0	139.0	NM_001080531		Silent	SNP	ENST00000438731.1	37	CCDS47140.1	.	.	.	.	.	.	.	.	.	.	A	10.95	1.495628	0.26774	.	.	ENSG00000237136	ENST00000511965	.	.	.	5.25	2.75	0.32379	.	.	.	.	.	T	0.25344	0.0616	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.18650	-1.0330	4	.	.	.	.	4.081	0.09925	0.7218:0.0:0.0963:0.1819	.	.	.	.	R	75	.	.	H	+	2	0	C4orf51	146867550	0.001000	0.12720	0.018000	0.16275	0.738000	0.42128	0.754000	0.26390	0.898000	0.36418	0.383000	0.25322	CAT	.		0.353	C4orf51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080531	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	181693632	181693632	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:181693632A>G	ENST00000367573.2	+	17	2101	c.2101A>G	c.(2101-2103)Atc>Gtc	p.I701V	CACNA1E_ENST00000367567.4_Missense_Mutation_p.I308V|CACNA1E_ENST00000367570.1_Missense_Mutation_p.I701V|CACNA1E_ENST00000526775.1_Missense_Mutation_p.I701V|CACNA1E_ENST00000357570.5_Missense_Mutation_p.I652V|CACNA1E_ENST00000360108.3_Missense_Mutation_p.I701V|CACNA1E_ENST00000358338.5_Missense_Mutation_p.I652V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	701					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GTTCTTGGCTATCGCTGTGGA	0.478																																					p.I701V		.											.	CACNA1E	95	0			c.A2101G						.						144.0	134.0	137.0					1																	181693632		1984	4175	6159	SO:0001583	missense	777	exon17			TTGGCTATCGCTG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2101A>G	1.37:g.181693632A>G	ENSP00000356545:p.Ile701Val	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	50.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.206634	0.39003	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97870	-4.58;-4.58;-4.58;-4.58;-4.58;-4.58;-4.58	4.86	4.86	0.63082	.	0.095951	0.64402	N	0.000001	D	0.97729	0.9255	L	0.48362	1.52	0.51012	D	0.999903	P;P	0.46327	0.876;0.876	D;D	0.64595	0.927;0.927	D	0.97408	1.0000	10	0.34782	T	0.22	.	14.4131	0.67128	1.0:0.0:0.0:0.0	.	701;701	Q15878-2;Q15878-3	.;.	V	701;701;652;652;308;701;701	ENSP00000356542:I701V;ENSP00000434814:I701V;ENSP00000350183:I652V;ENSP00000351101:I652V;ENSP00000356539:I308V;ENSP00000353222:I701V;ENSP00000356545:I701V	ENSP00000350183:I652V	I	+	1	0	CACNA1E	179960255	1.000000	0.71417	0.998000	0.56505	0.454000	0.32378	9.157000	0.94714	1.936000	0.56123	0.379000	0.24179	ATC	.		0.478	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CACNB4	785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152729009	152729009	+	Splice_Site	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:152729009T>C	ENST00000539935.1	-	6	589		c.e6-2		CACNB4_ENST00000427385.1_Splice_Site|CACNB4_ENST00000397327.2_Splice_Site|CACNB4_ENST00000534999.1_Splice_Site|CACNB4_ENST00000201943.5_Splice_Site|CACNB4_ENST00000360283.6_Splice_Site	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit						adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CTTGATTTCCTAGGATATAGA	0.388																																					.		.											.	CACNB4	24	0			c.522-2A>G						.						92.0	89.0	90.0					2																	152729009		1817	4081	5898	SO:0001630	splice_region_variant	785	exon7			ATTTCCTAGGATA	AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.522-2A>G	2.37:g.152729009T>C		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	41.0	NM_000726	A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Splice_Site	SNP	ENST00000539935.1	37	CCDS46426.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.654605	0.88056	.	.	ENSG00000182389	ENST00000539935;ENST00000360283;ENST00000543269;ENST00000439467;ENST00000534999;ENST00000397327;ENST00000427385;ENST00000201943;ENST00000339254	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4781	0.84144	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CACNB4	152437255	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.625000	0.83145	2.288000	0.76882	0.528000	0.53228	.	.		0.388	CACNB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338385.4	NM_000726.3	Intron
CCKAR	886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	26491839	26491839	+	Silent	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr4:26491839G>A	ENST00000295589.3	-	1	245	c.51C>T	c.(49-51)ccC>ccT	p.P17P		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	17					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	CGAGTTCACAGGGAGGAGTGA	0.488																																					p.P17P		.											.	CCKAR	523	0			c.C51T						.						127.0	104.0	112.0					4																	26491839		2203	4300	6503	SO:0001819	synonymous_variant	886	exon1			TTCACAGGGAGGA	L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.51C>T	4.37:g.26491839G>A		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	41.0	NM_000730	B2R9Z5	Silent	SNP	ENST00000295589.3	37	CCDS3438.1																																																																																			.		0.488	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2		
CCT2	10576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	69986800	69986800	+	Silent	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr12:69986800A>G	ENST00000299300.6	+	9	983	c.795A>G	c.(793-795)gcA>gcG	p.A265A	CCT2_ENST00000543146.2_Silent_p.A218A|CCT2_ENST00000544368.2_Silent_p.A265A	NM_006431.2	NP_006422.1	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2 (beta)	265					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(1)	24	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			CAAAGGTTGCAGAAATAGAAC	0.343																																					p.A265A		.											.	CCT2	651	0			c.A795G						.						85.0	86.0	86.0					12																	69986800		2203	4300	6503	SO:0001819	synonymous_variant	10576	exon9			GGTTGCAGAAATA	AF026293	CCDS8991.1, CCDS55843.1	12q14	2011-09-02						"""Heat Shock Proteins / Chaperonins"""	1615	protein-coding gene	gene with protein product		605139				9819444	Standard	NM_001198842		Approved	Cctb	uc001svb.1	P78371	OTTHUMG00000169383	ENST00000299300.6:c.795A>G	12.37:g.69986800A>G		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	26.0	NM_006431	A8K402|B5BTY7|B7Z243|B7Z7K4|B7ZAT2|Q14D36|Q6IAT3	Silent	SNP	ENST00000299300.6	37	CCDS8991.1																																																																																			.		0.343	CCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403818.1	NM_006431	
CDC42BPG	55561	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	64603631	64603631	+	Silent	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:64603631G>A	ENST00000342711.5	-	13	1625	c.1626C>T	c.(1624-1626)gcC>gcT	p.A542A		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						GGGAGCTCAGGGCCCGGGTCT	0.697											OREG0004017	type=REGULATORY REGION|Gene=CDC42BPG|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.A542A		.											.	CDC42BPG	528	0			c.C1626T						.						13.0	15.0	15.0					11																	64603631		2185	4278	6463	SO:0001819	synonymous_variant	55561	exon13			GCTCAGGGCCCGG	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.1626C>T	11.37:g.64603631G>A		Somatic	48.0	0.0	1077	WXS	Illumina HiSeq	Phase_I	51.0	18.0	NM_017525		Silent	SNP	ENST00000342711.5	37	CCDS31601.1																																																																																			.		0.697	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
CDH23	64072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73453964	73453964	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr10:73453964T>G	ENST00000224721.6	+	20	2257	c.2252T>G	c.(2251-2253)gTt>gGt	p.V751G	CDH23_ENST00000299366.7_Missense_Mutation_p.V791G	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	746	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						ATCCTCATCGTTCGCGCAGTG	0.632																																					p.V746G		.											.	CDH23	563	0			c.T2237G						.						70.0	87.0	82.0					10																	73453964		2080	4194	6274	SO:0001583	missense	64072	exon20			TCATCGTTCGCGC	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.2252T>G	10.37:g.73453964T>G	ENSP00000224721:p.Val751Gly	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	25.0	NM_001171931	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	T	19.66	3.868662	0.72065	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000299366;ENST00000224721;ENST00000442677	.	.	.	5.55	5.55	0.83447	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000003	D	0.88317	0.6404	H	0.97291	3.975	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.925;0.994	D	0.92445	0.5965	9	0.87932	D	0	.	15.7083	0.77602	0.0:0.0:0.0:1.0	.	746;749;746	Q6P152;G3XCN8;Q9H251	.;.;CAD23_HUMAN	G	751;746;746;749;749;263	.	ENSP00000224721:V751G	V	+	2	0	CDH23	73123970	1.000000	0.71417	0.718000	0.30602	0.224000	0.24922	8.008000	0.88588	2.119000	0.64992	0.523000	0.50628	GTT	.		0.632	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
CDH6	1004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	31323299	31323299	+	Silent	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:31323299C>T	ENST00000265071.2	+	12	2522	c.2257C>T	c.(2257-2259)Ctg>Ttg	p.L753L		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	753					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CCTGAGCTCGCTGGAGTCAGT	0.532																																					p.L753L		.											.	CDH6	159	0			c.C2257T						.						56.0	52.0	53.0					5																	31323299		2203	4300	6503	SO:0001819	synonymous_variant	1004	exon12			AGCTCGCTGGAGT	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2257C>T	5.37:g.31323299C>T		Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	73.0	NM_004932	A8K5H5|Q9BWS0	Silent	SNP	ENST00000265071.2	37	CCDS3894.1																																																																																			.		0.532	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	
CLCA4	22802	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	87040355	87040355	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:87040355G>A	ENST00000370563.3	+	10	1642	c.1600G>A	c.(1600-1602)Gat>Aat	p.D534N	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	534					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TTCTCTCTGGGATCCCAGTGG	0.433																																					p.D534N		.											.	CLCA4	92	0			c.G1600A						.						95.0	94.0	94.0					1																	87040355		1893	4109	6002	SO:0001583	missense	22802	exon10			CTCTGGGATCCCA	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.1600G>A	1.37:g.87040355G>A	ENSP00000359594:p.Asp534Asn	Somatic	198.0	2.0		WXS	Illumina HiSeq	Phase_I	239.0	96.0	NM_012128	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303888	0.81136	.	.	ENSG00000016602	ENST00000370563	T	0.34072	1.38	5.89	2.94	0.34122	Domain of unknown function DUF1973 (1);	0.254016	0.39210	N	0.001426	T	0.49064	0.1535	M	0.87827	2.91	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.76575	0.988;0.988	T	0.54050	-0.8351	10	0.87932	D	0	-18.3244	7.5127	0.27583	0.0664:0.1222:0.6844:0.127	.	86;534	Q9NXP1;Q14CN2	.;CLCA4_HUMAN	N	534	ENSP00000359594:D534N	ENSP00000359594:D534N	D	+	1	0	CLCA4	86812943	1.000000	0.71417	0.954000	0.39281	0.974000	0.67602	3.497000	0.53295	0.360000	0.24265	0.655000	0.94253	GAT	.		0.433	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	
CNTN5	53942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	99690405	99690405	+	Silent	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:99690405G>T	ENST00000524871.1	+	4	476	c.186G>T	c.(184-186)ctG>ctT	p.L62L	CNTN5_ENST00000528682.1_Silent_p.L62L|CNTN5_ENST00000527185.1_Silent_p.L62L|CNTN5_ENST00000279463.3_Silent_p.L62L|CNTN5_ENST00000418526.2_Intron	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	62					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TAGGAACACTGAGTGCTTCTT	0.428																																					p.L62L		.											.	CNTN5	366	0			c.G186T						.						97.0	97.0	97.0					11																	99690405		1918	4129	6047	SO:0001819	synonymous_variant	53942	exon3			AACACTGAGTGCT	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.186G>T	11.37:g.99690405G>T		Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	213.0	42.0	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	ENST00000524871.1	37	CCDS53696.1																																																																																			.		0.428	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
CNTNAP2	26047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	146536896	146536896	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr7:146536896A>T	ENST00000361727.3	+	3	818	c.302A>T	c.(301-303)cAa>cTa	p.Q101L		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	101	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ATTGCAACCCAAGGAAGGTAT	0.502										HNSCC(39;0.1)																											p.Q101L		.											.	CNTNAP2	100	0			c.A302T						.						102.0	89.0	94.0					7																	146536896		2203	4300	6503	SO:0001583	missense	26047	exon3			CAACCCAAGGAAG	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.302A>T	7.37:g.146536896A>T	ENSP00000354778:p.Gln101Leu	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	106.0	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.729716	0.89390	.	.	ENSG00000174469	ENST00000361727	D	0.97924	-4.61	5.83	5.83	0.93111	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.000000	0.53938	D	0.000050	D	0.99299	0.9755	H	0.98951	4.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98750	1.0720	10	0.52906	T	0.07	.	15.0243	0.71656	1.0:0.0:0.0:0.0	.	101	Q9UHC6	CNTP2_HUMAN	L	101	ENSP00000354778:Q101L	ENSP00000354778:Q101L	Q	+	2	0	CNTNAP2	146167829	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.339000	0.96797	2.227000	0.72691	0.528000	0.53228	CAA	.		0.502	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
COL9A2	1298	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	40770037	40770037	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:40770037delG	ENST00000372748.3	-	24	1338	c.1242delC	c.(1240-1242)cccfs	p.P414fs	COL9A2_ENST00000466267.1_5'UTR	NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	414	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			CTGGAATTCCGGGGGGGCCCT	0.602																																					p.P414fs		.											.	COL9A2	92	0			c.1242delC						.			22,11,4209		1,0,20,0,11,2089	22.0	25.0	24.0			5.5	1.0	1		23	14,41,8165		0,0,14,5,31,4060	no	codingComplex	COL9A2	NM_001852.3		1,0,34,5,42,6149	A1A1,A1A2,A1R,A2A2,A2R,RR		0.6691,0.7779,0.7061			40770037	36,52,12374	2193	4284	6477	SO:0001589	frameshift_variant	1298	exon24			AATTCCGGGGGGG	M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.1242delC	1.37:g.40770037delG	ENSP00000361834:p.Pro414fs	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	36.0	NM_001852	B2RMP9	Frame_Shift_Del	DEL	ENST00000372748.3	37	CCDS450.1																																																																																			.		0.602	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015764.3	NM_001852	
CPEB4	80315	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	173316743	173316743	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:173316743G>T	ENST00000265085.5	+	1	1461	c.7G>T	c.(7-9)Gat>Tat	p.D3Y	CPEB4_ENST00000520867.1_Missense_Mutation_p.D3Y|CPEB4_ENST00000519835.1_Missense_Mutation_p.D3Y|CPEB4_ENST00000334035.5_Missense_Mutation_p.D3Y	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	3					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATAAATGGGGGATTACGGGTT	0.408																																					p.D3Y		.											.	CPEB4	90	0			c.G7T						.						88.0	97.0	94.0					5																	173316743		2203	4300	6503	SO:0001583	missense	80315	exon1			ATGGGGGATTACG	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.7G>T	5.37:g.173316743G>T	ENSP00000265085:p.Asp3Tyr	Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	228.0	91.0	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	ENST00000265085.5	37	CCDS4390.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.472129	0.63737	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835	T;T;T;T	0.58797	0.46;0.34;0.42;0.31	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.67767	0.2928	L	0.27053	0.805	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.85130	0.993;0.997;0.993;0.995	T	0.71076	-0.4697	10	0.87932	D	0	-20.9008	19.6772	0.95941	0.0:0.0:1.0:0.0	.	3;3;3;3	B7ZLQ8;Q17RY0-2;E5RJM0;Q17RY0	.;.;.;CPEB4_HUMAN	Y	3	ENSP00000265085:D3Y;ENSP00000429092:D3Y;ENSP00000334533:D3Y;ENSP00000429048:D3Y	ENSP00000265085:D3Y	D	+	1	0	CPEB4	173249349	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.434000	0.97515	2.656000	0.90262	0.655000	0.94253	GAT	.		0.408	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
CROCC	9696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17248518	17248518	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:17248518G>A	ENST00000375541.5	+	1	74	c.5G>A	c.(4-6)aGc>aAc	p.S2N		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCCCCCATGAGCTTGGGGCTG	0.672																																					p.S2N		.											.	CROCC	137	0			c.G5A						.						8.0	8.0	8.0					1																	17248518		2127	4132	6259	SO:0001583	missense	9696	exon1			CCATGAGCTTGGG	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.5G>A	1.37:g.17248518G>A	ENSP00000364691:p.Ser2Asn	Somatic	215.0	0.0		WXS	Illumina HiSeq	Phase_I	224.0	45.0	NM_014675		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	9.949	1.219570	0.22373	.	.	ENSG00000058453	ENST00000375541	T	0.10477	2.87	4.53	-2.28	0.06826	.	.	.	.	.	T	0.07143	0.0181	L	0.29908	0.895	0.21861	N	0.999502	B	0.02656	0.0	B	0.06405	0.002	T	0.34700	-0.9818	9	0.66056	D	0.02	.	5.2082	0.15302	0.4783:0.15:0.3717:0.0	.	2	Q5TZA2	CROCC_HUMAN	N	2	ENSP00000364691:S2N	ENSP00000364691:S2N	S	+	2	0	CROCC	17121105	0.841000	0.29509	0.916000	0.36221	0.707000	0.40811	-0.126000	0.10563	-0.699000	0.05077	-0.218000	0.12543	AGC	.		0.672	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
CRB1	23418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197407733	197407733	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:197407733A>G	ENST00000367400.3	+	10	3941	c.3806A>G	c.(3805-3807)tAc>tGc	p.Y1269C	CRB1_ENST00000544212.1_Missense_Mutation_p.Y750C|CRB1_ENST00000535699.1_Missense_Mutation_p.Y1245C|CRB1_ENST00000367397.1_Missense_Mutation_p.Y650C|RP11-75C23.1_ENST00000422250.1_RNA|CRB1_ENST00000538660.1_Missense_Mutation_p.Y733C|CRB1_ENST00000367399.2_Missense_Mutation_p.Y1157C	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1269	EGF-like 18. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CTCACTTGCTACAATGGAGGC	0.443																																					p.Y1269C		.											.	CRB1	161	0			c.A3806G						.						104.0	101.0	102.0					1																	197407733		2203	4300	6503	SO:0001583	missense	23418	exon10			CTTGCTACAATGG		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.3806A>G	1.37:g.197407733A>G	ENSP00000356370:p.Tyr1269Cys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	42.0	NM_201253	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.679698	0.68042	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;D;T;D;D;D	0.91894	1.24;-2.93;1.24;-2.93;-2.93;-2.07	6.17	6.17	0.99709	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.95683	0.8596	M	0.81682	2.555	0.52501	D	0.999953	D;D;D;D;P	0.89917	0.998;1.0;1.0;0.999;0.618	P;D;D;D;B	0.91635	0.87;0.999;0.998;0.939;0.188	D	0.95029	0.8167	9	0.39692	T	0.17	.	12.9656	0.58481	0.879:0.0:0.0:0.121	.	733;1245;1157;918;1269	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	C	1245;733;1269;1157;750;650;918	ENSP00000438786:Y1245C;ENSP00000438091:Y733C;ENSP00000356370:Y1269C;ENSP00000356369:Y1157C;ENSP00000444556:Y750C;ENSP00000356367:Y650C	ENSP00000356367:Y650C	Y	+	2	0	CRB1	195674356	1.000000	0.71417	0.985000	0.45067	0.951000	0.60555	2.974000	0.49272	2.371000	0.80710	0.533000	0.62120	TAC	.		0.443	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113585851	113585851	+	Silent	SNP	T	T	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr8:113585851T>A	ENST00000297405.5	-	24	4165	c.3921A>T	c.(3919-3921)ctA>ctT	p.L1307L	CSMD3_ENST00000343508.3_Silent_p.L1267L|CSMD3_ENST00000352409.3_Silent_p.L1307L|CSMD3_ENST00000455883.2_Silent_p.L1203L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1307	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TAAAAGCACCTAGTAGATGAG	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.L1307L		.											.	CSMD3	1132	0			c.A3921T						.						113.0	112.0	112.0					8																	113585851		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon24			AGCACCTAGTAGA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3921A>T	8.37:g.113585851T>A		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	18.0	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																			.		0.333	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSNK1E	1454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	38690173	38690173	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr22:38690173T>C	ENST00000396832.1	-	9	1420	c.1160A>G	c.(1159-1161)aAc>aGc	p.N387S	CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000400206.2_Missense_Mutation_p.N387S|CSNK1E_ENST00000403904.1_Missense_Mutation_p.N387S|CSNK1E_ENST00000359867.3_Missense_Mutation_p.N387S	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	387					cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GGAGGAGACGTTGGCGGGCGC	0.647																																					p.N387S	Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	.											.	CSNK1E	1193	0			c.A1160G						.						35.0	36.0	35.0					22																	38690173		2202	4300	6502	SO:0001583	missense	1454	exon9			GAGACGTTGGCGG		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.1160A>G	22.37:g.38690173T>C	ENSP00000380044:p.Asn387Ser	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	25.0	NM_001894		Missense_Mutation	SNP	ENST00000396832.1	37	CCDS13970.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.87|19.87	3.906593|3.906593	0.72868|0.72868	.|.	.|.	ENSG00000213923|ENSG00000213923	ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904|ENST00000366216	T;T;T;T|.	0.54675|.	0.56;0.56;0.56;0.56|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.083044|.	0.85682|.	D|.	0.000000|.	T|T	0.54759|0.54759	0.1878|0.1878	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	P|.	0.42203|.	0.773|.	B|.	0.35931|.	0.214|.	T|T	0.51560|0.51560	-0.8690|-0.8690	10|5	0.07644|.	T|.	0.81|.	.|.	15.942|15.942	0.79763|0.79763	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	387|.	P49674|.	KC1E_HUMAN|.	S|A	387|90	ENSP00000352929:N387S;ENSP00000380044:N387S;ENSP00000383067:N387S;ENSP00000384074:N387S|.	ENSP00000352929:N387S|.	N|T	-|-	2|1	0|0	CSNK1E|CSNK1E	37020119|37020119	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.198000|0.198000	0.23893|0.23893	7.685000|7.685000	0.84117|0.84117	2.162000|2.162000	0.67917|0.67917	0.533000|0.533000	0.62120|0.62120	AAC|ACG	.		0.647	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	T	rs121913396|rs121913416		TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:41266098A>T	ENST00000349496.5	+	3	375	c.95A>T	c.(94-96)gAc>gTc	p.D32V	CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32V|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32V|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32V|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25V	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32V	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1	CTNNB1	24361	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95T						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>T	3.37:g.41266098A>T	ENSP00000344456:p.Asp32Val	Somatic	175.0	1.0		WXS	Illumina HiSeq	Phase_I	222.0	84.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184569	0.78677	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.74325	-0.3702	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	V	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25V;ENSP00000385604:D32V;ENSP00000412219:D32V;ENSP00000379486:D32V;ENSP00000344456:D32V;ENSP00000411226:D25V;ENSP00000379488:D32V;ENSP00000409302:D32V;ENSP00000401599:D32V	ENSP00000344456:D32V	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	16975121	16975121	+	Missense_Mutation	SNP	C	C	T	rs143400113	byFrequency	TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr10:16975121C>T	ENST00000377833.4	-	40	6154	c.6089G>A	c.(6088-6090)cGa>cAa	p.R2030Q		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2030	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGCACACGTTCGGTGAGATTC	0.443													C|||	5	0.000998403	0.0008	0.0	5008	,	,		20072	0.004		0.0	False		,,,				2504	0.0				p.R2030Q		.											.	CUBN	166	0			c.G6089A						.	C	GLN/ARG	4,4402	8.1+/-20.4	0,4,2199	137.0	121.0	126.0		6089	-10.0	0.0	10	dbSNP_134	126	0,8600		0,0,4300	yes	missense	CUBN	NM_001081.3	43	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign	2030/3624	16975121	4,13002	2203	4300	6503	SO:0001583	missense	8029	exon40			CACGTTCGGTGAG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6089G>A	10.37:g.16975121C>T	ENSP00000367064:p.Arg2030Gln	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	54.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	C	9.965	1.223840	0.22457	9.08E-4	0.0	ENSG00000107611	ENST00000377833	T	0.17528	2.27	5.85	-9.97	0.00440	CUB (5);	2.535090	0.01647	N	0.024355	T	0.02848	0.0085	N	0.02213	-0.635	0.09310	N	1	B	0.20671	0.047	B	0.10450	0.005	T	0.26710	-1.0095	10	0.10636	T	0.68	.	3.8008	0.08757	0.0895:0.3005:0.3821:0.2279	.	2030	O60494	CUBN_HUMAN	Q	2030	ENSP00000367064:R2030Q	ENSP00000367064:R2030Q	R	-	2	0	CUBN	17015127	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.232000	0.02936	-1.332000	0.02249	-0.211000	0.12701	CGA	C|0.999;T|0.001		0.443	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
CWF19L2	143884	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	107299752	107299752	+	Silent	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:107299752A>G	ENST00000282251.5	-	8	1233	c.1206T>C	c.(1204-1206)tgT>tgC	p.C402C	CWF19L2_ENST00000433523.1_Silent_p.C402C	NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	402							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		TAAAACCACTACACAAAGAGC	0.418																																					p.C402C		.											.	CWF19L2	68	0			c.T1206C						.						121.0	119.0	120.0					11																	107299752		2201	4297	6498	SO:0001819	synonymous_variant	143884	exon8			ACCACTACACAAA	AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.1206T>C	11.37:g.107299752A>G		Somatic	178.0	1.0		WXS	Illumina HiSeq	Phase_I	203.0	104.0	NM_152434	A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Silent	SNP	ENST00000282251.5	37	CCDS8336.2																																																																																			.		0.418	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328825.2	NM_152434	
CXorf36	79742	broad.mit.edu;ucsc.edu;mdanderson.org	37	X	45060068	45060068	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chrX:45060068C>A	ENST00000398000.2	-	1	78	c.4G>T	c.(4-6)Gag>Tag	p.E2*	CXorf36_ENST00000377934.4_Nonsense_Mutation_p.E2*|RP11-342D14.1_ENST00000450527.1_RNA|RP11-342D14.1_ENST00000438181.1_RNA	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	2						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						AGCTGGGGCTCCATCTTGGGC	0.667																																					p.E2X		.											.	CXorf36	130	0			c.G4T						.						9.0	9.0	9.0					X																	45060068		2162	4205	6367	SO:0001587	stop_gained	79742	exon1			GGGGCTCCATCTT	AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.4G>T	X.37:g.45060068C>A	ENSP00000381086:p.Glu2*	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	14.0	NM_176819	A8MUU5|B2RPN7|Q6UWJ5	Nonsense_Mutation	SNP	ENST00000398000.2	37	CCDS48096.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459999	0.84317	.	.	ENSG00000147113	ENST00000398000;ENST00000377934	.	.	.	5.33	4.46	0.54185	.	0.966277	0.08513	N	0.934596	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	11.4738	0.50286	0.0:0.9141:0.0:0.0859	.	.	.	.	X	2	.	ENSP00000367168:E2X	E	-	1	0	CXorf36	44945012	0.999000	0.42202	0.837000	0.33122	0.173000	0.22820	1.692000	0.37731	1.023000	0.39654	0.415000	0.27848	GAG	.		0.667	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2	NM_024689	
BRINP1	1620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	122011265	122011265	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr9:122011265G>C	ENST00000265922.3	-	3	843	c.382C>G	c.(382-384)Cac>Gac	p.H128D	BRINP1_ENST00000373964.2_Missense_Mutation_p.H128D	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	128	MACPF.				cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											ATGAGCAGGTGGGTGCCGTAC	0.557																																					p.H128D		.											.	DBC1	582	0			c.C382G						.						132.0	92.0	105.0					9																	122011265		2203	4300	6503	SO:0001583	missense	1620	exon3			GCAGGTGGGTGCC	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.382C>G	9.37:g.122011265G>C	ENSP00000265922:p.His128Asp	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	16.0	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868665	0.72065	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	D;D	0.95238	-3.65;-3.65	5.66	5.66	0.87406	Membrane attack complex component/perforin (MACPF) domain (2);	0.042512	0.85682	D	0.000000	D	0.96191	0.8758	L	0.45137	1.4	0.80722	D	1	D;D	0.62365	0.989;0.991	D;D	0.76071	0.978;0.987	D	0.95953	0.8956	10	0.56958	D	0.05	-33.0796	20.1076	0.97898	0.0:0.0:1.0:0.0	.	128;128	O60477-2;O60477	.;DBC1_HUMAN	D	128	ENSP00000265922:H128D;ENSP00000363075:H128D	ENSP00000265922:H128D	H	-	1	0	DBC1	121051086	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.823000	0.97156	0.650000	0.86243	CAC	.		0.557	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
DHCR7	1717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71146469	71146469	+	Silent	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:71146469C>T	ENST00000355527.3	-	9	1656	c.1380G>A	c.(1378-1380)gaG>gaA	p.E460E	DHCR7_ENST00000407721.2_Silent_p.E460E	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	460					blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)			endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						CGGTGTAGCGCTCCCAGTCCC	0.637									Smith-Lemli-Opitz syndrome																												p.E460E		.											.	DHCR7	228	0			c.G1380A						.						42.0	46.0	44.0					11																	71146469		2196	4289	6485	SO:0001819	synonymous_variant	1717	exon9	Familial Cancer Database	SLOS type I & II	GTAGCGCTCCCAG	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.1380G>A	11.37:g.71146469C>T		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	19.0	NM_001163817	B2R6Z2|O60492|O60717	Silent	SNP	ENST00000355527.3	37	CCDS8200.1																																																																																			.		0.637	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394243.1	NM_001360	
DOK1	1796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	74783058	74783058	+	Silent	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:74783058C>T	ENST00000233668.5	+	4	1161	c.492C>T	c.(490-492)gcC>gcT	p.A164A	LOXL3_ENST00000264094.3_5'Flank|M1AP_ENST00000464686.1_5'Flank|DOK1_ENST00000480318.1_3'UTR|LOXL3_ENST00000409986.1_5'Flank|DOK1_ENST00000340004.6_Intron|LOXL3_ENST00000409549.1_5'Flank|DOK1_ENST00000409429.1_Silent_p.A25A|LOXL3_ENST00000393937.2_5'Flank	NM_001381.3	NP_001372.1	Q99704	DOK1_HUMAN	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	164	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				cell surface receptor signaling pathway (GO:0007166)|insulin receptor signaling pathway (GO:0008286)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)			endometrium(3)|large_intestine(2)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						GGACTGAGGCCGCCGAGCGCT	0.637																																					p.A164A	Esophageal Squamous(36;520 860 12502 33616 51270)	.											.	DOK1	226	0			c.C492T						.						49.0	48.0	48.0					2																	74783058		2203	4299	6502	SO:0001819	synonymous_variant	1796	exon4			TGAGGCCGCCGAG	U70987	CCDS1954.1, CCDS56125.1	2p13	2008-05-21	2002-08-29		ENSG00000115325	ENSG00000115325			2990	protein-coding gene	gene with protein product		602919	"""docking protein 1, 62kD (downstream of tyrosine kinase 1)"""			9008160, 9790776, 15546884	Standard	NM_001381		Approved	p62dok	uc002sms.3	Q99704	OTTHUMG00000129956	ENST00000233668.5:c.492C>T	2.37:g.74783058C>T		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	36.0	NM_001381	O43204|Q53TY2|Q9UHG6	Silent	SNP	ENST00000233668.5	37	CCDS1954.1																																																																																			.		0.637	DOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252218.3	NM_001381	
DYNC2H1	79659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	103175403	103175403	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:103175403T>G	ENST00000375735.2	+	77	11480	c.11336T>G	c.(11335-11337)tTg>tGg	p.L3779W	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.L3786W|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3779	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGGCTCTGTTTGAAGAACTTA	0.373																																					p.L3786W		.											.	DYNC2H1	68	0			c.T11357G						.						95.0	95.0	95.0					11																	103175403		1877	4107	5984	SO:0001583	missense	79659	exon78			TCTGTTTGAAGAA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.11336T>G	11.37:g.103175403T>G	ENSP00000364887:p.Leu3779Trp	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	37.0	NM_001080463	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.450012	0.84101	.	.	ENSG00000187240	ENST00000375735;ENST00000398093;ENST00000540621	T;T	0.32023	1.47;1.47	5.37	5.37	0.77165	Dynein heavy chain (1);	0.000000	0.64402	D	0.000002	T	0.64616	0.2614	M	0.92169	3.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.74225	-0.3734	10	0.87932	D	0	.	14.242	0.65963	0.0:0.0:0.0:1.0	.	3779;3786	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	W	3779;3786;25	ENSP00000364887:L3779W;ENSP00000381167:L3786W	ENSP00000364887:L3779W	L	+	2	0	DYNC2H1	102680613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.772000	0.85439	2.170000	0.68504	0.533000	0.62120	TTG	.		0.373	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
ELP6	54859	broad.mit.edu;bcgsc.ca	37	3	47552690	47552690	+	Silent	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:47552690G>T	ENST00000296149.4	-	2	251	c.81C>A	c.(79-81)gcC>gcA	p.A27A	ELP6_ENST00000460502.1_5'Flank|ELP6_ENST00000446787.1_5'UTR|ELP6_ENST00000439305.1_5'UTR	NM_001031703.2	NP_001026873.2	Q0PNE2	ELP6_HUMAN	elongator acetyltransferase complex subunit 6	27					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Elongator holoenzyme complex (GO:0033588)											CATCTGTCTTGGCATCACAGA	0.433																																					p.A27A		.											.	.	.	0			c.C81A						.						105.0	99.0	101.0					3																	47552690		1874	4120	5994	SO:0001819	synonymous_variant	54859	exon2			TGTCTTGGCATCA	AK000218	CCDS43082.1	3p21.31	2012-08-14	2012-08-08	2012-08-08	ENSG00000163832	ENSG00000163832		"""Elongator acetyltransferase complex subunits"""	25976	protein-coding gene	gene with protein product		615020	"""transmembrane protein 103"", ""chromosome 3 open reading frame 75"""	TMEM103, C3orf75		22854966	Standard	XM_005265241		Approved	FLJ20211	uc003crk.3	Q0PNE2	OTTHUMG00000133521	ENST00000296149.4:c.81C>A	3.37:g.47552690G>T		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	6.0	NM_001031703	Q9BW57|Q9NXJ3	Silent	SNP	ENST00000296149.4	37	CCDS43082.1																																																																																			.		0.433	ELP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257493.1	NM_017713	
EMR3	84658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14740911	14740911	+	Silent	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr19:14740911G>T	ENST00000253673.5	-	14	1852	c.1752C>A	c.(1750-1752)acC>acA	p.T584T	EMR3_ENST00000599900.1_Silent_p.T369T|EMR3_ENST00000443157.2_Silent_p.T458T|EMR3_ENST00000344373.4_Silent_p.T532T	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	584					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						TGTTGATGATGGTGAAGAGGT	0.502																																					p.T584T		.											.	EMR3	528	0			c.C1752A						.						119.0	101.0	107.0					19																	14740911		2203	4300	6503	SO:0001819	synonymous_variant	84658	exon14			GATGATGGTGAAG	AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1752C>A	19.37:g.14740911G>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	34.0	NM_032571		Silent	SNP	ENST00000253673.5	37	CCDS12315.1																																																																																			.		0.502	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	NM_032571	
F10	2159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	113793724	113793724	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr13:113793724G>T	ENST00000375559.3	+	4	348	c.310G>T	c.(310-312)Ggc>Tgc	p.G104C	F10_ENST00000409306.1_Missense_Mutation_p.G104C|F10_ENST00000375551.3_Missense_Mutation_p.G104C	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	104	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	ATGTAAAGACGGCCTCGGGGA	0.498																																					p.G104C		.											.	F10	227	0			c.G310T						.						117.0	104.0	108.0					13																	113793724		2203	4300	6503	SO:0001583	missense	2159	exon4			AAAGACGGCCTCG		CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.310G>T	13.37:g.113793724G>T	ENSP00000364709:p.Gly104Cys	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	31.0	NM_000504	Q14340	Missense_Mutation	SNP	ENST00000375559.3	37	CCDS9530.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129585	0.37630	.	.	ENSG00000126218	ENST00000409306;ENST00000375551;ENST00000375559	D;D;D	0.99769	-6.7;-6.7;-6.7	5.63	4.79	0.61399	Gamma-carboxyglutamic acid-rich (GLA) domain (1);EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.112416	0.64402	D	0.000012	D	0.99832	0.9924	H	0.94306	3.52	0.42482	D	0.992868	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.96735	0.9542	10	0.87932	D	0	.	14.3883	0.66961	0.0714:0.0:0.9286:0.0	.	104;104;104	B7ZBK1;Q5JVE8;P00742	.;.;FA10_HUMAN	C	104	ENSP00000387092:G104C;ENSP00000364701:G104C;ENSP00000364709:G104C	ENSP00000364701:G104C	G	+	1	0	F10	112841725	0.786000	0.28738	0.049000	0.19019	0.012000	0.07955	1.767000	0.38501	1.381000	0.46364	0.655000	0.94253	GGC	.		0.498	F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045841.3		
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127626533	127626533	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:127626533C>A	ENST00000508053.1	-	56	7310	c.6336G>T	c.(6334-6336)aaG>aaT	p.K2112N	FBN2_ENST00000262464.4_Missense_Mutation_p.K2112N			P35556	FBN2_HUMAN	fibrillin 2	2112	TB 8.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GTACAGAACACTTTCCATTTT	0.433																																					p.K2112N		.											.	FBN2	146	0			c.G6336T						.						102.0	98.0	99.0					5																	127626533		2203	4300	6503	SO:0001583	missense	2201	exon50			AGAACACTTTCCA	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.6336G>T	5.37:g.127626533C>A	ENSP00000424571:p.Lys2112Asn	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	59.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	18.78	3.696964	0.68386	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.92911	-3.13;-3.13	5.01	2.26	0.28386	Matrix fibril-associated (3);TGF-beta binding (1);	0.091133	0.47455	D	0.000225	D	0.90424	0.7002	L	0.38531	1.155	0.34494	D	0.705247	D	0.59767	0.986	P	0.56563	0.801	D	0.89862	0.4017	10	0.38643	T	0.18	.	8.8514	0.35201	0.0:0.7095:0.0:0.2905	.	2112	P35556	FBN2_HUMAN	N	2112	ENSP00000262464:K2112N;ENSP00000424571:K2112N	ENSP00000262464:K2112N	K	-	3	2	FBN2	127654432	0.040000	0.19996	1.000000	0.80357	0.996000	0.88848	-0.531000	0.06171	0.391000	0.25143	0.655000	0.94253	AAG	.		0.433	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FAT2	2196	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	150946610	150946610	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:150946610A>G	ENST00000261800.5	-	1	1895	c.1883T>C	c.(1882-1884)cTt>cCt	p.L628P		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	628	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCAGCAGTAAGATTGATAAA	0.408																																					p.L628P		.											.	FAT2	96	0			c.T1883C						.						101.0	103.0	103.0					5																	150946610		2203	4300	6503	SO:0001583	missense	2196	exon1			GCAGTAAGATTGA	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1883T>C	5.37:g.150946610A>G	ENSP00000261800:p.Leu628Pro	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	21.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	A	1.508	-0.550230	0.03996	.	.	ENSG00000086570	ENST00000261800	T	0.75154	-0.91	5.53	-1.24	0.09435	Cadherin (4);Cadherin-like (1);	0.577513	0.16761	N	0.200601	T	0.51160	0.1658	N	0.24115	0.695	0.24546	N	0.994041	B	0.06786	0.001	B	0.09377	0.004	T	0.28038	-1.0056	10	0.36615	T	0.2	.	2.6154	0.04902	0.4649:0.2987:0.0787:0.1576	.	628	Q9NYQ8	FAT2_HUMAN	P	628	ENSP00000261800:L628P	ENSP00000261800:L628P	L	-	2	0	FAT2	150926803	0.009000	0.17119	0.007000	0.13788	0.408000	0.30992	-0.122000	0.10627	0.083000	0.17047	0.533000	0.62120	CTT	.		0.408	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
FCN1	2219	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	137801655	137801655	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr9:137801655G>A	ENST00000371806.3	-	9	1061	c.970C>T	c.(970-972)Cgg>Tgg	p.R324W		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	324	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.|P domain.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)			endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		TAGGCGGGCCGCACCTTCATC	0.592																																					p.R324W		.											.	FCN1	154	0			c.C970T						.						71.0	70.0	70.0					9																	137801655		2203	4300	6503	SO:0001583	missense	2219	exon9			CGGGCCGCACCTT	D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.970C>T	9.37:g.137801655G>A	ENSP00000360871:p.Arg324Trp	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	27.0	NM_002003	Q5VYV5|Q92596	Missense_Mutation	SNP	ENST00000371806.3	37	CCDS6985.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032366	0.54790	.	.	ENSG00000085265	ENST00000371806	T	0.81078	-1.45	3.2	2.17	0.27698	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);	.	.	.	.	D	0.93167	0.7824	H	0.99454	4.575	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	D	0.93121	0.6525	9	0.87932	D	0	.	9.2672	0.37647	0.0:0.0:0.7852:0.2148	.	324	O00602	FCN1_HUMAN	W	324	ENSP00000360871:R324W	ENSP00000360871:R324W	R	-	1	2	FCN1	136941476	0.960000	0.32886	0.985000	0.45067	0.516000	0.34256	1.843000	0.39259	1.771000	0.52183	0.643000	0.83706	CGG	.		0.592	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054963.1	NM_002003	
FHOD3	80206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	34289345	34289345	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr18:34289345A>T	ENST00000359247.4	+	14	1948	c.1948A>T	c.(1948-1950)Agg>Tgg	p.R650W	FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000590592.1_Missense_Mutation_p.R842W|FHOD3_ENST00000257209.4_Missense_Mutation_p.R667W|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000445677.1_Missense_Mutation_p.R629W	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	650					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CTCCAGGGACAGGACAACTGG	0.607																																					p.R667W		.											.	FHOD3	139	0			c.A1999T						.						51.0	37.0	42.0					18																	34289345		2202	4299	6501	SO:0001583	missense	80206	exon15			AGGGACAGGACAA	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1948A>T	18.37:g.34289345A>T	ENSP00000352186:p.Arg650Trp	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	65.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	A	17.23	3.337895	0.60963	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.32988	1.43;1.89;1.98	5.65	3.34	0.38264	.	0.798245	0.12292	N	0.481973	T	0.39118	0.1066	L	0.36672	1.1	0.28827	N	0.897373	P;D;P;P	0.69078	0.891;0.997;0.692;0.89	P;P;P;P	0.61477	0.46;0.889;0.46;0.502	T	0.19778	-1.0295	10	0.66056	D	0.02	.	7.5693	0.27898	0.7647:0.1594:0.076:0.0	.	629;650;667;842	Q2V2M9-2;Q2V2M9;Q2V2M9-3;E5F5Q0	.;FHOD3_HUMAN;.;.	W	667;650;629	ENSP00000257209:R667W;ENSP00000352186:R650W;ENSP00000411430:R629W	ENSP00000257209:R667W	R	+	1	2	FHOD3	32543343	1.000000	0.71417	0.940000	0.37924	0.358000	0.29455	5.655000	0.67981	0.592000	0.29728	0.533000	0.62120	AGG	.		0.607	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
FLNC	2318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	128486943	128486943	+	Silent	SNP	G	G	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr7:128486943G>C	ENST00000325888.8	+	24	4533	c.4272G>C	c.(4270-4272)ggG>ggC	p.G1424G	FLNC_ENST00000346177.6_Silent_p.G1424G	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1424					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TCACCTTCGGGGGGCGGCCCA	0.592																																					p.G1424G		.											.	FLNC	141	0			c.G4272C						.						63.0	65.0	65.0					7																	128486943		1984	4168	6152	SO:0001819	synonymous_variant	2318	exon24			CTTCGGGGGGCGG	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4272G>C	7.37:g.128486943G>C		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	87.0	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	CCDS43644.1																																																																																			.		0.592	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
FMO1	2326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	171251220	171251220	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:171251220G>T	ENST00000354841.4	+	6	1062	c.931G>T	c.(931-933)Gtc>Ttc	p.V311F	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Missense_Mutation_p.V248F|FMO1_ENST00000367750.3_Missense_Mutation_p.V311F	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	311					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GGAAAACTCTGTCATATTTAA	0.413																																					p.V311F		.											.	FMO1	515	0			c.G931T						.						116.0	109.0	111.0					1																	171251220		2203	4300	6503	SO:0001583	missense	2326	exon7			AACTCTGTCATAT	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.931G>T	1.37:g.171251220G>T	ENSP00000346901:p.Val311Phe	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	11.0	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.275737	0.59649	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.55588	0.51;0.51;0.51	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.75547	0.3864	M	0.88241	2.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.989;0.999;0.98	T	0.78735	-0.2088	10	0.87932	D	0	-13.1637	19.3467	0.94365	0.0:0.0:1.0:0.0	.	248;311;311	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	F	311;248;311	ENSP00000356724:V311F;ENSP00000385543:V248F;ENSP00000346901:V311F	ENSP00000346901:V311F	V	+	1	0	FMO1	169517844	1.000000	0.71417	0.196000	0.23383	0.051000	0.14879	9.428000	0.97476	2.868000	0.98415	0.557000	0.71058	GTC	.		0.413	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
GABRB1	2560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	47427952	47427952	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr4:47427952T>C	ENST00000295454.3	+	9	1634	c.1342T>C	c.(1342-1344)Tcc>Ccc	p.S448P	GABRB1_ENST00000538619.1_Missense_Mutation_p.S378P	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	448					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGATGTGAATTCCATAGACAA	0.527																																					p.S448P		.											.	GABRB1	92	0			c.T1342C						.						106.0	103.0	104.0					4																	47427952		2203	4300	6503	SO:0001583	missense	2560	exon9			GTGAATTCCATAG		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.1342T>C	4.37:g.47427952T>C	ENSP00000295454:p.Ser448Pro	Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	60.0	NM_000812	B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	ENST00000295454.3	37	CCDS3474.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.388430	0.42308	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	D;D	0.85773	-2.03;-2.03	5.34	5.34	0.76211	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.225184	0.39020	N	0.001491	T	0.75982	0.3924	L	0.29908	0.895	0.36066	D	0.84177	B;P	0.35821	0.282;0.523	B;B	0.37144	0.242;0.21	T	0.78894	-0.2024	10	0.40728	T	0.16	-20.1064	7.4507	0.27237	0.0:0.0737:0.1434:0.7829	.	378;448	F5GXV5;P18505	.;GBRB1_HUMAN	P	448;378	ENSP00000295454:S448P;ENSP00000440330:S378P	ENSP00000295454:S448P	S	+	1	0	GABRB1	47122709	0.993000	0.37304	0.969000	0.41365	0.990000	0.78478	2.157000	0.42320	2.244000	0.73946	0.528000	0.53228	TCC	.		0.527	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1		
FSTL5	56884	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	162307497	162307497	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr4:162307497G>A	ENST00000306100.5	-	16	2382	c.1946C>T	c.(1945-1947)cCt>cTt	p.P649L	RP11-234O6.2_ENST00000508189.1_RNA|FSTL5_ENST00000536695.1_Missense_Mutation_p.P648L|FSTL5_ENST00000379164.4_Missense_Mutation_p.P648L|FSTL5_ENST00000427802.2_Missense_Mutation_p.P639L	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	649						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.P649L(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CAATGACTGAGGAACGCACTT	0.428																																					p.P649L		.											.	FSTL5	158	1	Substitution - Missense(1)	endometrium(1)	c.C1946T						.						92.0	84.0	86.0					4																	162307497		2203	4300	6503	SO:0001583	missense	56884	exon16			GACTGAGGAACGC	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1946C>T	4.37:g.162307497G>A	ENSP00000305334:p.Pro649Leu	Somatic	99.0	1.0		WXS	Illumina HiSeq	Phase_I	180.0	40.0	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195721	0.58126	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.53	5.53	0.82687	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61413	0.2345	M	0.83223	2.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.66221	-0.5978	10	0.87932	D	0	.	18.4642	0.90749	0.0:0.0:1.0:0.0	.	639;648;649	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	L	649;648;639;648	ENSP00000305334:P649L;ENSP00000368462:P648L;ENSP00000389270:P639L;ENSP00000440409:P648L	ENSP00000305334:P649L	P	-	2	0	FSTL5	162526947	1.000000	0.71417	0.080000	0.20451	0.362000	0.29581	9.315000	0.96313	2.616000	0.88540	0.563000	0.77884	CCT	.		0.428	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
GLRA2	2742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	14550361	14550361	+	Splice_Site	SNP	G	G	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chrX:14550361G>C	ENST00000218075.4	+	2	599	c.69G>C	c.(67-69)agG>agC	p.R23S	GLRA2_ENST00000443437.2_5'UTR|GLRA2_ENST00000355020.4_Splice_Site_p.R23S	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	23					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	ATGTGTTTAGGACGGCTTTCT	0.393																																					p.R23S		.											.	GLRA2	131	0			c.G69C						.						133.0	115.0	121.0					X																	14550361		2203	4300	6503	SO:0001630	splice_region_variant	2742	exon3			GTTTAGGACGGCT		CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.69-1G>C	X.37:g.14550361G>C		Somatic	175.0	1.0		WXS	Illumina HiSeq	Phase_I	193.0	171.0	NM_001118885	A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	ENST00000218075.4	37	CCDS14160.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.20|12.20	1.865642|1.865642	0.32977|0.32977	.|.	.|.	ENSG00000101958|ENSG00000101958	ENST00000415367|ENST00000218075;ENST00000355020	T|T;T	0.54071|0.79454	0.59|-1.27;-1.27	4.87|4.87	4.87|4.87	0.63330|0.63330	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.58878|0.58878	0.2153|0.2153	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B|B;B	0.12630|0.25048	0.006|0.117;0.035	B|B;B	0.17722|0.16722	0.019|0.005;0.016	T|T	0.56703|0.56703	-0.7935|-0.7935	8|9	.|.	.|.	.|.	.|.	16.3031|16.3031	0.82832|0.82832	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	7|23;23	B7Z4E9|P23416;P23416-2	.|GLRA2_HUMAN;.	I|S	7|23	ENSP00000391606:M7I|ENSP00000218075:R23S;ENSP00000347123:R23S	.|.	M|R	+|+	3|3	0|2	GLRA2|GLRA2	14460282|14460282	1.000000|1.000000	0.71417|0.71417	0.916000|0.916000	0.36221|0.36221	0.653000|0.653000	0.38743|0.38743	5.348000|5.348000	0.66004|0.66004	2.134000|2.134000	0.65973|0.65973	0.594000|0.594000	0.82650|0.82650	ATG|AGG	.		0.393	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055829.1		Missense_Mutation
GLRB	2743	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	158043481	158043481	+	Splice_Site	SNP	G	G	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr4:158043481G>C	ENST00000264428.4	+	4	499		c.e4-1		GLRB_ENST00000512619.1_Intron|GLRB_ENST00000541722.1_Splice_Site|GLRB_ENST00000509282.1_Splice_Site	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta						acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)			central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	TTTATTCATAGGCATTCCTGT	0.244																																					.		.											.	GLRB	92	0			c.230-1G>C						.						29.0	34.0	32.0					4																	158043481		2166	4251	6417	SO:0001630	splice_region_variant	2743	exon4			TTCATAGGCATTC	U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.230-1G>C	4.37:g.158043481G>C		Somatic	362.0	1.0		WXS	Illumina HiSeq	Phase_I	602.0	142.0	NM_001166061	A8K3K2|D3DP23|F5GWE1	Splice_Site	SNP	ENST00000264428.4	37	CCDS3796.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255353	0.80135	.	.	ENSG00000109738	ENST00000264428;ENST00000541722;ENST00000509282	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4613	0.94918	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GLRB	158262931	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	7.226000	0.78060	2.677000	0.91161	0.557000	0.71058	.	.		0.244	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	Intron
HDAC3	8841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	141008783	141008783	+	Silent	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:141008783C>T	ENST00000305264.3	-	7	646	c.567G>A	c.(565-567)acG>acA	p.T189T	AC008781.7_ENST00000422040.2_RNA	NM_003883.3	NP_003874.2	O15379	HDAC3_HUMAN	histone deacetylase 3	189	Histone deacetylase.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|protein deacetylation (GO:0006476)|regulation of mitotic cell cycle (GO:0007346)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|cyclin binding (GO:0030332)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Vorinostat(DB02546)	GGAAGGACACCGTCATGACCC	0.498																																					p.T189T		.											.	HDAC3	227	0			c.G567A						.						125.0	107.0	113.0					5																	141008783		2203	4300	6503	SO:0001819	synonymous_variant	8841	exon7			GGACACCGTCATG	AF059650	CCDS4264.1	5q31.1-q31.2	2008-07-18			ENSG00000171720	ENSG00000171720	3.5.1.98		4854	protein-coding gene	gene with protein product		605166				9501169, 9464271	Standard	NM_003883		Approved	RPD3, HD3, RPD3-2	uc003llf.2	O15379	OTTHUMG00000129629	ENST00000305264.3:c.567G>A	5.37:g.141008783C>T		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	52.0	NM_003883	D3DQE1|O43268|Q9UEI5|Q9UEV0	Silent	SNP	ENST00000305264.3	37	CCDS4264.1																																																																																			.		0.498	HDAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251824.2	NM_003883	
HNF4A	3172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43036067	43036067	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr20:43036067C>T	ENST00000316099.4	+	3	426	c.337C>T	c.(337-339)Cgc>Tgc	p.R113C	MIR3646_ENST00000578301.1_RNA|HNF4A_ENST00000316673.4_Missense_Mutation_p.R91C|HNF4A_ENST00000415691.2_Missense_Mutation_p.R113C|HNF4A_ENST00000443598.2_Missense_Mutation_p.R113C|HNF4A_ENST00000609795.1_Missense_Mutation_p.R91C|HNF4A_ENST00000457232.1_Missense_Mutation_p.R91C	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	113					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GAACCAGTGCCGCTACTGCAG	0.597																																					p.R113C	Colon(79;2 1269 8820 14841 52347)	.											.	HNF4A	227	0			c.C337T						.						77.0	64.0	68.0					20																	43036067		2203	4300	6503	SO:0001583	missense	3172	exon3			CAGTGCCGCTACT	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.337C>T	20.37:g.43036067C>T	ENSP00000312987:p.Arg113Cys	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	31.0	NM_178849	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	ENST00000316099.4	37	CCDS13330.1	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848147	0.71603	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.96967	-4.19;-4.19;-4.19;-4.19;-4.19	5.69	2.7	0.31948	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.152113	0.64402	N	0.000012	D	0.97999	0.9341	M	0.93678	3.445	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0;1.0;1.0	D	0.96230	0.9167	10	0.87932	D	0	.	4.812	0.13347	0.1246:0.6224:0.1204:0.1326	.	106;113;113;113;91;91;91	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	C	91;91;113;113;143;113	ENSP00000315180:R91C;ENSP00000396216:R91C;ENSP00000312987:R113C;ENSP00000410911:R113C;ENSP00000412111:R113C	ENSP00000312987:R113C	R	+	1	0	HNF4A	42469481	0.981000	0.34729	0.987000	0.45799	0.984000	0.73092	1.393000	0.34497	0.336000	0.23639	-0.163000	0.13421	CGC	.		0.597	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3		
HOMER1	9456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	78734957	78734957	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:78734957C>A	ENST00000334082.6	-	5	1845	c.403G>T	c.(403-405)Gat>Tat	p.D135Y	HOMER1_ENST00000535690.1_Intron|HOMER1_ENST00000282260.6_Intron|HOMER1_ENST00000508576.1_Missense_Mutation_p.D135Y	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	135					behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		GACTGAAGATCCCCGCCTGCG	0.423																																					p.W135W		.											.	HOMER1	90	0			c.T403T						.						113.0	107.0	109.0					5																	78734957		1839	4092	5931	SO:0001583	missense	9456	exon5			GAAGATCCCCGCC	BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.403G>T	5.37:g.78734957C>A	ENSP00000334382:p.Asp135Tyr	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	57.0	NM_004272	B2R688|O96003|Q86YM5	Silent	SNP	ENST00000334082.6	37	CCDS43335.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.148204	0.57151	.	.	ENSG00000152413	ENST00000334082;ENST00000508576	T;T	0.47177	2.17;0.85	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	L	0.38175	1.15	0.80722	D	1	B;P	0.49253	0.113;0.921	B;B	0.35727	0.056;0.209	T	0.44421	-0.9329	10	0.59425	D	0.04	-8.716	19.3022	0.94148	0.0:1.0:0.0:0.0	.	135;135	Q86YM7-3;Q86YM7	.;HOME1_HUMAN	Y	135	ENSP00000334382:D135Y;ENSP00000426651:D135Y	ENSP00000334382:D135Y	D	-	1	0	HOMER1	78770713	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.114000	0.77103	2.552000	0.86080	0.585000	0.79938	GAT	.		0.423	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258856.1	NM_004272	
HYDIN	54768	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70841914	70841914	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr16:70841914C>A	ENST00000393567.2	-	86	15085	c.14935G>T	c.(14935-14937)Ggc>Tgc	p.G4979C		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4979					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCTCCCTGGCCTCCTGGGGCT	0.542																																					p.G4979C		.											.	HYDIN	92	0			c.G14935T						.						60.0	62.0	62.0					16																	70841914		1983	4149	6132	SO:0001583	missense	54768	exon86			CCTGGCCTCCTGG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.14935G>T	16.37:g.70841914C>A	ENSP00000377197:p.Gly4979Cys	Somatic	93.0	1.0		WXS	Illumina HiSeq	Phase_I	122.0	62.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	8.065	0.768926	0.15983	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00882	5.58	5.91	1.46	0.22682	.	1.281640	0.06374	U	0.714130	T	0.00875	0.0029	N	0.17082	0.46	0.09310	N	0.999994	B	0.29646	0.253	B	0.26614	0.071	T	0.50154	-0.8861	10	0.37606	T	0.19	.	8.6968	0.34301	0.6057:0.3187:0.0:0.0756	.	4978	F8WD23	.	C	4979;4978	ENSP00000377197:G4979C	ENSP00000313052:G4978C	G	-	1	0	HYDIN	69399415	0.014000	0.17966	0.947000	0.38551	0.526000	0.34562	0.623000	0.24447	0.361000	0.24292	0.655000	0.94253	GGC	.		0.542	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
IARS2	55699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220276901	220276901	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:220276901T>A	ENST00000302637.5	+	8	1167	c.1063T>A	c.(1063-1065)Tca>Aca	p.S355T	IARS2_ENST00000366922.1_Missense_Mutation_p.S283T	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	355					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TTCAACACTTTCAGGTGAAGA	0.363																																					p.S355T		.											.	IARS2	94	0			c.T1063A						.						82.0	83.0	82.0					1																	220276901		2203	4300	6503	SO:0001583	missense	55699	exon8			ACACTTTCAGGTG	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.1063T>A	1.37:g.220276901T>A	ENSP00000303279:p.Ser355Thr	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	20.0	NM_018060	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Missense_Mutation	SNP	ENST00000302637.5	37	CCDS1523.1	.	.	.	.	.	.	.	.	.	.	T	10.92	1.488146	0.26686	.	.	ENSG00000067704	ENST00000366922;ENST00000302637	T;T	0.35236	1.32;1.32	5.38	0.163	0.14986	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.602172	0.17646	N	0.166847	T	0.15998	0.0385	N	0.13352	0.335	0.45183	D	0.998194	B	0.10296	0.003	B	0.15052	0.012	T	0.10965	-1.0607	10	0.49607	T	0.09	-14.5012	0.5971	0.00738	0.2461:0.2539:0.1158:0.3843	.	355	Q9NSE4	SYIM_HUMAN	T	283;355	ENSP00000355889:S283T;ENSP00000303279:S355T	ENSP00000303279:S355T	S	+	1	0	IARS2	218343524	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	0.641000	0.24720	0.049000	0.15920	0.533000	0.62120	TCA	.		0.363	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
IBTK	25998	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	82912269	82912269	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr6:82912269delT	ENST00000306270.7	-	18	3254	c.2705delA	c.(2704-2706)aatfs	p.N902fs	IBTK_ENST00000503631.1_Frame_Shift_Del_p.N701fs|IBTK_ENST00000510291.1_Frame_Shift_Del_p.N902fs	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	902					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		AGCTGCCATATTCAATCCTAT	0.338																																					p.N902fs		.											.	IBTK	92	0			c.2705delA						.						133.0	137.0	135.0					6																	82912269		2203	4300	6503	SO:0001589	frameshift_variant	25998	exon18			GCCATATTCAATC	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.2705delA	6.37:g.82912269delT	ENSP00000305721:p.Asn902fs	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	107.0	NM_015525	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Frame_Shift_Del	DEL	ENST00000306270.7	37	CCDS34490.1																																																																																			.		0.338	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
IFNA4	3441	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	21187461	21187461	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr9:21187461A>G	ENST00000421715.1	-	1	137	c.70T>C	c.(70-72)Tgt>Cgt	p.C24R		NM_021068.2	NP_066546.1	P05014	IFNA4_HUMAN	interferon, alpha 4	24					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GGCAGATCACAGCCCAGAGAA	0.502																																					p.C24R	NSCLC(154;890 1986 23660 27800 51138)	.											.	IFNA4	92	0			c.T70C						.						30.0	33.0	32.0					9																	21187461		2202	4274	6476	SO:0001583	missense	3441	exon1			GATCACAGCCCAG		CCDS6498.1	9p22	2010-08-24			ENSG00000236637	ENSG00000236637		"""Interferons"""	5425	protein-coding gene	gene with protein product		147564				1385305	Standard	NM_021068		Approved	MGC142200, IFN-alpha4a	uc003zon.2	P05014	OTTHUMG00000019660	ENST00000421715.1:c.70T>C	9.37:g.21187461A>G	ENSP00000412897:p.Cys24Arg	Somatic	304.0	0.0		WXS	Illumina HiSeq	Phase_I	370.0	160.0	NM_021068	P13358|Q14CS4|Q5VV15	Missense_Mutation	SNP	ENST00000421715.1	37	CCDS6498.1	.	.	.	.	.	.	.	.	.	.	-	15.62	2.887285	0.52014	.	.	ENSG00000236637	ENST00000421715	T	0.05996	3.36	2.96	2.96	0.34315	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.000000	0.85682	D	0.000000	T	0.26231	0.0640	M	0.89840	3.065	0.46044	D	0.998833	D	0.89917	1.0	D	0.70227	0.968	T	0.04065	-1.0980	10	0.87932	D	0	.	8.99	0.36017	1.0:0.0:0.0:0.0	.	24	P05014	IFNA4_HUMAN	R	24	ENSP00000412897:C24R	ENSP00000412897:C24R	C	-	1	0	IFNA4	21177461	0.032000	0.19561	0.068000	0.19968	0.426000	0.31534	1.990000	0.40717	1.352000	0.45808	0.397000	0.26171	TGT	.		0.502	IFNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051889.1	NM_021068	
ILVBL	10994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15233713	15233713	+	Silent	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr19:15233713C>A	ENST00000263383.3	-	5	733	c.594G>T	c.(592-594)tcG>tcT	p.S198S	ILVBL_ENST00000531635.1_5'UTR|ILVBL_ENST00000534378.1_Silent_p.S91S|AC003956.1_ENST00000598450.1_RNA	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	198						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)			NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						CTGGGGTGCCCGACTGGGCGG	0.642																																					p.S198S		.											.	ILVBL	92	0			c.G594T						.						57.0	59.0	58.0					19																	15233713		2203	4300	6503	SO:0001819	synonymous_variant	10994	exon5			GGTGCCCGACTGG	U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.594G>T	19.37:g.15233713C>A		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	16.0	NM_006844	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Silent	SNP	ENST00000263383.3	37	CCDS12325.1																																																																																			C|1.000;T|0.000		0.642	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385439.1	NM_006844	
IRX4	50805	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	1878852	1878852	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:1878852T>C	ENST00000505790.1	-	6	1247	c.791A>G	c.(790-792)gAc>gGc	p.D264G	IRX4_ENST00000513692.1_Missense_Mutation_p.D264G|IRX4_ENST00000231357.2_Missense_Mutation_p.D264G|IRX4_ENST00000505938.1_5'Flank	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	264					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		TTCCAGCGGGTCGAAGTCGTC	0.687																																					p.D264G		.											.	IRX4	226	0			c.A791G						.						30.0	32.0	31.0					5																	1878852		2203	4300	6503	SO:0001583	missense	50805	exon5			AGCGGGTCGAAGT	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.791A>G	5.37:g.1878852T>C	ENSP00000423161:p.Asp264Gly	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	193.0	80.0	NM_016358	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Missense_Mutation	SNP	ENST00000505790.1	37	CCDS3867.1	.	.	.	.	.	.	.	.	.	.	t	15.82	2.946878	0.53186	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692	T;T;T	0.69175	-0.38;-0.38;-0.38	3.75	3.75	0.43078	.	0.198676	0.41605	U	0.000858	T	0.60327	0.2260	L	0.61218	1.895	0.58432	D	0.99999	P	0.46987	0.888	B	0.39465	0.3	T	0.61676	-0.7014	10	0.30854	T	0.27	-33.5842	12.3115	0.54931	0.0:0.0:0.0:1.0	.	264	P78413	IRX4_HUMAN	G	264	ENSP00000231357:D264G;ENSP00000423161:D264G;ENSP00000424235:D264G	ENSP00000231357:D264G	D	-	2	0	IRX4	1931852	1.000000	0.71417	0.886000	0.34754	0.138000	0.21146	4.084000	0.57650	1.563000	0.49615	0.370000	0.22315	GAC	.		0.687	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
ITIH4	3700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52860642	52860642	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:52860642T>C	ENST00000266041.4	-	5	641	c.545A>G	c.(544-546)cAg>cGg	p.Q182R	ITIH4_ENST00000485816.1_Missense_Mutation_p.Q182R|RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4_ENST00000434759.3_Missense_Mutation_p.Q94R|ITIH4_ENST00000406595.1_Missense_Mutation_p.Q182R|ITIH4_ENST00000346281.5_Missense_Mutation_p.Q182R|ITIH4-AS1_ENST00000478366.1_RNA|ITIH4_ENST00000467462.1_5'Flank	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	182					acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GCTGATGCCCTGGGGCTCGAA	0.592																																					p.Q182R		.											.	ITIH4	46	0			c.A545G						.						89.0	82.0	84.0					3																	52860642		2203	4300	6503	SO:0001583	missense	3700	exon5			ATGCCCTGGGGCT	D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.545A>G	3.37:g.52860642T>C	ENSP00000266041:p.Gln182Arg	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	32.0	NM_001166449	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	ENST00000266041.4	37	CCDS2865.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.210740	0.79240	.	.	ENSG00000055955	ENST00000266041;ENST00000346281;ENST00000485816;ENST00000406595;ENST00000538421;ENST00000434759	T;T;T;T;T	0.03094	4.81;4.79;4.83;4.86;4.05	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000006	T	0.13713	0.0332	M	0.65677	2.01	0.80722	D	1	P;D;D;P	0.62365	0.864;0.991;0.991;0.559	B;P;P;P	0.58970	0.327;0.849;0.804;0.533	T	0.00234	-1.1893	10	0.72032	D	0.01	-24.8528	14.8606	0.70379	0.0:0.0:0.0:1.0	.	182;182;182;182	E9PGN5;B7ZKJ8;Q14624;Q14624-2	.;.;ITIH4_HUMAN;.	R	182;182;182;182;170;94	ENSP00000266041:Q182R;ENSP00000340520:Q182R;ENSP00000417824:Q182R;ENSP00000384425:Q182R;ENSP00000440036:Q94R	ENSP00000266041:Q182R	Q	-	2	0	ITIH4	52835682	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.394000	0.52551	1.997000	0.58415	0.533000	0.62120	CAG	.		0.592	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218	
JAG1	182	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	10654131	10654131	+	Silent	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr20:10654131G>T	ENST00000254958.5	-	1	563	c.48C>A	c.(46-48)ctC>ctA	p.L16L	RP11-103J8.1_ENST00000605292.1_RNA	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	16					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						GGGCGAGCAGGAGGCTTAGGG	0.771									Alagille Syndrome																												p.L16L		.											.	JAG1	1273	0			c.C48A						.						9.0	10.0	10.0					20																	10654131		1687	3222	4909	SO:0001819	synonymous_variant	182	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GAGCAGGAGGCTT	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.48C>A	20.37:g.10654131G>T		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	26.0	NM_000214	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Silent	SNP	ENST00000254958.5	37	CCDS13112.1																																																																																			.		0.771	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
KCNA4	3739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	30032269	30032269	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:30032269C>A	ENST00000328224.6	-	2	3190	c.1957G>T	c.(1957-1959)Gtg>Ttg	p.V653L	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	653					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	AAGATTCACACATCAGTCTCC	0.433																																					p.V653L		.											.	KCNA4	517	0			c.G1957T						.						75.0	81.0	79.0					11																	30032269		1974	4148	6122	SO:0001583	missense	3739	exon2			TTCACACATCAGT	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1957G>T	11.37:g.30032269C>A	ENSP00000328511:p.Val653Leu	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	50.0	NM_002233		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283161	0.80803	.	.	ENSG00000182255	ENST00000328224	D	0.97731	-4.51	5.7	5.7	0.88788	.	0.484707	0.21100	N	0.080165	D	0.96185	0.8756	L	0.42529	1.33	0.80722	D	1	B	0.15719	0.014	B	0.12837	0.008	D	0.92603	0.6093	10	0.87932	D	0	.	19.8411	0.96685	0.0:1.0:0.0:0.0	.	653	P22459	KCNA4_HUMAN	L	653	ENSP00000328511:V653L	ENSP00000328511:V653L	V	-	1	0	KCNA4	29988845	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.818000	0.86416	2.683000	0.91414	0.655000	0.94253	GTG	.		0.433	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
KCNK6	9424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38818018	38818018	+	Missense_Mutation	SNP	C	C	T	rs371433357		TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr19:38818018C>T	ENST00000263372.3	+	3	1024	c.917C>T	c.(916-918)aCc>aTc	p.T306I		NM_004823.1	NP_004814.1	Q9Y257	KCNK6_HUMAN	potassium channel, subfamily K, member 6	306					negative regulation of systemic arterial blood pressure (GO:0003085)|potassium ion transport (GO:0006813)|regulation of resting membrane potential (GO:0060075)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)	17	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)	AGCTCCCACACCGACTACGCT	0.662																																					p.T306I		.											.	KCNK6	91	0			c.C917T						.	C	ILE/THR	0,4406		0,0,2203	44.0	44.0	44.0		917	2.0	0.0	19		44	1,8599	1.2+/-3.3	0,1,4299	no	missense	KCNK6	NM_004823.1	89	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	306/314	38818018	1,13005	2203	4300	6503	SO:0001583	missense	9424	exon3			CCCACACCGACTA	AF117708	CCDS12513.1	19q13.1	2012-03-07				ENSG00000099337		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6281	protein-coding gene	gene with protein product		603939				10075682, 10393428, 16382106	Standard	NM_004823		Approved	K2p6.1, TWIK-2	uc002oic.3	Q9Y257		ENST00000263372.3:c.917C>T	19.37:g.38818018C>T	ENSP00000263372:p.Thr306Ile	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	21.0	NM_004823	Q9HB47	Missense_Mutation	SNP	ENST00000263372.3	37	CCDS12513.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.546587	0.45383	0.0	1.16E-4	ENSG00000099337	ENST00000263372	T	0.23348	1.91	5.36	1.99	0.26369	.	1.362410	0.04438	N	0.370303	T	0.24470	0.0593	L	0.40543	1.245	0.09310	N	1	B	0.26845	0.161	B	0.29176	0.099	T	0.33007	-0.9885	10	0.62326	D	0.03	.	6.2581	0.20885	0.1493:0.6874:0.0:0.1634	.	306	Q9Y257	KCNK6_HUMAN	I	306	ENSP00000263372:T306I	ENSP00000263372:T306I	T	+	2	0	KCNK6	43509858	0.000000	0.05858	0.000000	0.03702	0.203000	0.24098	0.485000	0.22324	0.238000	0.21222	0.561000	0.74099	ACC	.		0.662	KCNK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460524.1	NM_004823	
KCTD20	222658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	36442832	36442832	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr6:36442832C>G	ENST00000373731.2	+	3	818	c.427C>G	c.(427-429)Ctg>Gtg	p.L143V	KCTD20_ENST00000544295.1_Intron|KCTD20_ENST00000474988.1_Intron|KCTD20_ENST00000449081.2_Intron|KCTD20_ENST00000536244.1_Intron	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	143	BTB.				protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						GGATACCATGCTGGGAAGGTA	0.368																																					p.L143V		.											.	KCTD20	92	0			c.C427G						.						103.0	100.0	101.0					6																	36442832		2203	4300	6503	SO:0001583	missense	222658	exon3			ACCATGCTGGGAA	BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.427C>G	6.37:g.36442832C>G	ENSP00000362836:p.Leu143Val	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	74.0	NM_173562	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Missense_Mutation	SNP	ENST00000373731.2	37	CCDS4821.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.562852	0.65538	.	.	ENSG00000112078	ENST00000373731	D	0.86497	-2.13	5.16	-0.292	0.12839	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.53938	D	0.000044	D	0.92008	0.7468	M	0.92555	3.32	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.91501	0.5219	10	0.87932	D	0	-11.0887	10.1399	0.42730	0.0:0.3762:0.0:0.6238	.	143	Q7Z5Y7	KCD20_HUMAN	V	143	ENSP00000362836:L143V	ENSP00000362836:L143V	L	+	1	2	KCTD20	36550810	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	1.002000	0.29796	-0.129000	0.11620	-0.290000	0.09829	CTG	.		0.368	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562	
KRT33B	3884	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39521232	39521232	+	Missense_Mutation	SNP	G	G	A	rs199838257		TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:39521232G>A	ENST00000251646.3	-	6	945	c.896C>T	c.(895-897)aCg>aTg	p.T299M		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	299	Coil 2.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				CTCTGTCAGCGTGTTTTCCAG	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		17796	0.001		0.0	False		,,,				2504	0.0				p.T299M		.											.	KRT33B	90	0			c.C896T						.						42.0	49.0	46.0					17																	39521232		2190	4300	6490	SO:0001583	missense	3884	exon6			GTCAGCGTGTTTT	X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.896C>T	17.37:g.39521232G>A	ENSP00000251646:p.Thr299Met	Somatic	87.0	1.0		WXS	Illumina HiSeq	Phase_I	132.0	72.0	NM_002279	O76010	Missense_Mutation	SNP	ENST00000251646.3	37	CCDS11389.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	21.0	4.081066	0.76528	.	.	ENSG00000131738	ENST00000251646	D	0.89415	-2.51	4.85	4.85	0.62838	Filament (1);	0.000000	0.64402	D	0.000003	D	0.91841	0.7418	M	0.86864	2.845	0.34814	D	0.738018	P	0.46784	0.884	P	0.45195	0.473	D	0.96218	0.9158	10	0.87932	D	0	.	17.494	0.87712	0.0:0.0:1.0:0.0	.	299	Q14525	KT33B_HUMAN	M	299	ENSP00000251646:T299M	ENSP00000251646:T299M	T	-	2	0	KRT33B	36774758	0.820000	0.29190	1.000000	0.80357	0.990000	0.78478	2.146000	0.42216	2.666000	0.90696	0.650000	0.86243	ACG	G|0.999;A|0.000		0.567	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257292.1	NM_002279	
ZNRF1	84937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	75147448	75147448	+	IGR	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr16:75147448C>A	ENST00000335325.4	+	0	4620				LDHD_ENST00000300051.4_Silent_p.T380T|RP11-252E2.1_ENST00000499110.1_RNA|LDHD_ENST00000450168.2_Silent_p.T357T	NM_032268.4	NP_115644.1	Q8ND25	ZNRF1_HUMAN	zinc and ring finger 1, E3 ubiquitin protein ligase						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)	1						AGCCTGGCCGCGTGGCCAGGG	0.652																																					p.T380T		.											.	LDHD	90	0			c.G1140T						.						17.0	20.0	19.0					16																	75147448		2188	4274	6462	SO:0001628	intergenic_variant	197257	exon8			TGGCCGCGTGGCC	AF378524	CCDS10912.1	16q22.3	2013-01-09	2012-02-23		ENSG00000186187	ENSG00000186187		"""RING-type (C3HC4) zinc fingers"""	18452	protein-coding gene	gene with protein product		612060	"""zinc and ring finger 1"""				Standard	NM_032268		Approved	nin283, FLJ14846, DKFZp434E229	uc002fdl.1	Q8ND25	OTTHUMG00000137606		16.37:g.75147448C>A		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	31.0	NM_153486	D3DUJ9|Q9H083	Silent	SNP	ENST00000335325.4	37	CCDS10912.1																																																																																			.		0.652	ZNRF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269020.2		
ELMOD1	55531	broad.mit.edu;mdanderson.org	37	11	107462580	107462580	+	Intron	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:107462580C>T	ENST00000265840.7	+	1	180				ELMOD1_ENST00000531234.1_Intron|AP000889.3_ENST00000600612.1_Silent_p.L33L|ELMOD1_ENST00000443271.2_Intron|ELMOD1_ENST00000529675.1_3'UTR	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1						phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		CAGGGAGGAGCTAGGCAGCCG	0.711																																					.		.											.	.	.	0			.						.						11.0	14.0	13.0					11																	107462580		1852	4025	5877	SO:0001627	intron_variant	0	.			GAGGAGCTAGGCA	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.-86+445C>T	11.37:g.107462580C>T		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	40.0	.	B4E167|G5E9S5|Q9NPW3	RNA	SNP	ENST00000265840.7	37	CCDS44723.1																																																																																			.		0.711	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389406.1	NM_018712	
LRP1B	53353	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141707938	141707938	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:141707938C>A	ENST00000389484.3	-	20	3973	c.3002G>T	c.(3001-3003)gGc>gTc	p.G1001V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1001	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTGAACACAGCCCACCTCATC	0.463										TSP Lung(27;0.18)																											p.G1001V	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.G3002T						.						120.0	84.0	96.0					2																	141707938		2203	4300	6503	SO:0001583	missense	53353	exon20			ACACAGCCCACCT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3002G>T	2.37:g.141707938C>A	ENSP00000374135:p.Gly1001Val	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	60.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	33	5.251997	0.95336	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.95447	-3.71;-3.71	5.8	5.8	0.92144	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	U	0.000000	D	0.97598	0.9213	M	0.81682	2.555	0.80722	D	1	D;D	0.63880	0.972;0.993	P;D	0.65233	0.864;0.933	D	0.96765	0.9564	10	0.39692	T	0.17	.	20.0693	0.97712	0.0:1.0:0.0:0.0	.	184;1001	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	V	1001;939;146	ENSP00000374135:G1001V;ENSP00000413239:G146V	ENSP00000374135:G1001V	G	-	2	0	LRP1B	141424408	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.017000	0.57167	2.758000	0.94735	0.563000	0.77884	GGC	.		0.463	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRP4	4038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	46912023	46912023	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:46912023C>T	ENST00000378623.1	-	14	1962	c.1720G>A	c.(1720-1722)Ggc>Agc	p.G574S		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	574					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		GGGGTGTTGCCCCAGTCTGTC	0.527											OREG0020948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G574S		.											.	LRP4	94	0			c.G1720A						.						34.0	34.0	34.0					11																	46912023		2201	4299	6500	SO:0001583	missense	4038	exon14			TGTTGCCCCAGTC	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.1720G>A	11.37:g.46912023C>T	ENSP00000367888:p.Gly574Ser	Somatic	67.0	0.0	942	WXS	Illumina HiSeq	Phase_I	62.0	33.0	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	C	35	5.536369	0.96460	.	.	ENSG00000134569	ENST00000378623	D	0.95103	-3.61	5.73	5.73	0.89815	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.97005	0.9022	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96677	0.9501	10	0.59425	D	0.04	.	20.2602	0.98440	0.0:1.0:0.0:0.0	.	574	O75096	LRP4_HUMAN	S	574	ENSP00000367888:G574S	ENSP00000367888:G574S	G	-	1	0	LRP4	46868599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.861000	0.98227	0.655000	0.94253	GGC	.		0.527	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
LSR	51599	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	35740010	35740010	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr19:35740010C>T	ENST00000361790.3	+	1	388	c.229C>T	c.(229-231)Ctt>Ttt	p.L77F	LSR_ENST00000427250.1_Missense_Mutation_p.L29F|LSR_ENST00000597933.1_Intron|LSR_ENST00000360798.3_Missense_Mutation_p.L77F|LSR_ENST00000347609.4_Intron|AC002128.5_ENST00000604161.1_RNA|LSR_ENST00000354900.3_Missense_Mutation_p.L77F|LSR_ENST00000602122.1_Missense_Mutation_p.L77F	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	77					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTTCGTGTGGCTTCTGCTTAG	0.716																																					p.L77F		.											.	LSR	90	0			c.C229T						.						3.0	4.0	3.0					19																	35740010		1895	3662	5557	SO:0001583	missense	51599	exon1			GTGTGGCTTCTGC	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.229C>T	19.37:g.35740010C>T	ENSP00000354575:p.Leu77Phe	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	31.0	NM_205834	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	ENST00000361790.3	37	CCDS12450.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.425959	0.83667	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000427250	T;T;T;T	0.69175	0.17;0.26;-0.11;-0.38	3.39	3.39	0.38822	.	0.334023	0.27289	N	0.020043	T	0.65719	0.2718	L	0.54323	1.7	0.24268	N	0.995256	P;P;P;P;D	0.61697	0.938;0.925;0.892;0.877;0.99	P;P;P;B;P	0.49528	0.614;0.571;0.447;0.368;0.614	T	0.60052	-0.7338	10	0.52906	T	0.07	-24.1551	10.5643	0.45163	0.0:1.0:0.0:0.0	.	34;77;77;77;77	Q9BT33;Q86X29-3;A6NDW3;E9PHD4;Q86X29	.;.;.;.;LSR_HUMAN	F	77;77;77;29	ENSP00000354575:L77F;ENSP00000346976:L77F;ENSP00000354034:L77F;ENSP00000394479:L29F	ENSP00000346976:L77F	L	+	1	0	LSR	40431850	0.975000	0.34042	0.862000	0.33874	0.180000	0.23129	1.152000	0.31663	2.200000	0.70718	0.491000	0.48974	CTT	.		0.716	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	NM_015925	
LTK	4058	broad.mit.edu;mdanderson.org	37	15	41803628	41803628	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr15:41803628C>G	ENST00000263800.6	-	6	902	c.806G>C	c.(805-807)gGg>gCg	p.G269A	LTK_ENST00000453182.2_Missense_Mutation_p.G269A|LTK_ENST00000561619.1_Intron|LTK_ENST00000355166.5_Missense_Mutation_p.G269A	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	269					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		ACCTGCCGCCCCGCCTCTCCC	0.766										TSP Lung(18;0.14)																											p.G269A		.											.	LTK	1377	0			c.G806C						.																																			SO:0001583	missense	4058	exon6			GCCGCCCCGCCTC	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.806G>C	15.37:g.41803628C>G	ENSP00000263800:p.Gly269Ala	Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	9.0	NM_001135685	A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	ENST00000263800.6	37	CCDS10077.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.288915	0.59976	.	.	ENSG00000062524	ENST00000360087;ENST00000355166;ENST00000263800;ENST00000453182	T;T;T	0.60920	0.15;0.15;0.15	4.15	2.24	0.28232	.	.	.	.	.	T	0.66867	0.2833	L	0.49699	1.58	0.26009	N	0.982018	D;D;D	0.76494	0.996;0.995;0.999	P;P;D	0.78314	0.894;0.83;0.991	T	0.54193	-0.8330	9	0.59425	D	0.04	.	8.3504	0.32299	0.0:0.8012:0.0:0.1988	.	269;269;269	E9PFX4;P29376-4;P29376	.;.;LTK_HUMAN	A	269	ENSP00000347293:G269A;ENSP00000263800:G269A;ENSP00000392196:G269A	ENSP00000263800:G269A	G	-	2	0	LTK	39590920	0.628000	0.27138	0.959000	0.39883	0.486000	0.33341	2.284000	0.43478	0.731000	0.32448	0.555000	0.69702	GGG	.		0.766	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		
LYG2	254773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	99861785	99861785	+	Silent	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:99861785A>G	ENST00000409238.1	-	3	341	c.321T>C	c.(319-321)caT>caC	p.H107H	LYG2_ENST00000333017.2_Silent_p.H107H|LYG2_ENST00000409679.1_Silent_p.H107H|LYG2_ENST00000423800.1_Silent_p.H107H			Q86SG7	LYG2_HUMAN	lysozyme G-like 2	107					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|stomach(1)	12						CAGATCCGCCATGGCTTTCCC	0.522																																					p.H107H		.											.	LYG2	91	0			c.T321C						.						112.0	102.0	106.0					2																	99861785		2203	4300	6503	SO:0001819	synonymous_variant	254773	exon4			TCCGCCATGGCTT	AF323919	CCDS2042.1	2q11.2	2008-02-05			ENSG00000185674	ENSG00000185674			29615	protein-coding gene	gene with protein product						8889548, 12574869	Standard	NM_175735		Approved	LYGH	uc002szw.1	Q86SG7	OTTHUMG00000130643	ENST00000409238.1:c.321T>C	2.37:g.99861785A>G		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	38.0	NM_175735	Q496G2|Q53RW0	Silent	SNP	ENST00000409238.1	37	CCDS2042.1																																																																																			.		0.522	LYG2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330307.1	NM_175735	
MAK	4117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	10784806	10784806	+	Splice_Site	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr6:10784806C>A	ENST00000313243.2	-	11	1699		c.e11-1		MAK_ENST00000538030.1_Splice_Site|RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000354489.2_Splice_Site|MAK_ENST00000474039.1_Splice_Site|SYCP2L_ENST00000543878.1_Intron			P20794	MAK_HUMAN	male germ cell-associated kinase						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				CTCTGGAAGCCTTGAAAGCCA	0.512																																					.		.											.	MAK	335	0			c.1317-1G>T						.						105.0	97.0	100.0					6																	10784806		2203	4300	6503	SO:0001630	splice_region_variant	4117	exon12			GGAAGCCTTGAAA		CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.1317-1G>T	6.37:g.10784806C>A		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	67.0	NM_005906	F1T0K6|G1FL29|Q547D0|Q9NUH7	Splice_Site	SNP	ENST00000313243.2	37	CCDS4516.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673631	0.47781	.	.	ENSG00000111837	ENST00000313243;ENST00000354489	.	.	.	5.27	3.28	0.37604	.	.	.	.	.	.	.	.	.	.	.	0.21290	N	0.99974	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4613	0.55733	0.2652:0.7348:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAK	10892792	1.000000	0.71417	0.815000	0.32552	0.439000	0.31926	4.233000	0.58651	2.472000	0.83506	0.563000	0.77884	.	.		0.512	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039841.1	NM_005906	Intron
MIR891B	100126304	broad.mit.edu;ucsc.edu;mdanderson.org	37	X	145082629	145082629	+	RNA	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chrX:145082629G>T	ENST00000401245.1	-	0	20					NR_030590.1				microRNA 891b																		CAATGACTCAGGTAAGTTGCA	0.353																																					.		.											.	.	.	0			.						.						159.0	123.0	134.0					X																	145082629		1568	3582	5150			100126304	.			GACTCAGGTAAGT			Xq27.3	2011-09-12		2008-12-18	ENSG00000216064	ENSG00000216064		"""ncRNAs / Micro RNAs"""	33645	non-coding RNA	RNA, micro				MIRN891B			Standard	NR_030590		Approved	hsa-mir-891b	uc022cfs.1				X.37:g.145082629G>T		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	56.0	.		RNA	SNP	ENST00000401245.1	37																																																																																				.		0.353	MIR891B-201	KNOWN	basic	miRNA	miRNA		NR_030590	
KMT2B	9757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	36221665	36221665	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr19:36221665C>A	ENST00000222270.7	+	26	5334	c.5334C>A	c.(5332-5334)tgC>tgA	p.C1778*	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Nonsense_Mutation_p.C1778*	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1778	FYR N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00875}.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GGTATCGGTGCCGAATTCTGG	0.607																																					p.C1778X		.											.	MLL4	697	0			c.C5334A						.						45.0	51.0	49.0					19																	36221665		2038	4195	6233	SO:0001587	stop_gained	8085	exon26			TCGGTGCCGAATT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.5334C>A	19.37:g.36221665C>A	ENSP00000222270:p.Cys1778*	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	32.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Nonsense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	44	11.157437	0.99524	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	5.97	3.8	0.43715	.	0.000000	0.49305	D	0.000157	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7366	0.40392	0.0:0.7683:0.0:0.2317	.	.	.	.	X	1778	.	ENSP00000222270:C1778X	C	+	3	2	AD000671.1	40913505	0.999000	0.42202	0.977000	0.42913	0.999000	0.98932	0.952000	0.29149	0.807000	0.34208	0.655000	0.94253	TGC	.		0.607	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
MNAT1	4331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	61275080	61275080	+	Silent	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr14:61275080C>T	ENST00000261245.4	+	4	455	c.354C>T	c.(352-354)acC>acT	p.T118T	MNAT1_ENST00000539616.2_Silent_p.T118T	NM_002431.3	NP_002422.1	P51948	MAT1_HUMAN	MNAT CDK-activating kinase assembly factor 1	118					7-methylguanosine mRNA capping (GO:0006370)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to calcium ion (GO:0051592)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|ventricular system development (GO:0021591)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		TGGACAACACCAAAAAGAAAA	0.289								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																													p.T118T		.											.	MNAT1	523	0			c.C354T						.						52.0	50.0	51.0					14																	61275080		2203	4297	6500	SO:0001819	synonymous_variant	4331	exon4			CAACACCAAAAAG	X87843	CCDS9750.1, CCDS53899.1	14q23	2013-07-31	2013-07-31		ENSG00000020426	ENSG00000020426		"""RING-type (C3HC4) zinc fingers"", ""General transcription factor IIH complex subunits"""	7181	protein-coding gene	gene with protein product	"""CDK-activating kinase assembly factor"""	602659	"""menage a trois 1 (CAK assembly factor)"", ""menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)"""			9465303	Standard	NM_002431		Approved	MAT1, RNF66	uc001xfd.3	P51948	OTTHUMG00000152340	ENST00000261245.4:c.354C>T	14.37:g.61275080C>T		Somatic	442.0	1.0		WXS	Illumina HiSeq	Phase_I	475.0	231.0	NM_001177963	G3V1U8|Q15817|Q6ICQ7	Silent	SNP	ENST00000261245.4	37	CCDS9750.1																																																																																			.		0.289	MNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276956.1	NM_002431	
MOB3B	79817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	27330605	27330605	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr9:27330605T>C	ENST00000262244.5	-	4	1055	c.631A>G	c.(631-633)Acg>Gcg	p.T211A		NM_024761.4	NP_079037.3	Q86TA1	MOB3B_HUMAN	MOB kinase activator 3B	211							metal ion binding (GO:0046872)										ATCCTGCTCGTCATTTCTTTC	0.502																																					p.T211A		.											.	.	.	0			c.A631G						.						113.0	96.0	102.0					9																	27330605		2203	4300	6503	SO:0001583	missense	79817	exon4			TGCTCGTCATTTC	AK023266	CCDS6520.1	9p21.1	2012-07-05	2011-09-28	2011-09-28	ENSG00000120162	ENSG00000120162		"""MOB kinase activators"""	23825	protein-coding gene	gene with protein product	"""monopolar spindle 1 binding, MOB1, domain containing"""		"""MOB1, Mps One Binder kinase activator-like 2B (yeast)"", ""chromosome 9 open reading frame 35"""	MOBKL2B, C9orf35		12477932	Standard	NM_024761		Approved	MOB1D, FLJ13204	uc003zqn.3	Q86TA1	OTTHUMG00000019717	ENST00000262244.5:c.631A>G	9.37:g.27330605T>C	ENSP00000262244:p.Thr211Ala	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	54.0	NM_024761	Q8NEB4|Q9H8V4	Missense_Mutation	SNP	ENST00000262244.5	37	CCDS6520.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.573057	0.45902	.	.	ENSG00000120162	ENST00000262244	.	.	.	5.45	5.45	0.79879	.	0.393532	0.23120	N	0.051709	T	0.54046	0.1834	L	0.45285	1.41	0.46586	D	0.999111	B	0.14438	0.01	B	0.12156	0.007	T	0.51426	-0.8707	9	0.42905	T	0.14	-5.7892	11.912	0.52745	0.0:0.0:0.0:1.0	.	211	Q86TA1	MOB3B_HUMAN	A	211	.	ENSP00000262244:T211A	T	-	1	0	MOBKL2B	27320605	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.198000	0.58419	2.062000	0.61559	0.533000	0.62120	ACG	.		0.502	MOB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051974.2	NM_024761	
MRC2	9902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	60767109	60767109	+	Silent	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:60767109G>A	ENST00000303375.5	+	24	3963	c.3561G>A	c.(3559-3561)ctG>ctA	p.L1187L	MRC2_ENST00000580916.1_Intron|MRC2_ENST00000446119.2_Intron	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1187	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						GGATTGGGCTGGCTGGCGAGG	0.706																																					p.L1187L		.											.	MRC2	117	0			c.G3561A						.						8.0	8.0	8.0					17																	60767109		2179	4277	6456	SO:0001819	synonymous_variant	9902	exon24			TGGGCTGGCTGGC	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3561G>A	17.37:g.60767109G>A		Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	17.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Silent	SNP	ENST00000303375.5	37	CCDS11634.1																																																																																			.		0.706	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
MUC5B	727897	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1267649	1267649	+	Missense_Mutation	SNP	C	C	T	rs369158178		TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:1267649C>T	ENST00000529681.1	+	31	9597	c.9539C>T	c.(9538-9540)aCg>aTg	p.T3180M	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.T3183M	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3180	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCGGATCCACGGCCACCGCC	0.687													c|||	1	0.000199681	0.0	0.0	5008	,	,		16818	0.0		0.001	False		,,,				2504	0.0				p.T3180M		.											.	.	.	0			c.C9539T						.						72.0	95.0	87.0					11																	1267649		2099	4193	6292	SO:0001583	missense	727897	exon31			GATCCACGGCCAC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9539C>T	11.37:g.1267649C>T	ENSP00000436812:p.Thr3180Met	Somatic	207.0	1.0		WXS	Illumina HiSeq	Phase_I	239.0	42.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	c	0.848	-0.739697	0.03088	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000538459	T;T	0.20332	2.08;2.26	1.81	-3.63	0.04529	.	.	.	.	.	T	0.19127	0.0459	L	0.55990	1.75	0.09310	N	1	D;D	0.67145	0.987;0.996	P;P	0.48030	0.467;0.564	T	0.09314	-1.0680	9	0.87932	D	0	.	0.575	0.00702	0.2558:0.3132:0.2203:0.2106	.	3763;3183	A7Y9J9;E9PBJ0	.;.	M	3180;3183;3152;3140;68	ENSP00000436812:T3180M;ENSP00000415793:T3183M	ENSP00000343037:T3152M	T	+	2	0	MUC5B	1224225	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.544000	0.06077	-3.223000	0.00211	0.121000	0.15741	ACG	.		0.687	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MYH13	8735	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	10223741	10223741	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:10223741C>T	ENST00000418404.3	-	24	3347	c.3184G>A	c.(3184-3186)Gat>Aat	p.D1062N	MYH13_ENST00000252172.4_Missense_Mutation_p.D1062N|RP11-401O9.3_ENST00000577743.1_RNA|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1062					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						ATTTTCAGATCTCCTTCCAGC	0.423																																					p.D1062N		.											.	MYH13	6	0			c.G3184A						.						81.0	79.0	79.0					17																	10223741		1882	4099	5981	SO:0001583	missense	8735	exon25			TCAGATCTCCTTC	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.3184G>A	17.37:g.10223741C>T	ENSP00000404570:p.Asp1062Asn	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	69.0	NM_003802	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.796779	0.90453	.	.	ENSG00000006788	ENST00000252172	D	0.93019	-3.15	3.78	3.78	0.43462	.	.	.	.	.	D	0.97420	0.9156	M	0.93594	3.435	0.46478	D	0.999066	D	0.76494	0.999	D	0.97110	1.0	D	0.98400	1.0567	9	0.62326	D	0.03	.	16.1667	0.81768	0.0:1.0:0.0:0.0	.	1062	Q9UKX3	MYH13_HUMAN	N	1062	ENSP00000252172:D1062N	ENSP00000252172:D1062N	D	-	1	0	MYH13	10164466	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.495000	0.81514	2.102000	0.63906	0.655000	0.94253	GAT	.		0.423	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
MYH3	4621	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	10549294	10549294	+	Silent	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:10549294C>T	ENST00000583535.1	-	11	1041	c.954G>A	c.(952-954)gaG>gaA	p.E318E	MYH3_ENST00000226209.7_Silent_p.E318E	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	318	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CCACCAGGATCTCCCCCTGGC	0.517											OREG0024181	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E318E		.											.	MYH3	95	0			c.G954A						.						133.0	123.0	126.0					17																	10549294		2203	4300	6503	SO:0001819	synonymous_variant	4621	exon11			CAGGATCTCCCCC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.954G>A	17.37:g.10549294C>T		Somatic	211.0	0.0	665	WXS	Illumina HiSeq	Phase_I	189.0	11.0	NM_002470	Q15492	Silent	SNP	ENST00000583535.1	37	CCDS11157.1																																																																																			.		0.517	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
MYT1L	23040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	1915791	1915791	+	Splice_Site	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:1915791C>A	ENST00000399161.2	-	12	2457		c.e12+1		MYT1L_ENST00000428368.2_Splice_Site	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCGTGGCTTACCTTCGGTGGG	0.632																																					.		.											.	MYT1L	95	0			c.1703+1G>T						.						37.0	41.0	40.0					2																	1915791		2062	4212	6274	SO:0001630	splice_region_variant	23040	exon13			GGCTTACCTTCGG	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1709+1G>T	2.37:g.1915791C>A		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	26.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Splice_Site	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	C	16.98	3.271077	0.59540	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1783	0.93612	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYT1L	1894798	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	7.677000	0.84024	2.595000	0.87683	0.561000	0.74099	.	.		0.632	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	Intron
NADSYN1	55191	broad.mit.edu;bcgsc.ca	37	11	71202924	71202924	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:71202924A>C	ENST00000319023.2	+	18	1927	c.1739A>C	c.(1738-1740)gAt>gCt	p.D580A	NADSYN1_ENST00000530055.1_Missense_Mutation_p.D209A|NADSYN1_ENST00000539574.1_Missense_Mutation_p.D320A	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	580	Ligase. {ECO:0000250}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	CCCTTGGCTGATGGACAGGTG	0.627																																					p.D580A	Ovarian(79;763 1781 6490 50276)	.											.	NADSYN1	92	0			c.A1739C						.						107.0	77.0	87.0					11																	71202924		2200	4294	6494	SO:0001583	missense	55191	exon18			TGGCTGATGGACA	AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.1739A>C	11.37:g.71202924A>C	ENSP00000326424:p.Asp580Ala	Somatic	69.0	1.0		WXS	Illumina HiSeq	Phase_I	95.0	23.0	NM_018161	B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Missense_Mutation	SNP	ENST00000319023.2	37	CCDS8201.1	.	.	.	.	.	.	.	.	.	.	.	6.788	0.514378	0.12944	.	.	ENSG00000172890	ENST00000319023;ENST00000539574;ENST00000530055	T;T;T	0.42513	0.97;0.97;0.97	4.83	3.7	0.42460	NAD/GMP synthase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.436776	0.23275	N	0.049966	T	0.22859	0.0552	N	0.10782	0.045	0.37629	D	0.921617	B;B	0.14438	0.01;0.001	B;B	0.16722	0.016;0.014	T	0.07309	-1.0779	10	0.36615	T	0.2	-7.4644	8.5099	0.33211	0.9061:0.0:0.0939:0.0	.	320;580	B3KUU4;Q6IA69	.;NADE_HUMAN	A	580;320;209	ENSP00000326424:D580A;ENSP00000443718:D320A;ENSP00000431820:D209A	ENSP00000326424:D580A	D	+	2	0	NADSYN1	70880572	0.339000	0.24784	0.090000	0.20809	0.089000	0.18198	3.739000	0.55075	0.703000	0.31848	0.533000	0.62120	GAT	.		0.627	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394356.1	NM_018161	
NBPF14	25832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	148004618	148004618	+	Missense_Mutation	SNP	T	T	C	rs143743039	byFrequency	TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:148004618T>C	ENST00000369219.1	-	22	2712	c.2696A>G	c.(2695-2697)aAt>aGt	p.N899S				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	899	NBPF 10. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					AAAAAACCTATTGTCCACGTA	0.448													-|||	2	0.000399361	0.0008	0.0	5008	,	,		29882	0.0		0.001	False		,,,				2504	0.0				p.N899S		.											.	NBPF14	91	0			c.A2696G						.	T	SER/ASN	0,3962		0,0,1981	61.0	98.0	86.0		2696	-1.0	0.0	1	dbSNP_134	86	2,8300		0,2,4149	no	missense	NBPF14	NM_015383.1	46	0,2,6130	CC,CT,TT		0.0241,0.0,0.0163	benign	899/922	148004618	2,12262	1981	4151	6132	SO:0001583	missense	25832	exon22			AACCTATTGTCCA	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.2696A>G	1.37:g.148004618T>C	ENSP00000358221:p.Asn899Ser	Somatic	410.0	0.0		WXS	Illumina HiSeq	Phase_I	453.0	265.0	NM_015383	Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	ENST00000369219.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	0.010|0.010	-1.756989|-1.756989	0.00657|0.00657	0.0|0.0	2.41E-4|2.41E-4	ENSG00000122497|ENSG00000122497	ENST00000310701|ENST00000369219;ENST00000369368	.|T	.|0.05319	.|3.46	0.512|0.512	-1.02|-1.02	0.10135|0.10135	.|DUF1220 (1);	.|.	.|.	.|.	.|.	T|T	0.00875|0.00875	0.0029|0.0029	N|N	0.17082|0.17082	0.46|0.46	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.15473	.|0.0;0.013;0.007	.|B;B;B	.|0.17433	.|0.0;0.007;0.018	T|T	0.48103|0.48103	-0.9064|-0.9064	4|8	.|0.22109	.|T	.|0.4	.|.	.|.	.|.	.|.	.|.	.|247;880;899	.|F8WEX8;B4DH59;Q5TI25	.|.;.;NBPFE_HUMAN	V|S	905|899;247	.|ENSP00000358221:N899S	.|ENSP00000358221:N899S	I|N	-|-	1|2	0|0	NBPF14|NBPF14	146471242|146471242	0.671000|0.671000	0.27521|0.27521	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.784000|-0.784000	0.04633|0.04633	-1.010000|-1.010000	0.03396|0.03396	-0.571000|-0.571000	0.04153|0.04153	ATA|AAT	T|1.000;C|0.000		0.448	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
NOX5	79400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	69331285	69331285	+	Missense_Mutation	SNP	A	A	G	rs148791297	byFrequency	TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr15:69331285A>G	ENST00000388866.3	+	9	1501	c.1460A>G	c.(1459-1461)tAt>tGt	p.Y487C	RP11-809H16.4_ENST00000559495.1_RNA|NOX5_ENST00000260364.5_Missense_Mutation_p.Y469C|NOX5_ENST00000448182.3_Missense_Mutation_p.Y441C|NOX5_ENST00000530406.2_Missense_Mutation_p.Y459C|NOX5_ENST00000455873.3_Missense_Mutation_p.Y452C	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	487	C-terminal catalytic region.|FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						ATTGCTCGCTATGAGTGGCAC	0.522													A|||	3	0.000599042	0.0023	0.0	5008	,	,		20581	0.0		0.0	False		,,,				2504	0.0				p.Y487C		.											.	NOX5	136	0			c.A1460G						.	A	CYS/TYR,CYS/TYR,CYS/TYR	17,4383	24.3+/-50.5	0,17,2183	243.0	221.0	229.0		1376,1355,1460	2.3	0.3	15	dbSNP_134	229	0,8596		0,0,4298	yes	missense,missense,missense	NOX5	NM_001184779.1,NM_001184780.1,NM_024505.3	194,194,194	0,17,6481	GG,GA,AA		0.0,0.3864,0.1308	probably-damaging,probably-damaging,probably-damaging	459/738,452/731,487/766	69331285	17,12979	2200	4298	6498	SO:0001583	missense	79400	exon9			CTCGCTATGAGTG	AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.1460A>G	15.37:g.69331285A>G	ENSP00000373518:p.Tyr487Cys	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	67.0	NM_024505	B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Missense_Mutation	SNP	ENST00000388866.3	37	CCDS32276.2	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	A	11.08	1.532172	0.27387	0.003864	0.0	ENSG00000255346	ENST00000455873;ENST00000448182;ENST00000388866;ENST00000530406	D;D;D	0.92495	-3.05;-3.05;-3.05	3.43	2.28	0.28536	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.91872	0.7427	M	0.79475	2.455	0.58432	D	0.999999	P;P;P	0.49635	0.599;0.926;0.599	B;P;B	0.48571	0.333;0.582;0.333	D	0.88881	0.3339	10	0.54805	T	0.06	-7.9885	7.526	0.27656	0.8903:0.0:0.1097:0.0	.	452;487;459	Q96PH1-6;Q96PH1;Q96PH1-3	.;NOX5_HUMAN;.	C	452;469;487;459	ENSP00000416828:Y452C;ENSP00000373518:Y487C;ENSP00000432440:Y459C	ENSP00000373518:Y487C	Y	+	2	0	NOX5	67118339	1.000000	0.71417	0.325000	0.25375	0.094000	0.18550	5.625000	0.67770	0.245000	0.21373	-0.736000	0.03550	TAT	A|0.999;G|0.001		0.522	NOX5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257124.2	NM_024505	
NR3C1	2908	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	142680054	142680054	+	Silent	SNP	T	T	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:142680054T>A	ENST00000343796.2	-	5	2736	c.1743A>T	c.(1741-1743)atA>atT	p.I581I	NR3C1_ENST00000416954.2_Silent_p.I184I|NR3C1_ENST00000504572.1_Silent_p.I582I|NR3C1_ENST00000424646.2_Silent_p.I555I|NR3C1_ENST00000231509.3_Silent_p.I582I|NR3C1_ENST00000415690.2_Silent_p.I581I|NR3C1_ENST00000503201.1_Silent_p.I581I|NR3C1_ENST00000394466.2_Silent_p.I582I|NR3C1_ENST00000504336.1_5'Flank|NR3C1_ENST00000394464.2_Silent_p.I581I	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	581	Interaction with CLOCK.|Interaction with CRY1.|Steroid-binding.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	TCTTACCTGGTATTGCCTTTG	0.418																																					p.I582I		.											.	NR3C1	92	0			c.A1746T						.						213.0	206.0	209.0					5																	142680054		2203	4300	6503	SO:0001819	synonymous_variant	2908	exon5			ACCTGGTATTGCC	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.1743A>T	5.37:g.142680054T>A		Somatic	97.0	1.0		WXS	Illumina HiSeq	Phase_I	130.0	66.0	NM_001024094	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Silent	SNP	ENST00000343796.2	37	CCDS4278.1																																																																																			.		0.418	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1		
NXF3	56000	broad.mit.edu;bcgsc.ca	37	X	102337749	102337749	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chrX:102337749G>T	ENST00000395065.3	-	8	820	c.719C>A	c.(718-720)gCa>gAa	p.A240E	NXF3_ENST00000425644.1_5'UTR|NXF3_ENST00000425463.2_Missense_Mutation_p.A151E	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	240					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						AGGATTCGATGCCATCTTAGT	0.517																																					p.A240E		.											.	NXF3	205	0			c.C719A						.						168.0	139.0	149.0					X																	102337749		2203	4300	6503	SO:0001583	missense	56000	exon8			TTCGATGCCATCT	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.719C>A	X.37:g.102337749G>T	ENSP00000378504:p.Ala240Glu	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	5.0	NM_022052	B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	ENST00000395065.3	37	CCDS14503.1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508785	0.44660	.	.	ENSG00000147206	ENST00000395065;ENST00000425463	T;T	0.42513	0.97;0.97	3.64	-3.54	0.04653	.	0.977036	0.08398	N	0.951837	T	0.23532	0.0569	L	0.34521	1.04	0.09310	N	1	P;P;P	0.50617	0.937;0.872;0.515	B;B;B	0.42851	0.4;0.321;0.265	T	0.16158	-1.0412	10	0.06365	T	0.9	-0.0056	4.7508	0.13059	0.5908:0.0:0.2468:0.1624	.	240;136;240	B4DYI1;E9PEY7;Q9H4D5	.;.;NXF3_HUMAN	E	240;151	ENSP00000378504:A240E;ENSP00000404347:A151E	ENSP00000378504:A240E	A	-	2	0	NXF3	102224405	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.090000	0.15025	-1.006000	0.03412	0.600000	0.82982	GCA	.		0.517	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228467595	228467595	+	Silent	SNP	C	C	T	rs553927346		TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:228467595C>T	ENST00000422127.1	+	28	7514	c.7470C>T	c.(7468-7470)tgC>tgT	p.C2490C	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.C2490C|OBSCN_ENST00000570156.2_Silent_p.C2919C|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000359599.6_Silent_p.C1337C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2490	Ig-like 24.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCCTGTCCTGCGACTTCCGGC	0.627																																					p.C2919C		.											.	OBSCN	403	0			c.C8757T						.						22.0	28.0	26.0					1																	228467595		2128	4231	6359	SO:0001819	synonymous_variant	84033	exon33			GTCCTGCGACTTC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7470C>T	1.37:g.228467595C>T		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	51.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			.		0.627	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OGFOD2	79676	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	123461262	123461262	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr12:123461262T>G	ENST00000228922.7	+	3	283	c.251T>G	c.(250-252)cTc>cGc	p.L84R	OGFOD2_ENST00000536150.1_5'UTR|ABCB9_ENST00000442028.2_5'Flank|ABCB9_ENST00000542678.1_Intron|OGFOD2_ENST00000545317.1_5'UTR|OGFOD2_ENST00000538755.1_5'UTR|OGFOD2_ENST00000542117.1_3'UTR|OGFOD2_ENST00000545612.1_5'UTR|OGFOD2_ENST00000538628.1_5'UTR|RP11-197N18.2_ENST00000540866.2_RNA|OGFOD2_ENST00000454694.2_5'UTR|ABCB9_ENST00000392439.3_5'Flank|OGFOD2_ENST00000397389.2_Missense_Mutation_p.L24R			Q6N063	OGFD2_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 2	84							iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			breast(1)|endometrium(2)|lung(4)|pancreas(1)	8	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.11e-05)|Epithelial(86;0.000127)|BRCA - Breast invasive adenocarcinoma(302;0.107)	Vitamin C(DB00126)	AGGAAAGCCCTCATCGCGAGT	0.642																																					p.L24R		.											.	OGFOD2	69	0			c.T71G						.						41.0	52.0	48.0					12																	123461262		2200	4291	6491	SO:0001583	missense	79676	exon4			AAGCCCTCATCGC	AK094820	CCDS41855.1	12q24.31	2010-11-23			ENSG00000111325	ENSG00000111325			25823	protein-coding gene	gene with protein product						12477932	Standard	NM_024623		Approved	FLJ13491, FLJ37501	uc001udz.1	Q6N063		ENST00000228922.7:c.251T>G	12.37:g.123461262T>G	ENSP00000228922:p.Leu84Arg	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	44.0	NM_024623	B3KT24|Q4KN13|Q6N023|Q9H8K6	Missense_Mutation	SNP	ENST00000228922.7	37		.	.	.	.	.	.	.	.	.	.	T	18.49	3.634402	0.67130	.	.	ENSG00000111325	ENST00000397389;ENST00000228922;ENST00000537966	D;D	0.85955	-2.05;-2.02	5.67	4.51	0.55191	.	0.391203	0.30020	N	0.010617	D	0.82282	0.5003	L	0.34521	1.04	0.35682	D	0.814179	D;B;B	0.59767	0.986;0.001;0.178	P;B;B	0.57152	0.814;0.003;0.086	T	0.81457	-0.0924	10	0.21014	T	0.42	-31.7487	6.8534	0.24028	0.1327:0.0729:0.0:0.7944	.	65;84;24	B4DZU3;Q6N063;Q6N063-2	.;OGFD2_HUMAN;.	R	24;84;157	ENSP00000380544:L24R;ENSP00000228922:L84R	ENSP00000228922:L84R	L	+	2	0	OGFOD2	122027215	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	2.093000	0.41710	2.153000	0.67306	0.528000	0.53228	CTC	.		0.642	OGFOD2-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000400984.1	NM_024623	
OR10Q1	219960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57995924	57995924	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:57995924G>A	ENST00000316770.2	-	1	466	c.424C>T	c.(424-426)Cgc>Tgc	p.R142C		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				CACAGCTCGCGGGTCATGATG	0.627																																					p.R142C		.											OR10Q1,NS,carcinoma,+2	OR10Q1	70	0			c.C424T						.						64.0	55.0	58.0					11																	57995924		2201	4295	6496	SO:0001583	missense	219960	exon1			GCTCGCGGGTCAT	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.424C>T	11.37:g.57995924G>A	ENSP00000314324:p.Arg142Cys	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	23.0	NM_001004471	Q6IFG4	Missense_Mutation	SNP	ENST00000316770.2	37	CCDS31547.1	.	.	.	.	.	.	.	.	.	.	G	1.984	-0.433489	0.04669	.	.	ENSG00000180475	ENST00000316770	T	0.01388	4.95	4.54	2.64	0.31445	GPCR, rhodopsin-like superfamily (1);	0.916466	0.09003	N	0.862742	T	0.02494	0.0076	M	0.64997	1.995	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.39187	-0.9626	10	0.59425	D	0.04	.	8.4661	0.32958	0.0:0.1499:0.5405:0.3095	.	142	Q8NGQ4	O10Q1_HUMAN	C	142	ENSP00000314324:R142C	ENSP00000314324:R142C	R	-	1	0	OR10Q1	57752500	0.000000	0.05858	0.247000	0.24249	0.003000	0.03518	-0.667000	0.05274	0.526000	0.28541	-0.224000	0.12420	CGC	.		0.627	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471	
OR2G2	81470	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247752217	247752217	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:247752217G>A	ENST00000320065.1	+	1	556	c.556G>A	c.(556-558)Gtg>Atg	p.V186M	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CGAGGTCCCTGTGCTCATCAA	0.537																																					p.V186M		.											.	OR2G2	68	0			c.G556A						.						183.0	178.0	179.0					1																	247752217		2203	4300	6503	SO:0001583	missense	81470	exon1			GTCCCTGTGCTCA	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.556G>A	1.37:g.247752217G>A	ENSP00000326349:p.Val186Met	Somatic	162.0	1.0		WXS	Illumina HiSeq	Phase_I	281.0	89.0	NM_001001915	Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	37	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754964	0.49362	.	.	ENSG00000177489	ENST00000320065	T	0.00099	8.73	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.228496	0.21529	U	0.073079	T	0.00241	0.0007	L	0.59436	1.845	0.09310	N	1	P	0.39376	0.67	P	0.47251	0.542	T	0.40496	-0.9560	10	0.87932	D	0	.	10.2325	0.43264	0.0:0.202:0.798:0.0	.	186	Q8NGZ5	OR2G2_HUMAN	M	186	ENSP00000326349:V186M	ENSP00000326349:V186M	V	+	1	0	OR2G2	245818840	0.000000	0.05858	1.000000	0.80357	0.983000	0.72400	0.477000	0.22196	2.206000	0.71126	0.591000	0.81541	GTG	.		0.537	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
OR2T1	26696	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248569357	248569357	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:248569357C>A	ENST00000366474.1	+	1	62	c.62C>A	c.(61-63)aCa>aAa	p.T21K		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGCTGCCTAACAATTAATTCA	0.338																																					p.T21K		.											.	OR2T1	69	0			c.C62A						.						90.0	92.0	91.0					1																	248569357		2203	4300	6503	SO:0001583	missense	26696	exon1			GCCTAACAATTAA	U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.62C>A	1.37:g.248569357C>A	ENSP00000355430:p.Thr21Lys	Somatic	125.0	1.0		WXS	Illumina HiSeq	Phase_I	216.0	74.0	NM_030904	Q6IEZ9	Missense_Mutation	SNP	ENST00000366474.1	37	CCDS31115.1	.	.	.	.	.	.	.	.	.	.	C	8.874	0.949989	0.18431	.	.	ENSG00000175143	ENST00000366474	T	0.02916	4.11	3.38	-4.92	0.03075	.	.	.	.	.	T	0.01387	0.0045	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46871	-0.9160	9	0.72032	D	0.01	.	1.8919	0.03249	0.1308:0.2923:0.1292:0.4477	.	21	O43869	OR2T1_HUMAN	K	21	ENSP00000355430:T21K	ENSP00000355430:T21K	T	+	2	0	OR2T1	246635980	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.966000	0.01509	-1.198000	0.02669	-1.127000	0.01993	ACA	.		0.338	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097346.2		
OR52N1	79473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5809718	5809718	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr11:5809718G>A	ENST00000317078.1	-	1	328	c.329C>T	c.(328-330)aCa>aTa	p.T110I	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		CTCCATCCCTGTGAAGGTGTG	0.502																																					p.T110I		.											.	OR52N1	69	0			c.C329T						.						156.0	140.0	145.0					11																	5809718		2201	4296	6497	SO:0001583	missense	79473	exon1			ATCCCTGTGAAGG	AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.329C>T	11.37:g.5809718G>A	ENSP00000322823:p.Thr110Ile	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	37.0	NM_001001913	Q6IFF6	Missense_Mutation	SNP	ENST00000317078.1	37	CCDS31398.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536171	0.64972	.	.	ENSG00000181001	ENST00000317078	T	0.19938	2.11	4.59	4.59	0.56863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000096	T	0.40196	0.1107	L	0.60455	1.87	0.28687	N	0.904773	D	0.63046	0.992	D	0.65010	0.931	T	0.17349	-1.0372	10	0.59425	D	0.04	.	14.6035	0.68460	0.0:0.0:1.0:0.0	.	110	Q8NH53	O52N1_HUMAN	I	110	ENSP00000322823:T110I	ENSP00000322823:T110I	T	-	2	0	OR52N1	5766294	0.001000	0.12720	1.000000	0.80357	0.998000	0.95712	1.010000	0.29898	2.528000	0.85240	0.609000	0.83330	ACA	.		0.502	OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401142.1	NM_001001913	
OTOP2	92736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72921033	72921033	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:72921033G>T	ENST00000580223.1	+	1	336	c.306G>T	c.(304-306)tgG>tgT	p.W102C	OTOP2_ENST00000331427.4_Missense_Mutation_p.W102C|USH1G_ENST00000319642.1_5'Flank			Q7RTS6	OTOP2_HUMAN	otopetrin 2	102						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					GCCCCATCTGGCTCCGAGGTG	0.657																																					p.W102C		.											.	OTOP2	134	0			c.G306T						.						14.0	10.0	11.0					17																	72921033		2187	4269	6456	SO:0001583	missense	92736	exon2			CATCTGGCTCCGA	BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.306G>T	17.37:g.72921033G>T	ENSP00000463837:p.Trp102Cys	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	22.0	NM_178160		Missense_Mutation	SNP	ENST00000580223.1	37	CCDS11708.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.223018	0.79464	.	.	ENSG00000183034	ENST00000331427	T	0.22134	1.97	4.12	4.12	0.48240	.	0.000000	0.85682	D	0.000000	T	0.46347	0.1388	M	0.74647	2.275	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	T	0.54063	-0.8349	10	0.87932	D	0	-4.6811	16.5517	0.84474	0.0:0.0:1.0:0.0	.	102	Q7RTS6	OTOP2_HUMAN	C	102	ENSP00000332528:W102C	ENSP00000332528:W102C	W	+	3	0	OTOP2	70432628	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.056000	0.93881	2.122000	0.65172	0.555000	0.69702	TGG	.		0.657	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445306.1	NM_178160	
OXSR1	9943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38292941	38292941	+	Missense_Mutation	SNP	G	G	T	rs145431865	byFrequency	TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:38292941G>T	ENST00000311806.3	+	16	1795	c.1423G>T	c.(1423-1425)Gac>Tac	p.D475Y		NM_005109.2	NP_005100.1			oxidative stress responsive 1											skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TGGCCTGGTCGACGGAAGGGA	0.448																																					p.D475Y		.											.	OXSR1	311	0			c.G1423T						.						305.0	276.0	286.0					3																	38292941		2203	4300	6503	SO:0001583	missense	9943	exon16			CTGGTCGACGGAA	AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000311806.3:c.1423G>T	3.37:g.38292941G>T	ENSP00000311713:p.Asp475Tyr	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	84.0	NM_005109		Missense_Mutation	SNP	ENST00000311806.3	37	CCDS2675.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782855	0.90282	.	.	ENSG00000172939	ENST00000311806	T	0.78003	-1.14	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.88123	0.6352	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.88930	0.3372	10	0.87932	D	0	-20.8632	17.1648	0.86812	0.0:0.0:1.0:0.0	.	475	O95747	OXSR1_HUMAN	Y	475	ENSP00000311713:D475Y	ENSP00000311713:D475Y	D	+	1	0	OXSR1	38267945	1.000000	0.71417	0.644000	0.29465	0.993000	0.82548	8.284000	0.89912	2.801000	0.96364	0.650000	0.86243	GAC	G|0.999;A|0.001		0.448	OXSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253744.1	NM_005109	
PCDHA6	56142	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140208380	140208380	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:140208380T>C	ENST00000529310.1	+	1	818	c.704T>C	c.(703-705)gTg>gCg	p.V235A	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.V235A|PCDHA5_ENST00000529859.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	235	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCTGGATGTGAATGATAAT	0.463																																					p.V235A		.											.	PCDHA6	92	0			c.T704C						.						65.0	63.0	64.0					5																	140208380		2203	4297	6500	SO:0001583	missense	56142	exon1			TGGATGTGAATGA	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.704T>C	5.37:g.140208380T>C	ENSP00000433378:p.Val235Ala	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	84.0	NM_018909	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.846988	0.00568	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.02032	4.49;4.49	3.7	2.56	0.30785	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.257775	0.19837	U	0.104955	T	0.01353	0.0044	N	0.21324	0.655	0.09310	N	1	B;B;B	0.19706	0.038;0.006;0.004	B;B;B	0.20955	0.032;0.007;0.005	T	0.49418	-0.8942	10	0.02654	T	1	.	5.0187	0.14350	0.0:0.2349:0.0:0.7651	.	235;235;235	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	A	235	ENSP00000433378:V235A;ENSP00000434113:V235A	ENSP00000434113:V235A	V	+	2	0	PCDHA6	140188564	0.000000	0.05858	0.994000	0.49952	0.709000	0.40893	-0.589000	0.05767	1.669000	0.50854	0.260000	0.18958	GTG	.		0.463	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCDHAC2	56134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140347864	140347864	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:140347864A>G	ENST00000289269.5	+	1	2045	c.1513A>G	c.(1513-1515)Acc>Gcc	p.T505A	PCDHA13_ENST00000409494.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	505	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCAGAGGTGACCTACTCCCT	0.498																																					p.T505A	Melanoma(190;638 2083 3390 11909 52360)	.											.	PCDHAC2	26	0			c.A1513G						.						107.0	101.0	103.0					5																	140347864		2203	4300	6503	SO:0001583	missense	56134	exon1			GAGGTGACCTACT	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1513A>G	5.37:g.140347864A>G	ENSP00000289269:p.Thr505Ala	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	66.0	NM_031883	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	ENST00000289269.5	37	CCDS4242.1	.	.	.	.	.	.	.	.	.	.	A	12.03	1.814777	0.32053	.	.	ENSG00000243232	ENST00000289269	T	0.51574	0.7	6.02	6.02	0.97574	Cadherin (4);Cadherin-like (1);	0.000000	0.43260	D	0.000582	T	0.51787	0.1695	L	0.56280	1.765	0.44937	D	0.997953	P;P	0.43231	0.566;0.801	B;P	0.48770	0.198;0.589	T	0.55560	-0.8122	10	0.66056	D	0.02	.	9.9761	0.41783	0.7503:0.0:0.0:0.2497	.	505;505	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	A	505	ENSP00000289269:T505A	ENSP00000289269:T505A	T	+	1	0	PCDHAC2	140328048	0.002000	0.14202	1.000000	0.80357	0.993000	0.82548	0.715000	0.25822	2.311000	0.77944	0.533000	0.62120	ACC	.		0.498	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PCDHB3	56132	hgsc.bcm.edu;broad.mit.edu	37	5	140481966	140481966	+	Frame_Shift_Del	DEL	G	G	-	rs541148618	byFrequency	TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:140481966delG	ENST00000231130.2	+	1	1733	c.1733delG	c.(1732-1734)cggfs	p.R578fs	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	578	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGGTGCCCCGGGCGGCTGAG	0.706																																					p.R578fs		.											.	PCDHB3	92	0			c.1733delG						.						17.0	22.0	20.0					5																	140481966		2170	4201	6371	SO:0001589	frameshift_variant	56132	exon1			TGCCCCGGGCGGC	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1733delG	5.37:g.140481966delG	ENSP00000231130:p.Arg578fs	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	11.0	NM_018937	B2R8P2	Frame_Shift_Del	DEL	ENST00000231130.2	37	CCDS4245.1																																																																																			.		0.706	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDHGA8	9708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140773532	140773532	+	Silent	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:140773532T>C	ENST00000398604.2	+	1	1152	c.1152T>C	c.(1150-1152)tgT>tgC	p.C384C	PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	384	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGTTGTCTGTTACACACGTG	0.358																																					p.C384C		.											.	.	.	0			c.T1152C						.						46.0	44.0	45.0					5																	140773532		1843	4090	5933	SO:0001819	synonymous_variant	9708	exon1			TGTCTGTTACACA	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1152T>C	5.37:g.140773532T>C		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	55.0	NM_014004	A7MCZ4|O15039	Silent	SNP	ENST00000398604.2	37	CCDS47291.1																																																																																			.		0.358	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088	
PENK	5179	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	8	57353832	57353832	+	Silent	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr8:57353832T>C	ENST00000314922.3	-	2	879	c.803A>G	c.(802-804)tAa>tGa	p.*268*	PENK_ENST00000523274.1_5'Flank|PENK_ENST00000451791.2_Silent_p.*268*	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	0					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			GAAAAGATATTAAAATCTCAT	0.478																																					p.X268X		.											.	PENK	517	0			c.A803G						.						77.0	87.0	84.0					8																	57353832		2203	4300	6503	SO:0001819	synonymous_variant	5179	exon4			AGATATTAAAATC		CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.803A>G	8.37:g.57353832T>C		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	40.0	NM_001135690	B2RC23|Q6FHC6|Q6FHE6	Silent	SNP	ENST00000314922.3	37	CCDS6168.1																																																																																			.		0.478	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378645.1		
PHB2	11331	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7076910	7076910	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr12:7076910C>G	ENST00000535923.1	-	6	921	c.640G>C	c.(640-642)Gta>Cta	p.V214L	PHB2_ENST00000542912.1_Missense_Mutation_p.V214L|PHB2_ENST00000544134.1_5'Flank|U47924.29_ENST00000606539.1_RNA|PHB2_ENST00000440277.1_Intron|PHB2_ENST00000399433.2_Missense_Mutation_p.V214L|PHB2_ENST00000546111.1_Intron|SCARNA12_ENST00000459155.1_RNA	NM_001144831.1	NP_001138303.1			prohibitin 2											ovary(2)|pancreas(1)	3						GCTTTTTCTACCAAGAATTGG	0.597																																					.		.											.	PHB2	48	0			.						.						115.0	125.0	122.0					12																	7076910		1919	4125	6044	SO:0001583	missense	11331	.			TTTCTACCAAGAA	AF126021	CCDS53741.1, CCDS58207.1	12p13	2013-03-11			ENSG00000215021	ENSG00000215021			30306	protein-coding gene	gene with protein product		610704				11302691, 9259555	Standard	NM_001144831		Approved	REA, BCAP37, Bap37, p22	uc021quf.1	Q99623	OTTHUMG00000168519	ENST00000535923.1:c.640G>C	12.37:g.7076910C>G	ENSP00000441875:p.Val214Leu	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	24.0	.		Missense_Mutation	SNP	ENST00000535923.1	37	CCDS53741.1	.	.	.	.	.	.	.	.	.	.	C	32	5.116958	0.94385	.	.	ENSG00000215021	ENST00000535923;ENST00000542912;ENST00000399433;ENST00000545167	D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39	4.6	4.6	0.57074	.	0.000000	0.64402	U	0.000002	D	0.96697	0.8922	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97386	0.9986	10	0.87932	D	0	-12.6357	17.6167	0.88069	0.0:1.0:0.0:0.0	.	214	Q99623	PHB2_HUMAN	L	214;214;214;250	ENSP00000441875:V214L;ENSP00000440317:V214L;ENSP00000382362:V214L;ENSP00000441662:V250L	ENSP00000382362:V214L	V	-	1	0	PHB2	6947171	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.617000	0.83032	2.389000	0.81357	0.655000	0.94253	GTA	.		0.597	PHB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400040.3	NM_007273	
PHOSPHO1	162466	broad.mit.edu;mdanderson.org	37	17	47302389	47302389	+	Intron	SNP	C	C	A	rs146708566|rs531860059	byFrequency	TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:47302389C>A	ENST00000310544.4	-	3	173				PHOSPHO1_ENST00000514112.1_Missense_Mutation_p.C33F|PHOSPHO1_ENST00000413580.1_Missense_Mutation_p.C33F			Q8TCT1	PHOP1_HUMAN	phosphatase, orphan 1						bone mineralization involved in bone maturation (GO:0035630)|dephosphorylation (GO:0016311)|endochondral ossification (GO:0001958)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of bone mineralization (GO:0030500)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|phosphocholine phosphatase activity (GO:0052731)|phosphoethanolamine phosphatase activity (GO:0052732)|pyrophosphatase activity (GO:0016462)							Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)		Choline(DB00122)	gggagagcagcaggaggagga	0.706																																					p.C33F		.											.	PHOSPHO1	90	0			c.G98T						.						3.0	3.0	3.0					17																	47302389		1946	3842	5788	SO:0001627	intron_variant	162466	exon3			GAGCAGCAGGAGG	AJ457189	CCDS11547.1, CCDS45726.1	17q21.32	2008-05-02				ENSG00000173868			16815	protein-coding gene	gene with protein product						12464021	Standard	NM_178500		Approved		uc010wlv.1	Q8TCT1		ENST00000310544.4:c.46-23G>T	17.37:g.47302389C>A		Somatic	10.0	0.0		WXS	Illumina HiSeq	Phase_I	11.0	6.0	NM_001143804	E9PAM0|Q17RU6	Missense_Mutation	SNP	ENST00000310544.4	37	CCDS11547.1	.	.	.	.	.	.	.	.	.	.	C	4.751	0.139718	0.09083	.	.	ENSG00000173868	ENST00000413580;ENST00000514112;ENST00000512250;ENST00000503902	T;T	0.41758	0.99;0.99	1.02	-1.95	0.07548	.	.	.	.	.	T	0.16128	0.0388	N	0.08118	0	0.09310	N	1	B	0.33266	0.404	B	0.20384	0.029	T	0.09574	-1.0668	9	0.52906	T	0.07	.	3.7507	0.08565	0.2338:0.4778:0.2884:0.0	.	33	E9PAM0	.	F	33;33;33;91	ENSP00000406909:C33F;ENSP00000427694:C33F	ENSP00000406909:C33F	C	-	2	0	PHOSPHO1	44657388	0.934000	0.31675	0.150000	0.22450	0.889000	0.51656	-0.033000	0.12246	-0.600000	0.05790	0.313000	0.20887	TGC	.		0.706	PHOSPHO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364467.2		
PKIB	5570	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	123039083	123039083	+	Silent	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr6:123039083A>G	ENST00000368448.1	+	5	771	c.144A>G	c.(142-144)aaA>aaG	p.K48K	PKIB_ENST00000368452.2_Silent_p.K48K|PKIB_ENST00000258014.3_Silent_p.K55K|PKIB_ENST00000392490.1_Silent_p.K48K|PKIB_ENST00000354275.2_Silent_p.K48K|PKIB_ENST00000392491.2_Silent_p.K48K|PKIB_ENST00000368446.1_Silent_p.K57K			Q9C010	IPKB_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor beta	48							cAMP-dependent protein kinase inhibitor activity (GO:0004862)			large_intestine(3)|lung(1)	4				GBM - Glioblastoma multiforme(226;0.164)		TGCCCCTCAAACTGGAGGCTC	0.493																																					p.K55K		.											.	PKIB	90	0			c.A165G						.						102.0	96.0	98.0					6																	123039083		2203	4300	6503	SO:0001819	synonymous_variant	5570	exon7			CCTCAAACTGGAG		CCDS5126.1, CCDS59033.1	6q21-q22.1	2008-05-27			ENSG00000135549	ENSG00000135549			9018	protein-coding gene	gene with protein product		606914		PRKACN2		10880337	Standard	NM_181795		Approved		uc003pzc.4	Q9C010	OTTHUMG00000015488	ENST00000368448.1:c.144A>G	6.37:g.123039083A>G		Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	11.0	8.0	NM_001270394	B2RCK2|Q567T9|Q5T0Z7	Silent	SNP	ENST00000368448.1	37	CCDS5126.1																																																																																			.		0.493	PKIB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042035.1		
PLA2G2F	64600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	20466020	20466020	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:20466020C>T	ENST00000375102.3	+	1	202	c.100C>T	c.(100-102)Cct>Tct	p.P34S		NM_022819.3	NP_073730.3	Q9BZM2	PA2GF_HUMAN	phospholipase A2, group IIF	0					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		GGCCTCCTGTCCTTCAAGAAC	0.592																																					p.P34S		.											.	PLA2G2F	91	0			c.C100T						.						30.0	35.0	33.0					1																	20466020		1874	4090	5964	SO:0001583	missense	64600	exon1			TCCTGTCCTTCAA	AL158172	CCDS204.2	1p35	2008-09-19			ENSG00000158786	ENSG00000158786	3.1.1.4		30040	protein-coding gene	gene with protein product						11112443	Standard	NM_022819		Approved		uc009vpp.1	Q9BZM2	OTTHUMG00000002704	ENST00000375102.3:c.100C>T	1.37:g.20466020C>T	ENSP00000364243:p.Pro34Ser	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	36.0	NM_022819	Q5R385|Q8N217|Q9H506	Missense_Mutation	SNP	ENST00000375102.3	37	CCDS204.2	.	.	.	.	.	.	.	.	.	.	C	2.272	-0.366780	0.05069	.	.	ENSG00000158786	ENST00000375102	T	0.26810	1.71	4.92	-1.83	0.07833	.	1.532860	0.03995	N	0.295562	T	0.18425	0.0442	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.35549	-0.9784	9	0.87932	D	0	0.0063	4.3185	0.11005	0.1691:0.3491:0.0:0.4818	.	34	Q9BZM2-2	.	S	34	ENSP00000364243:P34S	ENSP00000364243:P34S	P	+	1	0	PLA2G2F	20338607	0.000000	0.05858	0.000000	0.03702	0.159000	0.22180	-0.972000	0.03802	-0.305000	0.08831	-0.136000	0.14681	CCT	.		0.592	PLA2G2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007687.1	NM_022819	
PPT2	9374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32122457	32122457	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr6:32122457C>T	ENST00000324816.6	+	2	654	c.86C>T	c.(85-87)cCc>cTc	p.P29L	PPT2_ENST00000361568.2_Missense_Mutation_p.P35L|PPT2_ENST00000395523.1_Missense_Mutation_p.P29L|PRRT1_ENST00000211413.5_5'Flank|PPT2_ENST00000375137.2_Missense_Mutation_p.P29L|PPT2-EGFL8_ENST00000422437.1_Missense_Mutation_p.P29L|PPT2_ENST00000375143.2_Missense_Mutation_p.P29L|PPT2_ENST00000445576.2_Missense_Mutation_p.P29L|PPT2_ENST00000493548.1_3'UTR|PRRT1_ENST00000375150.2_5'Flank|PRRT1_ENST00000375152.2_5'Flank|PPT2_ENST00000437001.2_5'UTR|PPT2-EGFL8_ENST00000453656.2_3'UTR			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2	29					cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						CTTGCAGCCCCCGCGCCCCAC	0.662																																					p.P35L		.											.	PPT2	44	0			c.C104T						.						57.0	66.0	63.0					6																	32122457		1507	2705	4212	SO:0001583	missense	9374	exon2			CAGCCCCCGCGCC	AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257	ENST00000324816.6:c.86C>T	6.37:g.32122457C>T	ENSP00000320528:p.Pro29Leu	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	39.0	NM_138717	A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	Missense_Mutation	SNP	ENST00000324816.6	37	CCDS4742.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845631	0.51164	.	.	ENSG00000221988	ENST00000414204;ENST00000361568;ENST00000395523;ENST00000445576;ENST00000324816;ENST00000375137;ENST00000375143;ENST00000424499;ENST00000436118;ENST00000453656	T;D;D;D;D;D;D;T;T	0.91407	1.59;-2.82;-2.81;-2.84;-2.81;-2.81;-2.81;-1.47;1.55	4.63	4.63	0.57726	.	0.367119	0.27691	N	0.018243	T	0.77896	0.4199	N	0.08118	0	0.80722	D	1	D;P;P	0.57571	0.98;0.906;0.906	P;B;B	0.52957	0.714;0.346;0.346	T	0.78919	-0.2014	10	0.07175	T	0.84	-4.6008	15.0206	0.71627	0.0:1.0:0.0:0.0	.	29;29;35	Q9UMR5-2;Q9UMR5;B0S872	.;PPT2_HUMAN;.	L	29;35;29;29;29;29;29;29;29;29	ENSP00000398847:P29L;ENSP00000354608:P35L;ENSP00000378894:P29L;ENSP00000412381:P29L;ENSP00000320528:P29L;ENSP00000364279:P29L;ENSP00000364285:P29L;ENSP00000409877:P29L;ENSP00000395456:P29L	ENSP00000320528:P29L	P	+	2	0	PPT2	32230435	0.437000	0.25593	0.703000	0.30354	0.321000	0.28281	2.579000	0.46059	2.384000	0.81235	0.484000	0.47621	CCC	.		0.662	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076552.4	NM_138717	
PSTPIP1	9051	broad.mit.edu;ucsc.edu	37	15	77310541	77310541	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr15:77310541T>C	ENST00000558012.1	+	2	578	c.89T>C	c.(88-90)cTg>cCg	p.L30P	PSTPIP1_ENST00000379595.3_Missense_Mutation_p.L30P|PSTPIP1_ENST00000559295.1_Missense_Mutation_p.L30P|PSTPIP1_ENST00000267939.5_Missense_Mutation_p.L29P	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	30	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						CAGCGGCTTCTGGATGGCAGG	0.622																																					p.L30P		.											.	PSTPIP1	23	0			c.T89C						.						28.0	35.0	33.0					15																	77310541		2138	4243	6381	SO:0001583	missense	9051	exon2			GGCTTCTGGATGG	U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.89T>C	15.37:g.77310541T>C	ENSP00000452746:p.Leu30Pro	Somatic	113.0	2.0		WXS	Illumina HiSeq	Phase_I	105.0	10.0	NM_003978	B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	ENST00000558012.1	37	CCDS45312.1	.	.	.	.	.	.	.	.	.	.	T	13.05	2.120557	0.37436	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.41758	0.99;2.58	4.28	4.28	0.50868	Fps/Fes/Fer/CIP4 homology (3);Prismane-like (1);	0.383802	0.23999	N	0.042493	T	0.50990	0.1648	L	0.48642	1.525	0.58432	D	0.999999	B;P;D;P	0.67145	0.199;0.854;0.996;0.67	B;P;P;P	0.60609	0.248;0.674;0.877;0.603	T	0.43393	-0.9394	10	0.30078	T	0.28	-13.4192	12.7064	0.57063	0.0:0.0:0.0:1.0	.	30;29;30;30	O43586-2;C9K004;B4E1Z9;O43586	.;.;.;PPIP1_HUMAN	P	30;29	ENSP00000368914:L30P;ENSP00000267939:L29P	ENSP00000267939:L29P	L	+	2	0	PSTPIP1	75097596	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.954000	0.40362	1.707000	0.51288	0.358000	0.22013	CTG	.		0.622	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978	
RANBP17	64901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	170598268	170598268	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:170598268T>G	ENST00000523189.1	+	16	2007	c.1843T>G	c.(1843-1845)Ttc>Gtc	p.F615V	RANBP17_ENST00000521759.1_Intron	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	615					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GACTCTTCAGTTCCTAAATGA	0.318			T	TRD@	ALL																																p.F615V		.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17	524	0			c.T1843G						.						138.0	133.0	135.0					5																	170598268		2203	4296	6499	SO:0001583	missense	64901	exon16			CTTCAGTTCCTAA	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1843T>G	5.37:g.170598268T>G	ENSP00000427975:p.Phe615Val	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	71.0	NM_022897	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	T	16.26	3.073825	0.55646	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.67523	-0.27	6.08	6.08	0.98989	Armadillo-type fold (1);	0.093422	0.47093	D	0.000252	T	0.56848	0.2013	L	0.38175	1.15	0.38926	D	0.957846	B	0.18610	0.029	B	0.20184	0.028	T	0.57711	-0.7764	10	0.56958	D	0.05	-16.6915	10.6336	0.45551	0.0:0.0717:0.0:0.9283	.	615	Q9H2T7	RBP17_HUMAN	V	615;45	ENSP00000427975:F615V	ENSP00000427975:F615V	F	+	1	0	RANBP17	170530873	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.925000	0.56484	2.333000	0.79357	0.482000	0.46254	TTC	.		0.318	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
RASAL1	8437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	113553809	113553809	+	Missense_Mutation	SNP	C	C	T	rs150792397		TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr12:113553809C>T	ENST00000261729.5	-	10	1094	c.779G>A	c.(778-780)cGc>cAc	p.R260H	RASAL1_ENST00000446861.3_Missense_Mutation_p.R260H|RASAL1_ENST00000546530.1_Missense_Mutation_p.R260H|RASAL1_ENST00000548055.1_Missense_Mutation_p.R260H|RASAL1_ENST00000418411.2_5'UTR			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	260					intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						GGGCAGGACGCGGTCCTCAAT	0.582																																					p.R260H		.											.	RASAL1	229	0			c.G779A						.	C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	80.0	76.0	78.0		779,779,779	4.1	0.8	12	dbSNP_134	78	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense	RASAL1	NM_001193520.1,NM_001193521.1,NM_004658.2	29,29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign	260/807,260/777,260/805	113553809	2,13004	2203	4300	6503	SO:0001583	missense	8437	exon10			AGGACGCGGTCCT	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.779G>A	12.37:g.113553809C>T	ENSP00000261729:p.Arg260His	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	61.0	NM_004658	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	C	5.562	0.288508	0.10513	0.0	2.33E-4	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.67698	-0.28;-0.21;-0.18;-0.28	4.98	4.08	0.47627	Ras GTPase-activating protein (1);	0.532365	0.19108	N	0.122512	T	0.50633	0.1627	N	0.21508	0.67	0.35045	D	0.760136	B;B;B;B;B;B;B	0.20164	0.025;0.006;0.042;0.025;0.011;0.006;0.042	B;B;B;B;B;B;B	0.18561	0.01;0.004;0.022;0.004;0.013;0.006;0.022	T	0.52457	-0.8573	10	0.11794	T	0.64	.	14.5788	0.68271	0.0:0.8524:0.1476:0.0	.	260;260;260;272;260;260;260	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	H	260	ENSP00000450244:R260H;ENSP00000261729:R260H;ENSP00000395920:R260H;ENSP00000448510:R260H	ENSP00000261729:R260H	R	-	2	0	RASAL1	112038192	0.547000	0.26465	0.767000	0.31495	0.543000	0.35085	1.157000	0.31724	1.204000	0.43247	0.484000	0.47621	CGC	C|1.000;T|0.000		0.582	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658	
RASGEF1A	221002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	43694401	43694401	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr10:43694401C>A	ENST00000395809.1	-	9	3518	c.1012G>T	c.(1012-1014)Gcc>Tcc	p.A338S	RASGEF1A_ENST00000472864.1_5'Flank|RASGEF1A_ENST00000395810.1_Missense_Mutation_p.A338S|RASGEF1A_ENST00000374459.1_Missense_Mutation_p.A346S			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	338	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						TCAAACTTGGCTGTCTTGACC	0.617																																					p.A338S		.											.	RASGEF1A	227	0			c.G1012T						.						139.0	133.0	135.0					10																	43694401		2203	4300	6503	SO:0001583	missense	221002	exon9			ACTTGGCTGTCTT	AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.1012G>T	10.37:g.43694401C>A	ENSP00000379154:p.Ala338Ser	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	25.0	NM_145313	Q8TBF1	Missense_Mutation	SNP	ENST00000395809.1	37	CCDS7202.2	.	.	.	.	.	.	.	.	.	.	C	32	5.120339	0.94385	.	.	ENSG00000198915	ENST00000374459;ENST00000395810;ENST00000395809	T;T;T	0.30182	1.54;1.54;1.54	5.39	5.39	0.77823	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.64402	D	0.000001	T	0.42449	0.1203	L	0.47716	1.5	0.80722	D	1	B;P	0.36183	0.41;0.542	P;P	0.46718	0.45;0.525	T	0.22068	-1.0227	10	0.49607	T	0.09	.	19.143	0.93452	0.0:1.0:0.0:0.0	.	338;346	Q8N9B8;Q8N9B8-2	RGF1A_HUMAN;.	S	346;338;338	ENSP00000363583:A346S;ENSP00000379155:A338S;ENSP00000379154:A338S	ENSP00000363583:A346S	A	-	1	0	RASGEF1A	43014407	1.000000	0.71417	0.990000	0.47175	0.981000	0.71138	7.342000	0.79310	2.509000	0.84616	0.561000	0.74099	GCC	.		0.617	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313989.1	NM_145313	
RBMS3	27303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	29977613	29977613	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:29977613T>C	ENST00000383767.2	+	11	1312	c.976T>C	c.(976-978)Tca>Cca	p.S326P	RBMS3_ENST00000452462.1_Missense_Mutation_p.S326P|RBMS3_ENST00000396583.3_Missense_Mutation_p.S339P|RBMS3_ENST00000456853.1_Missense_Mutation_p.S339P|RBMS3_ENST00000383766.2_Missense_Mutation_p.S308P|RBMS3_ENST00000273139.9_Missense_Mutation_p.S326P|RBMS3_ENST00000473799.1_3'UTR|RBMS3_ENST00000434693.2_Missense_Mutation_p.S325P|RBMS3-AS1_ENST00000414547.1_RNA			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	326					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				CCATCCCATGTCAATGCAGCC	0.438																																					p.S339P		.											.	RBMS3	90	0			c.T1015C						.						116.0	96.0	103.0					3																	29977613		2203	4300	6503	SO:0001583	missense	27303	exon12			CCCATGTCAATGC	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.976T>C	3.37:g.29977613T>C	ENSP00000373277:p.Ser326Pro	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	298.0	161.0	NM_001177712	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.853255	0.91355	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T	0.29397	1.58;1.72;1.57;1.65;1.75;1.63;1.74	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.59838	0.2223	M	0.83852	2.665	0.80722	D	1	D;D;D;D	0.65815	0.991;0.991;0.995;0.991	D;D;D;D	0.71870	0.962;0.953;0.975;0.944	T	0.62835	-0.6770	9	.	.	.	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	326;339;308;326	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	P	325;339;326;326;308;326;339	ENSP00000395592:S325P;ENSP00000379828:S339P;ENSP00000373277:S326P;ENSP00000273139:S326P;ENSP00000373276:S308P;ENSP00000397926:S326P;ENSP00000400519:S339P	.	S	+	1	0	RBMS3	29952617	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.980000	0.88113	2.371000	0.80710	0.533000	0.62120	TCA	.		0.438	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
RBMS3	27303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	29977619	29977619	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:29977619C>A	ENST00000383767.2	+	11	1318	c.982C>A	c.(982-984)Cag>Aag	p.Q328K	RBMS3_ENST00000452462.1_Missense_Mutation_p.Q328K|RBMS3_ENST00000396583.3_Missense_Mutation_p.Q341K|RBMS3_ENST00000456853.1_Missense_Mutation_p.Q341K|RBMS3_ENST00000383766.2_Missense_Mutation_p.Q310K|RBMS3_ENST00000273139.9_Missense_Mutation_p.Q328K|RBMS3_ENST00000473799.1_3'UTR|RBMS3_ENST00000434693.2_Missense_Mutation_p.Q327K|RBMS3-AS1_ENST00000414547.1_RNA			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	328					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				CATGTCAATGCAGCCAGCCAA	0.443																																					p.Q341K		.											.	RBMS3	90	0			c.C1021A						.						118.0	98.0	104.0					3																	29977619		2203	4300	6503	SO:0001583	missense	27303	exon12			TCAATGCAGCCAG	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.982C>A	3.37:g.29977619C>A	ENSP00000373277:p.Gln328Lys	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	293.0	160.0	NM_001177712	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640196	0.87859	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T	0.30182	1.67;1.57;1.68;1.63;1.68;1.65;1.54	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.54565	0.1866	M	0.85099	2.735	0.80722	D	1	P;P;P;P	0.44659	0.57;0.523;0.84;0.588	B;B;P;B	0.50405	0.363;0.273;0.64;0.359	T	0.53229	-0.8468	9	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	328;341;310;328	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	K	327;341;328;328;310;328;341	ENSP00000395592:Q327K;ENSP00000379828:Q341K;ENSP00000373277:Q328K;ENSP00000273139:Q328K;ENSP00000373276:Q310K;ENSP00000397926:Q328K;ENSP00000400519:Q341K	.	Q	+	1	0	RBMS3	29952623	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.760000	0.85248	2.941000	0.99782	0.655000	0.94253	CAG	.		0.443	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
RNF219	79596	broad.mit.edu;bcgsc.ca	37	13	79190249	79190249	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr13:79190249G>T	ENST00000282003.6	-	6	1705	c.1647C>A	c.(1645-1647)gaC>gaA	p.D549E	RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000560209.2_RNA	NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	549	Ser-rich.						zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		TCTTGCTGTTGTCTGACTCTG	0.413																																					p.D549E		.											.	RNF219	135	0			c.C1647A						.						147.0	148.0	148.0					13																	79190249		2203	4300	6503	SO:0001583	missense	79596	exon6			GCTGTTGTCTGAC	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.1647C>A	13.37:g.79190249G>T	ENSP00000282003:p.Asp549Glu	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	6.0	NM_024546	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	ENST00000282003.6	37	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681270	0.47991	.	.	ENSG00000152193	ENST00000282003	T	0.12984	2.63	5.86	5.86	0.93980	.	0.000000	0.64402	D	0.000001	T	0.13798	0.0334	L	0.33485	1.01	0.34258	D	0.679562	P	0.43750	0.816	B	0.42282	0.382	T	0.10405	-1.0631	10	0.36615	T	0.2	-9.9211	14.9767	0.71281	0.0:0.0:0.8574:0.1426	.	549	Q5W0B1	RN219_HUMAN	E	549	ENSP00000282003:D549E	ENSP00000282003:D549E	D	-	3	2	RNF219	78088250	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.017000	0.40981	2.776000	0.95493	0.655000	0.94253	GAC	.		0.413	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546	
RPS6KC1	26750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	213415976	213415976	+	Silent	SNP	C	C	T	rs147823242	byFrequency	TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:213415976C>T	ENST00000366960.3	+	12	3036	c.2886C>T	c.(2884-2886)gcC>gcT	p.A962A	RPS6KC1_ENST00000366959.3_Silent_p.A950A|RPS6KC1_ENST00000543354.1_3'UTR|RPS6KC1_ENST00000543470.1_Silent_p.A750A|RPS6KC1_ENST00000490299.1_3'UTR	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	962	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		ACAGCGATGCCATAGAGAGAA	0.393													C|||	9	0.00179712	0.0061	0.0014	5008	,	,		18103	0.0		0.0	False		,,,				2504	0.0				p.A962A		.											.	RPS6KC1	417	0			c.C2886T						.	C	,	23,4383	29.0+/-57.7	0,23,2180	127.0	114.0	119.0		2850,2886	6.0	1.0	1	dbSNP_134	119	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RPS6KC1	NM_001136138.1,NM_012424.3	,	0,23,6480	TT,TC,CC		0.0,0.522,0.1768	,	950/1055,962/1067	213415976	23,12983	2203	4300	6503	SO:0001819	synonymous_variant	26750	exon12			CGATGCCATAGAG	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.2886C>T	1.37:g.213415976C>T		Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	242.0	66.0	NM_012424	B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Silent	SNP	ENST00000366960.3	37	CCDS1513.1																																																																																			C|0.999;T|0.001		0.393	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3	NM_012424	
SALL4	57167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	50407317	50407317	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr20:50407317G>A	ENST00000217086.4	-	2	1816	c.1705C>T	c.(1705-1707)Ctc>Ttc	p.L569F	SALL4_ENST00000395997.3_Intron|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	569					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGGCAAATGAGACATTCGTTG	0.552																																					p.L569F		.											.	SALL4	92	0			c.C1705T						.						134.0	114.0	121.0					20																	50407317		2203	4300	6503	SO:0001583	missense	57167	exon2			AAATGAGACATTC	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.1705C>T	20.37:g.50407317G>A	ENSP00000217086:p.Leu569Phe	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	58.0	NM_020436	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.818592	0.32145	.	.	ENSG00000101115	ENST00000217086	T	0.07444	3.19	5.59	0.862	0.19056	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.370925	0.19948	N	0.102487	T	0.12135	0.0295	M	0.79475	2.455	0.80722	D	1	P	0.46706	0.883	P	0.46659	0.523	T	0.06516	-1.0822	10	0.54805	T	0.06	-37.1761	2.4308	0.04470	0.173:0.2437:0.4368:0.1465	.	569	Q9UJQ4	SALL4_HUMAN	F	569	ENSP00000217086:L569F	ENSP00000217086:L569F	L	-	1	0	SALL4	49840724	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.405000	0.34635	0.651000	0.30788	0.650000	0.86243	CTC	.		0.552	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
SLC46A1	113235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26723269	26723269	+	3'UTR	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:26723269C>T	ENST00000440501.1	-	0	4878				SARM1_ENST00000379061.4_3'UTR|SARM1_ENST00000457710.3_Silent_p.T679T|SLC46A1_ENST00000584729.1_5'UTR|SLC46A1_ENST00000321666.5_3'UTR	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1						cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	GCTCTGACACCAGTTTGGAGG	0.592																																					p.T712T		.											.	.	.	0			c.C2136T						.						87.0	87.0	87.0					17																	26723269		2203	4300	6503	SO:0001624	3_prime_UTR_variant	23098	exon10			TGACACCAGTTTG	AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.*3403G>A	17.37:g.26723269C>T		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	59.0	NM_015077	Q1HE20|Q86T92|Q8TEG3|Q96FL0	Silent	SNP	ENST00000440501.1	37																																																																																				.		0.592	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_080669	
SCN11A	11280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38921513	38921513	+	Silent	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:38921513T>C	ENST00000302328.3	-	19	3519	c.3321A>G	c.(3319-3321)ctA>ctG	p.L1107L	SCN11A_ENST00000456224.3_Silent_p.L1069L|SCN11A_ENST00000450244.1_Silent_p.L1107L|SCN11A_ENST00000444237.2_Silent_p.L1107L	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1107					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTACCCATTTTAGTACCATCT	0.373																																					p.L1107L		.											.	SCN11A	99	0			c.A3321G						.						71.0	70.0	70.0					3																	38921513		2203	4300	6503	SO:0001819	synonymous_variant	11280	exon19			CCATTTTAGTACC	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3321A>G	3.37:g.38921513T>C		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	38.0	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	CCDS33737.1																																																																																			.		0.373	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
SCN2A	6326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	166245504	166245504	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:166245504G>T	ENST00000375437.2	+	27	5478	c.5188G>T	c.(5188-5190)Gac>Tac	p.D1730Y	SCN2A_ENST00000375427.2_Missense_Mutation_p.D1730Y|SCN2A_ENST00000283256.6_Missense_Mutation_p.D1730Y|SCN2A_ENST00000357398.3_Missense_Mutation_p.D1730Y	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1730					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGGACCTCCAGACTGTGACCC	0.453																																					p.D1730Y		.											.	SCN2A	142	0			c.G5188T						.						193.0	192.0	192.0					2																	166245504		2203	4300	6503	SO:0001583	missense	6326	exon26			CCTCCAGACTGTG	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5188G>T	2.37:g.166245504G>T	ENSP00000364586:p.Asp1730Tyr	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	318.0	56.0	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505875	0.44558	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.97404	-4.37;-4.37;-4.37;-4.37	5.72	5.72	0.89469	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.97598	0.9213	L	0.43598	1.365	0.80722	D	1	P;D	0.89917	0.699;1.0	P;D	0.97110	0.565;1.0	D	0.96247	0.9180	10	0.26408	T	0.33	.	20.3082	0.98638	0.0:0.0:1.0:0.0	.	1730;1730	Q99250-2;Q99250	.;SCN2A_HUMAN	Y	1730	ENSP00000364586:D1730Y;ENSP00000349973:D1730Y;ENSP00000283256:D1730Y;ENSP00000364576:D1730Y	ENSP00000283256:D1730Y	D	+	1	0	SCN2A	165953750	1.000000	0.71417	0.986000	0.45419	0.937000	0.57800	9.742000	0.98846	2.875000	0.98604	0.644000	0.83932	GAC	.		0.453	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
SCN1A	6323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	166898866	166898866	+	Silent	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:166898866T>C	ENST00000303395.4	-	12	2111	c.2112A>G	c.(2110-2112)ctA>ctG	p.L704L	AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Silent_p.L693L|SCN1A_ENST00000423058.2_Silent_p.L704L|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000409050.1_Silent_p.L676L			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	704					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGGATCTTCTAGAAAGTCCA	0.348																																					p.L704L		.											.	SCN1A	147	0			c.A2112G						.						151.0	144.0	146.0					2																	166898866		2203	4300	6503	SO:0001819	synonymous_variant	6323	exon12			ATCTTCTAGAAAG	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2112A>G	2.37:g.166898866T>C		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	63.0	NM_001165963	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																			.		0.348	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
SLC24A2	25769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	19786089	19786089	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr9:19786089T>C	ENST00000341998.2	-	1	837	c.776A>G	c.(775-777)aAt>aGt	p.N259S	SLC24A2_ENST00000286344.3_Missense_Mutation_p.N259S	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	259					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CATGATGACATTATCCAGGAA	0.378																																					p.N259S		.											.	SLC24A2	517	0			c.A776G						.						111.0	104.0	106.0					9																	19786089		2203	4300	6503	SO:0001583	missense	25769	exon1			ATGACATTATCCA	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.776A>G	9.37:g.19786089T>C	ENSP00000344801:p.Asn259Ser	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	32.0	NM_001193288	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	T	12.39	1.922815	0.33908	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.63255	-0.03;-0.03	5.91	4.78	0.61160	Sodium/calcium exchanger membrane region (1);	0.041428	0.85682	D	0.000000	T	0.58694	0.2140	N	0.21508	0.67	0.80722	D	1	B;D	0.55605	0.357;0.972	B;P	0.54706	0.155;0.759	T	0.55835	-0.8078	9	.	.	.	.	11.8686	0.52507	0.0:0.0679:0.0:0.9321	.	259;259	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	S	259	ENSP00000344801:N259S;ENSP00000286344:N259S	.	N	-	2	0	SLC24A2	19776089	1.000000	0.71417	0.888000	0.34837	0.983000	0.72400	8.036000	0.88901	1.066000	0.40716	0.533000	0.62120	AAT	.		0.378	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
SLC25A16	8034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70243246	70243246	+	Silent	SNP	A	A	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr10:70243246A>T	ENST00000609923.1	-	9	1040	c.942T>A	c.(940-942)tcT>tcA	p.S314S	SLC25A16_ENST00000265870.3_5'UTR|SLC25A16_ENST00000539557.1_Silent_p.S216S	NM_152707.3	NP_689920.1	P16260	GDC_HUMAN	solute carrier family 25 (mitochondrial carrier), member 16	314					coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	antiporter activity (GO:0015297)			endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	7						CCACTGCTTGAGAGGGAATAC	0.368																																					p.S314S		.											.	SLC25A16	90	0			c.T942A						.						131.0	126.0	128.0					10																	70243246		2203	4300	6503	SO:0001819	synonymous_variant	8034	exon9			TGCTTGAGAGGGA	M31659	CCDS7280.1	10q21.3-q22.1	2014-06-17	2014-06-17		ENSG00000122912	ENSG00000122912		"""Solute carriers"""	10986	protein-coding gene	gene with protein product	"""Graves disease autoantigen"""	139080				8444471, 2575220	Standard	NM_152707		Approved	GDA, D10S105E, HGT.1, ML7	uc001joi.3	P16260	OTTHUMG00000018354	ENST00000609923.1:c.942T>A	10.37:g.70243246A>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	9.0	NM_152707	Q8N2U1	Silent	SNP	ENST00000609923.1	37	CCDS7280.1																																																																																			.		0.368	SLC25A16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048347.2		
SLC5A1	6523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32487698	32487698	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr22:32487698A>G	ENST00000266088.4	+	11	1479	c.1229A>G	c.(1228-1230)tAc>tGc	p.Y410C	SLC5A1_ENST00000543737.1_Missense_Mutation_p.Y283C	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	410					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	ATGGACATCTACGCCAAGGTC	0.542																																					p.Y410C		.											.	SLC5A1	91	0			c.A1229G						.						130.0	109.0	116.0					22																	32487698		2203	4300	6503	SO:0001583	missense	6523	exon11			ACATCTACGCCAA		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.1229A>G	22.37:g.32487698A>G	ENSP00000266088:p.Tyr410Cys	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	42.0	NM_000343	B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	ENST00000266088.4	37	CCDS13902.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524912	0.85600	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	D;D	0.96232	-3.95;-3.95	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.98707	0.9566	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99709	1.1006	10	0.87932	D	0	.	15.5887	0.76506	1.0:0.0:0.0:0.0	.	410	P13866	SC5A1_HUMAN	C	410;283	ENSP00000266088:Y410C;ENSP00000444898:Y283C	ENSP00000266088:Y410C	Y	+	2	0	SLC5A1	30817698	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.118000	0.71583	2.275000	0.75901	0.528000	0.53228	TAC	.		0.542	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	NM_000343	
SLCO3A1	28232	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	92397220	92397220	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr15:92397220A>G	ENST00000318445.6	+	1	296	c.82A>G	c.(82-84)Aaa>Gaa	p.K28E	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.K28E	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	28					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GAGGAACAAGAAAAAGAAAAA	0.657																																					p.K28E		.											.	SLCO3A1	91	0			c.A82G						.						17.0	18.0	18.0					15																	92397220		2194	4296	6490	SO:0001583	missense	28232	exon1			AACAAGAAAAAGA	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.82A>G	15.37:g.92397220A>G	ENSP00000320634:p.Lys28Glu	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	38.0	NM_013272	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	A	12.43	1.935329	0.34189	.	.	ENSG00000176463	ENST00000318445;ENST00000424469	T;T	0.37411	1.2;1.2	3.49	3.49	0.39957	Major facilitator superfamily domain, general substrate transporter (1);	0.431079	0.23036	N	0.052666	T	0.15652	0.0377	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.10451	-1.0629	10	0.02654	T	1	.	11.1339	0.48362	1.0:0.0:0.0:0.0	.	28;28	Q9UIG8-2;Q9UIG8	.;SO3A1_HUMAN	E	28	ENSP00000320634:K28E;ENSP00000387846:K28E	ENSP00000320634:K28E	K	+	1	0	SLCO3A1	90198224	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.798000	0.69095	1.380000	0.46344	0.397000	0.26171	AAA	.		0.657	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272	
SMOC2	64094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	168927046	168927046	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr6:168927046G>A	ENST00000356284.2	+	3	497	c.277G>A	c.(277-279)Gaa>Aaa	p.E93K	SMOC2_ENST00000354536.5_Missense_Mutation_p.E93K	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	93	Thyroglobulin type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		GTGTGTGGCCGAAAGGAAGTA	0.502																																					p.E93K		.											.	SMOC2	91	0			c.G277A						.						129.0	104.0	113.0					6																	168927046		2203	4300	6503	SO:0001583	missense	64094	exon3			GTGGCCGAAAGGA	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.277G>A	6.37:g.168927046G>A	ENSP00000348630:p.Glu93Lys	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	55.0	NM_022138	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	ENST00000356284.2	37	CCDS55076.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.959648	0.92791	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793	T;T	0.63913	-0.07;-0.07	4.86	4.86	0.63082	Thyroglobulin type-1 (3);	0.000000	0.85682	D	0.000000	T	0.71281	0.3321	M	0.71296	2.17	0.43471	D	0.995689	D;D	0.89917	0.999;1.0	D;D	0.67231	0.95;0.943	T	0.74047	-0.3790	10	0.52906	T	0.07	-1.7924	15.2225	0.73324	0.0:0.0:1.0:0.0	.	93;93	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	K	93	ENSP00000348630:E93K;ENSP00000346537:E93K	ENSP00000346537:E93K	E	+	1	0	SMOC2	168669895	1.000000	0.71417	0.998000	0.56505	0.881000	0.50899	8.019000	0.88732	2.241000	0.73720	0.650000	0.86243	GAA	.		0.502	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		
SPAG6	9576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	22676816	22676816	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr10:22676816T>C	ENST00000376624.3	+	6	885	c.743T>C	c.(742-744)gTt>gCt	p.V248A	RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000538630.1_Missense_Mutation_p.V223A|SPAG6_ENST00000376601.1_Intron|SPAG6_ENST00000376603.2_Missense_Mutation_p.V324A|SPAG6_ENST00000313311.6_Missense_Mutation_p.V248A	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	248					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						GAAATGGTTGTTGAAGCAGAG	0.373																																					p.V248A		.											.	SPAG6	153	0			c.T743C						.						96.0	96.0	96.0					10																	22676816		2203	4300	6503	SO:0001583	missense	9576	exon6			TGGTTGTTGAAGC	AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.743T>C	10.37:g.22676816T>C	ENSP00000365811:p.Val248Ala	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	45.0	NM_172242	A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Missense_Mutation	SNP	ENST00000376624.3	37	CCDS7139.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.313061	0.81358	.	.	ENSG00000077327	ENST00000376624;ENST00000376603;ENST00000538630;ENST00000313311	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.64	4.51	0.55191	Armadillo-like helical (1);Armadillo-type fold (1);	0.296544	0.36628	N	0.002484	T	0.75635	0.3876	M	0.92026	3.265	0.58432	D	0.99999	B;B;P;P	0.45768	0.329;0.294;0.638;0.866	B;P;P;P	0.49853	0.292;0.624;0.486;0.521	T	0.79671	-0.1706	10	0.72032	D	0.01	-20.0336	11.5016	0.50441	0.0:0.0701:0.0:0.9299	.	223;324;248;248	B4DXZ4;O75602-3;O75602-2;O75602	.;.;.;SPAG6_HUMAN	A	248;324;223;248	ENSP00000365811:V248A;ENSP00000365788:V324A;ENSP00000441325:V223A;ENSP00000323599:V248A	ENSP00000323599:V248A	V	+	2	0	SPAG6	22716822	1.000000	0.71417	0.982000	0.44146	0.997000	0.91878	5.005000	0.63972	0.969000	0.38237	0.533000	0.62120	GTT	.		0.373	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047187.1		
TARS	6897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	33448802	33448802	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr5:33448802G>A	ENST00000265112.3	+	3	605	c.294G>A	c.(292-294)tgG>tgA	p.W98*	TARS_ENST00000502553.1_Nonsense_Mutation_p.W98*|TARS_ENST00000455217.2_Nonsense_Mutation_p.W98*|TARS_ENST00000541634.1_Intron|TARS_ENST00000414361.2_Missense_Mutation_p.G31E	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	98					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	CGGAATCTTGGAAAACTACAC	0.383																																					p.W98X		.											.	TARS	92	0			c.G294A						.						137.0	126.0	130.0					5																	33448802		2203	4300	6503	SO:0001587	stop_gained	6897	exon3			ATCTTGGAAAACT	AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.294G>A	5.37:g.33448802G>A	ENSP00000265112:p.Trp98*	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	62.0	NM_152295	A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Nonsense_Mutation	SNP	ENST00000265112.3	37	CCDS3899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.524973|4.524973	0.85600|0.85600	.|.	.|.	ENSG00000113407|ENSG00000113407	ENST00000414361|ENST00000502553;ENST00000514259;ENST00000265112;ENST00000455217;ENST00000506040	.|.	.|.	.|.	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.49932|.	0.1586|.	.|.	.|.	.|.	0.47374|0.47374	D|D	0.999405|0.999405	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|.	0.37888|.	-0.9686|.	7|.	0.02654|0.02654	T|T	1|1	-7.9176|-7.9176	20.6242|20.6242	0.99512|0.99512	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	31|.	E7ERI3|.	.|.	E|X	31|98;98;98;98;39	.|.	ENSP00000394291:G31E|ENSP00000265112:W98X	G|W	+|+	2|3	0|0	TARS|TARS	33484559|33484559	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.826000|0.826000	0.46750|0.46750	9.562000|9.562000	0.98145|0.98145	2.880000|2.880000	0.98712|0.98712	0.650000|0.650000	0.86243|0.86243	GGA|TGG	.		0.383	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207367.1	NM_152295	
TBX2	6909	broad.mit.edu;mdanderson.org	37	17	59482800	59482800	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:59482800G>A	ENST00000240328.3	+	6	1570	c.1289G>A	c.(1288-1290)cGg>cAg	p.R430Q	RP11-332H18.4_ENST00000592009.1_RNA	NM_005994.3	NP_005985.3	Q13207	TBX2_HUMAN	T-box 2	430					aorta morphogenesis (GO:0035909)|atrioventricular canal development (GO:0036302)|cardiac muscle tissue development (GO:0048738)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|developmental growth involved in morphogenesis (GO:0060560)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|endocardial cushion morphogenesis (GO:0003203)|mammary placode formation (GO:0060596)|muscle cell fate determination (GO:0007521)|negative regulation of cardiac chamber formation (GO:1901211)|negative regulation of heart looping (GO:1901208)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|palate development (GO:0060021)|pharynx development (GO:0060465)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(7)|ovary(1)	9						GCCGAAGCTCGGAGGAAGGAC	0.746																																					p.R430Q	GBM(3;187 253 11467 14965 23079)	.											.	TBX2	226	0			c.G1289A						.						7.0	8.0	8.0					17																	59482800		2115	4161	6276	SO:0001583	missense	6909	exon6			AAGCTCGGAGGAA	AB209378	CCDS11627.2	17q23.2	2012-01-23			ENSG00000121068	ENSG00000121068		"""T-boxes"""	11597	protein-coding gene	gene with protein product		600747				8530034	Standard	NM_005994		Approved		uc010wox.2	Q13207	OTTHUMG00000156986	ENST00000240328.3:c.1289G>A	17.37:g.59482800G>A	ENSP00000240328:p.Arg430Gln	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	6.0	NM_005994	Q16424|Q7Z647	Missense_Mutation	SNP	ENST00000240328.3	37	CCDS11627.2	.	.	.	.	.	.	.	.	.	.	G	19.90	3.913629	0.72983	.	.	ENSG00000121068	ENST00000240328	D	0.86432	-2.12	4.34	4.34	0.51931	.	0.319624	0.32258	N	0.006350	D	0.82591	0.5070	N	0.14661	0.345	0.58432	D	0.999999	D	0.69078	0.997	P	0.52109	0.69	T	0.82125	-0.0612	10	0.28530	T	0.3	.	15.5774	0.76404	0.0:0.0:1.0:0.0	.	430	Q13207	TBX2_HUMAN	Q	430	ENSP00000240328:R430Q	ENSP00000240328:R430Q	R	+	2	0	TBX2	56837582	1.000000	0.71417	0.840000	0.33206	0.272000	0.26649	4.064000	0.57506	2.240000	0.73641	0.561000	0.74099	CGG	.		0.746	TBX2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346977.2	NM_005994	
TDRD5	163589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179604969	179604969	+	Silent	SNP	G	G	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:179604969G>C	ENST00000367614.1	+	9	1826	c.1467G>C	c.(1465-1467)cgG>cgC	p.R489R	TDRD5_ENST00000294848.8_Silent_p.R489R|TDRD5_ENST00000444136.1_Silent_p.R489R	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	489					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)		p.R489R(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TCTACATCCGGATCTATAGCA	0.418																																					p.R489R		.											.	TDRD5	94	1	Substitution - coding silent(1)	lung(1)	c.G1467C						.						106.0	102.0	103.0					1																	179604969		2203	4300	6503	SO:0001819	synonymous_variant	163589	exon9			CATCCGGATCTAT	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1467G>C	1.37:g.179604969G>C		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	36.0	NM_173533	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	ENST00000367614.1	37	CCDS1332.1																																																																																			.		0.418	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
TDRD6	221400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46660441	46660441	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr6:46660441A>G	ENST00000316081.6	+	1	4576	c.4576A>G	c.(4576-4578)Act>Gct	p.T1526A	TDRD6_ENST00000544460.1_Missense_Mutation_p.T1526A	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1526					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			AGCTTATGCCACTGTGATAGA	0.378																																					p.T1526A		.											.	TDRD6	138	0			c.A4576G						.						118.0	117.0	117.0					6																	46660441		2203	4300	6503	SO:0001583	missense	221400	exon1			TATGCCACTGTGA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.4576A>G	6.37:g.46660441A>G	ENSP00000346065:p.Thr1526Ala	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	284.0	88.0	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	15.83	2.948829	0.53186	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.12361	2.69;2.69	6.07	3.68	0.42216	Maternal tudor protein (1);	0.413900	0.25648	N	0.029232	T	0.12390	0.0301	M	0.83223	2.63	0.22541	N	0.999001	P;P	0.49358	0.906;0.923	P;P	0.51415	0.539;0.669	T	0.14504	-1.0470	10	0.28530	T	0.3	-10.7704	7.5322	0.27689	0.7937:0.0:0.0683:0.1379	.	1526;1526	F5H5M3;O60522	.;TDRD6_HUMAN	A	1526	ENSP00000443299:T1526A;ENSP00000346065:T1526A	ENSP00000346065:T1526A	T	+	1	0	TDRD6	46768400	0.058000	0.20735	0.957000	0.39632	0.991000	0.79684	1.423000	0.34837	0.526000	0.28541	0.533000	0.62120	ACT	.		0.378	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
THBS3	7059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155172876	155172876	+	Splice_Site	SNP	C	C	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:155172876C>A	ENST00000368378.3	-	7	829		c.e7+1		RP11-263K19.4_ENST00000430312.1_RNA|RP11-263K19.4_ENST00000436772.1_RNA|THBS3_ENST00000541990.1_Splice_Site|THBS3_ENST00000486260.1_Intron|THBS3_ENST00000541576.1_5'Flank|RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000447623.1_RNA|THBS3_ENST00000457183.2_Splice_Site|RP11-263K19.4_ENST00000422665.1_RNA|RP11-263K19.4_ENST00000454348.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3						bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTCCCACTCACCGCACACCTG	0.562																																					.		.											.	THBS3	222	0			c.808+1G>T						.						114.0	97.0	103.0					1																	155172876		2203	4300	6503	SO:0001630	splice_region_variant	7059	exon8			CACTCACCGCACA	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.808+1G>T	1.37:g.155172876C>A		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	58.0	NM_007112	B1AVR8|B4DQ20|Q8WV34	Splice_Site	SNP	ENST00000368378.3	37	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.212999	0.79352	.	.	ENSG00000169231	ENST00000368378;ENST00000457183	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7058	0.85371	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	THBS3	153439500	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.234000	0.78134	2.884000	0.98904	0.655000	0.94253	.	.		0.562	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	Intron
THSD7B	80731	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	138414638	138414638	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:138414638G>A	ENST00000409968.1	+	24	4461	c.4283G>A	c.(4282-4284)gGc>gAc	p.G1428D	THSD7B_ENST00000272643.3_Missense_Mutation_p.G1431D|THSD7B_ENST00000413152.2_Missense_Mutation_p.G1400D|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1430	TSP type-1 18. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CTTACAGGAGGCAAATGTTAT	0.388																																					.		.											.	THSD7B	75	0			.						.						109.0	107.0	107.0					2																	138414638		1915	4134	6049	SO:0001583	missense	80731	.			CAGGAGGCAAATG			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.4283G>A	2.37:g.138414638G>A	ENSP00000387145:p.Gly1428Asp	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	44.0	.		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	G	29.8	5.037858	0.93630	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.48836	0.8;0.8;0.8	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	T	0.70954	0.3283	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65557	-0.6139	10	0.37606	T	0.19	.	20.8599	0.99761	0.0:0.0:1.0:0.0	.	1400	C9JKN6	.	D	1428;1431;1400	ENSP00000387145:G1428D;ENSP00000272643:G1431D;ENSP00000413841:G1400D	ENSP00000272643:G1431D	G	+	2	0	THSD7B	138131108	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GGC	.		0.388	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
TNS1	7145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	218700829	218700829	+	Missense_Mutation	SNP	G	G	T	rs141836163	byFrequency	TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:218700829G>T	ENST00000171887.4	-	18	3190	c.2738C>A	c.(2737-2739)cCt>cAt	p.P913H	TNS1_ENST00000419504.1_Missense_Mutation_p.P913H|TNS1_ENST00000430930.1_Missense_Mutation_p.P913H	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	913					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		AGGGCTACGAGGGGATGTGGC	0.647																																					p.P913H		.											.	TNS1	156	0			c.C2738A						.						81.0	79.0	80.0					2																	218700829		2203	4300	6503	SO:0001583	missense	7145	exon18			CTACGAGGGGATG	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.2738C>A	2.37:g.218700829G>T	ENSP00000171887:p.Pro913His	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	69.0	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199551	0.58126	.	.	ENSG00000079308	ENST00000171887;ENST00000446688;ENST00000419504;ENST00000430930	D;T;D;D	0.91740	-2.9;2.06;-2.86;-2.9	5.38	5.38	0.77491	.	0.180261	0.49305	D	0.000147	D	0.92335	0.7568	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.66196	0.942;0.942;0.897	D	0.92534	0.6036	10	0.46703	T	0.11	.	18.0736	0.89421	0.0:0.0:1.0:0.0	.	913;913;913	Q9HBL0;E9PGF5;E9PF55	TENS1_HUMAN;.;.	H	913;72;913;913	ENSP00000171887:P913H;ENSP00000394171:P72H;ENSP00000408724:P913H;ENSP00000406016:P913H	ENSP00000171887:P913H	P	-	2	0	TNS1	218409074	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.122000	0.50446	2.793000	0.96121	0.655000	0.94253	CCT	G|0.999;A|0.001		0.647	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
TOP2A	7153	ucsc.edu;bcgsc.ca	37	17	38560724	38560724	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr17:38560724G>T	ENST00000423485.1	-	18	2224	c.2066C>A	c.(2065-2067)aCt>aAt	p.T689N		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	689					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	ATATGTGGTAGTTTGTCCATA	0.368																																					p.T689N		.											.	TOP2A	655	0			c.C2066A						.						134.0	126.0	129.0					17																	38560724		1870	4096	5966	SO:0001583	missense	7153	exon18			GTGGTAGTTTGTC		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.2066C>A	17.37:g.38560724G>T	ENSP00000411532:p.Thr689Asn	Somatic	118.0	2.0		WXS	Illumina HiSeq	.	163.0	87.0	NM_001067	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	ENST00000423485.1	37	CCDS45672.1	.	.	.	.	.	.	.	.	.	.	G	7.746	0.702299	0.15172	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.21734	1.99	5.5	3.44	0.39384	DNA topoisomerase, type IIA, central (1);	0.589102	0.18881	N	0.128580	T	0.11750	0.0286	N	0.16833	0.445	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31641	-0.9936	10	0.11182	T	0.66	.	11.4892	0.50371	0.0:0.3435:0.5246:0.1318	.	689	P11388	TOP2A_HUMAN	N	689;769;712;725	ENSP00000411532:T689N	ENSP00000269577:T769N	T	-	2	0	TOP2A	35814250	0.962000	0.33011	0.992000	0.48379	0.988000	0.76386	2.138000	0.42140	0.641000	0.30601	0.591000	0.81541	ACT	.		0.368	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
TPO	7173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1488375	1488375	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:1488375C>T	ENST00000345913.4	+	9	1437	c.1346C>T	c.(1345-1347)aCc>aTc	p.T449I	TPO_ENST00000346956.3_Missense_Mutation_p.T449I|TPO_ENST00000349624.3_Missense_Mutation_p.T276I|TPO_ENST00000329066.4_Missense_Mutation_p.T449I|TPO_ENST00000382201.3_Missense_Mutation_p.T449I|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000337415.3_Missense_Mutation_p.T449I|TPO_ENST00000382198.1_Missense_Mutation_p.T276I	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	449					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CAGATCATCACCCTGAGGGAT	0.582																																					p.T449I		.											.	TPO	332	0			c.C1346T						.						55.0	51.0	52.0					2																	1488375		2203	4300	6503	SO:0001583	missense	7173	exon9			TCATCACCCTGAG		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1346C>T	2.37:g.1488375C>T	ENSP00000318820:p.Thr449Ile	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	239.0	83.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275390	0.59649	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.85048	0.5608	M	0.77712	2.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.91635	0.992;0.999;0.982;0.996	D	0.86662	0.1905	10	0.72032	D	0.01	-56.2999	18.9749	0.92731	0.0:1.0:0.0:0.0	.	449;276;449;449	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	I	449;449;449;276;449;449;276;378	ENSP00000337263:T449I;ENSP00000318820:T449I;ENSP00000263886:T449I;ENSP00000332044:T276I;ENSP00000329869:T449I;ENSP00000371636:T449I;ENSP00000371633:T276I;ENSP00000405788:T378I	ENSP00000329869:T449I	T	+	2	0	TPO	1467382	1.000000	0.71417	0.962000	0.40283	0.031000	0.12232	4.551000	0.60740	2.473000	0.83533	0.561000	0.74099	ACC	.		0.582	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TRIM59	286827	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	160156300	160156300	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:160156300T>A	ENST00000309784.4	-	3	857	c.672A>T	c.(670-672)agA>agT	p.R224S	RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.R224S|TRIM59_ENST00000543469.1_Missense_Mutation_p.R224S	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	224					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTTCCTTCATTCTTTCAATTT	0.328																																					p.R224S		.											.	TRIM59	658	0			c.A672T						.						88.0	93.0	92.0					3																	160156300		2203	4300	6503	SO:0001583	missense	286827	exon3			CTTCATTCTTTCA	AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.672A>T	3.37:g.160156300T>A	ENSP00000311219:p.Arg224Ser	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	64.0	NM_173084	A8K5G9|D3DNL9	Missense_Mutation	SNP	ENST00000309784.4	37	CCDS3190.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.418725	0.62622	.	.	ENSG00000213186	ENST00000543469;ENST00000309784	T;T	0.23950	2.07;1.88	5.77	0.644	0.17776	.	0.227039	0.45606	D	0.000353	T	0.15565	0.0375	L	0.42245	1.32	0.21762	N	0.999554	B	0.27625	0.183	B	0.22386	0.039	T	0.14337	-1.0476	9	.	.	.	-4.4696	3.9254	0.09261	0.172:0.413:0.0:0.4149	.	224	Q8IWR1	TRI59_HUMAN	S	224	ENSP00000444313:R224S;ENSP00000311219:R224S	.	R	-	3	2	TRIM59	161638994	0.001000	0.12720	0.924000	0.36721	0.982000	0.71751	-0.473000	0.06615	0.090000	0.17273	0.459000	0.35465	AGA	.		0.328	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352963.1	NM_173084	
TRMT1	55621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	13220610	13220610	+	Silent	SNP	C	C	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr19:13220610C>T	ENST00000592062.1	-	11	1719	c.1149G>A	c.(1147-1149)gaG>gaA	p.E383E	TRMT1_ENST00000221504.8_Silent_p.E354E|TRMT1_ENST00000357720.4_Silent_p.E383E|TRMT1_ENST00000437766.1_Silent_p.E383E			Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)	383	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		AGTGTTCACACTCGGGGGTCA	0.612																																					p.E383E		.											.	TRMT1	92	0			c.G1149A						.						74.0	75.0	75.0					19																	13220610		2203	4300	6503	SO:0001819	synonymous_variant	55621	exon10			TTCACACTCGGGG	AF196479	CCDS12293.1, CCDS45997.1	19p13.13	2012-06-12	2012-06-12						25980	protein-coding gene	gene with protein product		611669				10982862	Standard	NM_001142554		Approved	FLJ20244, TRM1	uc002mwl.3	Q9NXH9		ENST00000592062.1:c.1149G>A	19.37:g.13220610C>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	20.0	NM_001136035	O76103|Q548Y5|Q8WVA6	Silent	SNP	ENST00000592062.1	37	CCDS12293.1																																																																																			.		0.612	TRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452780.2	NM_017722	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	179590676	179590676	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:179590676C>G	ENST00000591111.1	-	68	19646	c.19422G>C	c.(19420-19422)gaG>gaC	p.E6474D	TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E6791D|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E5547D			Q8WZ42	TITIN_HUMAN	titin	12075	Ig-like 46.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCATACCACCTCAAACGGTG	0.428																																					p.E6791D		.											.	TTN	636	0			c.G20373C						.						95.0	91.0	92.0					2																	179590676		1908	4137	6045	SO:0001583	missense	7273	exon70			TACCACCTCAAAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.19422G>C	2.37:g.179590676C>G	ENSP00000465570:p.Glu6474Asp	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	234.0	128.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	10.85	1.467413	0.26335	.	.	ENSG00000155657	ENST00000342992	T	0.68181	-0.31	5.87	2.08	0.27032	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54854	0.1884	L	0.58510	1.815	0.80722	D	1	B	0.15141	0.012	B	0.12156	0.007	T	0.56318	-0.7999	9	0.87932	D	0	.	0.5624	0.00681	0.1872:0.3153:0.2277:0.2699	.	6474	Q8WZ42	TITIN_HUMAN	D	5547	ENSP00000343764:E5547D	ENSP00000343764:E5547D	E	-	3	2	TTN	179298921	0.134000	0.22483	1.000000	0.80357	0.919000	0.55068	-0.499000	0.06413	0.486000	0.27676	-0.150000	0.13652	GAG	.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TYSND1	219743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71899886	71899886	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr10:71899886T>A	ENST00000287078.6	-	4	1494	c.1495A>T	c.(1495-1497)Agc>Tgc	p.S499C	TYSND1_ENST00000335494.5_Missense_Mutation_p.Q393L|TYSND1_ENST00000494143.1_5'UTR	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	499	Serine protease.				protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						CGGGTGTTGCTGGTGATTATG	0.597																																					p.S499C		.											.	TYSND1	135	0			c.A1495T						.						111.0	86.0	94.0					10																	71899886		2203	4300	6503	SO:0001583	missense	219743	exon4			TGTTGCTGGTGAT	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.1495A>T	10.37:g.71899886T>A	ENSP00000287078:p.Ser499Cys	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	76.0	NM_173555	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Missense_Mutation	SNP	ENST00000287078.6	37	CCDS31213.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.5|22.5	4.296577|4.296577	0.81025|0.81025	.|.	.|.	ENSG00000156521|ENSG00000156521	ENST00000335494|ENST00000287078	T|D	0.42513|0.88818	0.97|-2.43	5.85|5.85	5.85|5.85	0.93711|0.93711	.|Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94434|0.94434	0.8209|0.8209	.|.	.|.	.|.	0.38745|0.38745	D|D	0.953983|0.953983	D|D	0.76494|0.89917	0.999|1.0	D|D	0.68943|0.87578	0.961|0.998	D|D	0.95717|0.95717	0.8763|0.8763	8|9	0.18276|0.72032	T|D	0.48|0.01	-41.7766|-41.7766	15.0531|15.0531	0.71891|0.71891	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	393|499	Q2T9J0-2|Q2T9J0	.|TYSD1_HUMAN	L|C	393|499	ENSP00000335673:Q393L|ENSP00000287078:S499C	ENSP00000335673:Q393L|ENSP00000287078:S499C	Q|S	-|-	2|1	0|0	TYSND1|TYSND1	71569892|71569892	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.663000|0.663000	0.39108|0.39108	7.825000|7.825000	0.86693|0.86693	2.238000|2.238000	0.73509|0.73509	0.528000|0.528000	0.53228|0.53228	CAG|AGC	.		0.597	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048483.1	NM_173555	
USP19	10869	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49152692	49152692	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:49152692G>A	ENST00000398888.2	-	12	2000	c.1682C>T	c.(1681-1683)aCc>aTc	p.T561I	USP19_ENST00000417901.1_Missense_Mutation_p.T664I|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000398892.3_Missense_Mutation_p.T601I|USP19_ENST00000398896.1_Missense_Mutation_p.T369I|USP19_ENST00000434032.2_Missense_Mutation_p.T662I|USP19_ENST00000398898.2_Missense_Mutation_p.T601I|USP19_ENST00000453664.1_Missense_Mutation_p.T652I	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	561	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGCATGGTGGGTGCCCTTCCA	0.622																																					p.T664I		.											.	USP19	663	0			c.C1991T						.						44.0	50.0	48.0					3																	49152692		2073	4190	6263	SO:0001583	missense	10869	exon13			TGGTGGGTGCCCT	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.1682C>T	3.37:g.49152692G>A	ENSP00000381863:p.Thr561Ile	Somatic	55.0	1.0		WXS	Illumina HiSeq	Phase_I	64.0	22.0	NM_001199161	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075237	0.76415	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032	T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.6	5.6	0.85130	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.088250	0.85682	D	0.000000	T	0.56514	0.1990	M	0.69463	2.115	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.993;0.999	T	0.54476	-0.8288	10	0.51188	T	0.08	-20.7752	19.2102	0.93751	0.0:0.0:1.0:0.0	.	662;652;561;601;647;369	E9PEG8;E7EN22;O94966;B5MEG5;O94966-2;E7ESU0	.;.;UBP19_HUMAN;.;.;.	I	369;601;664;652;601;561;662	ENSP00000381870:T369I;ENSP00000381872:T601I;ENSP00000395260:T664I;ENSP00000400090:T652I;ENSP00000381867:T601I;ENSP00000381863:T561I;ENSP00000401197:T662I	ENSP00000381863:T561I	T	-	2	0	USP19	49127696	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.744000	0.98853	2.628000	0.89032	0.655000	0.94253	ACC	.		0.622	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
USP53	54532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	120182988	120182988	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr4:120182988G>T	ENST00000274030.6	+	12	2120	c.941G>T	c.(940-942)tGg>tTg	p.W314L	USP53_ENST00000450251.1_Missense_Mutation_p.W314L	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						AGTTCCAAATGGGTATTTTTT	0.308																																					p.W314L		.											.	USP53	660	0			c.G941T						.						98.0	90.0	92.0					4																	120182988		1829	4084	5913	SO:0001583	missense	54532	exon11			CCAAATGGGTATT	BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.941G>T	4.37:g.120182988G>T	ENSP00000274030:p.Trp314Leu	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	56.0	NM_019050		Missense_Mutation	SNP	ENST00000274030.6	37	CCDS43265.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876206	0.91664	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.33216	1.42;1.42	5.81	5.81	0.92471	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.64394	0.2594	M	0.87971	2.92	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.69018	-0.5256	10	0.87932	D	0	-10.4211	20.089	0.97809	0.0:0.0:1.0:0.0	.	314	Q70EK8	UBP53_HUMAN	L	314	ENSP00000274030:W314L;ENSP00000409906:W314L	ENSP00000274030:W314L	W	+	2	0	USP53	120402436	1.000000	0.71417	0.999000	0.59377	0.925000	0.55904	9.292000	0.96076	2.752000	0.94435	0.557000	0.71058	TGG	.		0.308	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364564.2	XM_052597	
VWA5B2	90113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183956399	183956399	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr3:183956399C>G	ENST00000426955.2	+	13	2040	c.1940C>G	c.(1939-1941)tCt>tGt	p.S647C	EIF2B5_ENST00000444495.1_Intron|VWA5B2_ENST00000273794.5_Missense_Mutation_p.S429C|MIR1224_ENST00000408193.1_RNA	NM_138345.1	NP_612354.1	Q8N398	VW5B2_HUMAN	von Willebrand factor A domain containing 5B2	658										breast(3)|endometrium(4)|kidney(1)|lung(1)|prostate(1)|skin(5)	15						CCCAACCCCTCTGACACAGCC	0.632																																					p.S647C		.											.	.	.	0			c.C1940G						.						58.0	55.0	56.0					3																	183956399		692	1591	2283	SO:0001583	missense	90113	exon13			ACCCCTCTGACAC		CCDS54686.1	3q27.1	2008-07-25	2008-07-25		ENSG00000145198	ENSG00000145198			25144	protein-coding gene	gene with protein product						15231747	Standard	NM_138345		Approved	DKFZp761K032, LOC90113	uc011bra.2	Q8N398	OTTHUMG00000156820	ENST00000426955.2:c.1940C>G	3.37:g.183956399C>G	ENSP00000398688:p.Ser647Cys	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	28.0	NM_138345	B9EGN7	Missense_Mutation	SNP	ENST00000426955.2	37	CCDS54686.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807631	0.50421	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	T;T	0.21031	2.74;2.03	4.83	3.96	0.45880	.	0.265469	0.26948	N	0.021692	T	0.32436	0.0829	L	0.36672	1.1	0.09310	N	0.999994	D;D;D	0.76494	0.999;0.999;0.998	D;D;P	0.65573	0.936;0.936;0.888	T	0.05289	-1.0894	10	0.52906	T	0.07	.	11.9975	0.53212	0.0:0.9154:0.0:0.0846	.	429;647;658	E9PF42;B9EGN7;Q8N398	.;.;VW5B2_HUMAN	C	647;429	ENSP00000398688:S647C;ENSP00000273794:S429C	ENSP00000273794:S429C	S	+	2	0	VWA5B2	185439093	0.997000	0.39634	0.670000	0.29842	0.990000	0.78478	2.495000	0.45337	1.399000	0.46721	0.563000	0.77884	TCT	.		0.632	VWA5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346004.2	XM_291077	
WDR63	126820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	85561679	85561679	+	Silent	SNP	T	T	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr1:85561679T>A	ENST00000294664.6	+	11	1419	c.1239T>A	c.(1237-1239)atT>atA	p.I413I	WDR63_ENST00000326813.8_Silent_p.I374I|WDR63_ENST00000370596.1_Silent_p.I374I	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	413										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		CTAATATCATTGCTGGAGGCT	0.388																																					p.I413I		.											.	WDR63	95	0			c.T1239A						.						155.0	149.0	151.0					1																	85561679		2203	4300	6503	SO:0001819	synonymous_variant	126820	exon11			TATCATTGCTGGA		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.1239T>A	1.37:g.85561679T>A		Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	53.0	NM_145172	A8K988|Q96L72|Q96NU4	Silent	SNP	ENST00000294664.6	37	CCDS702.1																																																																																			.		0.388	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	NM_145172	
WDR7	23335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	54358525	54358525	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr18:54358525G>A	ENST00000254442.3	+	8	1007	c.796G>A	c.(796-798)Gtc>Atc	p.V266I	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.V266I	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	266					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GGGGGACTTTGTCTCATCAGA	0.423																																					p.V266I		.											.	WDR7	93	0			c.G796A						.						88.0	96.0	93.0					18																	54358525		2203	4300	6503	SO:0001583	missense	23335	exon8			GACTTTGTCTCAT	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.796G>A	18.37:g.54358525G>A	ENSP00000254442:p.Val266Ile	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	16.0	NM_052834	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	G	7.350	0.622634	0.14193	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.46819	0.86;0.86	5.45	4.57	0.56435	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.181053	0.48767	D	0.000180	T	0.22205	0.0535	N	0.03253	-0.375	0.40458	D	0.980212	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.13229	-1.0517	10	0.14656	T	0.56	.	11.1937	0.48700	0.147:0.0:0.853:0.0	.	266;266	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	I	266	ENSP00000254442:V266I;ENSP00000350187:V266I	ENSP00000254442:V266I	V	+	1	0	WDR7	52509523	1.000000	0.71417	0.999000	0.59377	0.834000	0.47266	2.591000	0.46163	2.729000	0.93468	0.460000	0.39030	GTC	.		0.423	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	72828036	72828036	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr16:72828036C>G	ENST00000268489.5	-	9	9217	c.8545G>C	c.(8545-8547)Gac>Cac	p.D2849H	ZFHX3_ENST00000397992.5_Missense_Mutation_p.D1935H|RP5-991G20.4_ENST00000569195.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2849					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TTGCCCTCGTCTCCAGTTGTG	0.493																																					p.D2849H		.											.	ZFHX3	72	0			c.G8545C						.						260.0	213.0	229.0					16																	72828036		2198	4300	6498	SO:0001583	missense	463	exon9			CCTCGTCTCCAGT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.8545G>C	16.37:g.72828036C>G	ENSP00000268489:p.Asp2849His	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	44.0	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.841602	0.32513	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.77750	-1.12;-1.08	5.96	5.96	0.96718	.	0.000000	0.52532	D	0.000075	D	0.87676	0.6237	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87367	0.2348	10	0.72032	D	0.01	.	20.4043	0.99006	0.0:1.0:0.0:0.0	.	2849	Q15911	ZFHX3_HUMAN	H	2849;1935	ENSP00000268489:D2849H;ENSP00000438926:D1935H	ENSP00000268489:D2849H	D	-	1	0	ZFHX3	71385537	1.000000	0.71417	0.904000	0.35570	0.963000	0.63663	7.818000	0.86416	2.823000	0.97156	0.650000	0.86243	GAC	.		0.493	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZC3H18	124245	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	88696976	88696976	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr16:88696976G>T	ENST00000301011.5	+	17	2850	c.2650G>T	c.(2650-2652)Gcc>Tcc	p.A884S	ZC3H18_ENST00000452588.2_Missense_Mutation_p.A908S	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	884						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		AGCCCCTGCAGCCCCGGCTGA	0.677																																					p.A884S	Ovarian(121;375 2276 20373 38669)	.											.	ZC3H18	69	0			c.G2650T						.						30.0	32.0	31.0					16																	88696976		2193	4294	6487	SO:0001583	missense	124245	exon17			CCTGCAGCCCCGG	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.2650G>T	16.37:g.88696976G>T	ENSP00000301011:p.Ala884Ser	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	9.0	NM_144604	Q96DG4|Q96MP7	Missense_Mutation	SNP	ENST00000301011.5	37	CCDS10967.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.52|15.52	2.859121|2.859121	0.51376|0.51376	.|.	.|.	ENSG00000158545|ENSG00000158545	ENST00000301011;ENST00000452588|ENST00000289509	T;T|.	0.27720|.	1.66;1.65|.	5.51|5.51	3.05|3.05	0.35203|0.35203	.|.	0.277205|.	0.42682|.	D|.	0.000680|.	T|T	0.34629|0.34629	0.0904|0.0904	L|L	0.28274|0.28274	0.84|0.84	0.09310|0.09310	N|N	1|1	D;D|.	0.58620|.	0.983;0.971|.	P;P|.	0.60541|.	0.876;0.79|.	T|T	0.27400|0.27400	-1.0075|-1.0075	10|6	0.16896|0.87932	T|D	0.51|0	-14.9097|-14.9097	8.0252|8.0252	0.30434|0.30434	0.2598:0.0:0.7402:0.0|0.2598:0.0:0.7402:0.0	.|.	908;884|.	E7ERS3;Q86VM9|.	.;ZCH18_HUMAN|.	S|H	884;908|709	ENSP00000301011:A884S;ENSP00000416951:A908S|.	ENSP00000301011:A884S|ENSP00000289509:Q709H	A|Q	+|+	1|3	0|2	ZC3H18|ZC3H18	87224477|87224477	0.127000|0.127000	0.22367|0.22367	0.042000|0.042000	0.18584|0.18584	0.431000|0.431000	0.31685|0.31685	1.282000|1.282000	0.33226|0.33226	1.161000|1.161000	0.42604|0.42604	0.561000|0.561000	0.74099|0.74099	GCC|CAG	.		0.677	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	
ZNF320	162967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53384284	53384284	+	Silent	SNP	A	A	C			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr19:53384284A>C	ENST00000595635.1	-	8	1596	c.1095T>G	c.(1093-1095)gcT>gcG	p.A365A	ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000391781.2_Silent_p.A365A|ZNF320_ENST00000600930.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		CACTCCGGAAAGCCTTGTCAC	0.403																																					p.A365A		.											.	ZNF320	91	0			c.T1095G						.						128.0	122.0	124.0					19																	53384284		2203	4300	6503	SO:0001819	synonymous_variant	162967	exon4			CCGGAAAGCCTTG	AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.1095T>G	19.37:g.53384284A>C		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	41.0	NM_207333	Q8NDR6	Silent	SNP	ENST00000595635.1	37	CCDS33095.1																																																																																			.		0.403	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	NM_207333	
ZNFX1	57169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	47865291	47865291	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr20:47865291A>G	ENST00000396105.1	-	14	4516	c.4270T>C	c.(4270-4272)Tat>Cat	p.Y1424H	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Missense_Mutation_p.Y1424H	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1424							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			AGACCACCATACAGGAGGCCT	0.527																																					p.Y1424H		.											.	ZNFX1	24	0			c.T4270C						.						87.0	85.0	85.0					20																	47865291		2203	4300	6503	SO:0001583	missense	57169	exon14			CACCATACAGGAG	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.4270T>C	20.37:g.47865291A>G	ENSP00000379412:p.Tyr1424His	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	28.0	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.536997	0.00942	.	.	ENSG00000124201	ENST00000371752;ENST00000396105	D;D	0.85861	-2.04;-2.04	6.06	2.63	0.31362	.	0.324362	0.29126	N	0.013075	T	0.71995	0.3406	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.53556	-0.8422	10	0.16896	T	0.51	-8.242	8.2977	0.31995	0.7708:0.0:0.2292:0.0	.	1424	Q9P2E3	ZNFX1_HUMAN	H	1424	ENSP00000360817:Y1424H;ENSP00000379412:Y1424H	ENSP00000360817:Y1424H	Y	-	1	0	ZNFX1	47298698	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.695000	0.25527	0.526000	0.28541	0.528000	0.53228	TAT	.		0.527	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
ZRANB3	84083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	135976732	135976732	+	Missense_Mutation	SNP	C	C	T	rs373108921		TCGA-DD-A73E-01A-12D-A32G-10	TCGA-DD-A73E-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7c7b2ed-0c9e-4c8e-a7f0-fb7d0f0b11ea	004c3f02-8bf1-4c76-9fb6-8a3c75687ce2	g.chr2:135976732C>T	ENST00000264159.6	-	16	2383	c.2267G>A	c.(2266-2268)aGc>aAc	p.S756N	ZRANB3_ENST00000401392.1_Missense_Mutation_p.S754N|ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000536680.1_Missense_Mutation_p.S754N	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	756					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		GAAATTACAGCTCATCTGTTT	0.313																																					p.S756N		.											.	ZRANB3	658	0			c.G2267A						.						40.0	38.0	38.0					2																	135976732		1796	4055	5851	SO:0001583	missense	84083	exon16			TTACAGCTCATCT	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.2267G>A	2.37:g.135976732C>T	ENSP00000264159:p.Ser756Asn	Somatic	215.0	0.0		WXS	Illumina HiSeq	Phase_I	287.0	86.0	NM_032143	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	C	3.359	-0.130935	0.06753	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.90324	-2.65;-2.65;-2.64	6.07	3.76	0.43208	.	0.196582	0.52532	N	0.000072	T	0.59542	0.2201	N	0.00088	-2.19	0.25032	N	0.991263	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.60762	-0.7199	10	0.02654	T	1	-19.2355	9.3422	0.38087	0.0:0.1476:0.0:0.8524	.	756;754	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	N	219;219;754;756;754	ENSP00000383979:S754N;ENSP00000264159:S756N;ENSP00000441320:S754N	ENSP00000264159:S756N	S	-	2	0	ZRANB3	135693202	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.004000	0.29822	1.127000	0.42034	-0.302000	0.09304	AGC	.		0.313	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
