#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADCY2	108	hgsc.bcm.edu;bcgsc.ca	37	5	7396525	7396525	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr5:7396525G>A	ENST00000338316.4	+	1	205	c.116G>A	c.(115-117)tGc>tAc	p.C39Y		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	39					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TCCTACTACTGCATGAGCCAG	0.701																																					p.C39Y		.											.	ADCY2	97	0			c.G116A						.						44.0	36.0	39.0					5																	7396525		2203	4300	6503	SO:0001583	missense	108	exon1			ACTACTGCATGAG	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.116G>A	5.37:g.7396525G>A	ENSP00000342952:p.Cys39Tyr	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	G	1.084	-0.665988	0.03428	.	.	ENSG00000078295	ENST00000338316	T	0.76060	-0.99	3.51	3.51	0.40186	.	0.209765	0.40064	U	0.001190	T	0.56804	0.2010	L	0.29908	0.895	0.80722	D	1	B	0.12630	0.006	B	0.09377	0.004	T	0.50996	-0.8761	10	0.05436	T	0.98	.	12.1741	0.54176	0.0:0.0:1.0:0.0	.	39	Q08462	ADCY2_HUMAN	Y	39	ENSP00000342952:C39Y	ENSP00000342952:C39Y	C	+	2	0	ADCY2	7449525	1.000000	0.71417	0.979000	0.43373	0.352000	0.29268	7.804000	0.85993	1.475000	0.48197	0.305000	0.20034	TGC	.		0.701	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ADAMTS12	81792	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	33891885	33891885	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr5:33891885T>C	ENST00000504830.1	-	1	412	c.77A>G	c.(76-78)tAt>tGt	p.Y26C	ADAMTS12_ENST00000515401.1_Missense_Mutation_p.Y26C|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.Y26C	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	26					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CTGTCTCCCATAGCAAAGCGC	0.512										HNSCC(64;0.19)																											p.Y26C		.											.	ADAMTS12	232	0			c.A77G						.						107.0	115.0	112.0					5																	33891885		2203	4300	6503	SO:0001583	missense	81792	exon1			CTCCCATAGCAAA	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.77A>G	5.37:g.33891885T>C	ENSP00000422554:p.Tyr26Cys	Somatic	354.0	0.0		WXS	Illumina HiSeq	Phase_I	361.0	22.0	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	T	9.105	1.005063	0.19199	.	.	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.58940	0.3;0.3;2.87	5.61	0.551	0.17225	.	1.661270	0.02918	N	0.137613	T	0.36082	0.0954	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.19647	-1.0299	10	0.40728	T	0.16	.	3.8638	0.09007	0.1494:0.248:0.0:0.6026	.	26;26;26	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	C	26	ENSP00000422554:Y26C;ENSP00000344847:Y26C;ENSP00000421638:Y26C	ENSP00000344847:Y26C	Y	-	2	0	ADAMTS12	33927642	0.021000	0.18746	0.005000	0.12908	0.703000	0.40648	0.365000	0.20348	0.077000	0.16863	0.477000	0.44152	TAT	.		0.512	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
AGMAT	79814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	15909713	15909713	+	Silent	SNP	T	T	G			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr1:15909713T>G	ENST00000375826.3	-	2	592	c.450A>C	c.(448-450)gcA>gcC	p.A150A	RP4-680D5.2_ENST00000428945.1_RNA|DNAJC16_ENST00000483270.1_Intron	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	150					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		TACAGCCAGCTGCTACAATTT	0.493																																					p.A150A	NSCLC(126;1678 1780 25805 43508 49531)	.											.	AGMAT	91	0			c.A450C						.						59.0	60.0	60.0					1																	15909713		2203	4300	6503	SO:0001819	synonymous_variant	79814	exon2			GCCAGCTGCTACA	AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.450A>C	1.37:g.15909713T>G		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	9.0	NM_024758	Q5TDH1|Q9H5J3	Silent	SNP	ENST00000375826.3	37	CCDS160.1																																																																																			.		0.493	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
ARHGEF15	22899	ucsc.edu;bcgsc.ca	37	17	8215882	8215882	+	Silent	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr17:8215882C>T	ENST00000361926.3	+	2	635	c.525C>T	c.(523-525)ctC>ctT	p.L175L	ARHGEF15_ENST00000421050.1_Silent_p.L175L	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	175					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						AGCCAGGTCTCCAAGCGAGAG	0.667																																					p.L175L		.											.	ARHGEF15	230	0			c.C525T						.						30.0	34.0	33.0					17																	8215882		2203	4300	6503	SO:0001819	synonymous_variant	22899	exon2			AGGTCTCCAAGCG	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.525C>T	17.37:g.8215882C>T		Somatic	34.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_025014	A8K6G1|Q8N449|Q9H8B4	Silent	SNP	ENST00000361926.3	37	CCDS11139.1																																																																																			.		0.667	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728	
ASIC2	40	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	32483120	32483120	+	Silent	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr17:32483120C>T	ENST00000359872.6	-	1	1193	c.432G>A	c.(430-432)aaG>aaA	p.K144K		NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	144					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GTTTGTAGTGCTTGAAGTTGG	0.592																																					p.K144K		.											.	.	.	0			c.G432A						.						97.0	105.0	103.0					17																	32483120		2136	4256	6392	SO:0001819	synonymous_variant	40	exon1			GTAGTGCTTGAAG	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.432G>A	17.37:g.32483120C>T		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	14.0	NM_001094	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Silent	SNP	ENST00000359872.6	37	CCDS42296.1																																																																																			.		0.592	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
BOD1L1	259282	ucsc.edu;bcgsc.ca	37	4	13606024	13606024	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr4:13606024C>T	ENST00000040738.5	-	10	2635	c.2500G>A	c.(2500-2502)Gaa>Aaa	p.E834K		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	834	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										TTAGTTTTTTCAGCTGACAAG	0.353																																					p.E834K		.											.	.	.	0			c.G2500A						.						105.0	99.0	101.0					4																	13606024		2203	4297	6500	SO:0001583	missense	259282	exon10			TTTTTTCAGCTGA	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.2500G>A	4.37:g.13606024C>T	ENSP00000040738:p.Glu834Lys	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	C	17.60	3.428990	0.62844	.	.	ENSG00000038219	ENST00000040738	T	0.10192	2.9	5.02	5.02	0.67125	.	0.332170	0.21751	N	0.069675	T	0.19485	0.0468	L	0.58101	1.795	0.37254	D	0.906701	D	0.54047	0.964	P	0.47981	0.563	T	0.05784	-1.0864	10	0.38643	T	0.18	-9.8996	18.337	0.90291	0.0:1.0:0.0:0.0	.	834	Q8NFC6	BOD1L_HUMAN	K	834	ENSP00000040738:E834K	ENSP00000040738:E834K	E	-	1	0	BOD1L	13215122	1.000000	0.71417	0.128000	0.21923	0.737000	0.42083	5.677000	0.68142	2.312000	0.78011	0.557000	0.71058	GAA	.		0.353	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
CA4	762	hgsc.bcm.edu;broad.mit.edu	37	17	58235740	58235740	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr17:58235740C>T	ENST00000300900.4	+	7	776	c.677C>T	c.(676-678)aCa>aTa	p.T226I		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	226	Substrate binding. {ECO:0000305}.				bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	TCACTCACCACACCGACCTGC	0.602																																					p.T226I		.											.	CA4	226	0			c.C677T						.						110.0	83.0	92.0					17																	58235740		2203	4300	6503	SO:0001583	missense	762	exon7			TCACCACACCGAC	L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.677C>T	17.37:g.58235740C>T	ENSP00000300900:p.Thr226Ile	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	8.0	NM_000717	B4DQA4|Q6FHI7	Missense_Mutation	SNP	ENST00000300900.4	37	CCDS11624.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996852	0.74818	.	.	ENSG00000167434	ENST00000300900	T	0.77229	-1.08	5.54	5.54	0.83059	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.89570	0.6753	H	0.95679	3.705	0.80722	D	1	D	0.67145	0.996	P	0.56514	0.8	D	0.92413	0.5939	10	0.87932	D	0	.	14.9783	0.71293	0.0:1.0:0.0:0.0	.	226	P22748	CAH4_HUMAN	I	226	ENSP00000300900:T226I	ENSP00000300900:T226I	T	+	2	0	CA4	55590522	0.998000	0.40836	0.957000	0.39632	0.626000	0.37791	4.321000	0.59209	2.589000	0.87451	0.491000	0.48974	ACA	.		0.602	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449189.1	NM_000717	
CNTN2	6900	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	205041630	205041630	+	Silent	SNP	C	C	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr1:205041630C>A	ENST00000331830.4	+	21	3035	c.2751C>A	c.(2749-2751)ggC>ggA	p.G917G		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	917	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GACCTCCTGGCAACATCTCCT	0.552																																					p.G917G	Melanoma(183;2548 2817 37099 41192)	.											.	CNTN2	91	0			c.C2751A						.						72.0	71.0	71.0					1																	205041630		2203	4300	6503	SO:0001819	synonymous_variant	6900	exon21			TCCTGGCAACATC	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2751C>A	1.37:g.205041630C>A		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	8.0	NM_005076	P78432|Q5T054	Silent	SNP	ENST00000331830.4	37	CCDS1449.1																																																																																			.		0.552	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
CREBBP	1387	broad.mit.edu;bcgsc.ca	37	16	3817806	3817806	+	Silent	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr16:3817806C>T	ENST00000262367.5	-	16	3974	c.3165G>A	c.(3163-3165)gtG>gtA	p.V1055V	CREBBP_ENST00000382070.3_Silent_p.V1017V	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1055					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CTTCTACTTTCACTTCAGGTT	0.438			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.V1055V		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	1807	0			c.G3165A						.						250.0	223.0	232.0					16																	3817806		2197	4300	6497	SO:0001819	synonymous_variant	1387	exon16			TACTTTCACTTCA	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3165G>A	16.37:g.3817806C>T		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	6.0	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																			.		0.438	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	2949136	2949136	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr8:2949136G>A	ENST00000520002.1	-	49	7745	c.7190C>T	c.(7189-7191)aCt>aTt	p.T2397I	CSMD1_ENST00000602723.1_Missense_Mutation_p.T2397I|CSMD1_ENST00000400186.3_Missense_Mutation_p.T2397I|CSMD1_ENST00000542608.1_Missense_Mutation_p.T2396I|CSMD1_ENST00000602557.1_Missense_Mutation_p.T2397I|CSMD1_ENST00000537824.1_Missense_Mutation_p.T2396I			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2397	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGATTGTTCAGTATGATTCCC	0.413																																					p.T2396I		.											.	CSMD1	86	0			c.C7187T						.						101.0	94.0	96.0					8																	2949136		1847	4085	5932	SO:0001583	missense	64478	exon48			TGTTCAGTATGAT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7190C>T	8.37:g.2949136G>A	ENSP00000430733:p.Thr2397Ile	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	4.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	11.39	1.625372	0.28889	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.8	4.91	0.64330	CUB (5);	0.073354	0.56097	D	0.000027	T	0.29256	0.0728	L	0.50919	1.6	0.80722	D	1	B;B;P	0.48911	0.317;0.14;0.917	B;B;P	0.52386	0.376;0.311;0.697	T	0.01557	-1.1325	10	0.48119	T	0.1	.	16.7039	0.85366	0.0:0.1297:0.8703:0.0	.	2397;2397;2396	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	I	2397;2397;2258;2396;2396	ENSP00000383047:T2397I;ENSP00000430733:T2397I;ENSP00000441462:T2396I;ENSP00000446243:T2396I	ENSP00000320445:T2258I	T	-	2	0	CSMD1	2936543	1.000000	0.71417	0.715000	0.30552	0.032000	0.12392	6.321000	0.72881	1.407000	0.46875	0.555000	0.69702	ACT	.		0.413	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CXorf58	254158	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	23934445	23934445	+	Splice_Site	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chrX:23934445G>A	ENST00000379211.3	+	5	972	c.423G>A	c.(421-423)aaG>aaA	p.K141K		NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58	141										breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						CGTCAAGTAAGGTGACGTTTC	0.299																																					p.K141K		.											.	CXorf58	130	0			c.G423A						.						106.0	93.0	97.0					X																	23934445		2202	4298	6500	SO:0001630	splice_region_variant	254158	exon5			AAGTAAGGTGACG	AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.423+1G>A	X.37:g.23934445G>A		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	9.0	NM_152761		Silent	SNP	ENST00000379211.3	37	CCDS14209.1	.	.	.	.	.	.	.	.	.	.	g	8.504	0.864873	0.17250	.	.	ENSG00000165182	ENST00000435707	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	T	0.70272	0.3205	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69914	-0.5016	4	.	.	.	-1.6058	14.2859	0.66245	0.0:0.0:1.0:0.0	.	.	.	.	S	115	.	.	G	+	1	0	CXorf58	23844366	1.000000	0.71417	0.869000	0.34112	0.261000	0.26267	5.194000	0.65125	2.064000	0.61679	0.411000	0.27672	GGT	.		0.299	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056071.1	NM_152761	Silent
DMD	1756	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	31525469	31525469	+	Silent	SNP	G	G	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chrX:31525469G>T	ENST00000357033.4	-	56	8525	c.8319C>A	c.(8317-8319)gtC>gtA	p.V2773V	DMD_ENST00000343523.2_Silent_p.V313V|DMD_ENST00000378707.3_Silent_p.V313V|DMD_ENST00000359836.1_Silent_p.V313V|DMD_ENST00000541735.1_Silent_p.V313V|DMD_ENST00000445312.1_5'UTR|DMD_ENST00000378677.2_Silent_p.V2769V|DMD_ENST00000474231.1_Silent_p.V313V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2773					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTGTAACAGGACTGCATCAT	0.423																																					p.V2773V		.											.	DMD	265	0			c.C8319A						.						181.0	146.0	158.0					X																	31525469		2202	4300	6502	SO:0001819	synonymous_variant	1756	exon56			TAACAGGACTGCA	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8319C>A	X.37:g.31525469G>T		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	8.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	4.269	0.049096	0.08243	.	.	ENSG00000198947	ENST00000465285	.	.	.	5.68	3.89	0.44902	.	.	.	.	.	T	0.45094	0.1325	.	.	.	0.30887	N	0.730797	.	.	.	.	.	.	T	0.47812	-0.9088	4	.	.	.	.	9.5377	0.39233	0.0754:0.0:0.781:0.1437	.	.	.	.	T	502	.	.	P	-	1	0	DMD	31435390	0.440000	0.25618	0.289000	0.24876	0.988000	0.76386	0.952000	0.29149	1.131000	0.42111	0.594000	0.82650	CCT	.		0.423	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DNAH17	8632	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	76451796	76451796	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr17:76451796C>T	ENST00000585328.1	-	63	10209	c.10085G>A	c.(10084-10086)gGc>gAc	p.G3362D	DNAH17_ENST00000586052.1_Intron|DNAH17_ENST00000389840.5_Missense_Mutation_p.G3353D	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3353					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GGTGAAGTAGCCCACGTAGGA	0.537																																					p.G3367D		.											.	DNAH17	142	0			c.G10100A						.						79.0	62.0	68.0					17																	76451796		2203	4299	6502	SO:0001583	missense	8632	exon63			AAGTAGCCCACGT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.10085G>A	17.37:g.76451796C>T	ENSP00000465516:p.Gly3362Asp	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	187.0	8.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	C	34	5.354418	0.95830	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	D	0.83075	-1.68	5.06	5.06	0.68205	.	0.093775	0.46758	D	0.000264	D	0.95294	0.8473	H	0.99169	4.455	0.58432	D	0.999997	D	0.67145	0.996	D	0.73708	0.981	D	0.97710	1.0190	10	0.87932	D	0	.	18.4429	0.90673	0.0:1.0:0.0:0.0	.	3362	E7EUM8	.	D	3362;3353	ENSP00000374490:G3353D	ENSP00000300671:G3362D	G	-	2	0	DNAH17	73963391	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.611000	0.82962	2.334000	0.79466	0.655000	0.94253	GGC	.		0.537	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
HEATR3	55027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	50106573	50106573	+	Silent	SNP	G	G	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr16:50106573G>T	ENST00000299192.7	+	5	761	c.570G>T	c.(568-570)gtG>gtT	p.V190V	HEATR3_ENST00000285767.4_Silent_p.V104V	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	190										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						TGGAGATTGTGTTAAAGTATT	0.338																																					p.V190V		.											.	HEATR3	92	0			c.G570T						.						205.0	192.0	197.0					16																	50106573		2198	4300	6498	SO:0001819	synonymous_variant	55027	exon5			GATTGTGTTAAAG	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.570G>T	16.37:g.50106573G>T		Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	5.0	NM_182922	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Silent	SNP	ENST00000299192.7	37	CCDS10739.1																																																																																			.		0.338	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	
IRGC	56269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44223141	44223141	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr19:44223141G>A	ENST00000244314.5	+	2	630	c.431G>A	c.(430-432)cGc>cAc	p.R144H		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	144	IRG-type G.					membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				TCCCCCCGCCGCTGCGGGGCC	0.652																																					p.R144H	Colon(189;350 2037 11447 13433 38914)	.											.	IRGC	70	0			c.G431A						.						12.0	12.0	12.0					19																	44223141		2114	4167	6281	SO:0001583	missense	56269	exon2			CCCGCCGCTGCGG	BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.431G>A	19.37:g.44223141G>A	ENSP00000244314:p.Arg144His	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	9.0	NM_019612	Q05BR8	Missense_Mutation	SNP	ENST00000244314.5	37	CCDS12629.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415973	0.62511	.	.	ENSG00000124449	ENST00000244314	T	0.27720	1.65	5.71	4.65	0.58169	.	0.000000	0.64402	D	0.000001	T	0.56232	0.1971	M	0.77406	2.37	0.46927	D	0.99925	D	0.89917	1.0	D	0.81914	0.995	T	0.61392	-0.7072	10	0.59425	D	0.04	.	14.4208	0.67183	0.0:0.1485:0.8515:0.0	.	144	Q6NXR0	IIGP5_HUMAN	H	144	ENSP00000244314:R144H	ENSP00000244314:R144H	R	+	2	0	IRGC	48914981	1.000000	0.71417	0.033000	0.17914	0.509000	0.34042	5.579000	0.67457	1.380000	0.46344	0.555000	0.69702	CGC	.		0.652	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612	
KIAA0930	23313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	45595761	45595761	+	Silent	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr22:45595761G>A	ENST00000336156.5	-	8	1073	c.1008C>T	c.(1006-1008)gaC>gaT	p.D336D	KIAA0930_ENST00000391627.2_Silent_p.D302D|KIAA0930_ENST00000443310.3_Silent_p.D318D|MIR1249_ENST00000408671.1_RNA|KIAA0930_ENST00000474515.1_5'UTR|KIAA0930_ENST00000251993.7_Silent_p.D341D	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	336										endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						CACCTCCACCGTCGTCCTCCC	0.562																																					p.D341D		.											.	KIAA0930	90	0			c.C1023T						.						98.0	94.0	96.0					22																	45595761		2203	4300	6503	SO:0001819	synonymous_variant	23313	exon8			TCCACCGTCGTCC	AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.1008C>T	22.37:g.45595761G>A		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_015264	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Silent	SNP	ENST00000336156.5	37	CCDS33665.1																																																																																			.		0.562	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321975.2	NM_001009880	
NPIPB5	100132247	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	22545898	22545898	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr16:22545898A>C	ENST00000517539.1	+	8	1669	c.1594A>C	c.(1594-1596)Aca>Cca	p.T532P	NPIPB5_ENST00000424340.1_Missense_Mutation_p.T532P|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	532	Pro-rich.					integral component of membrane (GO:0016021)											TAATATCAAGACACCTGCCGA	0.597																																					p.T532P		.											.	.	.	0			c.A1594C						.						10.0	7.0	8.0					16																	22545898		685	1572	2257	SO:0001583	missense	0	exon7			ATCAAGACACCTG		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1594A>C	16.37:g.22545898A>C	ENSP00000430633:p.Thr532Pro	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	8.0	NM_001135865	B4DK13	Missense_Mutation	SNP	ENST00000517539.1	37	CCDS45443.1	.	.	.	.	.	.	.	.	.	.	.	7.815	0.716460	0.15306	.	.	ENSG00000243716	ENST00000415833;ENST00000424340;ENST00000342168;ENST00000503072;ENST00000517539;ENST00000528249	T;T;T;T	0.23950	2.03;1.88;1.88;2.03	.	.	.	.	.	.	.	.	T	0.35856	0.0946	L	0.43923	1.385	0.09310	N	1	P;P	0.47106	0.89;0.767	D;B	0.64237	0.923;0.15	T	0.15350	-1.0440	6	0.32370	T	0.25	.	.	.	.	.	532;532	F5GWX0;A8MRT5	.;K220L_HUMAN	P	532;532;532;410;532;532	ENSP00000445388:T532P;ENSP00000440703:T532P;ENSP00000430633:T532P;ENSP00000431553:T532P	ENSP00000441680:T532P	T	+	1	0	RP11-368J21.2	22453399	.	.	.	.	.	.	.	.	.	.	.	.	ACA	.		0.597	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374343.2	NM_001135865	
LRRIQ3	127255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	74507289	74507289	+	Silent	SNP	A	A	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr1:74507289A>T	ENST00000395089.1	-	6	1325	c.1326T>A	c.(1324-1326)gtT>gtA	p.V442V	LRRIQ3_ENST00000354431.4_Silent_p.V442V			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	442										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						CCATGGCTACAACTCTTACTT	0.333																																					p.V442V		.											.	LRRIQ3	92	0			c.T1326A						.						208.0	191.0	197.0					1																	74507289		1843	4095	5938	SO:0001819	synonymous_variant	127255	exon7			GGCTACAACTCTT	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1326T>A	1.37:g.74507289A>T		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	4.0	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Silent	SNP	ENST00000395089.1	37	CCDS41350.1																																																																																			.		0.333	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
LRRK2	120892	ucsc.edu;bcgsc.ca	37	12	40715938	40715938	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr12:40715938C>T	ENST00000298910.7	+	36	5330	c.5272C>T	c.(5272-5274)Cat>Tat	p.H1758Y		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1758					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTTAGACAATCATCCAGAGAG	0.348																																					p.H1758Y		.											.	LRRK2	533	0			c.C5272T						.						72.0	75.0	74.0					12																	40715938		2203	4299	6502	SO:0001583	missense	120892	exon36			GACAATCATCCAG	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5272C>T	12.37:g.40715938C>T	ENSP00000298910:p.His1758Tyr	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	3.706	-0.060601	0.07317	.	.	ENSG00000188906	ENST00000298910	T	0.70869	-0.52	5.73	4.77	0.60923	.	0.621426	0.17474	N	0.172973	T	0.48660	0.1512	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.003;0.004	T	0.22173	-1.0224	10	0.22706	T	0.39	.	11.3691	0.49690	0.3943:0.6057:0.0:0.0	.	1758;1758	Q17RV3;Q5S007	.;LRRK2_HUMAN	Y	1758	ENSP00000298910:H1758Y	ENSP00000298910:H1758Y	H	+	1	0	LRRK2	39002205	1.000000	0.71417	0.213000	0.23690	0.981000	0.71138	5.039000	0.64185	2.705000	0.92388	0.555000	0.69702	CAT	.		0.348	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
MYO5B	4645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	47390748	47390748	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr18:47390748C>A	ENST00000285039.7	-	28	3905	c.3606G>T	c.(3604-3606)agG>agT	p.R1202S	MYO5B_ENST00000324581.6_Missense_Mutation_p.R343S|MYO5B_ENST00000587895.1_5'UTR	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1202					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CCAGCTCTTGCCTCTGGAAGA	0.577																																					p.R1202S		.											.	MYO5B	72	0			c.G3606T						.						97.0	108.0	105.0					18																	47390748		1979	4148	6127	SO:0001583	missense	4645	exon28			CTCTTGCCTCTGG	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3606G>T	18.37:g.47390748C>A	ENSP00000285039:p.Arg1202Ser	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	4.0	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478980	0.63849	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.05649	3.41;3.41	5.5	1.14	0.20703	.	0.000000	0.85682	D	0.000000	T	0.19565	0.0470	M	0.80183	2.485	0.53688	D	0.999973	P;D	0.89917	0.882;1.0	P;D	0.83275	0.521;0.996	T	0.16335	-1.0406	10	0.13853	T	0.58	.	10.3118	0.43712	0.0:0.6334:0.0:0.3666	.	1202;343	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	S	1202;343	ENSP00000285039:R1202S;ENSP00000315531:R343S	ENSP00000285039:R1202S	R	-	3	2	MYO5B	45644746	0.766000	0.28496	0.998000	0.56505	0.902000	0.53008	-0.042000	0.12063	0.294000	0.22547	-0.224000	0.12420	AGG	.		0.577	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
NIPBL	25836	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	37016248	37016248	+	Silent	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr5:37016248C>T	ENST00000282516.8	+	23	5251	c.4752C>T	c.(4750-4752)ctC>ctT	p.L1584L	NIPBL_ENST00000448238.2_Silent_p.L1584L	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1584					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CTGAACTACTCCTTAGTTTGT	0.368																																					p.L1584L		.											.	NIPBL	293	0			c.C4752T						.						82.0	77.0	78.0					5																	37016248		2203	4300	6503	SO:0001819	synonymous_variant	25836	exon23			ACTACTCCTTAGT	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4752C>T	5.37:g.37016248C>T		Somatic	75.0	1.0		WXS	Illumina HiSeq	Phase_I	81.0	12.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	37	CCDS3920.1																																																																																			.		0.368	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
ODF1	4956	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	103572783	103572783	+	Silent	SNP	C	C	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr8:103572783C>A	ENST00000285402.3	+	2	580	c.424C>A	c.(424-426)Cga>Aga	p.R142R	ODF1_ENST00000518835.1_5'UTR	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	142					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			AGTCAAAGTTCGAGTGAAGGA	0.448																																					p.R142R		.											.	ODF1	70	0			c.C424A						.						170.0	150.0	157.0					8																	103572783		2203	4300	6503	SO:0001819	synonymous_variant	4956	exon2			AAAGTTCGAGTGA	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.424C>A	8.37:g.103572783C>A		Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	245.0	13.0	NM_024410	Q3SX72	Silent	SNP	ENST00000285402.3	37	CCDS6293.1																																																																																			.		0.448	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1		
OR11A1	26531	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	29395394	29395394	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr6:29395394C>T	ENST00000377149.1	-	5	497	c.25G>A	c.(25-27)Gaa>Aaa	p.E9K	OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377147.2_Missense_Mutation_p.E9K|OR11A1_ENST00000377148.1_Missense_Mutation_p.E9K			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						GTAATAGTTTCGTTTCCTGTG	0.393																																					p.E9K		.											.	OR11A1	23	0			c.G25A						.						60.0	58.0	59.0					6																	29395394		1509	2709	4218	SO:0001583	missense	26531	exon1			TAGTTTCGTTTCC		CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.25G>A	6.37:g.29395394C>T	ENSP00000366354:p.Glu9Lys	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	6.0	NM_013937	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	ENST00000377149.1	37	CCDS34363.1	.	.	.	.	.	.	.	.	.	.	c	6.981	0.551005	0.13374	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.00333	8.07;8.07;8.07	3.66	-0.976	0.10286	.	.	.	.	.	T	0.00039	0.0001	N	0.17248	0.465	0.09310	N	1	B	0.17038	0.02	B	0.06405	0.002	T	0.04537	-1.0944	9	0.38643	T	0.18	0.5553	10.4396	0.44457	0.0:0.5807:0.2074:0.212	.	9	Q9GZK7	O11A1_HUMAN	K	9	ENSP00000366353:E9K;ENSP00000366354:E9K;ENSP00000366352:E9K	ENSP00000366352:E9K	E	-	1	0	OR11A1	29503373	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.993000	0.03720	-1.263000	0.02455	-2.938000	0.00087	GAA	.		0.393	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193778.1		
OR51A4	401666	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	4967860	4967860	+	Silent	SNP	C	C	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr11:4967860C>A	ENST00000380373.2	-	1	496	c.471G>T	c.(469-471)ctG>ctT	p.L157L	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L157L(1)		large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGGGAAGAACCAGGAGCATGC	0.438																																					p.L157L		.											.	OR51A4	71	1	Substitution - coding silent(1)	lung(1)	c.G471T						.						181.0	176.0	177.0					11																	4967860		2191	4266	6457	SO:0001819	synonymous_variant	401666	exon1			AAGAACCAGGAGC	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.471G>T	11.37:g.4967860C>A		Somatic	206.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	13.0	NM_001005329		Silent	SNP	ENST00000380373.2	37	CCDS31367.1																																																																																			.		0.438	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
OR8B4	283162	hgsc.bcm.edu;broad.mit.edu	37	11	124294075	124294075	+	Silent	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr11:124294075C>T	ENST00000356130.3	-	1	714	c.693G>A	c.(691-693)gaG>gaA	p.E231E		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TGGATCTGCCCTCTGCAGAAG	0.438																																					p.E231E		.											.	OR8B4	69	0			c.G693A						.						76.0	72.0	74.0					11																	124294075		2201	4299	6500	SO:0001819	synonymous_variant	283162	exon1			TCTGCCCTCTGCA	AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.693G>A	11.37:g.124294075C>T		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_001005196	B2RNF8|Q6IFQ7	Silent	SNP	ENST00000356130.3	37	CCDS31710.1																																																																																			.		0.438	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196	
RHBDD2	57414	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	75511359	75511359	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr7:75511359G>T	ENST00000006777.6	+	2	526	c.391G>T	c.(391-393)Gat>Tat	p.D131Y	RHBDD2_ENST00000468304.1_Intron|RHBDD2_ENST00000428119.1_5'Flank|RHBDD2_ENST00000318622.4_5'UTR	NM_001040456.1	NP_001035546.1	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2	131						Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|lung(4)|prostate(1)	6						GGAAGTGGAGGATGCCAGAGG	0.582																																					p.D131Y		.											.	RHBDD2	90	0			c.G391T						.						121.0	129.0	127.0					7																	75511359		2149	4253	6402	SO:0001583	missense	57414	exon2			GTGGAGGATGCCA	AF226732	CCDS43602.1, CCDS43603.1	7q11	2008-09-04	2006-02-22	2006-02-22	ENSG00000005486	ENSG00000005486			23082	protein-coding gene	gene with protein product		615203	"""rhomboid, veinlet-like 7 (Drosophila)"""	RHBDL7		12838346	Standard	XM_005250511		Approved	NPD007	uc003udw.1	Q6NTF9	OTTHUMG00000156435	ENST00000006777.6:c.391G>T	7.37:g.75511359G>T	ENSP00000006777:p.Asp131Tyr	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	258.0	21.0	NM_001040456	Q7L534|Q9H5W6|Q9HBK7|Q9UDT2	Missense_Mutation	SNP	ENST00000006777.6	37	CCDS43602.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459677	0.63401	.	.	ENSG00000005486	ENST00000006777;ENST00000413229	T	0.13657	2.57	5.1	5.1	0.69264	Peptidase S54, rhomboid domain (1);	0.497273	0.21411	N	0.074974	T	0.20455	0.0492	N	0.22421	0.69	0.80722	D	1	D	0.56287	0.975	P	0.59948	0.866	T	0.00759	-1.1578	10	0.49607	T	0.09	-8.2077	13.43	0.61049	0.0:0.1572:0.8428:0.0	.	131	Q6NTF9	RHBD2_HUMAN	Y	131;176	ENSP00000006777:D131Y	ENSP00000006777:D131Y	D	+	1	0	RHBDD2	75349295	1.000000	0.71417	0.999000	0.59377	0.832000	0.47134	3.425000	0.52771	2.652000	0.90054	0.655000	0.94253	GAT	.		0.582	RHBDD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344176.1	NM_020684	
PLXNA4	91584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	132193186	132193186	+	Silent	SNP	G	G	A	rs139250180	byFrequency	TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr7:132193186G>A	ENST00000359827.3	-	2	1229	c.267C>T	c.(265-267)gaC>gaT	p.D89D	PLXNA4_ENST00000378539.5_Silent_p.D89D|PLXNA4_ENST00000423507.2_Silent_p.D89D|PLXNA4_ENST00000321063.4_Silent_p.D89D			Q9HCM2	PLXA4_HUMAN	plexin A4	89	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGTTGTCCTCGTCCGGCCCTG	0.547													G|||	2	0.000399361	0.0	0.0	5008	,	,		19210	0.0		0.0	False		,,,				2504	0.002				p.D89D		.											PLXNA4,NS,carcinoma,-2	PLXNA4	91	0			c.C267T						.	G	,,	5,4401	9.9+/-24.2	0,5,2198	62.0	63.0	62.0		267,267,267	-6.9	0.9	7	dbSNP_134	62	6,8594	5.7+/-21.5	0,6,4294	no	coding-synonymous,coding-synonymous,coding-synonymous	PLXNA4	NM_001105543.1,NM_020911.1,NM_181775.3	,,	0,11,6492	AA,AG,GG		0.0698,0.1135,0.0846	,,	89/493,89/1895,89/523	132193186	11,12995	2203	4300	6503	SO:0001819	synonymous_variant	91584	exon2			GTCCTCGTCCGGC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.267C>T	7.37:g.132193186G>A		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	8.0	NM_001105543	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	CCDS43646.1																																																																																			G|0.999;A|0.001		0.547	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
RYR2	6262	broad.mit.edu;bcgsc.ca	37	1	237947093	237947093	+	Silent	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr1:237947093G>A	ENST00000366574.2	+	90	12398	c.12081G>A	c.(12079-12081)acG>acA	p.T4027T	RYR2_ENST00000542537.1_Silent_p.T4011T|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.T4033T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4027					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGGATTTGACGTCGTCTGATA	0.423																																					p.T4027T		.											.	RYR2	158	0			c.G12081A						.						56.0	52.0	54.0					1																	237947093		1856	4105	5961	SO:0001819	synonymous_variant	6262	exon90			TTTGACGTCGTCT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12081G>A	1.37:g.237947093G>A		Somatic	137.0	1.0		WXS	Illumina HiSeq	Phase_I	135.0	8.0	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																			.		0.423	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SLC13A4	26266	broad.mit.edu;bcgsc.ca	37	7	135376053	135376053	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr7:135376053G>T	ENST00000354042.4	-	13	2028	c.1339C>A	c.(1339-1341)Ctg>Atg	p.L447M	C7orf73_ENST00000422968.1_Intron	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	447					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						TCGGTCCCCAGTGAGTGCTCC	0.527																																					p.L447M		.											.	SLC13A4	90	0			c.C1339A						.						104.0	98.0	100.0					7																	135376053		2203	4300	6503	SO:0001583	missense	26266	exon13			TCCCCAGTGAGTG	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1339C>A	7.37:g.135376053G>T	ENSP00000297282:p.Leu447Met	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	6.0	NM_012450	A4D1Q4|Q8N631	Missense_Mutation	SNP	ENST00000354042.4	37	CCDS5840.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.611656	0.28712	.	.	ENSG00000164707	ENST00000354042	T	0.68903	-0.36	5.79	-1.67	0.08238	.	1.895920	0.03831	U	0.269157	T	0.35711	0.0941	N	0.02011	-0.69	0.09310	N	1	B;B	0.24368	0.102;0.012	B;B	0.21151	0.033;0.012	T	0.20505	-1.0273	10	0.46703	T	0.11	7.5469	1.8802	0.03226	0.1404:0.2018:0.3221:0.3357	.	316;447	Q59HF0;Q9UKG4	.;S13A4_HUMAN	M	447	ENSP00000297282:L447M	ENSP00000297282:L447M	L	-	1	2	SLC13A4	135026593	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.503000	0.22610	-0.156000	0.11079	0.650000	0.86243	CTG	.		0.527	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	NM_012450	
MTCL1	23255	hgsc.bcm.edu;broad.mit.edu	37	18	8824928	8824928	+	Silent	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr18:8824928G>A	ENST00000306329.11	+	13	4377	c.4377G>A	c.(4375-4377)cgG>cgA	p.R1459R	SOGA2_ENST00000359865.3_Silent_p.R1140R|SOGA2_ENST00000518815.1_Silent_p.R465R|SOGA2_ENST00000306285.7_Silent_p.R465R|SOGA2_ENST00000517570.1_Silent_p.R1099R|SOGA2_ENST00000400050.3_Silent_p.R1099R																							AGGTGGGGCGGGCAGGGCACG	0.617																																					p.R1140R		.											.	.	.	0			c.G3420A						.						73.0	61.0	65.0					18																	8824928		2203	4300	6503	SO:0001819	synonymous_variant	23255	exon15			GGGGCGGGCAGGG																												ENST00000306329.11:c.4377G>A	18.37:g.8824928G>A		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_015210		Silent	SNP	ENST00000306329.11	37																																																																																				.		0.617	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
SRC	6714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36031248	36031248	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr20:36031248C>G	ENST00000373578.2	+	13	1716	c.1367C>G	c.(1366-1368)aCt>aGt	p.T456S	SRC_ENST00000445403.1_Missense_Mutation_p.T456S|SRC_ENST00000477066.1_3'UTR|SRC_ENST00000358208.4_Missense_Mutation_p.T456S|SRC_ENST00000373558.2_Missense_Mutation_p.T462S|SRC_ENST00000360723.4_Missense_Mutation_p.T462S|SRC_ENST00000373567.2_Missense_Mutation_p.T456S	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	456	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	ATCCTGCTGACTGAGCTCACC	0.602																																					p.T456S		.											.	SRC	2731	0			c.C1367G						.						111.0	98.0	102.0					20																	36031248		2203	4300	6503	SO:0001583	missense	6714	exon13			TGCTGACTGAGCT	AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.1367C>G	20.37:g.36031248C>G	ENSP00000362680:p.Thr456Ser	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	12.0	NM_005417	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	37	CCDS13294.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.047008	0.75846	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	D;D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63;-1.63	4.63	4.63	0.57726	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75376	0.3841	N	0.11064	0.09	0.80722	D	1	P	0.51240	0.943	P	0.48552	0.581	T	0.80968	-0.1145	10	0.72032	D	0.01	.	15.3531	0.74405	0.0:1.0:0.0:0.0	.	456	P12931	SRC_HUMAN	S	456;456;462;456;456;462	ENSP00000408503:T456S;ENSP00000362680:T456S;ENSP00000353950:T462S;ENSP00000350941:T456S;ENSP00000362668:T456S;ENSP00000362659:T462S	ENSP00000350941:T456S	T	+	2	0	SRC	35464662	1.000000	0.71417	0.974000	0.42286	0.980000	0.70556	5.873000	0.69644	2.550000	0.86006	0.561000	0.74099	ACT	.		0.602	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417	
TMEM229A	730130	broad.mit.edu;bcgsc.ca	37	7	123672068	123672068	+	Silent	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr7:123672068C>T	ENST00000455783.1	-	1	1455	c.990G>A	c.(988-990)acG>acA	p.T330T	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	330						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						AAGCCCCGCACGTGCGGAGTC	0.557																																					p.T330T		.											.	.	.	0			c.G990A						.						39.0	46.0	44.0					7																	123672068		692	1591	2283	SO:0001819	synonymous_variant	730130	exon1			CCCGCACGTGCGG	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.990G>A	7.37:g.123672068C>T		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	5.0	NM_001136002	A4D0X6	Silent	SNP	ENST00000455783.1	37	CCDS47694.1																																																																																			.		0.557	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3	NM_001136002	
VWA3A	146177	broad.mit.edu;bcgsc.ca	37	16	22152958	22152958	+	Silent	SNP	A	A	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr16:22152958A>T	ENST00000389398.5	+	24	2535	c.2439A>T	c.(2437-2439)tcA>tcT	p.S813S	VWA3A_ENST00000389397.4_De_novo_Start_OutOfFrame	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	813						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		AGACCAAGTCAAGGGAAGCAG	0.522																																					p.S813S		.											.	VWA3A	1	0			c.A2439T						.						80.0	86.0	84.0					16																	22152958		2014	4177	6191	SO:0001819	synonymous_variant	146177	exon24			CAAGTCAAGGGAA	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2439A>T	16.37:g.22152958A>T		Somatic	166.0	2.0		WXS	Illumina HiSeq	Phase_I	164.0	14.0	NM_173615	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Silent	SNP	ENST00000389398.5	37	CCDS45441.1																																																																																			.		0.522	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		
