#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCF1	23	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30557649	30557649	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr6:30557649C>T	ENST00000326195.8	+	22	2243	c.2131C>T	c.(2131-2133)Ctg>Ttg	p.L711L	ABCF1_ENST00000396515.4_Intron|ABCF1_ENST00000376545.3_Silent_p.L673L	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	711	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						CACTGAGTACCTGCAGCGGGG	0.597																																					p.L711L		.											.	ABCF1	92	0			c.C2131T						.						106.0	117.0	113.0					6																	30557649		1511	2709	4220	SO:0001819	synonymous_variant	23	exon22			GAGTACCTGCAGC	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.2131C>T	6.37:g.30557649C>T		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	16.0	NM_001025091	A2BF75|O14897|Q69YP6	Silent	SNP	ENST00000326195.8	37	CCDS34380.1																																																																																			.		0.597	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3		
ADAMTS20	80070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	43837682	43837682	+	Silent	SNP	A	A	G	rs370946000		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr12:43837682A>G	ENST00000389420.3	-	16	2201	c.2202T>C	c.(2200-2202)taT>taC	p.Y734Y	ADAMTS20_ENST00000553158.1_Silent_p.Y734Y	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	734	Spacer.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CAACAACATTATAACCTGCAA	0.363																																					p.Y734Y		.											.	ADAMTS20	795	0			c.T2202C						.	A		0,4406		0,0,2203	127.0	130.0	129.0		2202	2.7	1.0	12		129	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADAMTS20	NM_025003.3		0,1,6502	GG,GA,AA		0.0116,0.0,0.0077		734/1911	43837682	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	80070	exon16			AACATTATAACCT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2202T>C	12.37:g.43837682A>G		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	14.0	NM_025003	A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	37	CCDS31778.2																																																																																			.		0.363	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
ADAMTSL4	54507	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	150529206	150529206	+	Silent	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:150529206G>A	ENST00000369038.2	+	8	1887	c.1686G>A	c.(1684-1686)agG>agA	p.R562R	ADAMTSL4_ENST00000369039.5_Silent_p.R585R|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Silent_p.R562R|ADAMTSL4_ENST00000369041.5_Silent_p.R562R			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	562					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GTCCTCCCAGGGAGGAGGGCA	0.652																																					p.R562R		.											.	ADAMTSL4	92	0			c.G1686A						.						100.0	117.0	112.0					1																	150529206		2203	4300	6503	SO:0001819	synonymous_variant	54507	exon10			TCCCAGGGAGGAG	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.1686G>A	1.37:g.150529206G>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	7.0	NM_019032	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Silent	SNP	ENST00000369038.2	37	CCDS955.1																																																																																			.		0.652	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032	
AKR1C3	8644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5139644	5139644	+	Silent	SNP	C	C	A	rs118150330	byFrequency	TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr10:5139644C>A	ENST00000380554.3	+	3	923	c.271C>A	c.(271-273)Cga>Aga	p.R91R	AKR1C3_ENST00000470862.2_3'UTR|AKR1C3_ENST00000439082.2_5'UTR|AKR1C3_ENST00000605149.1_Silent_p.R68R	NM_001253908.1|NM_003739.5	NP_001240837.1|NP_003730.4	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3	91					arachidonic acid metabolic process (GO:0019369)|cellular response to cadmium ion (GO:0071276)|cellular response to calcium ion (GO:0071277)|cellular response to corticosteroid stimulus (GO:0071384)|cellular response to jasmonic acid stimulus (GO:0071395)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to reactive oxygen species (GO:0034614)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|G-protein coupled receptor signaling pathway (GO:0007186)|keratinocyte differentiation (GO:0030216)|male gonad development (GO:0008584)|multicellular organismal macromolecule metabolic process (GO:0044259)|negative regulation of retinoic acid biosynthetic process (GO:1900053)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|protein import into nucleus, translocation (GO:0000060)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of testosterone biosynthetic process (GO:2000224)|renal absorption (GO:0070293)|response to nutrient (GO:0007584)|response to prostaglandin (GO:0034694)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	15-hydroxyprostaglandin-D dehydrogenase (NADP+) activity (GO:0047020)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|dihydrotestosterone 17-beta-dehydrogenase activity (GO:0035410)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|ketoreductase activity (GO:0045703)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin D2 11-ketoreductase activity (GO:0036131)|prostaglandin F receptor activity (GO:0004958)|prostaglandin-F synthase activity (GO:0047017)|retinal dehydrogenase activity (GO:0001758)|retinol dehydrogenase activity (GO:0004745)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)|testosterone dehydrogenase (NAD+) activity (GO:0047035)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|skin(1)	14					Bimatoprost(DB00905)|Doxorubicin(DB00997)	CACTTTTCATCGACCAGAGTT	0.393																																					p.R91R		.											.	AKR1C3	515	0			c.C271A						.						132.0	127.0	129.0					10																	5139644		2203	4300	6503	SO:0001819	synonymous_variant	8644	exon3			TTTCATCGACCAG	L43839	CCDS7063.1, CCDS73062.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000196139	ENSG00000196139	1.1.1.213, 1.1.1.188	"""Aldo-keto reductases"""	386	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase X"", ""prostaglandin F synthase"", ""3-alpha hydroxysteroid dehydrogenase, type II"""	603966	"""hydroxysteroid (17-beta) dehydrogenase 5"", ""aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)"""	HSD17B5		7650035, 9792917	Standard	NM_003739		Approved	KIAA0119, DDX, HAKRB, PGFS	uc021pml.1	P42330	OTTHUMG00000017585	ENST00000380554.3:c.271C>A	10.37:g.5139644C>A		Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	27.0	NM_001253909	A8K2V0|B4DL37|Q5T2L1|Q96DJ1|Q96KI8|Q99530|Q9UCX1|Q9UII3|Q9UKL9	Silent	SNP	ENST00000380554.3	37	CCDS7063.1																																																																																			C|0.999;T|0.001		0.393	AKR1C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046533.2	NM_003739	
AP3B2	8120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83328618	83328618	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr15:83328618C>T	ENST00000261722.3	-	25	3284	c.3077G>A	c.(3076-3078)tGt>tAt	p.C1026Y	AP3B2_ENST00000535359.1_Missense_Mutation_p.C1045Y|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Missense_Mutation_p.C994Y	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	1026					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			AGATGTCCCACAAGGAACACG	0.547																																					p.C1026Y		.											.	AP3B2	94	0			c.G3077A						.						104.0	96.0	99.0					15																	83328618		2055	4196	6251	SO:0001583	missense	8120	exon25			GTCCCACAAGGAA	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.3077G>A	15.37:g.83328618C>T	ENSP00000261722:p.Cys1026Tyr	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	18.0	NM_004644	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	37	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685673	0.68157	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359	T;T;T	0.55413	0.52;0.52;0.53	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.70570	0.3239	M	0.65975	2.015	0.80722	D	1	D;P;P	0.71674	0.998;0.91;0.91	D;B;B	0.72982	0.979;0.332;0.332	T	0.69569	-0.5110	10	0.36615	T	0.2	-8.7608	18.2494	0.89997	0.0:1.0:0.0:0.0	.	994;1045;1026	B7ZKR7;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	Y	1026;994;1045	ENSP00000261722:C1026Y;ENSP00000438721:C994Y;ENSP00000440984:C1045Y	ENSP00000261722:C1026Y	C	-	2	0	AP3B2	81125673	1.000000	0.71417	0.809000	0.32408	0.876000	0.50452	5.828000	0.69307	2.320000	0.78422	0.462000	0.41574	TGT	.		0.547	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
ARHGAP40	343578	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	20	37255663	37255663	+	Silent	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr20:37255663G>A	ENST00000373345.4	+	3	372	c.204G>A	c.(202-204)ctG>ctA	p.L68L		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	68					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						CCCAGTGGCTGCAGGACACAG	0.587																																					p.L120L		.											.	ARHGAP40	68	0			c.G360A						.						32.0	32.0	32.0					20																	37255663		692	1591	2283	SO:0001819	synonymous_variant	343578	exon3			GTGGCTGCAGGAC	AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.204G>A	20.37:g.37255663G>A		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	17.0	NM_001164431		Silent	SNP	ENST00000373345.4	37		.	.	.	.	.	.	.	.	.	.	G	10.04	1.242210	0.22796	.	.	ENSG00000124143	ENST00000243967	.	.	.	4.77	-0.242	0.13039	.	.	.	.	.	T	0.51075	0.1653	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39272	-0.9622	4	.	.	.	.	5.8712	0.18805	0.2839:0.0:0.5702:0.1459	.	.	.	.	T	9	.	.	A	+	1	0	ARHGAP40	36689077	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	0.561000	0.23515	0.086000	0.17137	0.643000	0.83706	GCA	.		0.587	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_293123	
ARL5B	221079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	18957556	18957556	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr10:18957556G>A	ENST00000377275.3	+	3	438	c.205G>A	c.(205-207)Ggt>Agt	p.G69S		NM_178815.3	NP_848930.1	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 5B	69					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(1)|ovary(1)	2						GGATATTGGTGGTCAGGAGTC	0.373																																					p.G69S		.											.	ARL5B	228	0			c.G205A						.						149.0	142.0	144.0					10																	18957556		2203	4300	6503	SO:0001583	missense	221079	exon3			ATTGGTGGTCAGG	AF494061	CCDS7131.1	10p13	2014-05-09	2005-11-03	2005-11-03	ENSG00000165997	ENSG00000165997		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23052	protein-coding gene	gene with protein product		608909	"""ADP-ribosylation factor-like 8"""	ARL8		12853149	Standard	XM_005252400		Approved		uc001iqd.1	Q96KC2	OTTHUMG00000017765	ENST00000377275.3:c.205G>A	10.37:g.18957556G>A	ENSP00000366487:p.Gly69Ser	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	18.0	NM_178815		Missense_Mutation	SNP	ENST00000377275.3	37	CCDS7131.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029595	0.93518	.	.	ENSG00000165997	ENST00000377275	D	0.99186	-5.53	5.83	5.83	0.93111	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.99648	0.9870	H	0.98664	4.295	0.80722	D	1	D	0.71674	0.998	D	0.74674	0.984	D	0.97607	1.0127	10	0.87932	D	0	-13.4351	20.1162	0.97934	0.0:0.0:1.0:0.0	.	69	Q96KC2	ARL5B_HUMAN	S	69	ENSP00000366487:G69S	ENSP00000366487:G69S	G	+	1	0	ARL5B	18997562	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	9.864000	0.99589	2.756000	0.94617	0.655000	0.94253	GGT	.		0.373	ARL5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047078.1	NM_178815	
ATHL1	80162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	290808	290808	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr11:290808C>G	ENST00000409548.2	+	4	716	c.601C>G	c.(601-603)Ctg>Gtg	p.L201V	RP11-326C3.2_ENST00000533924.1_RNA|ATHL1_ENST00000409479.1_Missense_Mutation_p.L201V|ATHL1_ENST00000409655.1_Missense_Mutation_p.L24V|RP11-326C3.2_ENST00000525217.1_RNA|RP11-326C3.2_ENST00000534742.1_RNA	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)	201					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GTGGGACTTCCTGACAGCAGT	0.667																																					p.L201V		.											.	ATHL1	516	0			c.C601G						.						51.0	50.0	50.0					11																	290808		2203	4300	6503	SO:0001583	missense	80162	exon4			GACTTCCTGACAG	AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.601C>G	11.37:g.290808C>G	ENSP00000387185:p.Leu201Val	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	6.0	NM_025092	Q658X8|Q8TEG9|Q9H635	Missense_Mutation	SNP	ENST00000409548.2	37	CCDS31322.2	.	.	.	.	.	.	.	.	.	.	C	6.510	0.462331	0.12342	.	.	ENSG00000142102	ENST00000409548;ENST00000409655;ENST00000409479	.	.	.	4.06	-1.78	0.07957	.	0.178793	0.37178	N	0.002214	T	0.36358	0.0964	L	0.45581	1.43	0.37722	D	0.924966	B;B;B	0.21225	0.009;0.038;0.053	B;B;B	0.18263	0.021;0.02;0.019	T	0.39981	-0.9587	9	0.02654	T	1	.	5.6093	0.17396	0.0:0.4993:0.2639:0.2367	.	201;201;24	Q32M88;E7EMA9;B8ZZ60	ATHL1_HUMAN;.;.	V	201;24;201	.	ENSP00000387099:L201V	L	+	1	2	ATHL1	280808	0.999000	0.42202	0.454000	0.27019	0.031000	0.12232	1.005000	0.29834	-0.287000	0.09064	0.448000	0.29417	CTG	.		0.667	ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330164.3	NM_025092	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52441263	52441263	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr3:52441263G>C	ENST00000460680.1	-	7	978	c.507C>G	c.(505-507)caC>caG	p.H169Q	BAP1_ENST00000296288.5_Missense_Mutation_p.H169Q	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H169Q(2)|p.E166fs*13(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGCTGACAAAGTGGAACGCCT	0.572			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.H169Q	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	BAP1,uveal_tract,malignant_melanoma,0	BAP1	1032	3	Substitution - Missense(2)|Deletion - Frameshift(1)	eye(3)	c.C507G						.						83.0	81.0	82.0					3																	52441263		2203	4300	6503	SO:0001583	missense	8314	exon7			GACAAAGTGGAAC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.507C>G	3.37:g.52441263G>C	ENSP00000417132:p.His169Gln	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	32.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584163	0.65992	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000470173	D;D;D	0.82526	-1.62;-1.62;-1.62	5.95	4.16	0.48862	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.85682	D	0.000000	D	0.93432	0.7905	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93788	0.7090	10	0.87932	D	0	-7.8942	11.0249	0.47739	0.217:0.0:0.783:0.0	.	169	Q92560	BAP1_HUMAN	Q	169;169;90	ENSP00000417132:H169Q;ENSP00000296288:H169Q;ENSP00000417776:H90Q	ENSP00000296288:H169Q	H	-	3	2	BAP1	52416303	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	0.356000	0.20181	0.847000	0.35167	-0.136000	0.14681	CAC	.		0.572	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
BIN1	274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	127806198	127806198	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:127806198C>T	ENST00000316724.5	-	19	2097	c.1686G>A	c.(1684-1686)tgG>tgA	p.W562*	BIN1_ENST00000259238.4_Nonsense_Mutation_p.W466*|BIN1_ENST00000357970.3_Nonsense_Mutation_p.W519*|BIN1_ENST00000466111.1_5'Flank|BIN1_ENST00000409400.1_Nonsense_Mutation_p.W408*|BIN1_ENST00000351659.3_Nonsense_Mutation_p.W475*|BIN1_ENST00000376113.2_Nonsense_Mutation_p.W393*|BIN1_ENST00000352848.3_Nonsense_Mutation_p.W423*|BIN1_ENST00000393040.3_Nonsense_Mutation_p.W451*|BIN1_ENST00000348750.4_Nonsense_Mutation_p.W378*|BIN1_ENST00000346226.3_Nonsense_Mutation_p.W487*|BIN1_ENST00000393041.3_Nonsense_Mutation_p.W444*	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1	562	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		CGCCCATGAGCCAGCCTTCAT	0.632																																					p.W562X		.											.	BIN1	655	0			c.G1686A						.						74.0	67.0	70.0					2																	127806198		2203	4300	6503	SO:0001587	stop_gained	274	exon19			CATGAGCCAGCCT	U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.1686G>A	2.37:g.127806198C>T	ENSP00000316779:p.Trp562*	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	22.0	NM_139343	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Nonsense_Mutation	SNP	ENST00000316724.5	37	CCDS2138.1	.	.	.	.	.	.	.	.	.	.	C	41	8.676158	0.98910	.	.	ENSG00000136717	ENST00000376113;ENST00000357970;ENST00000393040;ENST00000348750;ENST00000259238;ENST00000346226;ENST00000393041;ENST00000351659;ENST00000352848;ENST00000316724;ENST00000409400	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0032	15.6379	0.76970	0.0:1.0:0.0:0.0	.	.	.	.	X	393;519;451;378;466;487;444;475;423;562;408	.	ENSP00000259238:W466X	W	-	3	0	BIN1	127522668	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.071000	0.71229	2.565000	0.86533	0.555000	0.69702	TGG	.		0.632	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254298.2	NM_139343	
C4BPA	722	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207288822	207288822	+	Silent	SNP	A	A	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:207288822A>G	ENST00000367070.3	+	4	584	c.390A>G	c.(388-390)ttA>ttG	p.L130L		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	130	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						AGACAGATTTATCTTTTGGAT	0.338																																					p.L130L		.											.	C4BPA	154	0			c.A390G						.						93.0	93.0	93.0					1																	207288822		2203	4300	6503	SO:0001819	synonymous_variant	722	exon4			AGATTTATCTTTT	M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.390A>G	1.37:g.207288822A>G		Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	26.0	NM_000715	Q5VVQ8	Silent	SNP	ENST00000367070.3	37	CCDS1477.1																																																																																			.		0.338	C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088089.3		
C5	727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	123768307	123768307	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr9:123768307T>A	ENST00000223642.1	-	20	2481	c.2452A>T	c.(2452-2454)Aag>Tag	p.K818*	C5_ENST00000466280.1_5'UTR	NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	818					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TTGAACACCTTTGCCTTGACA	0.348																																					p.K818X		.											.	C5	92	0			c.A2452T						.						115.0	105.0	108.0					9																	123768307		2203	4300	6503	SO:0001587	stop_gained	727	exon20			ACACCTTTGCCTT	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.2452A>T	9.37:g.123768307T>A	ENSP00000223642:p.Lys818*	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	18.0	NM_001735	Q14CJ0|Q27I61	Nonsense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.781991	0.90282	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	.	.	.	5.54	0.0134	0.14096	.	0.939082	0.09034	N	0.858344	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.2216	0.31545	0.0:0.0792:0.5177:0.4031	.	.	.	.	X	818;889	.	ENSP00000223642:K818X	K	-	1	0	C5	122808128	0.142000	0.22610	0.000000	0.03702	0.099000	0.18886	1.572000	0.36461	0.109000	0.17891	-0.321000	0.08615	AAG	.		0.348	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
CALY	50632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	135140487	135140487	+	Silent	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr10:135140487G>T	ENST00000252939.4	-	4	348	c.255C>A	c.(253-255)acC>acA	p.T85T	ZNF511_ENST00000368554.4_Intron|CALY_ENST00000368556.2_Silent_p.T85T|CALY_ENST00000368558.1_Silent_p.T85T|CALY_ENST00000467611.1_5'Flank|RP11-122K13.14_ENST00000605518.1_lincRNA	NM_015722.3	NP_056537.1	Q9NYX4	CALY_HUMAN	calcyon neuron-specific vesicular protein	85					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)|endocytosis (GO:0006897)|positive regulation of endocytosis (GO:0045807)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)	clathrin light chain binding (GO:0032051)			kidney(1)|lung(2)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;6.94e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)	Apomorphine(DB00714)|Clozapine(DB00363)|Trifluoperazine(DB00831)	TCATCCGTGCGGTGGGCAGCT	0.667																																					p.T85T		.											.	CALY	68	0			c.C255A						.						44.0	36.0	39.0					10																	135140487		2200	4292	6492	SO:0001819	synonymous_variant	50632	exon4			CCGTGCGGTGGGC	AF225903	CCDS7678.1	10q26.3	2008-07-02	2008-01-16	2008-01-16	ENSG00000130643	ENSG00000130643			17938	protein-coding gene	gene with protein product		604647	"""dopamine receptor D1 interacting protein"""	DRD1IP		10698743, 17623072	Standard	NM_015722		Approved	CALCYON, NSG3	uc001lmo.2	Q9NYX4	OTTHUMG00000019310	ENST00000252939.4:c.255C>A	10.37:g.135140487G>T		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	37.0	NM_015722	Q5VWX3|Q5VWY5|Q5VWY6	Silent	SNP	ENST00000252939.4	37	CCDS7678.1																																																																																			.		0.667	CALY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051122.1	NM_015722	
CD109	135228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	74502505	74502505	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr6:74502505C>G	ENST00000287097.5	+	23	2970	c.2858C>G	c.(2857-2859)gCt>gGt	p.A953G	CD109_ENST00000437994.2_Missense_Mutation_p.A953G|CD109_ENST00000474094.1_3'UTR|CD109_ENST00000422508.2_Missense_Mutation_p.A876G			Q6YHK3	CD109_HUMAN	CD109 molecule	953					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AAAGAAAAAGCTCTTTCATTT	0.313																																					p.A953G		.											.	CD109	155	0			c.C2858G						.						47.0	49.0	48.0					6																	74502505		2203	4298	6501	SO:0001583	missense	135228	exon23			AAAAAGCTCTTTC	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2858C>G	6.37:g.74502505C>G	ENSP00000287097:p.Ala953Gly	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	6.0	NM_133493	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880009	0.72294	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.46063	0.88;0.88;0.88	5.87	5.0	0.66597	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.114074	0.64402	D	0.000014	T	0.61375	0.2342	M	0.91300	3.195	0.42286	D	0.992114	D;D;P	0.89917	1.0;0.997;0.883	D;D;P	0.70227	0.968;0.913;0.652	T	0.71427	-0.4596	10	0.72032	D	0.01	.	10.8014	0.46491	0.0:0.8005:0.1318:0.0677	.	876;953;953	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	G	953;876;953	ENSP00000388062:A953G;ENSP00000404475:A876G;ENSP00000287097:A953G	ENSP00000287097:A953G	A	+	2	0	CD109	74559226	0.999000	0.42202	0.993000	0.49108	0.967000	0.64934	4.239000	0.58694	1.616000	0.50265	0.655000	0.94253	GCT	.		0.313	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
CDH9	1007	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	26881302	26881302	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr5:26881302delC	ENST00000231021.4	-	12	2485	c.2313delG	c.(2311-2313)gggfs	p.G771fs		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	771					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGAAACGAGGCCCCCAGTCAC	0.413																																					p.G771fs	Melanoma(8;187 585 15745 40864 52829)	.											.	CDH9	99	0			c.2313delG						.						127.0	123.0	124.0					5																	26881302		2203	4299	6502	SO:0001589	frameshift_variant	1007	exon12			ACGAGGCCCCCAG	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2313delG	5.37:g.26881302delC	ENSP00000231021:p.Gly771fs	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	19.0	NM_016279	Q3B7I5	Frame_Shift_Del	DEL	ENST00000231021.4	37	CCDS3893.1																																																																																			.		0.413	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
CHAC1	79094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41247820	41247820	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr15:41247820G>A	ENST00000446533.3	+	3	952	c.643G>A	c.(643-645)Ggc>Agc	p.G215S	CHAC1_ENST00000444189.2_Missense_Mutation_p.G170S|CHAC1_ENST00000487220.1_5'UTR	NM_001142776.1|NM_024111.3	NP_001136248.1|NP_077016.2	Q9BUX1	CHAC1_HUMAN	ChaC, cation transport regulator homolog 1 (E. coli)	215					intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein processing (GO:0010955)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|trans-Golgi network (GO:0005802)	Notch binding (GO:0005112)			endometrium(1)|large_intestine(1)|skin(1)	3		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.66e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.163)		GGGCTTCTCCGGCCACAACCT	0.642																																					p.G215S		.											.	CHAC1	90	0			c.G643A						.						72.0	74.0	73.0					15																	41247820		2203	4300	6503	SO:0001583	missense	79094	exon3			TTCTCCGGCCACA	BC019625	CCDS10070.2, CCDS45233.1	15q15.1	2013-09-12	2006-09-12		ENSG00000128965	ENSG00000128965			28680	protein-coding gene	gene with protein product	"""gamma-GCT acting on glutathione homolog 1"""	614587	"""ChaC, cation transport regulator-like 1 (E. coli)"""			23070364	Standard	NM_024111		Approved	MGC4504	uc001znh.2	Q9BUX1	OTTHUMG00000130208	ENST00000446533.3:c.643G>A	15.37:g.41247820G>A	ENSP00000398105:p.Gly215Ser	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	16.0	NM_024111	Q0VIA0	Missense_Mutation	SNP	ENST00000446533.3	37	CCDS10070.2	.	.	.	.	.	.	.	.	.	.	G	23.6	4.430288	0.83776	.	.	ENSG00000128965	ENST00000446533;ENST00000444189	T	0.77877	-1.13	5.66	5.66	0.87406	Butirosin biosynthesis, BtrG-like (1);	0.000000	0.85682	D	0.000000	D	0.93180	0.7828	H	0.97874	4.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95175	0.8294	10	0.72032	D	0.01	-26.755	19.7464	0.96253	0.0:0.0:1.0:0.0	.	170;215	Q9BUX1-2;Q9BUX1	.;CHAC1_HUMAN	S	215;170	ENSP00000398105:G215S	ENSP00000395466:G170S	G	+	1	0	CHAC1	39035112	1.000000	0.71417	0.971000	0.41717	0.109000	0.19521	9.781000	0.99029	2.660000	0.90430	0.462000	0.41574	GGC	.		0.642	CHAC1-001	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252526.3	NM_024111	
CPNE3	8895	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	87549817	87549817	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr8:87549817C>A	ENST00000521271.1	+	7	648	c.486C>A	c.(484-486)taC>taA	p.Y162*	CPNE3_ENST00000198765.4_Nonsense_Mutation_p.Y162*	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	162	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						CAGACCCATACCTGGAATTCC	0.393																																					p.Y162X		.											.	CPNE3	117	0			c.C486A						.						135.0	122.0	126.0					8																	87549817		2203	4300	6503	SO:0001587	stop_gained	8895	exon7			CCCATACCTGGAA	AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.486C>A	8.37:g.87549817C>A	ENSP00000430934:p.Tyr162*	Somatic	69.0	1.0		WXS	Illumina HiSeq	Phase_I	75.0	10.0	NM_003909	A8KA47|Q8IYA1	Nonsense_Mutation	SNP	ENST00000521271.1	37	CCDS6243.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.944518	0.92593	.	.	ENSG00000085719	ENST00000198765;ENST00000521271;ENST00000523072	.	.	.	5.63	1.87	0.25490	.	0.058459	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-13.6606	8.2091	0.31473	0.0:0.5621:0.0:0.4379	.	.	.	.	X	162	.	ENSP00000198765:Y162X	Y	+	3	2	CPNE3	87618933	0.901000	0.30685	0.997000	0.53966	0.984000	0.73092	1.118000	0.31246	0.330000	0.23485	-0.136000	0.14681	TAC	.		0.393	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374994.1		
CPNE6	9362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24545726	24545726	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr14:24545726C>G	ENST00000397016.2	+	14	1436	c.1125C>G	c.(1123-1125)gaC>gaG	p.D375E	CPNE6_ENST00000537691.1_Missense_Mutation_p.D430E|CPNE6_ENST00000216775.2_Missense_Mutation_p.D375E	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	375	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		TGTCCCATGACTTTGCTATCA	0.567																																					p.D375E		.											.	CPNE6	93	0			c.C1125G						.						108.0	111.0	110.0					14																	24545726		2203	4300	6503	SO:0001583	missense	9362	exon13			CCATGACTTTGCT	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1125C>G	14.37:g.24545726C>G	ENSP00000380211:p.Asp375Glu	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	13.0	NM_006032	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	ENST00000397016.2	37	CCDS9607.1	.	.	.	.	.	.	.	.	.	.	C	5.033	0.191840	0.09547	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.26223	1.75;1.75;1.75	4.82	1.94	0.25998	von Willebrand factor, type A (2);Copine (1);	0.221420	0.31834	N	0.006991	T	0.15219	0.0367	N	0.16016	0.355	0.34117	D	0.663636	P;B	0.45126	0.851;0.094	P;B	0.49829	0.623;0.085	T	0.21621	-1.0240	10	0.02654	T	1	-27.8941	6.9845	0.24721	0.0:0.7031:0.0:0.2969	.	430;375	F5GXN1;O95741	.;CPNE6_HUMAN	E	430;375;375	ENSP00000440077:D430E;ENSP00000380211:D375E;ENSP00000216775:D375E	ENSP00000216775:D375E	D	+	3	2	CPNE6	23615566	0.047000	0.20315	1.000000	0.80357	0.646000	0.38490	-0.600000	0.05693	0.635000	0.30488	-0.251000	0.11542	GAC	.		0.567	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		
CPSF4	10898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99045802	99045802	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr7:99045802G>T	ENST00000292476.5	+	3	223	c.213G>T	c.(211-213)tgG>tgT	p.W71C	ATP5J2-PTCD1_ENST00000413834.1_Intron|ATP5J2_ENST00000466753.1_5'Flank|CPSF4_ENST00000451876.1_Missense_Mutation_p.W71C|PTCD1_ENST00000555673.1_Intron|CPSF4_ENST00000471455.1_3'UTR|CPSF4_ENST00000441580.1_Missense_Mutation_p.W18C|ATP5J2-PTCD1_ENST00000437572.1_5'UTR|CPSF4_ENST00000436336.2_Missense_Mutation_p.W71C			O95639	CPSF4_HUMAN	cleavage and polyadenylation specific factor 4, 30kDa	71					modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA processing (GO:0006397)|viral life cycle (GO:0019058)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(5)	14	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GCAAACACTGGCTGCGTGGCC	0.552																																					p.W71C		.											.	CPSF4	90	0			c.G213T						.						165.0	122.0	136.0					7																	99045802		2203	4300	6503	SO:0001583	missense	10898	exon3			ACACTGGCTGCGT		CCDS5664.1, CCDS47652.1	7q22	2007-10-18	2002-08-29		ENSG00000160917	ENSG00000160917			2327	protein-coding gene	gene with protein product		603052	"""cleavage and polyadenylation specific factor 4, 30kD subunit"""			9651582, 9224719	Standard	NM_006693		Approved	NAR, CPSF30	uc003uqj.3	O95639	OTTHUMG00000154599	ENST00000292476.5:c.213G>T	7.37:g.99045802G>T	ENSP00000292476:p.Trp71Cys	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	43.0	NM_001081559	D6W5S8|Q6FGE6|Q86TF8|Q9BTW6	Missense_Mutation	SNP	ENST00000292476.5	37	CCDS5664.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766144	0.90020	.	.	ENSG00000160917	ENST00000436336;ENST00000451876;ENST00000292476;ENST00000441580;ENST00000412686;ENST00000452047	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	5.96	5.96	0.96718	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.81178	0.4768	H	0.97077	3.935	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.86486	0.1794	10	0.87932	D	0	-15.1016	20.4084	0.99013	0.0:0.0:1.0:0.0	.	18;71;71;71	B7Z7B0;O95639-3;O95639;O95639-2	.;.;CPSF4_HUMAN;.	C	71;71;71;18;18;38	ENSP00000395311:W71C;ENSP00000396060:W71C;ENSP00000292476:W71C;ENSP00000402224:W18C;ENSP00000401150:W18C;ENSP00000392584:W38C	ENSP00000292476:W71C	W	+	3	0	CPSF4	98883738	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.476000	0.97823	2.833000	0.97629	0.650000	0.86243	TGG	.		0.552	CPSF4-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336254.1		
CR1L	1379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207871016	207871016	+	Missense_Mutation	SNP	G	G	C	rs532505670		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:207871016G>C	ENST00000508064.2	+	6	1091	c.1031G>C	c.(1030-1032)aGa>aCa	p.R344T	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	344	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GCAGCCCCCAGATGTGAAGGT	0.493													.|||	1	0.000199681	0.0	0.0014	5008	,	,		20118	0.0		0.0	False		,,,				2504	0.0				p.R344T		.											.	CR1L	46	0			c.G1031C						.						170.0	170.0	170.0					1																	207871016		1893	4118	6011	SO:0001583	missense	1379	exon6			CCCCCAGATGTGA	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1031G>C	1.37:g.207871016G>C	ENSP00000421736:p.Arg344Thr	Somatic	303.0	0.0		WXS	Illumina HiSeq	Phase_I	471.0	67.0	NM_175710	Q32MC9|Q8NEU7	Missense_Mutation	SNP	ENST00000508064.2	37	CCDS44310.1	.	.	.	.	.	.	.	.	.	.	.	0.020	-1.448032	0.01080	.	.	ENSG00000197721	ENST00000444269;ENST00000508064	T	0.63096	-0.02	2.53	0.428	0.16499	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.33789	0.0875	N	0.11000	0.08	0.21445	N	0.999686	B	0.11235	0.004	B	0.08055	0.003	T	0.18366	-1.0339	9	0.13470	T	0.59	.	3.7628	0.08610	0.1908:0.4411:0.3681:0.0	.	344	Q2VPA4	CR1L_HUMAN	T	344	ENSP00000421736:R344T	ENSP00000434864:R288T	R	+	2	0	CR1L	205937639	0.000000	0.05858	0.933000	0.37362	0.156000	0.22039	-0.921000	0.04008	0.321000	0.23259	0.298000	0.19748	AGA	.		0.493	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735	
CRYBA4	1413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	27026303	27026303	+	Splice_Site	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr22:27026303G>A	ENST00000354760.3	+	6	478		c.e6-1		CRYBA4_ENST00000466315.1_Splice_Site	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4						camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						CTCTTTTCCAGCTGGGTTTGC	0.512																																					.		.											.	CRYBA4	90	0			c.444-1G>A						.						146.0	107.0	120.0					22																	27026303		2203	4300	6503	SO:0001630	splice_region_variant	1413	exon6			TTTCCAGCTGGGT		CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.444-1G>A	22.37:g.27026303G>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	8.0	NM_001886	Q4VB22|Q6ICE4	Splice_Site	SNP	ENST00000354760.3	37	CCDS13841.1	.	.	.	.	.	.	.	.	.	.	G	8.394	0.840363	0.16891	.	.	ENSG00000196431	ENST00000354760	.	.	.	4.42	3.4	0.38934	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2798	0.43532	0.0971:0.0:0.9029:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CRYBA4	25356303	1.000000	0.71417	0.549000	0.28204	0.017000	0.09413	8.263000	0.89864	1.087000	0.41251	-0.300000	0.09419	.	.		0.512	CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320793.1	NM_001886	Intron
CYP2C9	1559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	96709012	96709012	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr10:96709012A>G	ENST00000260682.6	+	5	802	c.790A>G	c.(790-792)Att>Gtt	p.I264V		NM_000771.3	NP_000762.2	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 9	264					arachidonic acid metabolic process (GO:0019369)|cellular amide metabolic process (GO:0043603)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|urea metabolic process (GO:0019627)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|caffeine oxidase activity (GO:0034875)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|steroid hydroxylase activity (GO:0008395)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCAGGACTTTATTGATTGCTT	0.313																																					p.I264V	Ovarian(54;1266 1406 16072 35076)	.											.	CYP2C9	96	0			c.A790G						.						84.0	85.0	85.0					10																	96709012		2203	4300	6503	SO:0001583	missense	1559	exon5			GACTTTATTGATT	M61855	CCDS7437.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138109	ENSG00000138109		"""Cytochrome P450s"""	2623	protein-coding gene	gene with protein product		601130	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9"""	CYP2C10		2009263, 7841444	Standard	NM_000771		Approved	P450IIC9	uc001kka.4	P11712	OTTHUMG00000018805	ENST00000260682.6:c.790A>G	10.37:g.96709012A>G	ENSP00000260682:p.Ile264Val	Somatic	250.0	0.0		WXS	Illumina HiSeq	Phase_I	268.0	55.0	NM_000771	P11713|Q16756|Q16872|Q5VX92|Q6IRV8|Q8WW80	Missense_Mutation	SNP	ENST00000260682.6	37	CCDS7437.1	.	.	.	.	.	.	.	.	.	.	.	15.98	2.991462	0.54041	.	.	ENSG00000138109	ENST00000545448;ENST00000260682	T	0.71222	-0.55	3.29	3.29	0.37713	.	0.000000	0.64402	U	0.000001	T	0.68016	0.2955	L	0.55834	1.745	0.36862	D	0.88847	P;P	0.39094	0.659;0.659	B;B	0.43838	0.433;0.433	T	0.74788	-0.3546	10	0.59425	D	0.04	.	9.8769	0.41209	1.0:0.0:0.0:0.0	.	264;264	Q5VX92;P11712	.;CP2C9_HUMAN	V	264	ENSP00000260682:I264V	ENSP00000260682:I264V	I	+	1	0	CYP2C9	96699002	1.000000	0.71417	0.999000	0.59377	0.832000	0.47134	7.109000	0.77062	1.501000	0.48654	0.402000	0.26972	ATT	.		0.313	CYP2C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049501.1	NM_000771	
DACH1	1602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	72049304	72049304	+	Silent	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr13:72049304G>A	ENST00000359684.2	-	11	2213	c.2214C>T	c.(2212-2214)ggC>ggT	p.G738G	DACH1_ENST00000313174.7_Silent_p.G538G|DACH1_ENST00000305425.4_Silent_p.G686G|DACH1_ENST00000354591.4_Silent_p.G484G			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	738					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		CTGTTCTGCCGCCACTGCGGT	0.408																																					p.G686G		.											.	DACH1	135	0			c.C2058T						.						82.0	83.0	83.0					13																	72049304		1863	4107	5970	SO:0001819	synonymous_variant	1602	exon10			TCTGCCGCCACTG	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.2214C>T	13.37:g.72049304G>A		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	9.0	NM_080759	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Silent	SNP	ENST00000359684.2	37																																																																																				.		0.408	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	13866359	13866359	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr5:13866359C>T	ENST00000265104.4	-	26	4190	c.4086G>A	c.(4084-4086)caG>caA	p.Q1362Q	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1362	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CACTGGCTTCCTGGGGCTTCA	0.338									Kartagener syndrome																												p.Q1362Q		.											.	DNAH5	182	0			c.G4086A						.						26.0	31.0	29.0					5																	13866359		2202	4299	6501	SO:0001819	synonymous_variant	1767	exon26	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GGCTTCCTGGGGC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4086G>A	5.37:g.13866359C>T		Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	271.0	34.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																			.		0.338	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DNAJC3	5611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	96409903	96409903	+	Silent	SNP	A	A	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr13:96409903A>G	ENST00000602402.1	+	5	516	c.399A>G	c.(397-399)aaA>aaG	p.K133K	DNAJC3_ENST00000376795.6_Intron	NM_006260.4	NP_006251.1	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	133					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of protein kinase activity (GO:0006469)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum Sec complex (GO:0031205)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	protein kinase inhibitor activity (GO:0004860)			NS(1)|breast(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			TATAGCTCAAATCTAATCCAA	0.323																																					p.K133K		.											.	DNAJC3	226	0			c.A399G						.						50.0	51.0	51.0					13																	96409903		2203	4300	6503	SO:0001819	synonymous_variant	5611	exon5			GCTCAAATCTAAT	U28424	CCDS9479.1	13q32	2013-01-10			ENSG00000102580	ENSG00000102580		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	9439	protein-coding gene	gene with protein product		601184		PRKRI		7511204, 8824806	Standard	NM_006260		Approved	P58, P58IPK, HP58	uc001vmq.3	Q13217	OTTHUMG00000017227	ENST00000602402.1:c.399A>G	13.37:g.96409903A>G		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	8.0	NM_006260	Q86WT9|Q8N4N2	Silent	SNP	ENST00000602402.1	37	CCDS9479.1																																																																																			.		0.323	DNAJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045504.3		
DNM3	26052	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	172356431	172356431	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:172356431C>T	ENST00000355305.5	+	19	2392	c.2235C>T	c.(2233-2235)atC>atT	p.I745I	DNM3_ENST00000367731.1_Silent_p.I735I|DNM3_ENST00000358155.4_Silent_p.I739I			Q9UQ16	DYN3_HUMAN	dynamin 3	745	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TTGGGGACATCAGCACAGCCA	0.587																																					p.I739I		.											.	DNM3	90	0			c.C2217T						.						43.0	47.0	45.0					1																	172356431		2065	4199	6264	SO:0001819	synonymous_variant	26052	exon19			GGACATCAGCACA	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.2235C>T	1.37:g.172356431C>T		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	9.0	NM_015569	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Silent	SNP	ENST00000355305.5	37																																																																																				.		0.587	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	
DSPP	1834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88534393	88534393	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr4:88534393G>T	ENST00000282478.7	+	3	1088	c.1055G>T	c.(1054-1056)aGc>aTc	p.S352I	DSPP_ENST00000399271.1_Missense_Mutation_p.S352I|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	352					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		CATAGAGAAAGCAAACGCGTA	0.433																																					p.S352I		.											.	DSPP	90	0			c.G1055T						.						38.0	38.0	38.0					4																	88534393		1886	4110	5996	SO:0001583	missense	1834	exon4			GAGAAAGCAAACG	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1055G>T	4.37:g.88534393G>T	ENSP00000282478:p.Ser352Ile	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	31.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.810345	0.32053	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.87491	-2.26;-2.26	4.68	-2.03	0.07365	.	.	.	.	.	T	0.77811	0.4186	L	0.44542	1.39	0.09310	N	1	B	0.24823	0.112	B	0.23574	0.047	T	0.65676	-0.6110	9	0.66056	D	0.02	-0.0042	1.606	0.02684	0.1794:0.1202:0.4345:0.2658	.	352	Q9NZW4	DSPP_HUMAN	I	352	ENSP00000382213:S352I;ENSP00000282478:S352I	ENSP00000282478:S352I	S	+	2	0	DSPP	88753417	0.000000	0.05858	0.004000	0.12327	0.059000	0.15707	-1.538000	0.02204	-0.218000	0.10018	0.557000	0.71058	AGC	.		0.433	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DST	667	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	6	56341127	56341127	+	Silent	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr6:56341127G>A	ENST00000361203.3	-	87	20731	c.20724C>T	c.(20722-20724)gcC>gcT	p.A6908A	DST_ENST00000446842.2_Silent_p.A6693A|DST_ENST00000421834.2_Silent_p.A4931A|DST_ENST00000370788.2_Silent_p.A4822A|DST_ENST00000244364.6_Silent_p.A4605A|DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Silent_p.A7019A|DST_ENST00000370754.5_Silent_p.A7197A			Q03001	DYST_HUMAN	dystonin	6908					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCTTTGCCCAGGCCAGCACCT	0.398																																					p.A4605A		.											.	DST	523	0			c.C13815T						.						33.0	31.0	32.0					6																	56341127		1878	4103	5981	SO:0001819	synonymous_variant	667	exon73			TGCCCAGGCCAGC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.20724C>T	6.37:g.56341127G>A		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	15.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37																																																																																				.		0.398	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DUOX2	50506	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	45400255	45400257	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr15:45400255_45400257delTGT	ENST00000603300.1	-	13	1764_1766	c.1562_1564delACA	c.(1561-1566)aacacc>acc	p.N521del	DUOX2_ENST00000389039.6_In_Frame_Del_p.N521del	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	521	Peroxidase-like; mediates peroxidase activity. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CCATTCCTGGTGTTCTCAAACCA	0.611																																					p.521_522del		.											.	DUOX2	95	0			c.1562_1564del						.																																			SO:0001651	inframe_deletion	50506	exon13			TCCTGGTGTTCTC	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.1562_1564delACA	15.37:g.45400255_45400257delTGT	ENSP00000475084:p.Asn521del	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	22.0	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	In_Frame_Del	DEL	ENST00000603300.1	37	CCDS10117.1																																																																																			.		0.611	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
EFCAB7	84455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	64038167	64038167	+	Missense_Mutation	SNP	A	A	G	rs371640057		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:64038167A>G	ENST00000371088.4	+	14	2116	c.1870A>G	c.(1870-1872)Ata>Gta	p.I624V	EFCAB7_ENST00000461039.1_3'UTR	NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	624							calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						ATATTATTGTATATATTCTCT	0.239																																					p.I624V		.											.	EFCAB7	68	0			c.A1870G						.	A	VAL/ILE	0,4330		0,0,2165	23.0	27.0	26.0		1870	3.9	1.0	1		26	1,8489		0,1,4244	no	missense	EFCAB7	NM_032437.2	29	0,1,6409	GG,GA,AA		0.0118,0.0,0.0078	benign	624/630	64038167	1,12819	2165	4245	6410	SO:0001583	missense	84455	exon14			TATTGTATATATT	BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.1870A>G	1.37:g.64038167A>G	ENSP00000360129:p.Ile624Val	Somatic	447.0	0.0		WXS	Illumina HiSeq	Phase_I	487.0	81.0	NM_032437	Q658P0|Q96B95|Q96JM6	Missense_Mutation	SNP	ENST00000371088.4	37	CCDS30737.1	.	.	.	.	.	.	.	.	.	.	A	0.022	-1.413913	0.01145	0.0	1.18E-4	ENSG00000203965	ENST00000371088	T	0.54675	0.56	4.83	3.9	0.45041	.	0.283861	0.34531	N	0.003900	T	0.03959	0.0111	N	0.00119	-2.075	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44997	-0.9291	10	0.02654	T	1	-3.2702	10.1473	0.42771	0.1668:0.0:0.8332:0.0	.	624	A8K855	EFCB7_HUMAN	V	624	ENSP00000360129:I624V	ENSP00000360129:I624V	I	+	1	0	EFCAB7	63810755	1.000000	0.71417	0.994000	0.49952	0.530000	0.34684	2.304000	0.43655	1.120000	0.41904	-0.479000	0.04858	ATA	.		0.239	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024910.1	NM_032437	
EIF4G2	1982	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	10824597	10824597	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr11:10824597T>C	ENST00000526148.1	-	11	1486	c.976A>G	c.(976-978)Att>Gtt	p.I326V	SNORD97_ENST00000459187.1_RNA|RP11-685M7.5_ENST00000532365.1_RNA|EIF4G2_ENST00000525995.1_5'Flank|EIF4G2_ENST00000525681.1_Missense_Mutation_p.I326V|EIF4G2_ENST00000396525.2_Missense_Mutation_p.I326V|EIF4G2_ENST00000339995.5_Missense_Mutation_p.I326V	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TCTTGACGAATTTGATTGATC	0.393																																					p.I326V		.											.	EIF4G2	91	0			c.A976G						.						80.0	75.0	77.0					11																	10824597		2201	4294	6495	SO:0001583	missense	1982	exon11			GACGAATTTGATT	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.976A>G	11.37:g.10824597T>C	ENSP00000433664:p.Ile326Val	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_001042559		Missense_Mutation	SNP	ENST00000526148.1	37	CCDS31428.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.074621	0.55646	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000531416	T;T;T;T;T	0.42131	1.25;1.25;1.25;1.22;0.98	6.07	6.07	0.98685	.	0.044346	0.85682	D	0.000000	T	0.35799	0.0944	L	0.33245	0.995	0.46564	D	0.999108	B;B;B	0.17465	0.009;0.005;0.022	B;B;B	0.15052	0.012;0.005;0.005	T	0.30880	-0.9963	9	0.37606	T	0.19	-6.4612	16.6407	0.85098	0.0:0.0:0.0:1.0	.	326;326;399	P78344-2;P78344;B4DZF2	.;IF4G2_HUMAN;.	V	326;326;326;326;399;326	ENSP00000433664:I326V;ENSP00000433371:I326V;ENSP00000340281:I326V;ENSP00000379778:I326V;ENSP00000431583:I326V	ENSP00000340281:I326V	I	-	1	0	EIF4G2	10781173	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.045000	0.71020	2.326000	0.78906	0.533000	0.62120	ATT	.		0.393	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
EMILIN3	90187	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	39990391	39990391	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr20:39990391G>T	ENST00000332312.3	-	4	2010	c.1818C>A	c.(1816-1818)agC>agA	p.S606R		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	606						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)		p.S606R(2)		biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				CAGAGTACTGGCTGACAGAGT	0.582																																					p.S606R		.											.	EMILIN3	91	2	Substitution - Missense(2)	lung(2)	c.C1818A						.						82.0	70.0	74.0					20																	39990391		2203	4300	6503	SO:0001583	missense	90187	exon4			GTACTGGCTGACA	AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.1818C>A	20.37:g.39990391G>T	ENSP00000332806:p.Ser606Arg	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	5.0	NM_052846	Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	ENST00000332312.3	37	CCDS13316.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.088610	0.55968	.	.	ENSG00000183798	ENST00000332312	T	0.78126	-1.15	4.86	2.88	0.33553	.	0.318283	0.34025	N	0.004321	T	0.78704	0.4325	L	0.53249	1.67	0.38784	D	0.954821	D	0.64830	0.994	P	0.57911	0.829	T	0.77335	-0.2626	9	.	.	.	-27.0187	6.1951	0.20546	0.2254:0.1328:0.6418:0.0	.	606	Q9NT22	EMIL3_HUMAN	R	606	ENSP00000332806:S606R	.	S	-	3	2	EMILIN3	39423805	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.368000	0.34216	1.039000	0.40074	0.561000	0.74099	AGC	.		0.582	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106876.2	XM_029741	
EML2	24139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46136177	46136177	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr19:46136177T>G	ENST00000245925.3	-	6	502	c.452A>C	c.(451-453)cAc>cCc	p.H151P	EML2_ENST00000587152.1_Missense_Mutation_p.H352P|EML2_ENST00000586902.1_5'Flank|EML2_ENST00000589876.1_Missense_Mutation_p.H151P|EML2_ENST00000536630.1_Missense_Mutation_p.H298P	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	151	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.H151R(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GCCCAGCACGTGTAAGGTGGA	0.622																																					p.H352P		.											.	EML2	154	1	Substitution - Missense(1)	kidney(1)	c.A1055C						.						108.0	91.0	97.0					19																	46136177		2203	4300	6503	SO:0001583	missense	24139	exon9			AGCACGTGTAAGG	AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.452A>C	19.37:g.46136177T>G	ENSP00000245925:p.His151Pro	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	19.0	NM_001193268	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	ENST00000245925.3	37	CCDS12670.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.565171	0.86439	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055;ENST00000399594	T;T;T	0.40225	1.04;1.04;4.99	4.97	4.97	0.65823	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.64724	0.2624	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.993;0.994;0.997;0.993	T	0.67688	-0.5606	10	0.49607	T	0.09	-30.8838	12.649	0.56751	0.0:0.0:0.0:1.0	.	151;317;298;309;151	B7Z918;B7Z3Q9;B7Z3I2;B7Z872;O95834	.;.;.;.;EMAL2_HUMAN	P	298;151;352;309	ENSP00000442365:H298P;ENSP00000245925:H151P;ENSP00000382503:H309P	ENSP00000245925:H151P	H	-	2	0	EML2	50828017	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.416000	0.80143	2.075000	0.62263	0.460000	0.39030	CAC	.		0.622	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155	
EPHB6	2051	hgsc.bcm.edu;bcgsc.ca	37	7	142562074	142562074	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr7:142562074C>T	ENST00000392957.2	+	7	1303	c.516C>T	c.(514-516)tcC>tcT	p.S172S	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Silent_p.S172S	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	172	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					cctcctcctcctcttcttcct	0.622																																					p.S172S		.											.	EPHB6	1489	0			c.C516T						.						83.0	98.0	93.0					7																	142562074		2200	4299	6499	SO:0001819	synonymous_variant	2051	exon7			CTCCTCCTCTTCT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.516C>T	7.37:g.142562074C>T		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	9.0	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	37	CCDS5873.2																																																																																			.		0.622	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
ESRP2	80004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	68266322	68266322	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr16:68266322G>T	ENST00000565858.1	-	8	1022	c.936C>A	c.(934-936)gaC>gaA	p.D312E	ESRP2_ENST00000473183.2_Missense_Mutation_p.D302E	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	312	RRM 1.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						GCAGCGCTAGGTCCCGCTGCT	0.632																																					p.D302E		.											.	ESRP2	91	0			c.C906A						.						66.0	66.0	66.0					16																	68266322		2198	4300	6498	SO:0001583	missense	80004	exon8			CGCTAGGTCCCGC	AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.936C>A	16.37:g.68266322G>T	ENSP00000454554:p.Asp312Glu	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	17.0	NM_024939	Q8N6H8|Q8WZ15|Q9H6I4	Missense_Mutation	SNP	ENST00000565858.1	37		.	.	.	.	.	.	.	.	.	.	G	19.69	3.875066	0.72180	.	.	ENSG00000103067	ENST00000473183	T	0.07216	3.21	5.65	4.7	0.59300	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.10294	0.0252	N	0.11427	0.14	0.80722	D	1	D;P	0.63880	0.993;0.823	P;P	0.59948	0.866;0.615	T	0.42949	-0.9421	10	0.25751	T	0.34	-21.4757	12.379	0.55295	0.1397:0.0:0.8603:0.0	.	312;302	Q9H6T0;Q9H6T0-2	ESRP2_HUMAN;.	E	302	ENSP00000418748:D302E	ENSP00000418748:D302E	D	-	3	2	ESRP2	66823823	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.308000	0.51896	1.396000	0.46663	0.561000	0.74099	GAC	.		0.632	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000433083.1	NM_024939	
EVX2	344191	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	176945497	176945497	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:176945497C>T	ENST00000308618.4	-	3	905	c.769G>A	c.(769-771)Gac>Aac	p.D257N		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	257					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		AAGCTGGGGTCGGCTGGGTGC	0.677																																					p.D257N		.											.	EVX2	70	0			c.G769A						.						28.0	35.0	33.0					2																	176945497		2180	4241	6421	SO:0001583	missense	344191	exon3			TGGGGTCGGCTGG		CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.769G>A	2.37:g.176945497C>T	ENSP00000312385:p.Asp257Asn	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	8.0	NM_001080458		Missense_Mutation	SNP	ENST00000308618.4	37	CCDS33333.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265013	0.80358	.	.	ENSG00000174279	ENST00000308618	D	0.91740	-2.9	4.51	4.51	0.55191	Homeodomain-like (1);	0.098661	0.64402	D	0.000003	D	0.89480	0.6727	M	0.66939	2.045	0.80722	D	1	P	0.41475	0.751	B	0.32724	0.151	D	0.89669	0.3882	10	0.35671	T	0.21	-31.2504	17.0219	0.86436	0.0:1.0:0.0:0.0	.	257	Q03828	EVX2_HUMAN	N	257	ENSP00000312385:D257N	ENSP00000312385:D257N	D	-	1	0	EVX2	176653743	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	7.490000	0.81461	2.355000	0.79922	0.462000	0.41574	GAC	.		0.677	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1		
FAM208B	54906	broad.mit.edu;mdanderson.org	37	10	5772478	5772478	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr10:5772478C>G	ENST00000328090.5	+	11	1141	c.516C>G	c.(514-516)gaC>gaG	p.D172E	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	172																	TTGAAGATGACATCTCAATGA	0.318																																					p.D172E		.											.	.	.	0			c.C516G						.						86.0	79.0	81.0					10																	5772478		1820	4080	5900	SO:0001583	missense	54906	exon11			AGATGACATCTCA	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.516C>G	10.37:g.5772478C>G	ENSP00000328426:p.Asp172Glu	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	11.0	NM_017782	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	C	3.682	-0.065333	0.07273	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.04119	3.7	5.95	-0.295	0.12828	.	1.048290	0.07416	N	0.893175	T	0.03136	0.0092	L	0.27053	0.805	0.09310	N	1	B	0.29988	0.264	B	0.26693	0.072	T	0.46871	-0.9160	10	0.25106	T	0.35	.	2.2244	0.03980	0.1159:0.438:0.1129:0.3332	.	172	Q5VWN6	F208B_HUMAN	E	172	ENSP00000328426:D172E	ENSP00000328426:D172E	D	+	3	2	C10orf18	5812484	0.001000	0.12720	0.071000	0.20095	0.079000	0.17450	-0.930000	0.03972	-0.068000	0.12953	-0.244000	0.11960	GAC	.		0.318	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
FAM71E2	284418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55871106	55871106	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr19:55871106G>T	ENST00000424985.3	-	9	1323	c.1130C>A	c.(1129-1131)tCc>tAc	p.S377Y	CTD-2105E13.6_ENST00000591954.3_5'Flank	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	377	Pro-rich.									NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						CCTGGGGATGGAAGAGTAGGG	0.657																																					p.S377Y		.											.	.	.	0			c.C1130A						.						19.0	25.0	23.0					19																	55871106		692	1591	2283	SO:0001583	missense	284418	exon9			GGGATGGAAGAGT	AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.1130C>A	19.37:g.55871106G>T	ENSP00000398617:p.Ser377Tyr	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	23.0	NM_001145402	Q8ND99	Missense_Mutation	SNP	ENST00000424985.3	37		.	.	.	.	.	.	.	.	.	.	N	16.76	3.211483	0.58343	.	.	ENSG00000180043	ENST00000424985	T	0.19806	2.12	3.27	2.16	0.27623	.	.	.	.	.	T	0.22244	0.0536	N	0.08118	0	0.09310	N	0.999999	D	0.76494	0.999	D	0.70716	0.97	T	0.10064	-1.0646	9	0.72032	D	0.01	.	7.49	0.27456	0.0:0.0:0.7429:0.2571	.	377	Q8N5Q1	F71E2_HUMAN	Y	377	ENSP00000398617:S377Y	ENSP00000398617:S377Y	S	-	2	0	FAM71E2	60562918	0.266000	0.24112	0.029000	0.17559	0.390000	0.30446	0.854000	0.27791	0.897000	0.36392	0.450000	0.29827	TCC	.		0.657	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000409063.4	NM_001145402	
FANCA	2175	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	89831471	89831471	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr16:89831471G>C	ENST00000389301.3	-	28	2635	c.2605C>G	c.(2605-2607)Cag>Gag	p.Q869E	FANCA_ENST00000568369.1_Missense_Mutation_p.Q869E	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	869			Q -> P (in FA). {ECO:0000269|PubMed:17924555}.		DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		ATGAGGAACTGAAACTGAAAC	0.522			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.Q869E		.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	1130	0			c.C2605G						.						70.0	66.0	67.0					16																	89831471		2198	4300	6498	SO:0001583	missense	2175	exon28	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GGAACTGAAACTG	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.2605C>G	16.37:g.89831471G>C	ENSP00000373952:p.Gln869Glu	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	4.0	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990896	0.54041	.	.	ENSG00000187741	ENST00000389301	D	0.85339	-1.97	5.21	5.21	0.72293	.	0.000000	0.53938	D	0.000058	D	0.90174	0.6929	M	0.76574	2.34	0.80722	D	1	D;D	0.67145	0.996;0.996	P;P	0.58266	0.836;0.836	D	0.91227	0.5011	10	0.72032	D	0.01	-25.0849	14.3113	0.66416	0.0:0.0:1.0:0.0	.	869;869	B4DRI7;O15360	.;FANCA_HUMAN	E	869	ENSP00000373952:Q869E	ENSP00000373952:Q869E	Q	-	1	0	FANCA	88358972	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	5.135000	0.64777	2.440000	0.82611	0.650000	0.86243	CAG	.		0.522	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
FBLIM1	54751	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	16096974	16096974	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:16096974C>G	ENST00000375766.3	+	6	1252	c.612C>G	c.(610-612)taC>taG	p.Y204*	FBLIM1_ENST00000441801.2_Nonsense_Mutation_p.Y204*|FBLIM1_ENST00000375771.1_Nonsense_Mutation_p.Y204*|FBLIM1_ENST00000332305.5_Nonsense_Mutation_p.Y107*|FBLIM1_ENST00000400773.1_Nonsense_Mutation_p.Y107*	NM_017556.2	NP_060026.2	Q8WUP2	FBLI1_HUMAN	filamin binding LIM protein 1	204	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell junction assembly (GO:0034329)|regulation of cell shape (GO:0008360)|regulation of integrin activation (GO:0033623)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|stress fiber (GO:0001725)	filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	16		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		AGAGGCAGTACCATGCCCAGT	0.642																																					p.Y204X		.											.	FBLIM1	91	0			c.C612G						.						65.0	61.0	62.0					1																	16096974		2203	4300	6503	SO:0001587	stop_gained	54751	exon5			GCAGTACCATGCC		CCDS163.1, CCDS30609.1, CCDS44064.1	1p36.13	2014-04-07			ENSG00000162458	ENSG00000162458			24686	protein-coding gene	gene with protein product		607747				12679033, 12496242	Standard	XM_005245900		Approved	FBLP-1, CAL, migfilin	uc001axe.1	Q8WUP2	OTTHUMG00000003079	ENST00000375766.3:c.612C>G	1.37:g.16096974C>G	ENSP00000364921:p.Tyr204*	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	11.0	NM_001024215	B3KNY0|Q5VVE0|Q5VVE1|Q8IX23|Q96T00|Q9UFD6	Nonsense_Mutation	SNP	ENST00000375766.3	37	CCDS163.1	.	.	.	.	.	.	.	.	.	.	C	38	6.692953	0.97768	.	.	ENSG00000162458	ENST00000375771;ENST00000375766;ENST00000400773;ENST00000502739;ENST00000441801;ENST00000332305	.	.	.	5.24	5.24	0.73138	.	0.207190	0.43110	D	0.000609	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.2082	0.89861	0.0:1.0:0.0:0.0	.	.	.	.	X	204;204;107;107;204;107	.	ENSP00000364920:Y107X	Y	+	3	2	FBLIM1	15969561	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.499000	0.53310	2.618000	0.88619	0.591000	0.81541	TAC	.		0.642	FBLIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008511.3	NM_001024215	
LMAN2L	81562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	97370374	97370374	+	IGR	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:97370374G>T	ENST00000264963.4	-	0	2397				FER1L5_ENST00000457909.1_RNA	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like						ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						CTCCACCCAGGACCCACAAAT	0.507																																					p.G2076V		.											.	FER1L5	23	0			c.G6227T						.						92.0	91.0	91.0					2																	97370374		1877	4100	5977	SO:0001628	intergenic_variant	90342	exon52			ACCCAGGACCCAC	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453		2.37:g.97370374G>T		Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	27.0	NM_001113382	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Missense_Mutation	SNP	ENST00000264963.4	37	CCDS2023.1	.	.	.	.	.	.	.	.	.	.	G	3.179	-0.168393	0.06461	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	4.43	-0.00959	0.14000	.	.	.	.	.	T	0.23249	0.0562	N	0.19112	0.55	.	.	.	B;B;B	0.16802	0.011;0.003;0.019	B;B;B	0.17433	0.008;0.003;0.018	T	0.24119	-1.0169	7	0.66056	D	0.02	-1.6009	2.1665	0.03838	0.1013:0.1707:0.3785:0.3495	.	784;2076;785	B7ZLI3;A0AVI2;A0AVI2-2	.;FR1L5_HUMAN;.	V	2076;2080;785	.	ENSP00000442027:G785V	G	+	2	0	FER1L5	96734101	0.000000	0.05858	0.011000	0.14972	0.004000	0.04260	-1.059000	0.03479	0.157000	0.19338	-0.169000	0.13324	GGA	.		0.507	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	NM_030805	
FYCO1	79443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46006599	46006599	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr3:46006599T>C	ENST00000296137.2	-	9	3281	c.3076A>G	c.(3076-3078)Aag>Gag	p.K1026E	FYCO1_ENST00000535325.1_Missense_Mutation_p.K1026E	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1026					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CTGAGGCTCTTGCACTCTTCA	0.552																																					p.K1026E		.											.	FYCO1	91	0			c.A3076G						.						49.0	49.0	49.0					3																	46006599		2203	4300	6503	SO:0001583	missense	79443	exon9			GGCTCTTGCACTC	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3076A>G	3.37:g.46006599T>C	ENSP00000296137:p.Lys1026Glu	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	6.0	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	T	2.802	-0.248873	0.05867	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.79554	-1.28;-1.28	5.79	-0.342	0.12635	.	1.274560	0.04713	N	0.417928	T	0.61223	0.2330	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.49762	-0.8905	10	0.05959	T	0.93	-3.5581	6.577	0.22573	0.0:0.4614:0.1465:0.3921	.	1026;1026	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	E	1026	ENSP00000296137:K1026E;ENSP00000441178:K1026E	ENSP00000296137:K1026E	K	-	1	0	FYCO1	45981603	0.208000	0.23494	0.043000	0.18650	0.179000	0.23085	0.460000	0.21924	0.015000	0.14971	0.533000	0.62120	AAG	.		0.552	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
GGT1	2678	broad.mit.edu;mdanderson.org	37	22	25024304	25024304	+	Silent	SNP	G	G	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr22:25024304G>C	ENST00000400382.1	+	15	2267	c.1512G>C	c.(1510-1512)ctG>ctC	p.L504L	GGT1_ENST00000403838.1_Silent_p.L160L|GGT1_ENST00000404223.1_Silent_p.L187L|GGT1_ENST00000400383.1_Silent_p.L504L|GGT1_ENST00000406383.2_Silent_p.L504L|GGT1_ENST00000404532.1_Silent_p.L160L|GGT1_ENST00000248923.4_Silent_p.L504L|GGT1_ENST00000400380.1_Silent_p.L504L|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000404920.1_Silent_p.L153L|GGT1_ENST00000401885.1_Silent_p.L160L			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	504					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	AGCCCCGGCTGCACAACCAGC	0.617																																					p.L504L		.											.	GGT1	90	0			c.G1512C						.						10.0	11.0	11.0					22																	25024304		2082	4152	6234	SO:0001819	synonymous_variant	2678	exon15			CCGGCTGCACAAC	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.1512G>C	22.37:g.25024304G>C		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	15.0	NM_013430	Q08247|Q14404|Q8TBS1|Q9UMK1	Silent	SNP	ENST00000400382.1	37	CCDS42992.1																																																																																			.		0.617	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	
GLOD5	392465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48631828	48631828	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chrX:48631828G>A	ENST00000303227.6	+	4	501	c.460G>A	c.(460-462)Gtg>Atg	p.V154M	GLOD5_ENST00000470676.1_3'UTR	NM_001080489.2	NP_001073958.2	A6NK44	GLOD5_HUMAN	glyoxalase domain containing 5	154										endometrium(1)|lung(2)	3						TCTGATTGAGGTGTCCAACTA	0.562																																					p.V154M		.											.	GLOD5	108	0			c.G460A						.						95.0	87.0	90.0					X																	48631828		1931	4123	6054	SO:0001583	missense	392465	exon4			ATTGAGGTGTCCA		CCDS55410.1	Xp11.23	2008-02-05			ENSG00000171433	ENSG00000171433			33358	protein-coding gene	gene with protein product							Standard	NM_001080489		Approved		uc011mmh.2	A6NK44	OTTHUMG00000024125	ENST00000303227.6:c.460G>A	X.37:g.48631828G>A	ENSP00000302552:p.Val154Met	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	6.0	NM_001080489		Missense_Mutation	SNP	ENST00000303227.6	37	CCDS55410.1	.	.	.	.	.	.	.	.	.	.	g	19.46	3.832094	0.71258	.	.	ENSG00000171433	ENST00000303227	.	.	.	5.05	4.19	0.49359	.	0.057487	0.64402	D	0.000002	T	0.75140	0.3809	M	0.70595	2.14	0.45690	D	0.998604	D	0.76494	0.999	D	0.71870	0.975	T	0.76623	-0.2891	9	0.72032	D	0.01	.	10.6748	0.45778	0.0971:0.0:0.9029:0.0	.	142	A6NK44	GLOD5_HUMAN	M	154	.	ENSP00000302552:V154M	V	+	1	0	GLOD5	48516772	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	3.707000	0.54838	1.031000	0.39867	0.597000	0.82753	GTG	.		0.562	GLOD5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080489	
GPR101	83550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	136112567	136112567	+	Missense_Mutation	SNP	C	C	T	rs143030995	byFrequency	TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chrX:136112567C>T	ENST00000298110.1	-	1	1266	c.1267G>A	c.(1267-1269)Gtg>Atg	p.V423M		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	423						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.V423M(2)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					TCCACCCACACGGCCAGGACT	0.517																																					p.V423M		.											.	GPR101	134	2	Substitution - Missense(2)	endometrium(2)	c.G1267A						.	C	MET/VAL	0,3835		0,0,0,1632,571	84.0	74.0	77.0		1267	-1.5	0.6	X	dbSNP_134	77	2,6726		0,0,2,2428,1870	no	missense	GPR101	NM_054021.1	21	0,0,2,4060,2441	TT,TC,T,CC,C		0.0297,0.0,0.0189	possibly-damaging	423/509	136112567	2,10561	2203	4300	6503	SO:0001583	missense	83550	exon1			CCCACACGGCCAG	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1267G>A	X.37:g.136112567C>T	ENSP00000298110:p.Val423Met	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	24.0	NM_054021	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	C	5.801	0.332028	0.10956	0.0	2.97E-4	ENSG00000165370	ENST00000298110	T	0.38401	1.14	5.46	-1.54	0.08584	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30920	N	0.008604	T	0.15739	0.0379	L	0.36672	1.1	0.09310	N	0.999996	P	0.37176	0.586	B	0.25140	0.058	T	0.13710	-1.0499	10	0.51188	T	0.08	-6.5238	0.2141	0.00160	0.248:0.2552:0.2412:0.2556	.	423	Q96P66	GP101_HUMAN	M	423	ENSP00000298110:V423M	ENSP00000298110:V423M	V	-	1	0	GPR101	135940233	0.394000	0.25246	0.639000	0.29394	0.028000	0.11728	-0.029000	0.12329	-0.121000	0.11787	-0.312000	0.09012	GTG	C|1.000;T|0.000		0.517	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
GPR128	84873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	100328724	100328724	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr3:100328724C>A	ENST00000273352.3	+	1	292	c.24C>A	c.(22-24)aaC>aaA	p.N8K		NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	8					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						GTGCCTGGAACCTTAGGGTGC	0.478																																					p.N8K	Pancreas(87;185 1975 7223 18722)	.											.	GPR128	94	0			c.C24A						.						174.0	147.0	156.0					3																	100328724		2203	4300	6503	SO:0001583	missense	84873	exon1			CTGGAACCTTAGG	AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.24C>A	3.37:g.100328724C>A	ENSP00000273352:p.Asn8Lys	Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	24.0	NM_032787	Q14D94|Q86SQ2	Missense_Mutation	SNP	ENST00000273352.3	37	CCDS2938.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076128	0.36662	.	.	ENSG00000144820	ENST00000273352	T	0.38077	1.16	5.69	4.81	0.61882	.	1.017810	0.07833	N	0.961614	T	0.31420	0.0796	L	0.44542	1.39	0.27520	N	0.951425	P	0.38922	0.651	B	0.32805	0.153	T	0.23904	-1.0175	10	0.66056	D	0.02	.	9.7137	0.40260	0.0:0.9036:0.0:0.0964	.	8	Q96K78	GP128_HUMAN	K	8	ENSP00000273352:N8K	ENSP00000273352:N8K	N	+	3	2	GPR128	101811414	0.015000	0.18098	0.007000	0.13788	0.017000	0.09413	1.277000	0.33167	1.375000	0.46248	0.563000	0.77884	AAC	.		0.478	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353236.1		
GTF3C2	2976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27559284	27559284	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:27559284G>A	ENST00000359541.2	-	8	1565	c.1136C>T	c.(1135-1137)tCg>tTg	p.S379L	AC109828.1_ENST00000588707.1_RNA|AC109828.1_ENST00000587586.1_RNA|AC109828.1_ENST00000589232.1_RNA|AC109828.1_ENST00000590754.1_RNA|AC109828.1_ENST00000585645.1_RNA|AC109828.1_ENST00000585326.1_RNA|GTF3C2_ENST00000264720.3_Missense_Mutation_p.S379L|AC109828.1_ENST00000608473.1_RNA|AC109828.1_ENST00000416453.2_RNA|AC109828.1_ENST00000589853.1_RNA|AC109828.1_ENST00000590383.1_RNA|AC109828.1_ENST00000592265.1_RNA			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	379					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTGTGATCGAGCTAAATCT	0.542																																					p.S379F		.											.	GTF3C2	92	0			c.C1136T						.						34.0	37.0	36.0					2																	27559284		2202	4300	6502	SO:0001583	missense	2976	exon9			GTGATCGAGCTAA	D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.1136C>T	2.37:g.27559284G>A	ENSP00000352536:p.Ser379Leu	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	9.0	NM_001521	D6W557|Q16632|Q9BWI7	Missense_Mutation	SNP	ENST00000359541.2	37	CCDS1749.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420123	0.83559	.	.	ENSG00000115207	ENST00000359541;ENST00000264720	T;T	0.75477	-0.94;-0.94	5.7	5.7	0.88788	.	0.067277	0.64402	D	0.000008	T	0.79482	0.4453	L	0.32530	0.975	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.998;0.998	D;P;P	0.66084	0.941;0.773;0.884	T	0.78324	-0.2248	10	0.41790	T	0.15	-9.7855	17.3276	0.87253	0.0:0.0:1.0:0.0	.	379;379;379	Q8WUA4-2;Q8WUA4;Q53QN0	.;TF3C2_HUMAN;.	L	379	ENSP00000352536:S379L;ENSP00000264720:S379L	ENSP00000264720:S379L	S	-	2	0	GTF3C2	27412788	1.000000	0.71417	0.959000	0.39883	0.457000	0.32468	8.388000	0.90170	2.706000	0.92434	0.557000	0.71058	TCG	.		0.542	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2		
HEATR5A	25938	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	31819906	31819906	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr14:31819906T>C	ENST00000389961.3	-	16	2410	c.2411A>G	c.(2410-2412)cAg>cGg	p.Q804R	HEATR5A_ENST00000404677.3_Missense_Mutation_p.Q810R|HEATR5A_ENST00000439727.1_Missense_Mutation_p.Q517R|HEATR5A_ENST00000543095.2_Missense_Mutation_p.Q810R|HEATR5A_ENST00000439348.1_Missense_Mutation_p.Q804R			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	804										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GTCCAAAAGCTGTTCCAATAT	0.328																																					p.Q810R		.											.	HEATR5A	23	0			c.A2429G						.						59.0	57.0	58.0					14																	31819906		1821	4071	5892	SO:0001583	missense	25938	exon17			AAAAGCTGTTCCA	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.2411A>G	14.37:g.31819906T>C	ENSP00000374611:p.Gln804Arg	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	8.0	NM_015473	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	ENST00000389961.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.51|19.51	3.840919|3.840919	0.71488|0.71488	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095;ENST00000404677|ENST00000538864	T;T;T;T;T|.	0.05319|.	3.46;3.46;3.46;3.46;3.46|.	5.61|5.61	4.41|4.41	0.53225|0.53225	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.060604|.	0.64402|.	D|.	0.000002|.	T|T	0.64405|0.64405	0.2595|0.2595	M|M	0.63428|0.63428	1.95|1.95	0.49213|0.49213	D|D	0.99976|0.99976	P;P;B|.	0.49253|.	0.921;0.696;0.409|.	P;B;B|.	0.52710|.	0.707;0.433;0.438|.	T|T	0.63808|0.63808	-0.6553|-0.6553	10|5	0.72032|.	D|.	0.01|.	.|.	11.316|11.316	0.49392|0.49392	0.1357:0.0:0.0:0.8643|0.1357:0.0:0.0:0.8643	.|.	810;804;804|.	B5MC49;Q86XA9-2;Q86XA9|.	.;.;HTR5A_HUMAN|.	R|G	804;804;517;810;810|438	ENSP00000374611:Q804R;ENSP00000405407:Q804R;ENSP00000408681:Q517R;ENSP00000437968:Q810R;ENSP00000384646:Q810R|.	ENSP00000374611:Q804R|.	Q|S	-|-	2|1	0|0	HEATR5A|HEATR5A	30889657|30889657	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	5.774000|5.774000	0.68906|0.68906	2.137000|2.137000	0.66172|0.66172	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.		0.328	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473	
IFT140	9742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1575967	1575967	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr16:1575967G>T	ENST00000426508.2	-	21	3052	c.2689C>A	c.(2689-2691)Cgc>Agc	p.R897S	IFT140_ENST00000361339.5_Missense_Mutation_p.R91S|TMEM204_ENST00000253934.5_5'Flank	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	897					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				AGGTGCACGCGATCGTGGTGC	0.687																																					p.R897S		.											.	IFT140	95	0			c.C2689A						.						35.0	32.0	33.0					16																	1575967		2183	4291	6474	SO:0001583	missense	9742	exon21			GCACGCGATCGTG	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2689C>A	16.37:g.1575967G>T	ENSP00000406012:p.Arg897Ser	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	11.0	NM_014714	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.929706	0.73327	.	.	ENSG00000187535	ENST00000397417;ENST00000361339;ENST00000426508	T;T	0.55588	0.51;0.51	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.76300	0.3968	M	0.92219	3.285	0.80722	D	1	D;D	0.69078	0.996;0.997	P;P	0.61874	0.788;0.895	T	0.79391	-0.1823	10	0.33940	T	0.23	.	16.8983	0.86106	0.0:0.0:1.0:0.0	.	897;584	Q96RY7;B4DR58	IF140_HUMAN;.	S	897;91;897	ENSP00000354895:R91S;ENSP00000406012:R897S	ENSP00000354895:R91S	R	-	1	0	IFT140	1515968	1.000000	0.71417	0.981000	0.43875	0.028000	0.11728	7.733000	0.84916	2.514000	0.84764	0.561000	0.74099	CGC	.		0.687	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
IL25	64806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23842468	23842468	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr14:23842468C>T	ENST00000329715.2	+	1	399	c.141C>T	c.(139-141)acC>acT	p.T47T	IL25_ENST00000397242.2_Silent_p.T31T	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	47					eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		GGCAGGACACCTCTGAGGAGC	0.602																																					p.T47T		.											.	IL25	91	0			c.C141T						.						85.0	73.0	77.0					14																	23842468		2203	4300	6503	SO:0001819	synonymous_variant	64806	exon1			GGACACCTCTGAG	AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.141C>T	14.37:g.23842468C>T		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	11.0	NM_022789	Q2M3F0|Q8IZV3|Q8WXB0	Silent	SNP	ENST00000329715.2	37	CCDS9597.1																																																																																			.		0.602	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071789.2		
IL33	90865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	6241766	6241766	+	Silent	SNP	C	C	T	rs557833104		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr9:6241766C>T	ENST00000381434.3	+	1	85	c.72C>T	c.(70-72)gcC>gcT	p.A24A	IL33_ENST00000463336.1_3'UTR|IL33_ENST00000456383.2_Silent_p.A24A|IL33_ENST00000417746.2_Silent_p.A24A	NM_033439.3	NP_254274.1	O95760	IL33_HUMAN	interleukin 33	24	Homeodomain-like HTH domain.				extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of immunoglobulin secretion (GO:0051025)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type 2 immune response (GO:0002830)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|nucleus (GO:0005634)	cytokine activity (GO:0005125)			breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(23;0.158)|Prostate(43;0.167)		GBM - Glioblastoma multiforme(50;0.0161)|Lung(218;0.105)		CAAGCAAAGCCTTGTGTTTCA	0.313																																					p.A24A		.											.	IL33	90	0			c.C72T						.						93.0	91.0	92.0					9																	6241766		2203	4300	6503	SO:0001819	synonymous_variant	90865	exon2			CAAAGCCTTGTGT	AB024518	CCDS6468.1, CCDS56563.1, CCDS56564.1	9p24.1	2014-01-28	2006-11-20	2006-11-20	ENSG00000137033	ENSG00000137033		"""Interleukins and interleukin receptors"""	16028	protein-coding gene	gene with protein product	"""DVS27-related protein"", ""nuclear factor for high endothelial venules"", ""interleukin-1 family, member 11"""	608678	"""chromosome 9 open reading frame 26 (NF-HEV)"""	C9orf26		10566975, 12819012	Standard	NM_033439		Approved	DVS27, DKFZp586H0523, NF-HEV, IL1F11	uc003zjt.3	O95760	OTTHUMG00000019516	ENST00000381434.3:c.72C>T	9.37:g.6241766C>T		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	51.0	NM_001199640	B2R8L1|B4DJ35|B4E1Q9|D3DRI5|E7EAX4|Q2YEJ5	Silent	SNP	ENST00000381434.3	37	CCDS6468.1																																																																																			.		0.313	IL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051655.1	NM_033439	
ITPKB	3707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	226829808	226829808	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:226829808C>T	ENST00000272117.3	-	4	2264	c.2265G>A	c.(2263-2265)gaG>gaA	p.E755E	ITPKB_ENST00000429204.1_Silent_p.E755E			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	755					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CCTTCGTGAGCTCCTCCTCCA	0.637																																					p.E755E	Colon(84;110 1851 5306 33547)	.											.	ITPKB	230	0			c.G2265A						.						100.0	103.0	102.0					1																	226829808		2203	4300	6503	SO:0001819	synonymous_variant	3707	exon5			CGTGAGCTCCTCC	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2265G>A	1.37:g.226829808C>T		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	8.0	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Silent	SNP	ENST00000272117.3	37	CCDS1555.1																																																																																			.		0.637	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
IWS1	55677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128262855	128262855	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:128262855C>A	ENST00000295321.4	-	3	883	c.624G>T	c.(622-624)atG>atT	p.M208I	IWS1_ENST00000486662.1_5'UTR|AC010976.2_ENST00000599001.1_RNA|IWS1_ENST00000455721.2_Missense_Mutation_p.M215I	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	208	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CAGAATCACTCATTCGAGGTT	0.502																																					p.M208I		.											.	IWS1	91	0			c.G624T						.						141.0	145.0	143.0					2																	128262855		2203	4300	6503	SO:0001583	missense	55677	exon3			ATCACTCATTCGA	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.624G>T	2.37:g.128262855C>A	ENSP00000295321:p.Met208Ile	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	31.0	NM_017969	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	ENST00000295321.4	37	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	C	4.183	0.032672	0.08101	.	.	ENSG00000163166	ENST00000295321;ENST00000433551;ENST00000455721;ENST00000409725	T;T	0.28454	1.64;1.61	5.7	-0.873	0.10635	.	0.898347	0.09753	N	0.760319	T	0.08133	0.0203	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28933	-1.0028	10	0.33940	T	0.23	0.3917	4.3121	0.10976	0.0838:0.1425:0.4913:0.2823	.	208	Q96ST2	IWS1_HUMAN	I	208;161;215;213	ENSP00000295321:M208I;ENSP00000399245:M215I	ENSP00000295321:M208I	M	-	3	0	IWS1	127979325	0.000000	0.05858	0.012000	0.15200	0.642000	0.38348	-3.011000	0.00647	-0.543000	0.06240	-0.218000	0.12543	ATG	.		0.502	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
RIMS4	140730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43378872	43378872	+	IGR	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr20:43378872G>A	ENST00000372851.3	-	0	5203				KCNK15_ENST00000372861.3_Missense_Mutation_p.G129D	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				CAGAGCCTGGGCGAACGGCTG	0.687																																					p.G129D		.											.	KCNK15	90	0			c.G386A						.						32.0	29.0	30.0					20																	43378872		2203	4300	6503	SO:0001628	intergenic_variant	60598	exon2			GCCTGGGCGAACG		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546		20.37:g.43378872G>A		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	7.0	NM_022358	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	37	CCDS13338.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.417197	0.83449	.	.	ENSG00000124249	ENST00000372861	T	0.35048	1.33	4.08	4.08	0.47627	Ion transport 2 (1);	0.138661	0.47093	U	0.000257	T	0.74966	0.3786	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86492	0.1798	10	0.87932	D	0	.	16.4786	0.84151	0.0:0.0:1.0:0.0	.	129	Q9H427	KCNKF_HUMAN	D	129	ENSP00000361952:G129D	ENSP00000361952:G129D	G	+	2	0	KCNK15	42812286	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.552000	0.82192	2.095000	0.63458	0.655000	0.94253	GGC	.		0.687	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	
KCNK16	83795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	39286882	39286882	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr6:39286882C>T	ENST00000373229.5	-	2	254	c.241G>A	c.(241-243)Gtg>Atg	p.V81M	KCNK16_ENST00000425054.2_Missense_Mutation_p.V81M|KCNK16_ENST00000373227.4_Missense_Mutation_p.V81M|KCNK16_ENST00000507712.1_Missense_Mutation_p.V16M|KCNK16_ENST00000437525.2_Missense_Mutation_p.V81M	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	81					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						TTGGGGTTCACACCTTTCACC	0.542																																					p.V81M		.											.	KCNK16	229	0			c.G241A						.						112.0	109.0	110.0					6																	39286882		2203	4300	6503	SO:0001583	missense	83795	exon2			GGTTCACACCTTT	AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.241G>A	6.37:g.39286882C>T	ENSP00000362326:p.Val81Met	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	5.0	NM_001135106	B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	ENST00000373229.5	37	CCDS4843.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.445880	0.63178	.	.	ENSG00000095981	ENST00000373229;ENST00000425054;ENST00000507712;ENST00000373227;ENST00000437525	T;T;T;T;T	0.20463	2.33;2.32;2.36;2.94;2.07	5.33	4.45	0.53987	.	0.144829	0.46758	D	0.000275	T	0.24084	0.0583	L	0.55481	1.735	0.42219	D	0.991847	D;D;D;D	0.67145	0.988;0.996;0.993;0.969	P;D;P;D	0.67548	0.9;0.952;0.864;0.944	T	0.05305	-1.0893	10	0.87932	D	0	.	7.11	0.25384	0.0:0.7034:0.142:0.1546	.	81;81;81;81	B5TJL9;Q96T55-5;Q96T55-4;Q96T55	.;.;.;KCNKG_HUMAN	M	81;81;16;81;81	ENSP00000362326:V81M;ENSP00000391498:V81M;ENSP00000423842:V16M;ENSP00000362324:V81M;ENSP00000415375:V81M	ENSP00000362324:V81M	V	-	1	0	KCNK16	39394860	0.959000	0.32827	0.998000	0.56505	0.994000	0.84299	2.137000	0.42130	1.208000	0.43306	0.561000	0.74099	GTG	.		0.542	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115	
KIRREL2	84063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36352846	36352846	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr19:36352846C>A	ENST00000360202.5	+	11	1628	c.1430C>A	c.(1429-1431)tCt>tAt	p.S477Y	KIRREL2_ENST00000262625.7_Missense_Mutation_p.S477Y|NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000347900.6_Missense_Mutation_p.S427Y|KIRREL2_ENST00000592409.1_Missense_Mutation_p.S477Y	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	477	Ig-like C2-type 5.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACCCAGGAGTCTGACTTTAGC	0.657																																					p.S477Y		.											.	KIRREL2	93	0			c.C1430A						.						38.0	41.0	40.0					19																	36352846		2203	4300	6503	SO:0001583	missense	84063	exon11			AGGAGTCTGACTT	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1430C>A	19.37:g.36352846C>A	ENSP00000353331:p.Ser477Tyr	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	16.0	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	37	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845370	0.32606	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	T;T;T	0.15834	2.39;2.39;2.39	4.95	2.77	0.32553	Immunoglobulin-like (1);	0.160614	0.29838	N	0.011069	T	0.28001	0.0690	L	0.49126	1.545	0.09310	N	1	D;D;D;D;D	0.71674	0.989;0.998;0.996;0.998;0.998	P;D;P;D;D	0.64877	0.726;0.93;0.853;0.93;0.93	T	0.02491	-1.1151	10	0.38643	T	0.18	-17.2205	8.0251	0.30431	0.0:0.8012:0.0:0.1988	.	477;457;477;427;477	F1T0I2;Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;.;KIRR2_HUMAN;.;.	Y	477;427;477;457	ENSP00000262625:S477Y;ENSP00000345067:S427Y;ENSP00000353331:S477Y	ENSP00000262625:S477Y	S	+	2	0	KIRREL2	41044686	0.001000	0.12720	0.334000	0.25495	0.119000	0.20118	0.887000	0.28254	1.088000	0.41272	0.555000	0.69702	TCT	.		0.657	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
KRT26	353288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	38922867	38922867	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr17:38922867A>G	ENST00000335552.4	-	8	1355	c.1307T>C	c.(1306-1308)aTt>aCt	p.I436T		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				GAGATTGCCAATTTGATCCAG	0.338																																					p.I436T		.											.	KRT26	90	0			c.T1307C						.						168.0	164.0	165.0					17																	38922867		2203	4300	6503	SO:0001583	missense	353288	exon8			TTGCCAATTTGAT	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.1307T>C	17.37:g.38922867A>G	ENSP00000334798:p.Ile436Thr	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	4.0	NM_181539		Missense_Mutation	SNP	ENST00000335552.4	37	CCDS11374.1	.	.	.	.	.	.	.	.	.	.	A	1.340	-0.594385	0.03771	.	.	ENSG00000186393	ENST00000335552	T	0.80994	-1.44	5.49	1.8	0.24995	.	1.038830	0.07615	N	0.925995	T	0.64768	0.2628	N	0.22421	0.69	0.09310	N	1	B	0.19200	0.034	B	0.17722	0.019	T	0.49615	-0.8921	10	0.13470	T	0.59	.	5.1308	0.14909	0.4816:0.3345:0.0:0.1839	.	436	Q7Z3Y9	K1C26_HUMAN	T	436	ENSP00000334798:I436T	ENSP00000334798:I436T	I	-	2	0	KRT26	36176393	0.461000	0.25783	0.116000	0.21606	0.041000	0.13682	1.136000	0.31467	0.872000	0.35775	0.533000	0.62120	ATT	.		0.338	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	NM_181539	
LMO7	4008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	76397962	76397962	+	Missense_Mutation	SNP	T	T	G	rs200869696		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr13:76397962T>G	ENST00000321797.8	+	13	2924	c.2203T>G	c.(2203-2205)Tct>Gct	p.S735A	LMO7_ENST00000357063.3_Missense_Mutation_p.S1020A|LMO7_ENST00000341547.4_Missense_Mutation_p.S686A|LMO7_ENST00000377534.3_Missense_Mutation_p.S1020A|LMO7_ENST00000465261.2_Missense_Mutation_p.S735A|LMO7_ENST00000526202.1_Missense_Mutation_p.S585A			Q8WWI1	LMO7_HUMAN	LIM domain 7	1020					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AATGTCTGAATCTGGAGAAGG	0.453																																					p.S735A		.											.	LMO7	586	0			c.T2203G						.						73.0	66.0	69.0					13																	76397962		2203	4300	6503	SO:0001583	missense	4008	exon12			TCTGAATCTGGAG	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.2203T>G	13.37:g.76397962T>G	ENSP00000317802:p.Ser735Ala	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	21.0	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	12.90|12.90|12.90	2.075814|2.075814|2.075814	0.36662|0.36662|0.36662	.|.|.	.|.|.	ENSG00000136153|ENSG00000136153|ENSG00000136153	ENST00000447038|ENST00000524651|ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261	.|.|T;T;T;T;T;T;T	.|.|0.42900	.|.|1.56;1.55;1.55;0.97;0.98;0.96;0.97	5.98|5.98|5.98	3.66|3.66|3.66	0.41972|0.41972|0.41972	.|.|PDZ/DHR/GLGF (1);	.|.|0.866859	.|.|0.10480	.|.|N	.|.|0.669664	T|T|T	0.33585|0.33585|0.33585	0.0868|0.0868|0.0868	L|L|L	0.43923|0.43923|0.43923	1.385|1.385|1.385	0.09310|0.09310|0.09310	N|N|N	0.999998|0.999998|0.999998	.|.|B;B;B;B;B	.|.|0.29988	.|.|0.104;0.264;0.039;0.104;0.058	.|.|B;B;B;B;B	.|.|0.28011	.|.|0.039;0.085;0.016;0.079;0.075	T|T|T	0.22591|0.22591|0.22591	-1.0212|-1.0212|-1.0212	5|5|10	.|.|0.33141	.|.|T	.|.|0.24	4.066|4.066|4.066	7.2531|7.2531|7.2531	0.26160|0.26160|0.26160	0.0:0.1867:0.0:0.8133|0.0:0.1867:0.0:0.8133|0.0:0.1867:0.0:0.8133	.|.|.	.|.|585;686;1020;735;968	.|.|E9PMS6;Q8WWI1-3;Q8WWI1;E9PLH4;F8J2B5	.|.|.;.;LMO7_HUMAN;.;.	S|K|A	643|39|686;1020;1020;634;735;585;735	.|.|ENSP00000342112:S686A;ENSP00000349571:S1020A;ENSP00000366757:S1020A;ENSP00000366719:S634A;ENSP00000317802:S735A;ENSP00000431129:S585A;ENSP00000433352:S735A	.|.|ENSP00000317802:S735A	I|N|S	+|+|+	2|3|1	0|2|0	LMO7|LMO7|LMO7	75295963|75295963|75295963	0.842000|0.842000|0.842000	0.29525|0.29525|0.29525	0.125000|0.125000|0.125000	0.21846|0.21846|0.21846	0.617000|0.617000|0.617000	0.37484|0.37484|0.37484	1.232000|1.232000|1.232000	0.32636|0.32636|0.32636	0.548000|0.548000|0.548000	0.28955|0.28955|0.28955	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	ATC|AAT|TCT	T|0.999;C|0.001		0.453	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57573867	57573867	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr12:57573867G>A	ENST00000243077.3	+	31	5645	c.5179G>A	c.(5179-5181)Gcc>Acc	p.A1727T		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1727					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CATCAGCATGGCCAACATGGA	0.622																																					p.A1727T		.											.	LRP1	596	0			c.G5179A						.						173.0	170.0	171.0					12																	57573867		2203	4300	6503	SO:0001583	missense	4035	exon31			AGCATGGCCAACA	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5179G>A	12.37:g.57573867G>A	ENSP00000243077:p.Ala1727Thr	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	10.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411556	0.83340	.	.	ENSG00000123384	ENST00000243077	D	0.91464	-2.85	4.87	4.87	0.63330	Six-bladed beta-propeller, TolB-like (1);	0.075813	0.50627	D	0.000104	D	0.95217	0.8449	M	0.88031	2.925	0.80722	D	1	D	0.61080	0.989	P	0.58331	0.837	D	0.96053	0.9033	10	0.87932	D	0	.	16.9423	0.86221	0.0:0.0:1.0:0.0	.	1727	Q07954	LRP1_HUMAN	T	1727	ENSP00000243077:A1727T	ENSP00000243077:A1727T	A	+	1	0	LRP1	55860134	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.780000	0.85658	2.518000	0.84900	0.655000	0.94253	GCC	.		0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRRC28	123355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	99828120	99828120	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr15:99828120C>T	ENST00000301981.3	+	5	589	c.349C>T	c.(349-351)Cga>Tga	p.R117*	LRRC28_ENST00000422500.2_Nonsense_Mutation_p.R117*|LRRC28_ENST00000559399.1_3'UTR|LRRC28_ENST00000558879.1_Intron|LRRC28_ENST00000447360.2_Nonsense_Mutation_p.R117*|LRRC28_ENST00000331450.5_Intron|LRRC28_ENST00000442993.2_Nonsense_Mutation_p.R117*	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	117										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			ACGTCATCTTCGATTAGCTAA	0.373																																					p.R117X		.											.	LRRC28	90	0			c.C349T						.						157.0	151.0	153.0					15																	99828120		2197	4297	6494	SO:0001587	stop_gained	123355	exon5			CATCTTCGATTAG	AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.349C>T	15.37:g.99828120C>T	ENSP00000304923:p.Arg117*	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	19.0	NM_144598	A8KA22|Q6UY49|Q6ZSS6	Nonsense_Mutation	SNP	ENST00000301981.3	37	CCDS10380.1	.	.	.	.	.	.	.	.	.	.	C	38	6.774367	0.97829	.	.	ENSG00000168904	ENST00000301981;ENST00000447360;ENST00000422500;ENST00000442993	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	18.6355	0.91376	0.0:1.0:0.0:0.0	.	.	.	.	X	117	.	ENSP00000304923:R117X	R	+	1	2	LRRC28	97645643	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.170000	0.58229	2.741000	0.93983	0.585000	0.79938	CGA	.		0.373	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313546.1	NM_144598	
MAGEA11	4110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	148798396	148798396	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chrX:148798396T>A	ENST00000355220.5	+	5	1352	c.1250T>A	c.(1249-1251)cTg>cAg	p.L417Q	MAGEA11_ENST00000333104.4_Missense_Mutation_p.L388Q	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	417	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					TACCCATCCCTGTATGAAGAT	0.552																																					p.L417Q		.											.	MAGEA11	132	0			c.T1250A						.						122.0	95.0	104.0					X																	148798396		2203	4300	6503	SO:0001583	missense	4110	exon5			CATCCCTGTATGA		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.1250T>A	X.37:g.148798396T>A	ENSP00000347358:p.Leu417Gln	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	22.0	NM_005366	Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	ENST00000355220.5	37	CCDS48180.1	.	.	.	.	.	.	.	.	.	.	N	1.088	-0.664898	0.03428	.	.	ENSG00000185247	ENST00000333104;ENST00000355220	T;T	0.01584	4.77;4.75	0.976	-1.95	0.07548	.	.	.	.	.	T	0.00875	0.0029	N	0.11154	0.105	0.09310	N	1	P;B	0.34955	0.477;0.346	B;B	0.32090	0.14;0.066	T	0.44817	-0.9303	8	.	.	.	.	1.4184	0.02306	0.3263:0.2663:0.0:0.4074	.	388;417	G5E962;P43364	.;MAGAB_HUMAN	Q	388;417	ENSP00000328177:L388Q;ENSP00000347358:L417Q	.	L	+	2	0	MAGEA11	148576009	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.501000	0.02281	-0.911000	0.03843	0.350000	0.21858	CTG	.		0.552	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058725.4	NM_005366	
MCM3AP	8888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	47666686	47666686	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr21:47666686T>A	ENST00000397708.1	-	22	4659	c.4405A>T	c.(4405-4407)Atg>Ttg	p.M1469L	MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.M1469L|AP001469.7_ENST00000444966.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP_ENST00000467026.1_5'UTR			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1469					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					TCCTCTGCCATGTCCTCACTC	0.587																																					p.M1469L		.											.	MCM3AP	291	0			c.A4405T						.						173.0	167.0	169.0					21																	47666686		2203	4300	6503	SO:0001583	missense	8888	exon21			CTGCCATGTCCTC	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4405A>T	21.37:g.47666686T>A	ENSP00000380820:p.Met1469Leu	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	31.0	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	t	5.229	0.227731	0.09916	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.03035	4.07;4.07	5.68	-8.33	0.00992	.	2.169910	0.01461	N	0.015882	T	0.01765	0.0056	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43458	-0.9390	10	0.20046	T	0.44	0.1722	4.5933	0.12317	0.0788:0.3015:0.1553:0.4643	.	1469	O60318	MCM3A_HUMAN	L	1469	ENSP00000380820:M1469L;ENSP00000291688:M1469L	ENSP00000291688:M1469L	M	-	1	0	MCM3AP	46491114	0.000000	0.05858	0.000000	0.03702	0.095000	0.18619	-3.127000	0.00592	-1.597000	0.01609	-0.722000	0.03604	ATG	.		0.587	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
KMT2E	55904	hgsc.bcm.edu;bcgsc.ca	37	7	104742001	104742001	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr7:104742001G>C	ENST00000311117.3	+	16	2397	c.1852G>C	c.(1852-1854)Gat>Cat	p.D618H	KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_Missense_Mutation_p.D618H|KMT2E_ENST00000334877.4_Missense_Mutation_p.D618H|CTB-152G17.6_ENST00000607968.1_RNA	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	618					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TGAATGTAAAGATACACAGAT	0.323																																					p.D618H		.											.	MLL5	93	0			c.G1852C						.						92.0	89.0	90.0					7																	104742001		2203	4300	6503	SO:0001583	missense	55904	exon15			TGTAAAGATACAC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.1852G>C	7.37:g.104742001G>C	ENSP00000312379:p.Asp618His	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	6.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.145315	0.57044	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.92495	-3.05;-2.63;-3.05	5.53	5.53	0.82687	.	0.427481	0.26062	N	0.026575	D	0.90988	0.7166	L	0.40543	1.245	0.80722	D	1	P	0.49696	0.927	P	0.45946	0.498	D	0.91732	0.5397	10	0.62326	D	0.03	.	19.4728	0.94969	0.0:0.0:1.0:0.0	.	618	Q8IZD2	MLL5_HUMAN	H	618;618;618;538;618	ENSP00000312379:D618H;ENSP00000335599:D618H;ENSP00000257745:D618H	ENSP00000257745:D618H	D	+	1	0	MLL5	104529237	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	4.521000	0.60532	2.608000	0.88229	0.561000	0.74099	GAT	.		0.323	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151849960	151849960	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr7:151849960G>A	ENST00000262189.6	-	49	12574	c.12356C>T	c.(12355-12357)cCa>cTa	p.P4119L	KMT2C_ENST00000355193.2_Missense_Mutation_p.P4176L|KMT2C_ENST00000485241.1_5'Flank	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4119					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGGGACATCTGGAGCACTGCT	0.498																																					p.P4119L		.											.	MLL3	1398	0			c.C12356T						.						123.0	120.0	121.0					7																	151849960		2203	4300	6503	SO:0001583	missense	58508	exon49			ACATCTGGAGCAC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12356C>T	7.37:g.151849960G>A	ENSP00000262189:p.Pro4119Leu	Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	27.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867707	0.51588	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877	D;D;D	0.91011	-2.1;-2.04;-2.77	5.84	5.84	0.93424	.	0.000000	0.44483	U	0.000452	D	0.94125	0.8116	M	0.73962	2.25	0.80722	D	1	P;D;D	0.63046	0.651;0.992;0.992	B;P;P	0.59357	0.15;0.856;0.856	D	0.94383	0.7606	10	0.87932	D	0	.	15.6008	0.76623	0.0:0.1369:0.8631:0.0	.	4119;3237;4176	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	L	4119;4176;736	ENSP00000262189:P4119L;ENSP00000347325:P4176L;ENSP00000410411:P736L	ENSP00000262189:P4119L	P	-	2	0	MLL3	151480893	.	.	1.000000	0.80357	0.990000	0.78478	.	.	2.764000	0.94973	0.655000	0.94253	CCA	.		0.498	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MS4A3	932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	59837694	59837694	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr11:59837694C>T	ENST00000278865.3	+	7	706	c.633C>T	c.(631-633)ccC>ccT	p.P211P	MS4A3_ENST00000395032.2_Silent_p.P88P|MS4A3_ENST00000358152.2_Silent_p.P165P|MS4A3_ENST00000534744.1_Silent_p.P165P	NM_006138.4	NP_006129.4	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)	211						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(4)|kidney(2)|lung(9)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		all_epithelial(135;0.245)				CCTCACCTCCCAATTCTGTGT	0.388																																					p.P211P		.											.	MS4A3	93	0			c.C633T						.						188.0	166.0	174.0					11																	59837694		2201	4294	6495	SO:0001819	synonymous_variant	932	exon7			ACCTCCCAATTCT	L35848	CCDS31567.1, CCDS31568.1, CCDS41651.1	11q12-q13.1	2008-03-25				ENSG00000149516			7317	protein-coding gene	gene with protein product		606498		CD20L		7524084	Standard	NM_006138		Approved	HTM4	uc001nom.3	Q96HJ5		ENST00000278865.3:c.633C>T	11.37:g.59837694C>T		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	12.0	NM_006138	A8MTP8|Q8NHW2	Silent	SNP	ENST00000278865.3	37	CCDS31567.1																																																																																			.		0.388	MS4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394417.1		
MYBPC3	4607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47364195	47364195	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr11:47364195C>T	ENST00000545968.1	-	17	1612	c.1558G>A	c.(1558-1560)Gag>Aag	p.E520K	MYBPC3_ENST00000256993.4_Missense_Mutation_p.E519K|MYBPC3_ENST00000399249.2_Missense_Mutation_p.E520K	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	520	Ig-like C2-type 3.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CCCGCGTCCTCCAGCATGGCC	0.627																																					p.E520K		.											.	MYBPC3	92	0			c.G1558A						.						122.0	122.0	122.0					11																	47364195		2162	4263	6425	SO:0001583	missense	4607	exon16			CGTCCTCCAGCAT	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.1558G>A	11.37:g.47364195C>T	ENSP00000442795:p.Glu520Lys	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	25.0	NM_000256	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.588465	0.46110	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.78924	-1.22;-1.22;-1.22	4.63	4.63	0.57726	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.81465	0.4828	L	0.60957	1.885	0.58432	D	0.999997	P	0.41569	0.755	P	0.48873	0.593	T	0.82977	-0.0189	9	0.52906	T	0.07	.	17.6444	0.88145	0.0:1.0:0.0:0.0	.	519	Q14896	MYPC3_HUMAN	K	520;520;519	ENSP00000442795:E520K;ENSP00000382193:E520K;ENSP00000256993:E519K	ENSP00000256993:E519K	E	-	1	0	MYBPC3	47320771	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	7.234000	0.78134	2.395000	0.81488	0.462000	0.41574	GAG	.		0.627	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		
MSANTD4	84437	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	105881627	105881627	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr11:105881627T>A	ENST00000301919.4	-	2	1433	c.18A>T	c.(16-18)agA>agT	p.R6S	MSANTD4_ENST00000529805.1_5'Flank	NM_032424.1	NP_115800.1	Q8NCY6	MSD4_HUMAN	Myb/SANT-like DNA-binding domain containing 4 with coiled-coils	6	Myb-like.					nucleus (GO:0005634)											TTTTCCTTTTTCTTTTCAACT	0.323																																					p.R6S		.											.	.	.	0			c.A18T						.						37.0	38.0	38.0					11																	105881627		2201	4298	6499	SO:0001583	missense	84437	exon2			CCTTTTTCTTTTC	AB058729	CCDS31663.1	11q22	2012-03-13	2012-03-13	2012-03-13	ENSG00000170903	ENSG00000170903			29383	protein-coding gene	gene with protein product			"""KIAA1826"""	KIAA1826			Standard	XM_005271697		Approved		uc001piz.3	Q8NCY6	OTTHUMG00000166240	ENST00000301919.4:c.18A>T	11.37:g.105881627T>A	ENSP00000304713:p.Arg6Ser	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	10.0	NM_032424	Q96JK1|Q96JZ3|Q9H2N4	Missense_Mutation	SNP	ENST00000301919.4	37	CCDS31663.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.581617	0.65992	.	.	ENSG00000170903	ENST00000301919;ENST00000530788;ENST00000534458;ENST00000530108	.	.	.	5.79	-0.993	0.10228	.	0.000000	0.85682	D	0.000000	T	0.49115	0.1538	N	0.12182	0.205	0.45899	D	0.998749	P	0.51653	0.947	D	0.67231	0.95	T	0.50988	-0.8762	9	0.87932	D	0	-13.5711	11.4882	0.50367	0.0:0.4549:0.0:0.5451	.	6	Q8NCY6	K1826_HUMAN	S	6	.	ENSP00000304713:R6S	R	-	3	2	KIAA1826	105386837	0.994000	0.37717	0.997000	0.53966	0.995000	0.86356	0.206000	0.17375	-0.176000	0.10707	0.533000	0.62120	AGA	.		0.323	MSANTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388619.1	NM_032424	
MYH11	4629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	15857692	15857692	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr16:15857692C>T	ENST00000300036.5	-	10	1199	c.1090G>A	c.(1090-1092)Gaa>Aaa	p.E364K	MYH11_ENST00000396324.3_Missense_Mutation_p.E371K|MYH11_ENST00000576790.2_Missense_Mutation_p.E364K|MYH11_ENST00000452625.2_Missense_Mutation_p.E371K	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	364	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GTGTTTCTTTCCTTCTTGAAG	0.517			T	CBFB	AML																																p.E371K		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	666	0			c.G1111A						.						205.0	176.0	186.0					16																	15857692		2197	4300	6497	SO:0001583	missense	4629	exon11			TTCTTTCCTTCTT	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1090G>A	16.37:g.15857692C>T	ENSP00000300036:p.Glu364Lys	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	32.0	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	c	34	5.396011	0.96009	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25	5.31	5.31	0.75309	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.87857	0.6283	L	0.53671	1.685	0.80722	D	1	P;P;P;P;P;P	0.44877	0.486;0.845;0.845;0.845;0.845;0.845	P;P;P;P;P;P	0.52189	0.692;0.692;0.692;0.692;0.692;0.692	D	0.83983	0.0333	10	0.02654	T	1	.	17.9753	0.89126	0.0:1.0:0.0:0.0	.	371;364;364;371;364;371	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	K	364;364;371;371;371	ENSP00000300036:E364K;ENSP00000345136:E364K;ENSP00000379616:E371K;ENSP00000407821:E371K	ENSP00000300036:E364K	E	-	1	0	MYH11	15765193	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.773000	0.85462	2.482000	0.83794	0.556000	0.70494	GAA	.		0.517	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
NXPE3	91775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	101540508	101540508	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr3:101540508C>T	ENST00000491511.2	+	8	2346	c.1390C>T	c.(1390-1392)Cgt>Tgt	p.R464C	NXPE3_ENST00000273347.5_Missense_Mutation_p.R464C|RP11-49I4.3_ENST00000490324.2_RNA|NXPE3_ENST00000477909.1_Missense_Mutation_p.R464C|NXPE3_ENST00000422132.1_Missense_Mutation_p.R464C	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	464						extracellular region (GO:0005576)											CAGGAACATCCGTCGAGCAGT	0.572																																					p.R464C		.											.	.	.	0			c.C1390T						.						99.0	95.0	97.0					3																	101540508		2203	4300	6503	SO:0001583	missense	91775	exon8			AACATCCGTCGAG	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.1390C>T	3.37:g.101540508C>T	ENSP00000417485:p.Arg464Cys	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	12.0	NM_145037	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320856	0.81469	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.21361	2.01;2.01;2.01;2.01	6.03	5.13	0.70059	.	0.150449	0.64402	N	0.000016	T	0.51958	0.1705	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.61377	-0.7075	10	0.87932	D	0	-17.1789	16.2691	0.82606	0.1373:0.8627:0.0:0.0	.	464	Q969Y0	FA55C_HUMAN	C	464	ENSP00000273347:R464C;ENSP00000417485:R464C;ENSP00000418369:R464C;ENSP00000396421:R464C	ENSP00000273347:R464C	R	+	1	0	FAM55C	103023198	1.000000	0.71417	0.988000	0.46212	0.889000	0.51656	3.880000	0.56145	1.495000	0.48549	0.655000	0.94253	CGT	.		0.572	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	
OAS2	4939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	113444239	113444239	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr12:113444239C>A	ENST00000342315.4	+	8	1704	c.1490C>A	c.(1489-1491)aCa>aAa	p.T497K	RP1-71H24.1_ENST00000552784.1_RNA|OAS2_ENST00000392583.2_Missense_Mutation_p.T497K	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	497	OAS domain 2.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						TCTGGCTCCACACCCAGCCCC	0.468																																					p.T497K	Pancreas(199;709 2232 18410 33584 35052)	.											.	OAS2	91	0			c.C1490A						.						66.0	65.0	65.0					12																	113444239		2203	4300	6503	SO:0001583	missense	4939	exon8			GCTCCACACCCAG	M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.1490C>A	12.37:g.113444239C>A	ENSP00000342278:p.Thr497Lys	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	12.0	NM_002535	A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	ENST00000342315.4	37	CCDS31906.1	.	.	.	.	.	.	.	.	.	.	.	0.059	-1.228514	0.01518	.	.	ENSG00000111335	ENST00000342315;ENST00000392583	T;T	0.07114	3.22;3.22	4.51	-1.23	0.09465	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	1.183370	0.06544	U	0.743700	T	0.03434	0.0099	N	0.01446	-0.86	0.09310	N	1	P;B	0.47484	0.896;0.052	P;B	0.51550	0.673;0.022	T	0.22906	-1.0203	10	0.02654	T	1	-18.8292	2.2114	0.03949	0.3389:0.2753:0.2888:0.097	.	497;497	P29728;P29728-2	OAS2_HUMAN;.	K	497	ENSP00000342278:T497K;ENSP00000376362:T497K	ENSP00000342278:T497K	T	+	2	0	OAS2	111928622	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	-1.061000	0.03472	0.094000	0.17404	-0.140000	0.14226	ACA	.		0.468	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1		
OR10K2	391107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158390017	158390017	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:158390017T>A	ENST00000314902.2	-	1	639	c.640A>T	c.(640-642)Atc>Ttc	p.I214F		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	214						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					GACACCAAGATCAACAATAAG	0.448																																					p.I214F		.											.	OR10K2	69	0			c.A640T						.						147.0	136.0	140.0					1																	158390017		2203	4300	6503	SO:0001583	missense	391107	exon1			CCAAGATCAACAA	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.640A>T	1.37:g.158390017T>A	ENSP00000324251:p.Ile214Phe	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	20.0	NM_001004476		Missense_Mutation	SNP	ENST00000314902.2	37	CCDS30896.1	.	.	.	.	.	.	.	.	.	.	t	12.62	1.993357	0.35131	.	.	ENSG00000180708	ENST00000314902	T	0.00333	8.07	4.13	4.13	0.48395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000207	T	0.00666	0.0022	H	0.94925	3.6	0.39901	D	0.973894	D	0.89917	1.0	D	0.91635	0.999	T	0.47195	-0.9136	10	0.87932	D	0	.	12.5328	0.56126	0.0:0.0:0.0:1.0	.	214	Q6IF99	O10K2_HUMAN	F	214	ENSP00000324251:I214F	ENSP00000324251:I214F	I	-	1	0	OR10K2	156656641	0.013000	0.17824	0.371000	0.25978	0.068000	0.16541	1.284000	0.33249	1.852000	0.53769	0.378000	0.23410	ATC	.		0.448	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476	
OR1J2	26740	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125273953	125273953	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr9:125273953C>G	ENST00000335302.5	+	1	873	c.873C>G	c.(871-873)agC>agG	p.S291R		NM_054107.1	NP_473448.1	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J, member 2	291						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(7)|stomach(1)	26						TTATCTACAGCCTTAGGAACA	0.423																																					p.S291R		.											.	OR1J2	72	0			c.C873G						.						96.0	95.0	95.0					9																	125273953		2203	4300	6503	SO:0001583	missense	26740	exon1			CTACAGCCTTAGG		CCDS35121.1	9q33.2	2013-09-20			ENSG00000197233	ENSG00000197233		"""GPCR / Class A : Olfactory receptors"""	8209	protein-coding gene	gene with protein product				OR1J3, OR1J5			Standard	XM_005251920		Approved	OST044	uc011lyv.2	Q8NGS2	OTTHUMG00000020604	ENST00000335302.5:c.873C>G	9.37:g.125273953C>G	ENSP00000335575:p.Ser291Arg	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	29.0	NM_054107	A3KFL9|Q6IF14|Q96R90|Q9NZP1	Missense_Mutation	SNP	ENST00000335302.5	37	CCDS35121.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.847608	0.51164	.	.	ENSG00000197233	ENST00000335302	T	0.39229	1.09	5.14	0.466	0.16716	.	0.000000	0.47455	U	0.000238	T	0.68265	0.2982	H	0.97131	3.945	0.09310	N	0.999999	D	0.57899	0.981	P	0.61592	0.891	T	0.62029	-0.6940	10	0.87932	D	0	.	8.828	0.35067	0.0:0.461:0.0:0.539	.	291	Q8NGS2	OR1J2_HUMAN	R	291	ENSP00000335575:S291R	ENSP00000335575:S291R	S	+	3	2	OR1J2	124313774	0.000000	0.05858	0.697000	0.30258	0.991000	0.79684	-1.448000	0.02394	0.181000	0.19994	0.632000	0.83419	AGC	.		0.423	OR1J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053932.1		
OR1N2	138882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125315781	125315781	+	Silent	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr9:125315781T>C	ENST00000373688.2	+	1	391	c.333T>C	c.(331-333)taT>taC	p.Y111Y		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						TCATCTCGTATTCTGGGTGTC	0.493																																					p.Y111Y		.											.	OR1N2	72	0			c.T333C						.						231.0	226.0	227.0					9																	125315781		2203	4300	6503	SO:0001819	synonymous_variant	138882	exon1			CTCGTATTCTGGG		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.333T>C	9.37:g.125315781T>C		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	19.0	NM_001004457	A3KFM2|B2RNY4|Q6IF17|Q96RA3	Silent	SNP	ENST00000373688.2	37	CCDS35123.1																																																																																			.		0.493	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2		
PAPOLA	10914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96986492	96986492	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr14:96986492G>A	ENST00000216277.8	+	2	329	c.109G>A	c.(109-111)Gta>Ata	p.V37I	PAPOLA_ENST00000392990.2_Missense_Mutation_p.V37I|PAPOLA_ENST00000557471.1_Missense_Mutation_p.V37I|PAPOLA_ENST00000557320.1_Missense_Mutation_p.V37I|PAPOLA_ENST00000554130.1_3'UTR	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	37					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		GACTGACTGCGTACTTACACA	0.423																																					p.V37I	NSCLC(19;254 734 11908 35501 39234)	.											.	PAPOLA	68	0			c.G109A						.						119.0	105.0	110.0					14																	96986492		2203	4300	6503	SO:0001583	missense	10914	exon2			GACTGCGTACTTA	X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.109G>A	14.37:g.96986492G>A	ENSP00000216277:p.Val37Ile	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	10.0	NM_001252006	Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Missense_Mutation	SNP	ENST00000216277.8	37	CCDS9946.1	.	.	.	.	.	.	.	.	.	.	G	1.512	-0.549241	0.04024	.	.	ENSG00000090060	ENST00000216277;ENST00000557320;ENST00000546064;ENST00000557471;ENST00000556619;ENST00000392990	.	.	.	4.94	-1.68	0.08212	Poly(A) polymerase, central domain (1);	1.325060	0.05095	N	0.486031	T	0.18467	0.0443	N	0.05441	-0.05	0.09310	N	1	B;B;B;B;B	0.11235	0.001;0.001;0.004;0.001;0.001	B;B;B;B;B	0.10450	0.001;0.002;0.005;0.001;0.005	T	0.21008	-1.0258	9	0.31617	T	0.26	.	6.2973	0.21093	0.4795:0.2948:0.2257:0.0	.	53;53;37;37;53	F5H5I8;B4DYF4;P51003;P51003-2;B4DHB8	.;.;PAPOA_HUMAN;.;.	I	37;37;53;37;37;37	.	ENSP00000216277:V37I	V	+	1	0	PAPOLA	96056245	0.004000	0.15560	0.045000	0.18777	0.805000	0.45488	-0.082000	0.11304	-0.476000	0.06842	-0.247000	0.11927	GTA	.		0.423	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413411.2		
PARM1	25849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	75971416	75971416	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr4:75971416T>C	ENST00000307428.7	+	4	1104	c.892T>C	c.(892-894)Tcc>Ccc	p.S298P	PARM1_ENST00000513238.1_Missense_Mutation_p.S56P	NM_015393.3	NP_056208.2	Q6UWI2	PARM1_HUMAN	prostate androgen-regulated mucin-like protein 1	298					positive regulation of telomerase activity (GO:0051973)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|lung(4)|ovary(1)	8						TGACTACGGGTCCTGGGGAAA	0.453																																					p.S298P		.											.	PARM1	1	0			c.T892C						.						114.0	116.0	115.0					4																	75971416		2106	4251	6357	SO:0001583	missense	25849	exon4			TACGGGTCCTGGG	AK022311	CCDS47077.1	4q13.3-q21.3	2010-02-17	2009-09-28		ENSG00000169116	ENSG00000169116			24536	protein-coding gene	gene with protein product	"""Prostatic androgen-repressed message 1"", ""Castration-induced prostatic apoptosis-related protein 1"", ""WSC4, cell wall integrity and stress response component 4 homolog (S. cerevisiae)"""					10499539, 12772192, 18027867	Standard	NM_015393		Approved	DKFZP564O0823, Cipar1, WSC4	uc003hih.2	Q6UWI2	OTTHUMG00000160827	ENST00000307428.7:c.892T>C	4.37:g.75971416T>C	ENSP00000370224:p.Ser298Pro	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	35.0	NM_015393	B3KMQ9|Q96DV8|Q9Y4S1	Missense_Mutation	SNP	ENST00000307428.7	37	CCDS47077.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.421259	0.83559	.	.	ENSG00000169116	ENST00000513238;ENST00000307428	T;T	0.26957	1.7;1.7	5.36	5.36	0.76844	.	0.000000	0.53938	D	0.000051	T	0.36744	0.0978	N	0.24115	0.695	0.43218	D	0.995094	D	0.89917	1.0	D	0.91635	0.999	T	0.24190	-1.0167	10	0.87932	D	0	-24.7374	13.3503	0.60597	0.0:0.0:0.0:1.0	.	298	Q6UWI2	PARM1_HUMAN	P	56;298	ENSP00000424276:S56P;ENSP00000370224:S298P	ENSP00000370224:S298P	S	+	1	0	PARM1	76190440	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.965000	0.63708	2.257000	0.74773	0.459000	0.35465	TCC	.		0.453	PARM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362494.1	NM_015393	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140221574	140221574	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr5:140221574C>A	ENST00000531613.1	+	1	668	c.668C>A	c.(667-669)aCa>aAa	p.T223K	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.T223K|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	223	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGAGCTCACAGGCACTGTT	0.483																																					p.T223K		.											.	PCDHA8	92	0			c.C668A						.						50.0	51.0	51.0					5																	140221574		2203	4298	6501	SO:0001583	missense	56140	exon1			AGCTCACAGGCAC	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.668C>A	5.37:g.140221574C>A	ENSP00000434655:p.Thr223Lys	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	9.0	NM_031856	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630599	0.67015	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.02890	4.12;4.12	3.73	2.83	0.33086	Cadherin (4);Cadherin-like (1);	0.000000	0.37715	U	0.001966	T	0.11281	0.0275	M	0.93106	3.38	0.09310	N	1	P;P	0.44578	0.806;0.838	P;B	0.46940	0.532;0.397	T	0.06679	-1.0813	10	0.87932	D	0	.	12.0049	0.53252	0.0:0.6636:0.3364:0.0	.	223;223	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	K	223	ENSP00000434655:T223K;ENSP00000367363:T223K	ENSP00000367363:T223K	T	+	2	0	PCDHA8	140201758	0.019000	0.18553	0.008000	0.14137	0.634000	0.38068	2.118000	0.41949	0.644000	0.30656	0.558000	0.71614	ACA	.		0.483	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PHRF1	57661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	606503	606503	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr11:606503C>T	ENST00000264555.5	+	13	1644	c.1516C>T	c.(1516-1518)Ctg>Ttg	p.L506L	PHRF1_ENST00000413872.2_Silent_p.L504L|PHRF1_ENST00000533464.1_Silent_p.L502L|PHRF1_ENST00000416188.2_Silent_p.L505L	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	506					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GCCTGACCTGCTGGGCAGCAT	0.682																																					p.L505L		.											.	PHRF1	22	0			c.C1513T						.						18.0	23.0	21.0					11																	606503		2085	4201	6286	SO:0001819	synonymous_variant	57661	exon13			GACCTGCTGGGCA	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.1516C>T	11.37:g.606503C>T		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	19.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	ENST00000264555.5	37																																																																																				.		0.682	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
PI4KA	5297	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	21066826	21066826	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr22:21066826T>C	ENST00000572273.1	-	50	5806	c.5576A>G	c.(5575-5577)tAc>tGc	p.Y1859C	PI4KA_ENST00000255882.6_Missense_Mutation_p.Y1917C|PI4KA_ENST00000414196.3_Missense_Mutation_p.Y669C			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1859	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GAAGTAGTCGTACATGCCGAA	0.652																																					p.Y1917C	GBM(136;1332 1831 3115 23601 50806)	.											.	PI4KA	454	0			c.A5750G						.						33.0	32.0	32.0					22																	21066826		2187	4266	6453	SO:0001583	missense	5297	exon50			TAGTCGTACATGC	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.5576A>G	22.37:g.21066826T>C	ENSP00000458238:p.Tyr1859Cys	Somatic	300.0	0.0		WXS	Illumina HiSeq	Phase_I	302.0	72.0	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		.	.	.	.	.	.	.	.	.	.	T	22.8	4.333044	0.81801	.	.	ENSG00000241973	ENST00000255882;ENST00000414196;ENST00000399213	T;T	0.76839	-1.05;-1.05	4.49	4.49	0.54785	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.116625	0.64402	D	0.000011	D	0.89083	0.6614	M	0.88570	2.965	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.77557	0.967;0.99	D	0.91163	0.4962	10	0.72032	D	0.01	-15.5712	13.9524	0.64126	0.0:0.0:0.0:1.0	.	252;1859	A8MTF1;P42356	.;PI4KA_HUMAN	C	1859;669;252	ENSP00000402981:Y669C;ENSP00000382162:Y252C	ENSP00000255882:Y1859C	Y	-	2	0	PI4KA	19396826	1.000000	0.71417	0.969000	0.41365	0.986000	0.74619	7.817000	0.86213	1.894000	0.54839	0.519000	0.50382	TAC	.		0.652	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
PIK3C2A	5286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	17191175	17191175	+	Silent	SNP	A	A	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr11:17191175A>G	ENST00000265970.7	-	1	113	c.114T>C	c.(112-114)gcT>gcC	p.A38A	PIK3C2A_ENST00000540361.1_Intron|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	38	Interaction with clathrin; sufficient to induce clathrin assemby.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						GTTTTGCTAAAGCCTCTGCTT	0.423																																					p.A38A		.											.	PIK3C2A	1310	0			c.T114C						.						222.0	213.0	216.0					11																	17191175		2200	4293	6493	SO:0001819	synonymous_variant	5286	exon1			TGCTAAAGCCTCT	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.114T>C	11.37:g.17191175A>G		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	17.0	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Silent	SNP	ENST00000265970.7	37	CCDS7824.1																																																																																			.		0.423	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
PLVAP	83483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17476642	17476642	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr19:17476642C>T	ENST00000252590.4	-	3	693	c.632G>A	c.(631-633)cGc>cAc	p.R211H		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	211					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGCCAGCTGGCGCTCTTGGTG	0.562																																					p.R211H		.											.	PLVAP	90	0			c.G632A						.						79.0	72.0	74.0					19																	17476642		2203	4300	6503	SO:0001583	missense	83483	exon3			AGCTGGCGCTCTT	AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.632G>A	19.37:g.17476642C>T	ENSP00000252590:p.Arg211His	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	11.0	NM_031310	Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	ENST00000252590.4	37	CCDS32952.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.224342	0.58668	.	.	ENSG00000130300	ENST00000252590	.	.	.	4.86	-3.53	0.04667	.	1.476590	0.04187	N	0.327502	T	0.25938	0.0632	L	0.27053	0.805	0.09310	N	1	D	0.59767	0.986	P	0.52598	0.703	T	0.19128	-1.0315	9	0.40728	T	0.16	-5.6057	1.5906	0.02653	0.1382:0.3449:0.1367:0.3803	.	211	Q9BX97	PLVAP_HUMAN	H	211	.	ENSP00000252590:R211H	R	-	2	0	PLVAP	17337642	0.000000	0.05858	0.000000	0.03702	0.157000	0.22087	-0.542000	0.06091	-0.388000	0.07797	0.305000	0.20034	CGC	.		0.562	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463655.1	NM_031310	
POF1B	79983	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	84562234	84562234	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chrX:84562234C>A	ENST00000262753.4	-	11	1244	c.1099G>T	c.(1099-1101)Gac>Tac	p.D367Y	POF1B_ENST00000373145.3_Missense_Mutation_p.D367Y	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	367						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						AATTGAGTGTCTTTGAATGAT	0.328																																					p.D367Y		.											.	POF1B	130	0			c.G1099T						.						123.0	94.0	104.0					X																	84562234		2201	4297	6498	SO:0001583	missense	79983	exon11			GAGTGTCTTTGAA	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.1099G>T	X.37:g.84562234C>A	ENSP00000262753:p.Asp367Tyr	Somatic	176.0	1.0		WXS	Illumina HiSeq	Phase_I	195.0	31.0	NM_024921	A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	ENST00000262753.4	37	CCDS14452.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431540	0.43122	.	.	ENSG00000124429	ENST00000262753;ENST00000373145	D;D	0.83335	-1.71;-1.71	5.56	5.56	0.83823	.	0.236247	0.49916	D	0.000126	T	0.80706	0.4674	N	0.19112	0.55	0.30898	N	0.729578	P;P	0.46142	0.873;0.873	P;P	0.49999	0.628;0.628	T	0.82548	-0.0402	10	0.66056	D	0.02	.	17.0995	0.86645	0.0:1.0:0.0:0.0	.	367;367	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	Y	367	ENSP00000262753:D367Y;ENSP00000362238:D367Y	ENSP00000262753:D367Y	D	-	1	0	POF1B	84448890	1.000000	0.71417	0.998000	0.56505	0.168000	0.22595	2.959000	0.49153	2.302000	0.77476	0.600000	0.82982	GAC	.		0.328	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057391.2	NM_024921	
POTEE	445582	broad.mit.edu;bcgsc.ca	37	2	131976218	131976218	+	Silent	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:131976218C>A	ENST00000356920.5	+	1	337	c.243C>A	c.(241-243)ggC>ggA	p.G81G	PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_Silent_p.G81G	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	81					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GCAACGTGGGCGCTTCTGGAG	0.597																																					p.G81G		.											.	.	.	0			c.C243A						.						85.0	86.0	86.0					2																	131976218		2202	4295	6497	SO:0001819	synonymous_variant	445582	exon1			CGTGGGCGCTTCT	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.243C>A	2.37:g.131976218C>A		Somatic	123.0	1.0		WXS	Illumina HiSeq	Phase_I	109.0	23.0	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	ENST00000356920.5	37	CCDS46414.1																																																																																			.		0.597	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
TBC1D1	23216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	37962607	37962607	+	Intron	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr4:37962607G>T	ENST00000261439.4	+	3	772				TBC1D1_ENST00000508802.1_Intron|PTTG2_ENST00000504686.1_Missense_Mutation_p.K184N	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						TCTCCTTCAAGCATTCTGTCG	0.438																																					p.K184N		.											.	.	.	0			c.G552T						.						192.0	194.0	194.0					4																	37962607		2203	4300	6503	SO:0001627	intron_variant	10744	exon1			CTTCAAGCATTCT	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.418-53523G>T	4.37:g.37962607G>T		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	14.0	NM_006607	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	37	CCDS33972.1	.	.	.	.	.	.	.	.	.	.	G	9.939	1.216924	0.22373	.	.	ENSG00000250254	ENST00000504686	T	0.48836	0.8	1.4	0.483	0.16820	.	.	.	.	.	T	0.30541	0.0768	.	.	.	0.09310	N	1	P	0.51147	0.942	B	0.39217	0.294	T	0.14227	-1.0480	8	0.40728	T	0.16	.	4.7285	0.12952	0.0:0.0:0.6347:0.3653	.	184	Q9NZH5-2	.	N	184	ENSP00000424261:K184N	ENSP00000424261:K184N	K	+	3	2	PTTG2	37639002	0.016000	0.18221	0.017000	0.16124	0.013000	0.08279	0.029000	0.13666	0.140000	0.18849	0.563000	0.77884	AAG	.		0.438	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173	
PUM2	23369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	20454712	20454712	+	Silent	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:20454712G>A	ENST00000361078.2	-	18	2810	c.2788C>T	c.(2788-2790)Ctg>Ttg	p.L930L	PUM2_ENST00000338086.5_Silent_p.L928L|PUM2_ENST00000403432.1_Silent_p.L928L|PUM2_ENST00000319801.5_Silent_p.L851L|PUM2_ENST00000536417.1_Silent_p.L872L			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	930	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCGTGTTCCAGTACATGCTGA	0.358																																					p.L928L		.											.	PUM2	91	0			c.C2782T						.						105.0	102.0	103.0					2																	20454712		2203	4300	6503	SO:0001819	synonymous_variant	23369	exon18			GTTCCAGTACATG	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.2788C>T	2.37:g.20454712G>A		Somatic	227.0	0.0		WXS	Illumina HiSeq	Phase_I	204.0	45.0	NM_015317	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Silent	SNP	ENST00000361078.2	37																																																																																				.		0.358	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	
RBL1	5933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	35663859	35663859	+	Silent	SNP	G	G	A	rs150960998	byFrequency	TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr20:35663859G>A	ENST00000373664.3	-	15	2022	c.1956C>T	c.(1954-1956)acC>acT	p.T652T	RBL1_ENST00000344359.3_Silent_p.T652T	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	652	Pocket; binds T and E1A.|Spacer.				chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				CACTCCCTGCGGTAGGAGAAC	0.363																																					p.T652T		.											.	RBL1	419	0			c.C1956T						.	G	,	0,4404		0,0,2202	62.0	61.0	61.0		1956,1956	-4.8	0.9	20	dbSNP_134	61	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	RBL1	NM_002895.2,NM_183404.1	,	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	,	652/1069,652/1015	35663859	2,13002	2202	4300	6502	SO:0001819	synonymous_variant	5933	exon15			CCCTGCGGTAGGA	L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.1956C>T	20.37:g.35663859G>A		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	21.0	NM_183404	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Silent	SNP	ENST00000373664.3	37	CCDS13289.1																																																																																			G|0.999;A|0.001		0.363	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2	NM_002895	
REEP2	51308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	137780127	137780127	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr5:137780127A>C	ENST00000254901.5	+	4	328	c.206A>C	c.(205-207)aAg>aCg	p.K69T	REEP2_ENST00000378339.2_Missense_Mutation_p.K69T|REEP2_ENST00000506158.1_Missense_Mutation_p.K31T	NM_016606.2	NP_057690.2	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	69					cell death (GO:0008219)|endoplasmic reticulum tubular network organization (GO:0071786)|protein transport into membrane raft (GO:0032596)|regulation of intracellular transport (GO:0032386)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TTTGAACTGAAGATCGCCTTC	0.587																																					p.K69T		.											.	REEP2	90	0			c.A206C						.						159.0	127.0	138.0					5																	137780127		2203	4300	6503	SO:0001583	missense	51308	exon4			AACTGAAGATCGC	AK056193	CCDS4205.1, CCDS64259.1	5q31	2014-03-12	2006-02-07	2006-02-07	ENSG00000132563	ENSG00000132563		"""Receptor accessory proteins"""	17975	protein-coding gene	gene with protein product		609347	"""chromosome 5 open reading frame 19"""	C5orf19		16271481, 15550249, 24388663	Standard	NM_016606		Approved	SGC32445, SPG72	uc003lda.4	Q9BRK0	OTTHUMG00000129205	ENST00000254901.5:c.206A>C	5.37:g.137780127A>C	ENSP00000254901:p.Lys69Thr	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	11.0	NM_016606	Q53EM8|Q9NYF2	Missense_Mutation	SNP	ENST00000254901.5	37	CCDS4205.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.902600	0.92035	.	.	ENSG00000132563	ENST00000378339;ENST00000254901;ENST00000506158	D;D;D	0.96802	-4.13;-4.13;-4.13	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.98883	0.9622	H	0.98351	4.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99297	1.0900	10	0.87932	D	0	-4.7393	14.0341	0.64634	1.0:0.0:0.0:0.0	.	69;69	A8K3D2;Q9BRK0	.;REEP2_HUMAN	T	69;69;31	ENSP00000367590:K69T;ENSP00000254901:K69T;ENSP00000422530:K31T	ENSP00000254901:K69T	K	+	2	0	REEP2	137808026	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.017000	0.93651	2.159000	0.67721	0.533000	0.62120	AAG	.		0.587	REEP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251284.1	NM_016606	
RFPL4A	342931	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	56274316	56274316	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr19:56274316G>T	ENST00000434937.2	+	3	810	c.639G>T	c.(637-639)ttG>ttT	p.L213F		NM_001145014.1	NP_001138486.1	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	213	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GTCCCCAGTTGCACAGAGTGG	0.478																																					p.L213F		.											.	RFPL4A	68	0			c.G639T						.						88.0	73.0	78.0					19																	56274316		692	1578	2270	SO:0001583	missense	342931	exon3			CCAGTTGCACAGA		CCDS46201.1	19q13.42	2013-02-22	2007-01-19	2007-01-19	ENSG00000223638	ENSG00000223638		"""RING-type (C3HC4) zinc fingers"""	16449	protein-coding gene	gene with protein product		612601	"""ret finger protein-like 4"""	RFPL4		11850190	Standard	NM_001145014		Approved	RNF210	uc010yge.2	A6NLU0	OTTHUMG00000165449	ENST00000434937.2:c.639G>T	19.37:g.56274316G>T	ENSP00000392936:p.Leu213Phe	Somatic	274.0	0.0		WXS	Illumina HiSeq	Phase_I	365.0	26.0	NM_001145014		Missense_Mutation	SNP	ENST00000434937.2	37	CCDS46201.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496276	0.26861	.	.	ENSG00000223638	ENST00000434937	T	0.69040	-0.37	2.49	-3.11	0.05299	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.66906	0.2837	M	0.91459	3.21	0.09310	N	1	P	0.43607	0.812	B	0.40741	0.339	T	0.58572	-0.7613	9	0.39692	T	0.17	-28.1593	4.9032	0.13786	0.2486:0.3613:0.3902:0.0	.	213	A6NLU0	RFPLA_HUMAN	F	213	ENSP00000392936:L213F	ENSP00000392936:L213F	L	+	3	2	RFPL4A	60966128	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.964000	0.03833	-0.913000	0.03832	-1.224000	0.01588	TTG	.		0.478	RFPL4A-001	NOVEL	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384184.1	XM_292796	
RGPD4	285190	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	108499228	108499228	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:108499228T>C	ENST00000408999.3	+	22	5242	c.5165T>C	c.(5164-5166)tTc>tCc	p.F1722S	RGPD4_ENST00000354986.4_Missense_Mutation_p.F1722S	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1722	GRIP. {ECO:0000255|PROSITE- ProRule:PRU00250}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						CAGTTCATTTTCTTGAAGCCA	0.428																																					p.F1722S		.											.	RGPD4	2	0			c.T5165C						.						68.0	97.0	88.0					2																	108499228		692	1589	2281	SO:0001583	missense	285190	exon22			TCATTTTCTTGAA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.5165T>C	2.37:g.108499228T>C	ENSP00000386810:p.Phe1722Ser	Somatic	1132.0	1.0		WXS	Illumina HiSeq	Phase_I	893.0	181.0	NM_182588	B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	11.65	1.702561	0.30232	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.38560	1.15;1.13	0.854	0.854	0.19007	GRIP (3);	.	.	.	.	T	0.24812	0.0602	N	0.24115	0.695	0.27255	N	0.958782	B	0.31752	0.338	B	0.23852	0.049	T	0.18713	-1.0328	9	0.87932	D	0	-15.9155	7.1387	0.25543	0.0:0.0:0.0:1.0	.	1722	Q7Z3J3	RGPD4_HUMAN	S	1722;1722;1089	ENSP00000347081:F1722S;ENSP00000386810:F1722S	ENSP00000347081:F1722S	F	+	2	0	RGPD4	107865660	1.000000	0.71417	0.807000	0.32361	0.344000	0.29017	5.479000	0.66813	0.641000	0.30601	0.327000	0.21459	TTC	.		0.428	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
RNGTT	8732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	89554193	89554193	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr6:89554193T>C	ENST00000369485.4	-	11	1338	c.1152A>G	c.(1150-1152)atA>atG	p.I384M	RNGTT_ENST00000265607.6_Missense_Mutation_p.I384M|RNGTT_ENST00000369475.3_Missense_Mutation_p.I384M|RNGTT_ENST00000538899.1_Missense_Mutation_p.I324M	NM_003800.3	NP_003791.3	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase	384	GTase.|Interaction with POLR2A. {ECO:0000250}.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA processing (GO:0006396)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|mRNA guanylyltransferase activity (GO:0004484)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA guanylyltransferase activity (GO:0008192)|triphosphatase activity (GO:0050355)			endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	21		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		TTTCTCGTTCTATACACTGCA	0.348																																					p.I384M		.											.	RNGTT	91	0			c.A1152G						.						145.0	147.0	146.0					6																	89554193		2203	4300	6503	SO:0001583	missense	8732	exon11			TCGTTCTATACAC	AF025654	CCDS5017.1	6q16	2011-06-09			ENSG00000111880	ENSG00000111880	2.7.7.50	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	10073	protein-coding gene	gene with protein product		603512				9828141, 9512541	Standard	NM_001286428		Approved	HCE, HCE1, hCAP	uc003pmr.2	O60942	OTTHUMG00000015190	ENST00000369485.4:c.1152A>G	6.37:g.89554193T>C	ENSP00000358497:p.Ile384Met	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	13.0	NM_003800	E1P513|E1P514|O43483|O60257|O60351|Q5TCW8|Q8WUM8	Missense_Mutation	SNP	ENST00000369485.4	37	CCDS5017.1	.	.	.	.	.	.	.	.	.	.	T	17.29	3.351332	0.61183	.	.	ENSG00000111880	ENST00000369485;ENST00000265607;ENST00000538899;ENST00000536746;ENST00000369475	D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89	5.49	2.87	0.33458	mRNA capping enzyme (1);	0.039036	0.85682	D	0.000000	D	0.90150	0.6922	M	0.91249	3.19	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.995;0.997	D	0.89042	0.3449	10	0.49607	T	0.09	.	6.9231	0.24399	0.3539:0.0:0.1174:0.5287	.	324;384;384;384	B4DSJ8;Q5TCW7;O60942-2;O60942	.;.;.;MCE1_HUMAN	M	384;384;324;355;384	ENSP00000358497:I384M;ENSP00000265607:I384M;ENSP00000442609:I324M;ENSP00000358487:I384M	ENSP00000265607:I384M	I	-	3	3	RNGTT	89610912	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.134000	0.31442	0.985000	0.38656	0.460000	0.39030	ATA	.		0.348	RNGTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041469.1		
RPS23	6228	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	81573513	81573514	+	Splice_Site	INS	-	-	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr5:81573513_81573514insT	ENST00000296674.8	-	2	415_416	c.162_163insA	c.(160-165)aaagta>aaaAgta	p.V55fs	RPS23_ENST00000512493.1_Splice_Site_p.V55fs|RPS23_ENST00000503605.1_5'UTR|RPS23_ENST00000510210.1_Splice_Site_p.V55fs|RPS23_ENST00000507980.1_Splice_Site_p.V55fs|ATP6AP1L_ENST00000380167.4_5'Flank|RPS23_ENST00000510019.1_Splice_Site_p.V55fs|RPS23_ENST00000511844.1_Frame_Shift_Ins_p.V55fs	NM_001025.4	NP_001016.1	P62266	RS23_HUMAN	ribosomal protein S23	55					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			prostate(1)	1		Lung NSC(167;0.0025)|all_lung(232;0.00278)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-42)|Epithelial(54;8.38e-37)|all cancers(79;1.42e-31)		TGGACTTACACTTTTTCCAGCA	0.396																																					p.V55fs		.											.	RPS23	22	0			c.163_164insA						.																																			SO:0001630	splice_region_variant	6228	exon2			CTTACACTTTTTC	AB007158	CCDS47241.1	5q14.2	2013-05-09			ENSG00000186468	ENSG00000186468		"""S ribosomal proteins"""	10410	protein-coding gene	gene with protein product		603683				9582194	Standard	NM_001025		Approved	S23	uc003khu.3	P62266	OTTHUMG00000162557	ENST00000296674.8:c.164+1->A	5.37:g.81573518_81573518dupT		Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	19.0	NM_001025	P39028|Q6IB08	Frame_Shift_Ins	INS	ENST00000296674.8	37	CCDS47241.1																																																																																			.		0.396	RPS23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369546.2	NM_001025	Frame_Shift_Ins
RYK	6259	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	133921638	133921638	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr3:133921638G>C	ENST00000427044.2	-	7	758	c.148C>G	c.(148-150)Ctc>Gtc	p.L50V	RYK_ENST00000296084.4_Missense_Mutation_p.L240V			P34925	RYK_HUMAN	receptor-like tyrosine kinase	239					axon guidance (GO:0007411)|corpus callosum development (GO:0022038)|neuron differentiation (GO:0030182)|neuron projection development (GO:0031175)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of MAPK cascade (GO:0043410)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			lung(1)|ovary(3)	4						ATTGCTACGAGAAATATTACT	0.343																																					.		.											.	RYK	1379	0			.						.						77.0	70.0	72.0					3																	133921638		1836	4097	5933	SO:0001583	missense	6259	.			CTACGAGAAATAT	S59184	CCDS75016.1	3q22.1	2012-02-28	2012-02-28		ENSG00000163785	ENSG00000163785	2.7.10.1		10481	protein-coding gene	gene with protein product		600524	"""JTK5A protein tyrosine kinase"", ""RYK receptor-like tyrosine kinase"""	JTK5A		8386829	Standard	NM_001005861		Approved	D3S3195, RYK1, JTK5	uc003eqc.1	P34925	OTTHUMG00000159750	ENST00000427044.2:c.148C>G	3.37:g.133921638G>C	ENSP00000399527:p.Leu50Val	Somatic	132.0	1.0		WXS	Illumina HiSeq	Phase_I	164.0	27.0	.	Q04696	Missense_Mutation	SNP	ENST00000427044.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.79|17.79	3.475573|3.475573	0.63737|0.63737	.|.	.|.	ENSG00000163785|ENSG00000163785	ENST00000460933|ENST00000296084;ENST00000427044	T|T;T	0.19806|0.79247	2.12|1.88;-1.25	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.82540|0.82540	0.5059|0.5059	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D;D	.|0.61697	.|0.982;0.99	.|D;D	.|0.72982	.|0.952;0.979	T|T	0.80139|0.80139	-0.1507|-0.1507	7|10	0.07813|0.32370	T|T	0.8|0.25	-4.4698|-4.4698	19.851|19.851	0.96740|0.96740	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|239;239	.|P34925;P34925-2	.|RYK_HUMAN;.	L|V	221|240;50	ENSP00000419122:F221L|ENSP00000296084:L240V;ENSP00000399527:L50V	ENSP00000419122:F221L|ENSP00000296084:L240V	F|L	-|-	3|1	2|0	RYK|RYK	135404328|135404328	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.912000|0.912000	0.54170|0.54170	9.110000|9.110000	0.94302|0.94302	2.687000|2.687000	0.91594|0.91594	0.557000|0.557000	0.71058|0.71058	TTC|CTC	.		0.343	RYK-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001005861	
SBF1	6305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50905841	50905841	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr22:50905841C>T	ENST00000390679.3	-	5	659	c.475G>A	c.(475-477)Ggc>Agc	p.G159S	SBF1_ENST00000380817.3_Missense_Mutation_p.G159S|SBF1_ENST00000348911.6_Missense_Mutation_p.G160S			O95248	MTMR5_HUMAN	SET binding factor 1	159	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		ACATTCAGGCCCTCCACGTGG	0.617																																					p.G159S		.											.	SBF1	90	0			c.G475A						.						95.0	104.0	101.0					22																	50905841		2156	4245	6401	SO:0001583	missense	6305	exon5			TCAGGCCCTCCAC	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.475G>A	22.37:g.50905841C>T	ENSP00000375097:p.Gly159Ser	Somatic	219.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	25.0	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		.	.	.	.	.	.	.	.	.	.	C	8.360	0.832829	0.16820	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	T;T;T	0.10382	2.88;2.88;2.88	4.75	4.75	0.60458	.	1.634860	0.03868	N	0.275222	T	0.07728	0.0194	N	0.04373	-0.215	0.49798	D	0.999823	B;B	0.33694	0.421;0.421	B;B	0.40199	0.322;0.322	T	0.25847	-1.0120	10	0.02654	T	1	.	12.3763	0.55281	0.0:0.9154:0.0:0.0846	.	160;159	G5E933;O95248-4	.;.	S	159;160;170;169;159	ENSP00000370196:G159S;ENSP00000252027:G160S;ENSP00000375097:G159S	ENSP00000336522:G169S	G	-	1	0	SBF1	49252707	0.858000	0.29795	1.000000	0.80357	0.982000	0.71751	1.751000	0.38339	2.467000	0.83353	0.561000	0.74099	GGC	.		0.617	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
SCN10A	6336	broad.mit.edu;ucsc.edu	37	3	38739071	38739071	+	Silent	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr3:38739071G>T	ENST00000449082.2	-	27	5639	c.5640C>A	c.(5638-5640)ccC>ccA	p.P1880P		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1880	IQ.				AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CCTCAGCTCTGGGCACACATG	0.488																																					p.P1880P		.											.	SCN10A	99	0			c.C5640A						.						134.0	122.0	126.0					3																	38739071		2203	4300	6503	SO:0001819	synonymous_variant	6336	exon27			AGCTCTGGGCACA	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5640C>A	3.37:g.38739071G>T		Somatic	84.0	1.0		WXS	Illumina HiSeq	Phase_I	101.0	13.0	NM_006514	A6NDQ1	Silent	SNP	ENST00000449082.2	37	CCDS33736.1																																																																																			.		0.488	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
SCRN2	90507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	45916030	45916030	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr17:45916030G>C	ENST00000290216.9	-	6	930	c.805C>G	c.(805-807)Ctc>Gtc	p.L269V	SCRN2_ENST00000407215.3_Missense_Mutation_p.L269V|SCRN2_ENST00000584123.1_Missense_Mutation_p.L277V	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	269						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						TTGTCTCTGAGGATGCCCATC	0.637																																					p.L269V		.											.	SCRN2	91	0			c.C805G						.						93.0	72.0	79.0					17																	45916030		2203	4300	6503	SO:0001583	missense	90507	exon6			CTCTGAGGATGCC	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.805C>G	17.37:g.45916030G>C	ENSP00000290216:p.Leu269Val	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	13.0	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	37	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728715	0.69074	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.13657	2.61;2.57	5.52	5.52	0.82312	.	0.125936	0.56097	D	0.000039	T	0.40222	0.1108	M	0.89353	3.025	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.997	D;D;D	0.78314	0.991;0.991;0.991	T	0.39961	-0.9588	10	0.87932	D	0	-28.511	8.5536	0.33467	0.1648:0.0:0.8352:0.0	.	269;269;269	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	V	269	ENSP00000290216:L269V;ENSP00000383935:L269V	ENSP00000290216:L269V	L	-	1	0	SCRN2	43271029	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.102000	0.57776	2.588000	0.87417	0.655000	0.94253	CTC	.		0.637	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
SIPA1L2	57568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	232607246	232607246	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:232607246T>A	ENST00000366630.1	-	7	2472	c.2114A>T	c.(2113-2115)gAc>gTc	p.D705V	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.D705V			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	705	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GGTGACGATGTCATTTCCTAT	0.388																																					p.D705V		.											.	SIPA1L2	95	0			c.A2114T						.						129.0	134.0	133.0					1																	232607246		2121	4275	6396	SO:0001583	missense	57568	exon6			ACGATGTCATTTC	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.2114A>T	1.37:g.232607246T>A	ENSP00000355589:p.Asp705Val	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	19.0	NM_020808	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.924592	0.92319	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.97138	-4.26;-4.26	5.99	5.99	0.97316	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.99202	0.9723	H	0.98786	4.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98802	1.0740	10	0.87932	D	0	-44.4057	16.4892	0.84195	0.0:0.0:0.0:1.0	.	705	Q9P2F8	SI1L2_HUMAN	V	705	ENSP00000355589:D705V;ENSP00000262861:D705V	ENSP00000262861:D705V	D	-	2	0	SIPA1L2	230673869	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.296000	0.77279	0.533000	0.62120	GAC	.		0.388	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
SLC11A1	6556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219254739	219254739	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:219254739C>T	ENST00000233202.6	+	9	1282	c.942C>T	c.(940-942)acC>acT	p.T314T	SLC11A1_ENST00000539932.1_Silent_p.T196T	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	314					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCAGAAAACCAACCAGGCTG	0.552																																					p.T314T		.											.	SLC11A1	93	0			c.C942T						.						148.0	118.0	128.0					2																	219254739		2203	4300	6503	SO:0001819	synonymous_variant	6556	exon9			GAAAACCAACCAG	D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.942C>T	2.37:g.219254739C>T		Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	20.0	NM_000578	C0H5Y3	Silent	SNP	ENST00000233202.6	37	CCDS2415.1																																																																																			.		0.552	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578	
SLC39A8	64116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	103225548	103225548	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr4:103225548A>T	ENST00000394833.2	-	5	1242	c.766T>A	c.(766-768)Tgc>Agc	p.C256S	SLC39A8_ENST00000356736.4_Missense_Mutation_p.C256S|SLC39A8_ENST00000424970.2_Missense_Mutation_p.C256S|SLC39A8_ENST00000510255.1_5'Flank	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	256					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		TTTGCATAGCATGTCACACCA	0.378																																					p.C256S		.											.	SLC39A8	90	0			c.T766A						.						165.0	144.0	151.0					4																	103225548		2203	4300	6503	SO:0001583	missense	64116	exon5			CATAGCATGTCAC		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.766T>A	4.37:g.103225548A>T	ENSP00000378310:p.Cys256Ser	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	26.0	NM_022154	B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	ENST00000394833.2	37	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	A	11.02	1.515357	0.27123	.	.	ENSG00000138821	ENST00000424970;ENST00000356736;ENST00000394833	T;T;T	0.69926	-0.3;-0.44;-0.44	4.81	4.81	0.61882	.	4.723360	0.00166	N	0.000003	T	0.49098	0.1537	N	0.12637	0.245	0.42748	D	0.993769	B;B;B	0.25206	0.12;0.002;0.002	B;B;B	0.18561	0.022;0.017;0.007	T	0.37641	-0.9697	10	0.07813	T	0.8	-25.4895	9.2864	0.37760	0.8395:0.0:0.0:0.1605	.	256;256;189	B4E2H3;Q9C0K1;Q9C0K1-2	.;S39A8_HUMAN;.	S	256	ENSP00000394548:C256S;ENSP00000349174:C256S;ENSP00000378310:C256S	ENSP00000349174:C256S	C	-	1	0	SLC39A8	103444571	1.000000	0.71417	0.996000	0.52242	0.933000	0.57130	5.719000	0.68462	1.930000	0.55929	0.528000	0.53228	TGC	.		0.378	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	
SMYD3	64754	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	246021833	246021833	+	Silent	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:246021833G>A	ENST00000388985.4	-	10	1040	c.1041C>T	c.(1039-1041)gcC>gcT	p.A347A	SMYD3_ENST00000366517.1_5'UTR|SMYD3_ENST00000490107.1_Silent_p.A288A|SMYD3_ENST00000541742.1_Silent_p.A288A			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	347					cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)			breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		CATAGAACAAGGCTTCCTCCA	0.552																																					p.A347A		.											.	SMYD3	226	0			c.C1041T						.						118.0	97.0	104.0					1																	246021833		2203	4300	6503	SO:0001819	synonymous_variant	64754	exon10			GAACAAGGCTTCC	AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.1041C>T	1.37:g.246021833G>A		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	12.0	NM_001167740	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Silent	SNP	ENST00000388985.4	37	CCDS53486.1																																																																																			.		0.552	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022743	
SOGA1	140710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	35431376	35431376	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr20:35431376C>T	ENST00000357779.3	-	11	2834	c.2508G>A	c.(2506-2508)caG>caA	p.Q836Q	SOGA1_ENST00000456801.2_Silent_p.Q677Q|SOGA1_ENST00000279034.6_Silent_p.Q836Q|SOGA1_ENST00000237536.4_Silent_p.Q1074Q			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	836					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						TGATCTGCAGCTGCCGAGTCA	0.642																																					p.Q1074Q		.											.	.	.	0			c.G3222A						.																																			SO:0001819	synonymous_variant	140710	exon11			CTGCAGCTGCCGA	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.2508G>A	20.37:g.35431376C>T		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	15.0	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Silent	SNP	ENST00000357779.3	37																																																																																				.		0.642	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
SOX11	6664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	5834087	5834087	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:5834087G>T	ENST00000322002.3	+	1	1289	c.1234G>T	c.(1234-1236)Gag>Tag	p.E412*	AC108025.2_ENST00000453678.1_RNA|AC010729.1_ENST00000455579.2_RNA|AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000420221.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	412					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)	p.E412*(1)		central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		CTCCCACTTCGAGTTCCCCGA	0.647																																					p.E412X		.											SOX11,brain,glioma,0	SOX11	514	1	Substitution - Nonsense(1)	central_nervous_system(1)	c.G1234T						.						12.0	9.0	10.0					2																	5834087		2000	3826	5826	SO:0001587	stop_gained	6664	exon1			CACTTCGAGTTCC		CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.1234G>T	2.37:g.5834087G>T	ENSP00000322568:p.Glu412*	Somatic	59.0	1.0		WXS	Illumina HiSeq	Phase_I	70.0	19.0	NM_003108	Q4ZFV8	Nonsense_Mutation	SNP	ENST00000322002.3	37	CCDS1654.1	.	.	.	.	.	.	.	.	.	.	G	38	6.952028	0.97960	.	.	ENSG00000176887	ENST00000322002	.	.	.	5.15	5.15	0.70609	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.6079	0.91273	0.0:0.0:1.0:0.0	.	.	.	.	X	412	.	ENSP00000322568:E412X	E	+	1	0	SOX11	5751538	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.514000	0.98013	2.393000	0.81446	0.561000	0.74099	GAG	.		0.647	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206698.1	NM_003108	
SPRR3	6707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152975594	152975594	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:152975594T>G	ENST00000295367.4	+	2	140	c.98T>G	c.(97-99)tTt>tGt	p.F33C	SPRR3_ENST00000542696.1_Missense_Mutation_p.F33C|SPRR3_ENST00000331860.3_Missense_Mutation_p.F33C	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	33					epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGGAAATATTTGTTCCCACA	0.527																																					p.F33C		.											.	SPRR3	45	0			c.T98G						.						80.0	74.0	76.0					1																	152975594		2203	4300	6503	SO:0001583	missense	6707	exon2			AAATATTTGTTCC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.98T>G	1.37:g.152975594T>G	ENSP00000295367:p.Phe33Cys	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	58.0	NM_001097589	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Missense_Mutation	SNP	ENST00000295367.4	37	CCDS1033.1	.	.	.	.	.	.	.	.	.	.	T	7.187	0.590721	0.13812	.	.	ENSG00000163209	ENST00000331860;ENST00000443178;ENST00000295367;ENST00000542696	T;T;T;T	0.13657	2.57;2.57;2.57;2.57	3.78	1.39	0.22231	.	.	.	.	.	T	0.02888	0.0086	N	0.16743	0.435	0.09310	N	0.999997	B;B	0.32324	0.314;0.364	B;B	0.38616	0.182;0.277	T	0.45469	-0.9259	9	0.35671	T	0.21	.	5.2229	0.15377	0.0:0.1019:0.1813:0.7168	.	33;33	F5GZ12;Q9UBC9	.;SPRR3_HUMAN	C	33	ENSP00000330391:F33C;ENSP00000402016:F33C;ENSP00000295367:F33C;ENSP00000441477:F33C	ENSP00000295367:F33C	F	+	2	0	SPRR3	151242218	0.000000	0.05858	0.503000	0.27626	0.705000	0.40729	-1.661000	0.01972	0.267000	0.21916	0.460000	0.39030	TTT	.		0.527	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
ST8SIA2	8128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	92981799	92981799	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr15:92981799C>A	ENST00000268164.3	+	4	744	c.507C>A	c.(505-507)agC>agA	p.S169R	ST8SIA2_ENST00000539113.1_Missense_Mutation_p.S148R	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	169					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TGCTGAACAGCGGCTGTGGGC	0.607																																					p.S169R		.											.	ST8SIA2	90	0			c.C507A						.						53.0	46.0	49.0					15																	92981799		2198	4298	6496	SO:0001583	missense	8128	exon4			GAACAGCGGCTGT	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.507C>A	15.37:g.92981799C>A	ENSP00000268164:p.Ser169Arg	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	22.0	NM_006011	Q4VAZ0|Q92470|Q92746	Missense_Mutation	SNP	ENST00000268164.3	37	CCDS10372.1	.	.	.	.	.	.	.	.	.	.	C	19.38	3.817165	0.70912	.	.	ENSG00000140557	ENST00000268164;ENST00000539113;ENST00000555434	T;T;T	0.40225	1.04;1.04;1.04	5.03	-3.0	0.05480	.	0.078649	0.85682	D	0.000000	T	0.65396	0.2687	M	0.91920	3.255	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.70890	-0.4749	10	0.87932	D	0	-25.3223	11.7529	0.51859	0.0:0.462:0.0:0.538	.	148;169	C6G488;Q92186	.;SIA8B_HUMAN	R	169;148;126	ENSP00000268164:S169R;ENSP00000437382:S148R;ENSP00000450851:S126R	ENSP00000268164:S169R	S	+	3	2	ST8SIA2	90782803	0.462000	0.25791	0.989000	0.46669	0.975000	0.68041	-0.250000	0.08830	-0.420000	0.07427	0.563000	0.77884	AGC	.		0.607	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011	
STAT4	6775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	192011406	192011406	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:192011406C>A	ENST00000392320.2	-	3	520	c.206G>T	c.(205-207)gGt>gTt	p.G69V	STAT4_ENST00000409995.1_Missense_Mutation_p.G69V|STAT4_ENST00000358470.4_Missense_Mutation_p.G69V	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	69					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			GGAAACACGACCTAACTGTTC	0.338																																					p.G69V		.											.	STAT4	914	0			c.G206T						.						85.0	82.0	83.0					2																	192011406		2203	4297	6500	SO:0001583	missense	6775	exon3			ACACGACCTAACT		CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.206G>T	2.37:g.192011406C>A	ENSP00000376134:p.Gly69Val	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	15.0	NM_001243835	Q96NZ6	Missense_Mutation	SNP	ENST00000392320.2	37	CCDS2310.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.952549	0.53293	.	.	ENSG00000138378	ENST00000358470;ENST00000392320;ENST00000413064;ENST00000409995;ENST00000450994	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	5.55	5.55	0.83447	STAT transcription factor, protein interaction (4);	0.378286	0.27294	N	0.020030	T	0.46560	0.1399	N	0.19112	0.55	0.53005	D	0.999963	P;D;D	0.56287	0.915;0.975;0.975	P;P;P	0.54026	0.601;0.74;0.654	T	0.48736	-0.9009	10	0.87932	D	0	-15.749	6.7041	0.23240	0.0:0.8015:0.0:0.1985	.	69;69;69	B4DSY7;B4DV04;Q14765	.;.;STAT4_HUMAN	V	69;69;42;69;69	ENSP00000351255:G69V;ENSP00000376134:G69V;ENSP00000403238:G42V;ENSP00000386288:G69V;ENSP00000412397:G69V	ENSP00000351255:G69V	G	-	2	0	STAT4	191719651	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.725000	0.47294	2.885000	0.99019	0.655000	0.94253	GGT	.		0.338	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335586.1	NM_003151	
STXBP5L	9515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	120959330	120959330	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr3:120959330C>G	ENST00000273666.6	+	14	1647	c.1376C>G	c.(1375-1377)aCa>aGa	p.T459R	STXBP5L_ENST00000471454.1_Missense_Mutation_p.T459R|STXBP5L_ENST00000497029.1_Missense_Mutation_p.T459R|STXBP5L_ENST00000472879.1_Missense_Mutation_p.T459R|STXBP5L_ENST00000492541.1_Missense_Mutation_p.T459R	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	459					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		GGAGCACAAACATATCCAGAA	0.323																																					p.T459R		.											.	STXBP5L	77	0			c.C1376G						.						85.0	84.0	84.0					3																	120959330		1828	4084	5912	SO:0001583	missense	9515	exon14			CACAAACATATCC	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1376C>G	3.37:g.120959330C>G	ENSP00000273666:p.Thr459Arg	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	6.0	NM_014980	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	37	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956356	0.53293	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54	5.21	5.21	0.72293	WD40 repeat-like-containing domain (2);	0.049594	0.85682	D	0.000000	T	0.51669	0.1688	L	0.59436	1.845	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.69654	0.965;0.965	T	0.34477	-0.9827	10	0.31617	T	0.26	-34.4949	18.9528	0.92646	0.0:1.0:0.0:0.0	.	459;459	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	R	459	ENSP00000273666:T459R;ENSP00000420019:T459R;ENSP00000419627:T459R;ENSP00000420287:T459R;ENSP00000420666:T459R;ENSP00000420167:T459R	ENSP00000273666:T459R	T	+	2	0	STXBP5L	122442020	0.980000	0.34600	1.000000	0.80357	0.893000	0.52053	1.863000	0.39459	2.716000	0.92895	0.561000	0.74099	ACA	.		0.323	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
TACR2	6865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71166949	71166949	+	Missense_Mutation	SNP	C	C	G	rs200848530		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr10:71166949C>G	ENST00000373306.4	-	4	1372	c.829G>C	c.(829-831)Gag>Cag	p.E277Q	TACR2_ENST00000373307.1_Missense_Mutation_p.E65Q	NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	277					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						TAGATGTCCTCCTGGAAGCTG	0.532																																					p.E277Q		.											.	TACR2	522	0			c.G829C						.						223.0	183.0	197.0					10																	71166949		2203	4300	6503	SO:0001583	missense	6865	exon4			TGTCCTCCTGGAA		CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.829G>C	10.37:g.71166949C>G	ENSP00000362403:p.Glu277Gln	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	35.0	NM_001057	A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Missense_Mutation	SNP	ENST00000373306.4	37	CCDS7293.1	.	.	.	.	.	.	.	.	.	.	C	6.070	0.381138	0.11466	.	.	ENSG00000075073	ENST00000373307;ENST00000373306	T;T	0.37235	1.21;1.21	5.11	0.863	0.19062	GPCR, rhodopsin-like superfamily (1);	0.567000	0.17722	N	0.164200	T	0.18882	0.0453	N	0.19112	0.55	0.09310	N	0.999996	B	0.16802	0.019	B	0.19666	0.026	T	0.24977	-1.0145	10	0.14252	T	0.57	.	7.457	0.27272	0.0:0.5866:0.1267:0.2867	.	277	P21452	NK2R_HUMAN	Q	65;277	ENSP00000362404:E65Q;ENSP00000362403:E277Q	ENSP00000362403:E277Q	E	-	1	0	TACR2	70836955	0.000000	0.05858	0.991000	0.47740	0.602000	0.36980	-0.287000	0.08388	0.555000	0.29079	-0.300000	0.09419	GAG	.		0.532	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048411.1		
TCF7	6932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	133473769	133473769	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr5:133473769C>A	ENST00000321584.4	+	4	657	c.461C>A	c.(460-462)cCc>cAc	p.P154H	TCF7_ENST00000518915.1_Missense_Mutation_p.P39H|TCF7_ENST00000342854.5_Missense_Mutation_p.P154H|TCF7_ENST00000432532.2_Missense_Mutation_p.P39H|TCF7_ENST00000520958.1_Missense_Mutation_p.P39H|TCF7_ENST00000378560.4_Missense_Mutation_p.P39H|TCF7_ENST00000321603.6_Missense_Mutation_p.P154H|TCF7_ENST00000395029.1_Missense_Mutation_p.P154H|TCF7_ENST00000378564.1_Missense_Mutation_p.P154H|TCF7_ENST00000395023.1_Missense_Mutation_p.P39H			P36402	TCF7_HUMAN	transcription factor 7 (T-cell specific, HMG-box)	154					alpha-beta T cell differentiation (GO:0046632)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cellular response to interleukin-4 (GO:0071353)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|generation of neurons (GO:0048699)|immune response (GO:0006955)|neural tube development (GO:0021915)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor V(D)J recombination (GO:0033153)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			kidney(2)|large_intestine(7)|lung(2)|skin(1)	12		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AATCAGCCCCCCCACGGTGTC	0.577																																					p.P154H		.											.	TCF7	90	0			c.C461A						.						113.0	110.0	111.0					5																	133473769		2203	4300	6503	SO:0001583	missense	6932	exon4			AGCCCCCCCACGG	Z47362	CCDS4169.1, CCDS4170.1, CCDS43362.1, CCDS47263.1, CCDS47263.2	5q31	2008-02-05			ENSG00000081059	ENSG00000081059			11639	protein-coding gene	gene with protein product		189908					Standard	NM_003202		Approved	TCF-1	uc003kyt.3	P36402	OTTHUMG00000129124	ENST00000321584.4:c.461C>A	5.37:g.133473769C>A	ENSP00000326540:p.Pro154His	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	38.0	NM_003202	B3KSH3|Q86WR9|Q9UKI4	Missense_Mutation	SNP	ENST00000321584.4	37		.	.	.	.	.	.	.	.	.	.	C	14.15	2.448261	0.43429	.	.	ENSG00000081059	ENST00000342854;ENST00000361590;ENST00000321603;ENST00000321584;ENST00000378564;ENST00000395029;ENST00000518887;ENST00000517851;ENST00000521639;ENST00000522375;ENST00000378560;ENST00000432532;ENST00000520958;ENST00000518915;ENST00000395023;ENST00000519037	D;D;D;D;D;D;D;D;D;D;T	0.99201	-5.49;-5.54;-5.54;-5.55;-5.54;-5.48;-5.49;-5.49;-5.47;-5.49;0.95	4.95	2.08	0.27032	CTNNB1 binding, N-teminal (1);	0.381500	0.29884	N	0.010959	D	0.97926	0.9318	L	0.43152	1.355	0.09310	N	1	B;D;P;B	0.56287	0.073;0.975;0.954;0.0	B;P;P;B	0.55011	0.115;0.766;0.69;0.001	D	0.94600	0.7795	10	0.56958	D	0.05	.	8.3219	0.32134	0.3151:0.5325:0.1523:0.0	.	154;154;154;154	P36402-9;B7WNT5;P36402;P36402-5	.;.;TCF7_HUMAN;.	H	154;154;154;154;154;154;39;39;39;39;39;39;39;39;39;14	ENSP00000340347:P154H;ENSP00000326654:P154H;ENSP00000326540:P154H;ENSP00000367827:P154H;ENSP00000378472:P154H;ENSP00000367822:P39H;ENSP00000397946:P39H;ENSP00000429547:P39H;ENSP00000430179:P39H;ENSP00000378469:P39H;ENSP00000429696:P14H	ENSP00000326540:P154H	P	+	2	0	TCF7	133501668	0.022000	0.18835	0.001000	0.08648	0.893000	0.52053	2.933000	0.48948	0.232000	0.21100	0.557000	0.71058	CCC	.		0.577	TCF7-201	KNOWN	basic	protein_coding	protein_coding		NM_201634	
TECPR2	9895	ucsc.edu;bcgsc.ca	37	14	102904370	102904370	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr14:102904370C>T	ENST00000359520.7	+	10	2632	c.2406C>T	c.(2404-2406)agC>agT	p.S802S	TECPR2_ENST00000558678.1_Silent_p.S802S	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	802					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						TTGCAGAAAGCTGGATGGGCT	0.527											OREG0022547	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S802S		.											.	TECPR2	92	0			c.C2406T						.						143.0	152.0	149.0					14																	102904370		2203	4300	6503	SO:0001819	synonymous_variant	9895	exon10			AGAAAGCTGGATG	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.2406C>T	14.37:g.102904370C>T		Somatic	63.0	0.0	1370	WXS	Illumina HiSeq	.	33.0	4.0	NM_001172631	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Silent	SNP	ENST00000359520.7	37	CCDS32162.1																																																																																			.		0.527	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
TENM1	10178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	123680738	123680738	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chrX:123680738C>T	ENST00000371130.3	-	15	2700	c.2637G>A	c.(2635-2637)gtG>gtA	p.V879V	TENM1_ENST00000422452.2_Silent_p.V879V	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	879					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGTCAAATGACACCTCAGGAG	0.378																																					p.V879V		.											.	.	.	0			c.G2637A						.						105.0	98.0	101.0					X																	123680738		2203	4300	6503	SO:0001819	synonymous_variant	10178	exon15			AAATGACACCTCA	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2637G>A	X.37:g.123680738C>T		Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	12.0	NM_001163278	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																			.		0.378	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
TEX15	56154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	30702749	30702749	+	Missense_Mutation	SNP	G	G	A	rs115550830		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr8:30702749G>A	ENST00000256246.2	-	1	3859	c.3785C>T	c.(3784-3786)gCg>gTg	p.A1262V		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1262					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTCAGTTTTCGCCTTTGTGTG	0.313																																					p.A1262V		.											.	TEX15	97	0			c.C3785T						.						99.0	94.0	96.0					8																	30702749		2203	4299	6502	SO:0001583	missense	56154	exon1			GTTTTCGCCTTTG	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.3785C>T	8.37:g.30702749G>A	ENSP00000256246:p.Ala1262Val	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	17.0	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.829462	0.00584	.	.	ENSG00000133863	ENST00000256246	T	0.24538	1.85	5.96	-0.991	0.10235	.	0.700000	0.13040	N	0.418590	T	0.07593	0.0191	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25047	-1.0143	10	0.87932	D	0	.	1.4564	0.02386	0.4456:0.2626:0.1637:0.1281	.	1262	Q9BXT5	TEX15_HUMAN	V	1262	ENSP00000256246:A1262V	ENSP00000256246:A1262V	A	-	2	0	TEX15	30822291	0.000000	0.05858	0.009000	0.14445	0.071000	0.16799	0.117000	0.15583	0.159000	0.19401	-0.238000	0.12139	GCG	G|0.999;C|0.001		0.313	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
TLR8	51311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	12937742	12937742	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chrX:12937742G>A	ENST00000218032.6	+	2	670	c.583G>A	c.(583-585)Gga>Aga	p.G195R	TLR8_ENST00000311912.5_Missense_Mutation_p.G213R	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	195					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	CATAGAAGATGGAGTATTTGA	0.373																																					p.G195R		.											.	TLR8	629	0			c.G583A						.						65.0	70.0	68.0					X																	12937742		2203	4299	6502	SO:0001583	missense	51311	exon2			GAAGATGGAGTAT	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.583G>A	X.37:g.12937742G>A	ENSP00000218032:p.Gly195Arg	Somatic	218.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	36.0	NM_138636	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	37	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210039	0.39003	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.01059	5.39;5.39	4.93	4.93	0.64822	.	0.000000	0.40222	N	0.001143	T	0.02807	0.0084	N	0.25992	0.78	0.31765	N	0.632822	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.35943	-0.9768	10	0.59425	D	0.04	.	8.6708	0.34149	0.1584:0.0:0.8416:0.0	.	195;213	Q9NR97;D1CS70	TLR8_HUMAN;.	R	195;213	ENSP00000218032:G195R;ENSP00000312082:G213R	ENSP00000218032:G195R	G	+	1	0	TLR8	12847663	0.861000	0.29849	0.026000	0.17262	0.046000	0.14306	2.645000	0.46621	2.048000	0.60808	0.523000	0.50628	GGA	.		0.373	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610	
TMPRSS9	360200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	2399148	2399148	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr19:2399148C>T	ENST00000332578.3	+	3	369	c.369C>T	c.(367-369)atC>atT	p.I123I		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	123					plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCACGGCATCTCCCTGGCTG	0.647																																					p.I123I		.											.	TMPRSS9	91	0			c.C369T						.						44.0	38.0	40.0					19																	2399148		2203	4300	6503	SO:0001819	synonymous_variant	360200	exon3			CGGCATCTCCCTG	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.369C>T	19.37:g.2399148C>T		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	5.0	NM_182973	Q6ZND6|Q7Z411	Silent	SNP	ENST00000332578.3	37	CCDS12088.1																																																																																			.		0.647	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973	
TRPM7	54822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	50884667	50884667	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr15:50884667C>T	ENST00000313478.7	-	26	4046	c.3765G>A	c.(3763-3765)tcG>tcA	p.S1255S	TRPM7_ENST00000560955.1_Silent_p.S1255S	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1255					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TGCTAGCTTCCGACGCTTTCT	0.393																																					p.S1255S		.											.	TRPM7	392	0			c.G3765A						.						228.0	205.0	212.0					15																	50884667		1885	4117	6002	SO:0001819	synonymous_variant	54822	exon26			AGCTTCCGACGCT	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.3765G>A	15.37:g.50884667C>T		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	22.0	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Silent	SNP	ENST00000313478.7	37	CCDS42035.1																																																																																			.		0.393	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
TRPV3	162514	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	3417893	3417893	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr17:3417893G>A	ENST00000576742.1	-	17	2593	c.2272C>T	c.(2272-2274)Cga>Tga	p.R758*	TRPV3_ENST00000572519.1_Nonsense_Mutation_p.R758*|TRPV3_ENST00000301365.4_Nonsense_Mutation_p.R758*|SPATA22_ENST00000541913.1_5'Flank	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	758					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GTACCTGTTCGTCTTACAGGC	0.498																																					p.R758X		.											.	TRPV3	94	0			c.C2272T						.						201.0	139.0	160.0					17																	3417893		2203	4300	6503	SO:0001587	stop_gained	162514	exon17			CTGTTCGTCTTAC	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.2272C>T	17.37:g.3417893G>A	ENSP00000461518:p.Arg758*	Somatic	53.0	1.0		WXS	Illumina HiSeq	Phase_I	57.0	7.0	NM_001258205	Q8NDW7|Q8NET9|Q8NFH2	Nonsense_Mutation	SNP	ENST00000576742.1	37	CCDS11029.1	.	.	.	.	.	.	.	.	.	.	g	37	6.484810	0.97603	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	.	.	.	5.52	4.5	0.54988	.	0.328434	0.26532	N	0.023848	.	.	.	.	.	.	0.38053	D	0.935849	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-11.4365	12.2766	0.54739	0.0:0.0:0.831:0.169	.	.	.	.	X	758;758;742	.	ENSP00000301365:R758X	R	-	1	2	TRPV3	3364643	0.961000	0.32948	0.960000	0.40013	0.110000	0.19582	2.247000	0.43151	2.769000	0.95229	0.563000	0.77884	CGA	.		0.498	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179410949	179410949	+	Silent	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:179410949G>A	ENST00000591111.1	-	292	90410	c.90186C>T	c.(90184-90186)gtC>gtT	p.V30062V	TTN_ENST00000589042.1_Silent_p.V31703V|TTN_ENST00000342175.6_Silent_p.V22830V|TTN_ENST00000342992.6_Silent_p.V29135V|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Silent_p.V22638V|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Silent_p.V22763V			Q8WZ42	TITIN_HUMAN	titin	30062					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAGCACTTTGACCATGACAG	0.428																																					p.V31703V		.											.	TTN	636	0			c.C95109T						.						235.0	229.0	231.0					2																	179410949		1962	4148	6110	SO:0001819	synonymous_variant	7273	exon342			CACTTTGACCATG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.90186C>T	2.37:g.179410949G>A		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	11.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179431181	179431181	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:179431181T>C	ENST00000591111.1	-	276	74979	c.74755A>G	c.(74755-74757)Aaa>Gaa	p.K24919E	TTN_ENST00000589042.1_Missense_Mutation_p.K26560E|TTN_ENST00000342175.6_Missense_Mutation_p.K17687E|TTN_ENST00000342992.6_Missense_Mutation_p.K23992E|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K17495E|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K17620E			Q8WZ42	TITIN_HUMAN	titin	24919	Fibronectin type-III 81. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K17620E(1)|p.K17687E(1)|p.K23990E(1)|p.K17495E(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCGTATTTTATACTCTTGG	0.413																																					p.K26560E		.											.	TTN	636	4	Substitution - Missense(4)	skin(4)	c.A79678G						.						140.0	141.0	141.0					2																	179431181		1895	4119	6014	SO:0001583	missense	7273	exon326			GTATTTTATACTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.74755A>G	2.37:g.179431181T>C	ENSP00000465570:p.Lys24919Glu	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	10.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	12.85	2.061070	0.36373	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55052	0.54;0.54;0.54;0.54	5.92	5.92	0.95590	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45518	0.1346	N	0.25485	0.75	0.46298	D	0.998977	P;P;P;P	0.46859	0.885;0.885;0.885;0.885	P;P;P;P	0.45538	0.484;0.484;0.484;0.484	T	0.50448	-0.8827	9	0.87932	D	0	.	12.2414	0.54544	0.0:0.0:0.1417:0.8583	.	17495;17620;17687;24919	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	23992;17495;17687;17620;17493	ENSP00000343764:K23992E;ENSP00000434586:K17495E;ENSP00000340554:K17687E;ENSP00000352154:K17620E	ENSP00000340554:K17687E	K	-	1	0	TTN	179139427	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.147000	0.71783	2.270000	0.75569	0.459000	0.35465	AAA	.		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TYW1	55253	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	66482951	66482951	+	Missense_Mutation	SNP	G	G	A	rs531919446		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr7:66482951G>A	ENST00000359626.5	+	6	846	c.682G>A	c.(682-684)Gac>Aac	p.D228N		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	228	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				CATTGAGGCCGACTTCAGAGC	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		19818	0.0		0.0	False		,,,				2504	0.001				p.D228N		.											.	TYW1	91	0			c.G682A						.						89.0	79.0	82.0					7																	66482951		2203	4300	6503	SO:0001583	missense	55253	exon6			GAGGCCGACTTCA	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.682G>A	7.37:g.66482951G>A	ENSP00000352645:p.Asp228Asn	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	14.0	NM_018264	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	ENST00000359626.5	37	CCDS5538.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.396895	0.62177	.	.	ENSG00000198874	ENST00000359626	T	0.73575	-0.76	4.03	4.03	0.46877	Flavodoxin/nitric oxide synthase (2);	0.060261	0.64402	N	0.000005	T	0.78470	0.4288	M	0.93720	3.45	0.58432	D	0.999996	P	0.42039	0.769	B	0.38106	0.265	T	0.80269	-0.1453	10	0.20046	T	0.44	.	14.0157	0.64523	0.0:0.0:1.0:0.0	.	228	Q9NV66	TYW1_HUMAN	N	228	ENSP00000352645:D228N	ENSP00000352645:D228N	D	+	1	0	TYW1	66120386	1.000000	0.71417	0.949000	0.38748	0.100000	0.18952	8.803000	0.91915	2.254000	0.74563	0.313000	0.20887	GAC	.		0.557	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264	
UNC45A	55898	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	91478859	91478859	+	Missense_Mutation	SNP	A	A	C	rs34963697		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr15:91478859A>C	ENST00000418476.2	+	2	177	c.137A>C	c.(136-138)cAg>cCg	p.Q46P	UNC45A_ENST00000553671.2_3'UTR|AC068831.3_ENST00000448987.1_RNA|AC068831.3_ENST00000438890.1_RNA|UNC45A_ENST00000394275.2_Missense_Mutation_p.Q31P	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	46					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCCTACACTCAGGCCCTGGGT	0.667																																					p.Q46P		.											.	UNC45A	24	0			c.A137C						.						38.0	48.0	44.0					15																	91478859		2194	4297	6491	SO:0001583	missense	55898	exon2			ACACTCAGGCCCT		CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.137A>C	15.37:g.91478859A>C	ENSP00000407487:p.Gln46Pro	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	12.0	NM_018671	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	ENST00000418476.2	37	CCDS10367.1	.	.	.	.	.	.	.	.	.	.	A	15.81	2.944662	0.53079	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.62105	0.05;0.05	5.17	1.19	0.21007	Elongated TPR repeat-containing domain (1);Tetratricopeptide repeat-containing (1);	1.081060	0.06936	N	0.811985	T	0.68100	0.2964	M	0.81614	2.55	0.31266	N	0.692296	P;P;B;B	0.45428	0.685;0.858;0.177;0.177	B;P;B;B	0.48982	0.407;0.597;0.239;0.161	T	0.65524	-0.6147	10	0.59425	D	0.04	-16.0786	3.5096	0.07703	0.539:0.0:0.2132:0.2478	rs34963697	46;31;46;31	B4DZL0;B4DLE6;Q9H3U1;A8K6F7	.;.;UN45A_HUMAN;.	P	31;46	ENSP00000377816:Q31P;ENSP00000407487:Q46P	ENSP00000377816:Q31P	Q	+	2	0	UNC45A	89279863	0.846000	0.29590	0.975000	0.42487	0.774000	0.43823	1.300000	0.33436	0.826000	0.34661	0.454000	0.30748	CAG	A|0.982;C|0.018		0.667	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671	
UNG	7374	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	109535499	109535499	+	Silent	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr12:109535499G>A	ENST00000242576.2	+	1	121	c.15G>A	c.(13-15)aaG>aaA	p.K5K	UNG_ENST00000336865.2_5'Flank	NM_080911.2	NP_550433.1			uracil-DNA glycosylase											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						TCGGCCAGAAGACGCTCTACT	0.706								Base excision repair (BER), DNA glycosylases	Immune Deficiency with Hyper-IgM																												p.K5K		.											.	UNG	1083	0			c.G15A						.						14.0	14.0	14.0					12																	109535499		2199	4288	6487	SO:0001819	synonymous_variant	7374	exon1	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	CCAGAAGACGCTC	A64377	CCDS9124.1, CCDS9125.1	12q23-q24.1	2014-09-17			ENSG00000076248	ENSG00000076248	3.2.2.27		12572	protein-coding gene	gene with protein product	"""uracil-DNA glycosylase 1, uracil-DNA glycosylase 2"""	191525		DGU		1923798, 17101234	Standard	NM_080911		Approved	UDG, UNG1, UNG2, HIGM4	uc001tnz.2	P13051	OTTHUMG00000169247	ENST00000242576.2:c.15G>A	12.37:g.109535499G>A		Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	223.0	46.0	NM_080911		Silent	SNP	ENST00000242576.2	37	CCDS9124.1																																																																																			.		0.706	UNG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403067.1	NM_080911	
USP24	23358	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	55549487	55549488	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:55549487_55549488insA	ENST00000294383.6	-	57	6838_6839	c.6839_6840insT	c.(6838-6840)aacfs	p.N2280fs	USP24_ENST00000407756.1_Frame_Shift_Ins_p.N2120fs	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2280					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						ACTGAGCACAGTTTTTACAATT	0.312																																					p.N2280fs		.											.	USP24	521	0			c.6840_6841insT						.																																			SO:0001589	frameshift_variant	23358	exon57			AGCACAGTTTTTA	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.6839_6840insT	1.37:g.55549487_55549488insA	ENSP00000294383:p.Asn2280fs	Somatic	372.0	0.0		WXS	Illumina HiSeq	Phase_I	311.0	159.0	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Frame_Shift_Ins	INS	ENST00000294383.6	37	CCDS44154.2																																																																																			.		0.312	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216363610	216363610	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr1:216363610C>A	ENST00000307340.3	-	20	4737	c.4351G>T	c.(4351-4353)Ggt>Tgt	p.G1451C	USH2A_ENST00000366942.3_Missense_Mutation_p.G1451C|USH2A_ENST00000366943.2_Missense_Mutation_p.G1451C	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1451	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTCACACAACCAACTGAATTG	0.383										HNSCC(13;0.011)																											p.G1451C		.											.	USH2A	115	0			c.G4351T						.						112.0	108.0	109.0					1																	216363610		2203	4300	6503	SO:0001583	missense	7399	exon20			CACAACCAACTGA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4351G>T	1.37:g.216363610C>A	ENSP00000305941:p.Gly1451Cys	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	19.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393908	0.62066	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.65178	-0.14;-0.14;-0.14	5.51	4.59	0.56863	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.153474	0.29892	U	0.010933	T	0.81470	0.4829	M	0.85299	2.745	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.85389	0.1124	10	0.87932	D	0	.	16.6133	0.84900	0.0:0.8696:0.1304:0.0	.	1451;1451	O75445-2;O75445	.;USH2A_HUMAN	C	1451	ENSP00000305941:G1451C;ENSP00000355910:G1451C;ENSP00000355909:G1451C	ENSP00000305941:G1451C	G	-	1	0	USH2A	214430233	1.000000	0.71417	0.204000	0.23530	0.549000	0.35272	6.774000	0.75012	1.441000	0.47550	0.655000	0.94253	GGT	.		0.383	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
UTRN	7402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	144875994	144875994	+	Silent	SNP	C	C	A	rs375508056		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr6:144875994C>A	ENST00000367545.3	+	48	7099	c.7099C>A	c.(7099-7101)Cgg>Agg	p.R2367R		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2367					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GCAAGCCCGACGGGATCCACT	0.383																																					p.R2367R		.											.	UTRN	95	0			c.C7099A						.						61.0	62.0	61.0					6																	144875994		2203	4300	6503	SO:0001819	synonymous_variant	7402	exon48			GCCCGACGGGATC	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.7099C>A	6.37:g.144875994C>A		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	20.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	ENST00000367545.3	37	CCDS34547.1																																																																																			.		0.383	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
WDR20	91833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102676045	102676045	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr14:102676045T>C	ENST00000342702.3	+	3	1569	c.1538T>C	c.(1537-1539)cTg>cCg	p.L513P	WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000322340.5_Intron|WDR20_ENST00000556511.2_Missense_Mutation_p.L452P|WDR20_ENST00000499851.2_Missense_Mutation_p.L256P|WDR20_ENST00000335263.5_Missense_Mutation_p.L513P|WDR20_ENST00000545563.1_Missense_Mutation_p.L340P|WDR20_ENST00000556807.1_Missense_Mutation_p.L452P|WDR20_ENST00000424963.2_Missense_Mutation_p.L389P|WDR20_ENST00000454394.2_Missense_Mutation_p.L544P	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	513										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						GGAACGCCCCTGTGTCCTCGA	0.423											OREG0022939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L544P		.											.	WDR20	90	0			c.T1631C						.						96.0	92.0	94.0					14																	102676045		2203	4300	6503	SO:0001583	missense	91833	exon4			CGCCCCTGTGTCC	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.1538T>C	14.37:g.102676045T>C	ENSP00000341037:p.Leu513Pro	Somatic	111.0	0.0	1368	WXS	Illumina HiSeq	Phase_I	72.0	16.0	NM_001242417	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Missense_Mutation	SNP	ENST00000342702.3	37	CCDS9969.1	.	.	.	.	.	.	.	.	.	.	T	15.06	2.720593	0.48728	.	.	ENSG00000140153	ENST00000335263;ENST00000299135;ENST00000424963;ENST00000342702;ENST00000556807;ENST00000499851;ENST00000454394;ENST00000401892;ENST00000545563	D;D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.85031	0.5604	L	0.31926	0.97	0.80722	D	1	P;P;D;D;D;D;P	0.55800	0.955;0.943;0.958;0.966;0.973;0.966;0.904	P;P;P;P;P;P;P	0.58873	0.786;0.548;0.804;0.648;0.847;0.543;0.707	D	0.85688	0.1305	10	0.49607	T	0.09	.	16.2159	0.82217	0.0:0.0:0.0:1.0	.	544;525;452;513;452;389;513	E7EUY8;Q5JPH5;G3V2F8;Q8TBZ3-2;F8W9S4;B3KR43;Q8TBZ3	.;.;.;.;.;.;WDR20_HUMAN	P	513;452;389;513;452;256;544;443;340	ENSP00000335434:L513P;ENSP00000395793:L389P;ENSP00000341037:L513P;ENSP00000450636:L452P;ENSP00000443641:L256P;ENSP00000406084:L544P;ENSP00000437927:L340P	ENSP00000299135:L452P	L	+	2	0	WDR20	101745798	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.691000	0.84191	2.243000	0.73865	0.533000	0.62120	CTG	.		0.423	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414963.1	NM_181291	
WDR37	22884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	1149723	1149723	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr10:1149723G>T	ENST00000358220.1	+	10	1052	c.908G>T	c.(907-909)cGg>cTg	p.R303L	WDR37_ENST00000263150.4_Missense_Mutation_p.R303L			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	303										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		TCCTGGGACCGGACGGCAAAC	0.632																																					p.R303L		.											.	WDR37	90	0			c.G908T						.						62.0	55.0	57.0					10																	1149723		2203	4300	6503	SO:0001583	missense	22884	exon10			GGGACCGGACGGC	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.908G>T	10.37:g.1149723G>T	ENSP00000350954:p.Arg303Leu	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	11.0	NM_014023	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	37	CCDS7057.1	.	.	.	.	.	.	.	.	.	.	G	35	5.522038	0.96416	.	.	ENSG00000047056	ENST00000358220;ENST00000263150	T;T	0.61627	0.09;0.09	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83760	0.5324	H	0.94698	3.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87270	0.2285	10	0.62326	D	0.03	.	19.8834	0.96906	0.0:0.0:1.0:0.0	.	304;303	A8K976;Q9Y2I8	.;WDR37_HUMAN	L	303	ENSP00000350954:R303L;ENSP00000263150:R303L	ENSP00000263150:R303L	R	+	2	0	WDR37	1139723	1.000000	0.71417	0.382000	0.26119	0.910000	0.53928	9.480000	0.97931	2.694000	0.91930	0.655000	0.94253	CGG	.		0.632	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
WWC3	55841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	10085608	10085608	+	Silent	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chrX:10085608C>T	ENST00000380861.4	+	11	1900	c.1509C>T	c.(1507-1509)gcC>gcT	p.A503A	WWC3_ENST00000454666.1_Silent_p.A503A	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	503					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						GGGCACACGCCTCGGCTATGG	0.721																																					p.A503A		.											.	WWC3	134	0			c.C1509T						.						6.0	7.0	7.0					X																	10085608		2138	4194	6332	SO:0001819	synonymous_variant	55841	exon11			ACACGCCTCGGCT	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.1509C>T	X.37:g.10085608C>T		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	15.0	NM_015691	A8KA96|Q659C1|Q9BTQ1	Silent	SNP	ENST00000380861.4	37	CCDS14136.1																																																																																			.		0.721	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
ZC3H7A	29066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	11846585	11846585	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr16:11846585T>G	ENST00000396516.2	-	21	2863	c.2666A>C	c.(2665-2667)gAg>gCg	p.E889A	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.E889A|ZC3H7A_ENST00000575984.1_Missense_Mutation_p.E85A			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	889						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						CTGGTCGTCCTCGGTGTGGAA	0.483																																					p.E889A		.											.	ZC3H7A	94	0			c.A2666C						.						169.0	130.0	143.0					16																	11846585		2197	4300	6497	SO:0001583	missense	29066	exon22			TCGTCCTCGGTGT	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.2666A>C	16.37:g.11846585T>G	ENSP00000379773:p.Glu889Ala	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	12.0	NM_014153	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.217741	0.79352	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.11604	2.76;2.76	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.31199	0.0789	M	0.65498	2.005	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.01464	-1.1348	10	0.59425	D	0.04	.	15.165	0.72818	0.0:0.0:0.0:1.0	.	889	Q8IWR0	Z3H7A_HUMAN	A	889	ENSP00000347999:E889A;ENSP00000379773:E889A	ENSP00000347999:E889A	E	-	2	0	ZC3H7A	11754086	1.000000	0.71417	0.442000	0.26870	0.990000	0.78478	8.040000	0.89188	2.171000	0.68590	0.482000	0.46254	GAG	.		0.483	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
ZFC3H1	196441	broad.mit.edu;ucsc.edu	37	12	72022736	72022736	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr12:72022736C>T	ENST00000378743.3	-	20	4266	c.3908G>A	c.(3907-3909)aGt>aAt	p.S1303N		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1303					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CTCATCACTACTGAAGCTATT	0.328																																					p.S1303N		.											.	ZFC3H1	138	0			c.G3908A						.						147.0	134.0	138.0					12																	72022736		1825	4079	5904	SO:0001583	missense	196441	exon20			TCACTACTGAAGC	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.3908G>A	12.37:g.72022736C>T	ENSP00000368017:p.Ser1303Asn	Somatic	77.0	1.0		WXS	Illumina HiSeq	Phase_I	87.0	11.0	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080353	0.76528	.	.	ENSG00000133858	ENST00000378743	T	0.35605	1.3	5.87	5.87	0.94306	.	0.151633	0.64402	D	0.000013	T	0.47395	0.1443	N	0.24115	0.695	0.80722	D	1	D	0.58268	0.982	D	0.65874	0.939	T	0.29579	-1.0007	10	0.34782	T	0.22	.	20.2009	0.98259	0.0:1.0:0.0:0.0	.	1303	O60293	ZC3H1_HUMAN	N	1303	ENSP00000368017:S1303N	ENSP00000368017:S1303N	S	-	2	0	ZFC3H1	70309003	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.246000	0.51414	2.767000	0.95098	0.591000	0.81541	AGT	.		0.328	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
ZFP36L2	678	hgsc.bcm.edu;mdanderson.org	37	2	43451848	43451848	+	Silent	SNP	G	G	A			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:43451848G>A	ENST00000282388.3	-	2	1388	c.1095C>T	c.(1093-1095)ttC>ttT	p.F365F	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	365					cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				GCTCCGGACCGAAGGCGAAGG	0.726																																					p.F365F		.											.	ZFP36L2	226	0			c.C1095T						.						10.0	12.0	11.0					2																	43451848		2128	4207	6335	SO:0001819	synonymous_variant	678	exon2			CGGACCGAAGGCG	X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.1095C>T	2.37:g.43451848G>A		Somatic	9.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	8.0	NM_006887	Q53TB4|Q9BSJ3	Silent	SNP	ENST00000282388.3	37	CCDS1811.1																																																																																			.		0.726	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250513.2	NM_006887	
ZFP64	55734	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	50782459	50782459	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr20:50782459C>T	ENST00000216923.4	-	3	741	c.392G>A	c.(391-393)cGc>cAc	p.R131H	ZFP64_ENST00000346617.4_Intron|ZFP64_ENST00000477786.1_5'UTR|ZFP64_ENST00000371515.4_Missense_Mutation_p.R129H|ZFP64_ENST00000361387.2_Missense_Mutation_p.R131H|ZFP64_ENST00000371518.2_Missense_Mutation_p.R131H	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	131					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R131H(3)		breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CTTTTTGGTGCGTGACTTGGC	0.458																																					p.R131H		.											.	ZFP64	155	3	Substitution - Missense(3)	endometrium(3)	c.G392A						.						272.0	224.0	240.0					20																	50782459		2203	4300	6503	SO:0001583	missense	55734	exon3			TTGGTGCGTGACT	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.392G>A	20.37:g.50782459C>T	ENSP00000216923:p.Arg131His	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	11.0	NM_018197	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	37	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380341	0.82682	.	.	ENSG00000020256	ENST00000371518;ENST00000361387;ENST00000216923;ENST00000371515;ENST00000371516	T;T;T;T	0.08634	3.16;3.15;3.07;3.08	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000015	T	0.27349	0.0671	M	0.61703	1.905	0.39584	D	0.969476	D;D;D	0.89917	1.0;1.0;0.964	D;D;B	0.85130	0.997;0.997;0.354	T	0.00325	-1.1816	10	0.32370	T	0.25	-21.8346	18.1401	0.89637	0.0:1.0:0.0:0.0	.	129;131;131	Q5JWM1;Q9NPA5;Q9NTW7	.;ZF64A_HUMAN;ZF64B_HUMAN	H	131;131;131;129;131	ENSP00000360573:R131H;ENSP00000355179:R131H;ENSP00000216923:R131H;ENSP00000360570:R129H	ENSP00000216923:R131H	R	-	2	0	ZFP64	50215866	0.995000	0.38212	0.983000	0.44433	0.918000	0.54935	3.755000	0.55197	2.726000	0.93360	0.655000	0.94253	CGC	.		0.458	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
ZFYVE16	9765	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79734325	79734325	+	Silent	SNP	T	T	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr5:79734325T>C	ENST00000338008.5	+	3	2001	c.1821T>C	c.(1819-1821)aaT>aaC	p.N607N	ZFYVE16_ENST00000510158.1_Silent_p.N607N|ZFYVE16_ENST00000505560.1_Silent_p.N607N	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	607					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		CAATAGAAAATGGCCTTTCTT	0.313																																					p.N607N	Melanoma(150;1452 1854 16018 17851 37292)	.											.	ZFYVE16	90	0			c.T1821C						.						71.0	81.0	78.0					5																	79734325		2203	4298	6501	SO:0001819	synonymous_variant	9765	exon4			AGAAAATGGCCTT	AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.1821T>C	5.37:g.79734325T>C		Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	24.0	NM_001105251	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Silent	SNP	ENST00000338008.5	37	CCDS4050.1																																																																																			.		0.313	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733	
ZHX1	11244	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	124266184	124266185	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr8:124266184_124266185insT	ENST00000522655.1	-	3	2542_2543	c.2002_2003insA	c.(2002-2004)acafs	p.T668fs	ZHX1_ENST00000395571.3_Frame_Shift_Ins_p.T668fs|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Frame_Shift_Ins_p.T668fs			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	668					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CTGCTCAGGTGTTTTTTTACAT	0.465																																					p.T668fs		.											.	ZHX1	91	0			c.2003_2004insA						.																																			SO:0001589	frameshift_variant	11244	exon3			TCAGGTGTTTTTT	AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.2003dupA	8.37:g.124266191_124266191dupT	ENSP00000428821:p.Thr668fs	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	21.0	NM_001017926	Q8IWD8	Frame_Shift_Ins	INS	ENST00000522655.1	37	CCDS6342.1																																																																																			.		0.465	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1		
ZNF236	7776	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	74622651	74622651	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr18:74622651C>G	ENST00000253159.8	+	16	2881	c.2683C>G	c.(2683-2685)Cag>Gag	p.Q895E	ZNF236_ENST00000320610.9_Missense_Mutation_p.Q897E	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	895					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TCAGCAGCCTCAGTTTCCACC	0.433																																					p.Q895E		.											.	ZNF236	94	0			c.C2683G						.						79.0	77.0	78.0					18																	74622651		1968	4159	6127	SO:0001583	missense	7776	exon16			CAGCCTCAGTTTC	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.2683C>G	18.37:g.74622651C>G	ENSP00000253159:p.Gln895Glu	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	4.0	NM_007345	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	C	2.064	-0.414778	0.04766	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T;T	0.11604	2.8;2.93;2.76	4.78	0.697	0.18081	.	0.852017	0.10422	N	0.676534	T	0.08714	0.0216	L	0.47716	1.5	0.24198	N	0.995526	B	0.02656	0.0	B	0.04013	0.001	T	0.45920	-0.9228	10	0.02654	T	1	.	10.18	0.42961	0.0:0.5396:0.3874:0.073	.	895	Q9UL36	ZN236_HUMAN	E	895	ENSP00000253159:Q895E;ENSP00000444524:Q895E;ENSP00000322361:Q895E	ENSP00000253159:Q895E	Q	+	1	0	ZNF236	72751639	0.036000	0.19791	0.003000	0.11579	0.995000	0.86356	2.422000	0.44696	-0.104000	0.12154	0.467000	0.42956	CAG	.		0.433	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
ZNF280A	129025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	22869868	22869868	+	Silent	SNP	A	A	G			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr22:22869868A>G	ENST00000302097.3	-	2	339	c.87T>C	c.(85-87)gaT>gaC	p.D29D	snoU13_ENST00000459485.1_RNA	NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	29					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TCAGATCTGGATCTTCATCAT	0.368																																					p.D29D		.											.	ZNF280A	69	0			c.T87C						.						146.0	126.0	133.0					22																	22869868		2203	4300	6503	SO:0001819	synonymous_variant	129025	exon2			ATCTGGATCTTCA	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.87T>C	22.37:g.22869868A>G		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	16.0	NM_080740		Silent	SNP	ENST00000302097.3	37	CCDS13800.1																																																																																			.		0.368	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075433.3	NM_080740	
ZNF385B	151126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	180308145	180308145	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr2:180308145G>C	ENST00000410066.1	-	10	1851	c.1248C>G	c.(1246-1248)ttC>ttG	p.F416L	ZNF385B_ENST00000409343.1_Missense_Mutation_p.F340L|ZNF385B_ENST00000336917.5_Missense_Mutation_p.F314L|ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409692.1_Missense_Mutation_p.F314L	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	416	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			GTGAGGACAGGAAGGCTGGGG	0.577																																					p.F416L	Colon(155;204 2491 32774 51842)	.											.	ZNF385B	23	0			c.C1248G						.						33.0	41.0	39.0					2																	180308145		2200	4299	6499	SO:0001583	missense	151126	exon10			GGACAGGAAGGCT	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.1248C>G	2.37:g.180308145G>C	ENSP00000386845:p.Phe416Leu	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	5.0	NM_152520	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	ENST00000410066.1	37	CCDS33339.1	.	.	.	.	.	.	.	.	.	.	G	2.043	-0.419653	0.04734	.	.	ENSG00000144331	ENST00000410066;ENST00000336917;ENST00000409343;ENST00000409692	T;T;T;T	0.28666	1.6;1.63;1.61;1.63	5.49	4.61	0.57282	.	0.207022	0.51477	D	0.000100	T	0.18130	0.0435	N	0.21324	0.655	0.54753	D	0.99998	B;B	0.17667	0.023;0.009	B;B	0.17979	0.016;0.02	T	0.05599	-1.0875	10	0.09843	T	0.71	-27.7032	9.8606	0.41112	0.2148:0.0:0.7852:0.0	.	416;340	Q569K4;Q569K4-2	Z385B_HUMAN;.	L	416;314;340;314	ENSP00000386845:F416L;ENSP00000338225:F314L;ENSP00000386379:F340L;ENSP00000386507:F314L	ENSP00000338225:F314L	F	-	3	2	ZNF385B	180016390	1.000000	0.71417	0.998000	0.56505	0.912000	0.54170	1.825000	0.39081	1.307000	0.44944	0.561000	0.74099	TTC	.		0.577	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520	
ZNF407	55628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	72775252	72775252	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr18:72775252C>T	ENST00000299687.5	+	8	5575	c.5575C>T	c.(5575-5577)Ccc>Tcc	p.P1859S		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1859					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GCCAGCGCCGCCCCCTGAGCA	0.677																																					p.P1859S		.											.	ZNF407	92	0			c.C5575T						.																																			SO:0001583	missense	55628	exon8			GCGCCGCCCCCTG	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.5575C>T	18.37:g.72775252C>T	ENSP00000299687:p.Pro1859Ser	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	12.0	NM_017757	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	C	1.485	-0.556210	0.03967	.	.	ENSG00000215421	ENST00000299687	T	0.08458	3.09	4.96	-5.09	0.02920	.	.	.	.	.	T	0.03263	0.0095	N	0.04508	-0.205	0.27643	N	0.947669	B	0.09022	0.002	B	0.04013	0.001	T	0.52540	-0.8562	9	0.14252	T	0.57	.	12.5036	0.55970	0.0:0.6397:0.1204:0.2399	.	1859	Q9C0G0	ZN407_HUMAN	S	1859	ENSP00000299687:P1859S	ENSP00000299687:P1859S	P	+	1	0	ZNF407	70904240	0.000000	0.05858	0.007000	0.13788	0.017000	0.09413	-0.147000	0.10234	2.293000	0.77203	0.650000	0.86243	CCC	.		0.677	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
ZNF738	148203	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	21558044	21558044	+	Missense_Mutation	SNP	C	C	T	rs541516024		TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr19:21558044C>T	ENST00000311015.3	+	3	312	c.101C>T	c.(100-102)cCg>cTg	p.P34L	ZNF738_ENST00000380870.4_Missense_Mutation_p.P34L|ZNF738_ENST00000597810.1_Missense_Mutation_p.P34L			Q8NE65	ZN738_HUMAN	zinc finger protein 738	34					protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(1)	2						TTTCAGGGGCCGTTGACATTT	0.403													.|||	1	0.000199681	0.0	0.0	5008	,	,		15473	0.0		0.001	False		,,,				2504	0.0				.		.											.	ZNF738	68	0			.						.																																			SO:0001583	missense	148203	.			AGGGGCCGTTGAC	BC034499		19p12	2013-01-16			ENSG00000172687	ENSG00000172687			32469	other	unknown							Standard	NR_027130		Approved		uc002nps.4	Q8NE65	OTTHUMG00000141298	ENST00000311015.3:c.101C>T	19.37:g.21558044C>T	ENSP00000311957:p.Pro34Leu	Somatic	43.0	1.0		WXS	Illumina HiSeq	Phase_I	45.0	9.0	.	A8K4N7	RNA	SNP	ENST00000311015.3	37		.	.	.	.	.	.	.	.	.	.	N	3.636	-0.074590	0.07184	.	.	ENSG00000172687	ENST00000311015;ENST00000380870	T;T	0.00717	5.79;5.79	0.235	0.235	0.15431	Krueppel-associated box (1);	.	.	.	.	T	0.00468	0.0015	.	.	.	0.21290	N	0.999733	B	0.25563	0.129	B	0.18263	0.021	T	0.42916	-0.9423	8	0.12430	T	0.62	.	5.932	0.19144	0.0:1.0:0.0:0.0	.	34	Q8NE65	ZN738_HUMAN	L	34	ENSP00000311957:P34L;ENSP00000370252:P34L	ENSP00000311957:P34L	P	+	2	0	ZNF738	21349884	0.002000	0.14202	0.134000	0.22075	0.549000	0.35272	0.305000	0.19254	0.308000	0.22923	0.313000	0.20887	CCG	.		0.403	ZNF738-001	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000280564.1	NR_027130	
PLEKHG3	26030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	65208636	65208637	+	Missense_Mutation	DNP	CC	CC	GT			TCGA-DD-A73G-01A-22D-A32G-10	TCGA-DD-A73G-10A-01D-A32G-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	635235fc-77f3-49c0-96fa-9af89c5094c2	f14048d4-6611-479c-8cc0-9fe14f2b1618	g.chr14:65208636_65208637CC>GT	ENST00000394691.1	+	16	2548_2549	c.2401_2402CC>GT	c.(2401-2403)CCt>GTt	p.P801V	PLEKHG3_ENST00000484731.2_Missense_Mutation_p.P306V|PLEKHG3_ENST00000492928.1_Intron|PLEKHG3_ENST00000247226.7_Missense_Mutation_p.P745V|PLEKHG3_ENST00000471182.2_Missense_Mutation_p.P334V			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	801							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		AGGGGACCCACCTCCCATCTCA	0.614																																					p.P801V		.											.	.	.	0			.						.																																			SO:0001583	missense	26030	.			GACCCACCTCCCA	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	Exception_encountered	14.37:g.65208636_65208637delinsGT	ENSP00000378183:p.Pro801Val	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	9.0	.	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	DNP	ENST00000394691.1	37																																																																																				.		0.614	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549	
