#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACADL	33	hgsc.bcm.edu;bcgsc.ca	37	2	211069378	211069379	+	Frame_Shift_Ins	INS	-	-	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr2:211069378_211069379insT	ENST00000233710.3	-	7	1023_1024	c.796_797insA	c.(796-798)atafs	p.I266fs	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	266					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		TGGCAACCGTATATCTTCAAAG	0.376																																					p.I266fs		.											.	ACADL	90	0			c.797_798insA						.																																			SO:0001589	frameshift_variant	33	exon7			AACCGTATATCTT	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.797dupA	2.37:g.211069379_211069379dupT	ENSP00000233710:p.Ile266fs	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	12.0	NM_001608	B2R8T3|Q8IUN8	Frame_Shift_Ins	INS	ENST00000233710.3	37	CCDS2389.1																																																																																			.		0.376	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	NM_001608	
AKAP3	10566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	4724998	4724998	+	Silent	SNP	C	C	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr12:4724998C>T	ENST00000545990.2	-	6	2993	c.2469G>A	c.(2467-2469)tcG>tcA	p.S823S	AKAP3_ENST00000228850.1_Silent_p.S823S|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	823					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						AGCGCAGCACCGACTGCAGAA	0.567																																					p.S823S		.											.	AKAP3	292	0			c.G2469A						.						137.0	111.0	120.0					12																	4724998		2203	4300	6503	SO:0001819	synonymous_variant	10566	exon5			CAGCACCGACTGC	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.2469G>A	12.37:g.4724998C>T		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	21.0	NM_006422	O75945|Q86X01|Q9UM61	Silent	SNP	ENST00000545990.2	37	CCDS8531.1																																																																																			.		0.567	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398911.2	NM_006422	
ANKH	56172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	14749332	14749332	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr5:14749332A>C	ENST00000284268.6	-	6	1101	c.771T>G	c.(769-771)atT>atG	p.I257M	ANKH_ENST00000535119.1_Missense_Mutation_p.I59M|ANKH_ENST00000503939.1_5'UTR	NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator	257					locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						AGAGGTTGACAATAGGCCGAC	0.517																																					p.I257M		.											.	ANKH	91	0			c.T771G						.						108.0	109.0	109.0					5																	14749332		2203	4300	6503	SO:0001583	missense	56172	exon6			GTTGACAATAGGC	AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.771T>G	5.37:g.14749332A>C	ENSP00000284268:p.Ile257Met	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	10.0	NM_054027	B2RCA7|B3KMG4|D3DTD4|Q9NQW2	Missense_Mutation	SNP	ENST00000284268.6	37	CCDS3885.1	.	.	.	.	.	.	.	.	.	.	A	18.67	3.673655	0.67928	.	.	ENSG00000154122	ENST00000535119;ENST00000284268	D;D	0.95853	-3.83;-3.83	5.91	-7.87	0.01183	.	0.000000	0.85682	D	0.000000	D	0.95341	0.8488	L	0.54323	1.7	0.49389	D	0.999783	D	0.69078	0.997	D	0.83275	0.996	D	0.94319	0.7552	10	0.72032	D	0.01	-50.9292	12.974	0.58527	0.653:0.0:0.266:0.0809	.	257	Q9HCJ1	ANKH_HUMAN	M	59;257	ENSP00000442524:I59M;ENSP00000284268:I257M	ENSP00000284268:I257M	I	-	3	3	ANKH	14802332	0.009000	0.17119	0.249000	0.24280	0.847000	0.48162	-0.981000	0.03766	-1.417000	0.02017	-0.899000	0.02877	ATT	.		0.517	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207063.1	NM_054027	
ARID1B	57492	hgsc.bcm.edu;bcgsc.ca	37	6	157099362	157099362	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr6:157099362T>A	ENST00000350026.5	+	1	300	c.299T>A	c.(298-300)cTc>cAc	p.L100H	RP11-230C9.2_ENST00000603191.1_lincRNA|ARID1B_ENST00000275248.4_Missense_Mutation_p.L42H|ARID1B_ENST00000346085.5_Missense_Mutation_p.L100H|ARID1B_ENST00000367148.1_Missense_Mutation_p.L100H|RP11-230C9.3_ENST00000604792.1_RNA|MIR4466_ENST00000606121.1_RNA	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	100	His-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		gcccaccacctccaccaccac	0.637																																					p.L100H		.											.	ARID1B	154	0			c.T299A						.						10.0	17.0	15.0					6																	157099362		1859	3596	5455	SO:0001583	missense	57492	exon1			ACCACCTCCACCA	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.299T>A	6.37:g.157099362T>A	ENSP00000055163:p.Leu100His	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	8.0	NM_017519	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	t	7.657	0.684140	0.14907	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248	T;T;T;T	0.75821	1.18;1.18;1.18;-0.97	2.48	0.998	0.19857	.	.	.	.	.	T	0.26557	0.0649	N	0.17082	0.46	0.23421	N	0.997716	P;P;P	0.43352	0.704;0.804;0.688	B;B;B	0.29440	0.047;0.102;0.102	T	0.28996	-1.0026	9	0.87932	D	0	.	0.197	0.00141	0.2086:0.2495:0.2129:0.329	.	100;100;42	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	H	100;100;100;42	ENSP00000344546:L100H;ENSP00000055163:L100H;ENSP00000356116:L100H;ENSP00000275248:L42H	ENSP00000275248:L42H	L	+	2	0	ARID1B	157141054	0.981000	0.34729	0.995000	0.50966	0.981000	0.71138	0.013000	0.13310	0.890000	0.36211	0.312000	0.20444	CTC	.		0.637	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
BAZ1B	9031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	72891607	72891607	+	Silent	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr7:72891607G>A	ENST00000339594.4	-	7	2522	c.2184C>T	c.(2182-2184)ttC>ttT	p.F728F	BAZ1B_ENST00000404251.1_Silent_p.F728F	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	728					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				GCTTTTCTAGGAACTCATCTT	0.468																																					p.F728F	Esophageal Squamous(112;1167 1561 21085 43672 48228)	.											.	BAZ1B	159	0			c.C2184T						.						88.0	83.0	84.0					7																	72891607		2203	4300	6503	SO:0001819	synonymous_variant	9031	exon7			TTCTAGGAACTCA	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.2184C>T	7.37:g.72891607G>A		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	21.0	NM_032408	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	ENST00000339594.4	37	CCDS5549.1																																																																																			.		0.468	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	
CAMTA2	23125	broad.mit.edu;bcgsc.ca	37	17	4877747	4877747	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr17:4877747T>C	ENST00000348066.3	-	12	2072	c.1949A>G	c.(1948-1950)aAg>aGg	p.K650R	CAMTA2_ENST00000381311.5_Missense_Mutation_p.K652R|CAMTA2_ENST00000572543.1_Missense_Mutation_p.K655R|RP5-1050D4.2_ENST00000430920.1_RNA|CAMTA2_ENST00000358183.4_Missense_Mutation_p.K650R|CAMTA2_ENST00000361571.5_Missense_Mutation_p.K649R|CAMTA2_ENST00000414043.3_Missense_Mutation_p.K673R	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	650					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TGCCATCCGCTTCTCCATCTG	0.597																																					p.K673R		.											.	CAMTA2	91	0			c.A2018G						.						151.0	117.0	128.0					17																	4877747		2203	4300	6503	SO:0001583	missense	23125	exon12			ATCCGCTTCTCCA	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.1949A>G	17.37:g.4877747T>C	ENSP00000321813:p.Lys650Arg	Somatic	49.0	2.0		WXS	Illumina HiSeq	Phase_I	43.0	16.0	NM_001171167	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.792208	0.50102	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.29142	2.8;1.81;1.58;1.81;1.59	5.29	5.29	0.74685	.	0.230500	0.34531	N	0.003894	T	0.07052	0.0179	N	0.00926	-1.1	0.33196	D	0.55158	B;B;P;P;B	0.46142	0.013;0.021;0.873;0.799;0.002	B;B;B;B;B	0.36134	0.003;0.007;0.218;0.108;0.003	T	0.28459	-1.0043	10	0.02654	T	1	-22.4184	7.7445	0.28860	0.0:0.0909:0.0:0.9091	.	626;673;652;650;649	B7ZM30;E7EWU5;O94983-3;O94983;O94983-4	.;.;.;CMTA2_HUMAN;.	R	673;652;649;650;650	ENSP00000412886:K673R;ENSP00000370712:K652R;ENSP00000354828:K649R;ENSP00000350910:K650R;ENSP00000321813:K650R	ENSP00000321813:K650R	K	-	2	0	CAMTA2	4818471	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.261000	0.32980	2.232000	0.73038	0.482000	0.46254	AAG	.		0.597	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099	
BRIP1	83990	ucsc.edu;bcgsc.ca	37	17	59821818	59821818	+	Silent	SNP	G	G	A	rs374362388		TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr17:59821818G>A	ENST00000259008.2	-	15	2499	c.2232C>T	c.(2230-2232)gaC>gaT	p.D744D	BRIP1_ENST00000577598.1_Silent_p.D744D	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	744					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						ATTTGATTGCGTCATAGTACA	0.328			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																													p.D744D		.	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	.	BRIP1	660	0			c.C2232T						.	G		0,4406		0,0,2203	169.0	169.0	169.0		2232	0.8	1.0	17		169	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BRIP1	NM_032043.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		744/1250	59821818	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	83990	exon15			GATTGCGTCATAG	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.2232C>T	17.37:g.59821818G>A		Somatic	214.0	2.0		WXS	Illumina HiSeq	.	223.0	37.0	NM_032043	Q3MJE2|Q8NCI5	Silent	SNP	ENST00000259008.2	37	CCDS11631.1																																																																																			.		0.328	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043	
CHTOP	26097	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	153615718	153615718	+	Missense_Mutation	SNP	G	G	A	rs138105302		TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr1:153615718G>A	ENST00000368694.3	+	5	731	c.419G>A	c.(418-420)cGa>cAa	p.R140Q	CHTOP_ENST00000403433.1_Intron|CHTOP_ENST00000368687.1_Missense_Mutation_p.R115Q|CHTOP_ENST00000495554.1_Intron|CHTOP_ENST00000368690.3_Intron|CHTOP_ENST00000368686.1_3'UTR	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1	140	Arg/Gly-rich.				mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						AACCTGCTCCGAGGTGGACGA	0.537																																					p.R141Q		.											.	CHTOP	90	0			c.G422A						.	G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	126.0	124.0	124.0		422,419	5.4	1.0	1	dbSNP_134	124	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CHTOP	NM_001206612.1,NM_015607.3	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	141/250,140/249	153615718	1,13005	2203	4300	6503	SO:0001583	missense	26097	exon5			TGCTCCGAGGTGG		CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.419G>A	1.37:g.153615718G>A	ENSP00000357683:p.Arg140Gln	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	13.0	NM_001206612	D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	Missense_Mutation	SNP	ENST00000368694.3	37	CCDS1048.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.107452	0.56291	0.0	1.16E-4	ENSG00000160679	ENST00000368694;ENST00000368687	D;D	0.87966	-2.32;-2.32	5.44	5.44	0.79542	.	0.298829	0.31257	N	0.007967	D	0.83229	0.5209	L	0.29908	0.895	0.80722	D	1	D;D	0.61697	0.99;0.983	P;P	0.55455	0.776;0.602	T	0.80621	-0.1301	10	0.25106	T	0.35	.	16.8052	0.85625	0.0:0.0:1.0:0.0	.	141;140	Q9Y3Y2-3;Q9Y3Y2	.;CHTOP_HUMAN	Q	140;115	ENSP00000357683:R140Q;ENSP00000357676:R115Q	ENSP00000357676:R115Q	R	+	2	0	CHTOP	151882342	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.532000	0.73825	2.832000	0.97577	0.655000	0.94253	CGA	G|1.000;A|0.000		0.537	CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089967.1	NM_015607	
CILP	8483	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65497772	65497772	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr15:65497772T>C	ENST00000261883.4	-	5	623	c.457A>G	c.(457-459)Agc>Ggc	p.S153G		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	153	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GACCATGGGCTCCAGATGCGC	0.577																																					p.S153G		.											.	CILP	97	0			c.A457G						.						64.0	53.0	57.0					15																	65497772		2201	4299	6500	SO:0001583	missense	8483	exon5			ATGGGCTCCAGAT	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.457A>G	15.37:g.65497772T>C	ENSP00000261883:p.Ser153Gly	Somatic	45.0	1.0		WXS	Illumina HiSeq	Phase_I	51.0	7.0	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	T	6.908	0.537169	0.13188	.	.	ENSG00000138615	ENST00000261883	T	0.59364	0.27	5.56	4.44	0.53790	.	0.261332	0.44902	D	0.000417	T	0.41926	0.1180	L	0.43646	1.37	0.36424	D	0.864488	B	0.02656	0.0	B	0.01281	0.0	T	0.35525	-0.9785	10	0.14252	T	0.57	-13.8052	4.7614	0.13110	0.255:0.0825:0.0:0.6625	.	153	O75339	CILP1_HUMAN	G	153	ENSP00000261883:S153G	ENSP00000261883:S153G	S	-	1	0	CILP	63284825	1.000000	0.71417	0.904000	0.35570	0.391000	0.30476	2.227000	0.42972	0.965000	0.38133	0.528000	0.53228	AGC	.		0.577	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
COL6A5	256076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130107781	130107781	+	Silent	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr3:130107781G>A	ENST00000432398.2	+	6	2714	c.2220G>A	c.(2218-2220)gcG>gcA	p.A740A	COL6A5_ENST00000265379.6_Silent_p.A740A	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	740	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						ATGGAGTAGCGCAGGATGATG	0.463																																					p.A740A		.											.	.	.	0			c.G2220A						.						61.0	52.0	55.0					3																	130107781		692	1591	2283	SO:0001819	synonymous_variant	256076	exon6			AGTAGCGCAGGAT	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.2220G>A	3.37:g.130107781G>A		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	44.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	ENST00000432398.2	37																																																																																				.		0.463	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
CTBP1	1487	broad.mit.edu;ucsc.edu	37	4	1244558	1244558	+	5'Flank	SNP	G	G	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr4:1244558G>T	ENST00000290921.6	-	0	0				CTBP1-AS2_ENST00000581398.1_RNA|CTBP1_ENST00000382952.3_5'Flank|CTBP1-AS2_ENST00000507044.1_RNA|CTBP1-AS2_ENST00000514984.1_RNA|CTBP1-AS2_ENST00000505364.1_RNA|CTBP1-AS2_ENST00000578730.1_RNA|CTBP1-AS2_ENST00000357591.2_RNA	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1						Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		TTACTAGGGGGTGGTGAATAT	0.582																																					.		.											.	.	.	0			.						.						70.0	71.0	71.0					4																	1244558		2203	4300	6503	SO:0001631	upstream_gene_variant	92070	.			TAGGGGGTGGTGA	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259		4.37:g.1244558G>T	Exception_encountered	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	5.0	.	Q4W5N3|Q7Z2Q5	RNA	SNP	ENST00000290921.6	37	CCDS3348.1	.	.	.	.	.	.	.	.	.	.	G	0.638	-0.814695	0.02776	.	.	ENSG00000196810	ENST00000357591	.	.	.	1.04	-1.09	0.09904	.	.	.	.	.	T	0.27933	0.0688	.	.	.	0.26051	N	0.981474	B	0.19706	0.038	B	0.10450	0.005	T	0.13124	-1.0521	6	0.87932	D	0	.	3.7684	0.08632	0.1866:0.0:0.584:0.2294	.	66	Q0VAR9	CD042_HUMAN	V	66	.	ENSP00000350204:G66V	G	+	2	0	C4orf42	1234558	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.064000	0.14437	-1.382000	0.02109	-2.900000	0.00093	GGT	.		0.582	CTBP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000202938.1	NM_001328	
DHX35	60625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	37630379	37630379	+	Missense_Mutation	SNP	C	C	T	rs539104890	byFrequency	TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr20:37630379C>T	ENST00000252011.3	+	9	682	c.649C>T	c.(649-651)Cgg>Tgg	p.R217W	DHX35_ENST00000373325.2_Missense_Mutation_p.R217W|DHX35_ENST00000373323.4_Missense_Mutation_p.R186W	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	217	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TTAGAAATTCCGGGATTTCTT	0.328													C|||	2	0.000399361	0.0	0.0014	5008	,	,		17282	0.0		0.001	False		,,,				2504	0.0				p.R217W		.											.	DHX35	226	0			c.C649T						.						85.0	93.0	90.0					20																	37630379		2203	4300	6503	SO:0001583	missense	60625	exon9			AAATTCCGGGATT	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.649C>T	20.37:g.37630379C>T	ENSP00000252011:p.Arg217Trp	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	7.0	NM_021931	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Missense_Mutation	SNP	ENST00000252011.3	37	CCDS13310.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.309937	0.60414	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000441485	T;T;T;T	0.07908	3.15;3.15;3.15;3.15	5.64	3.59	0.41128	DEAD-like helicase (2);	0.152772	0.64402	D	0.000018	T	0.17874	0.0429	M	0.72894	2.215	0.44289	D	0.997154	D;D	0.59357	0.985;0.973	P;B	0.54815	0.761;0.38	T	0.00599	-1.1651	10	0.87932	D	0	.	7.7121	0.28684	0.2941:0.6236:0.0:0.0823	.	186;217	F5GXM6;Q9H5Z1	.;DHX35_HUMAN	W	217;217;186;182	ENSP00000362422:R217W;ENSP00000252011:R217W;ENSP00000362420:R186W;ENSP00000414630:R182W	ENSP00000252011:R217W	R	+	1	2	DHX35	37063793	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	3.050000	0.49877	1.523000	0.49018	0.561000	0.74099	CGG	.		0.328	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
DNAJA4	55466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	78562999	78562999	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr15:78562999G>A	ENST00000394852.3	+	2	483	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	DNAJA4_ENST00000394855.3_Missense_Mutation_p.R127Q|DNAJA4_ENST00000446172.2_Missense_Mutation_p.R71Q|DNAJA4_ENST00000343789.3_Missense_Mutation_p.R98Q	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	98					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						GGTGGTGGACGGATGGCTAGA	0.448																																					p.R127Q		.											.	DNAJA4	226	0			c.G380A						.						127.0	123.0	124.0					15																	78562999		2196	4293	6489	SO:0001583	missense	55466	exon3			GTGGACGGATGGC	AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.293G>A	15.37:g.78562999G>A	ENSP00000378321:p.Arg98Gln	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	22.0	NM_018602	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Missense_Mutation	SNP	ENST00000394852.3	37	CCDS45316.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.597407	0.87055	.	.	ENSG00000140403	ENST00000394855;ENST00000343789;ENST00000394852;ENST00000446172	T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69	5.63	5.63	0.86233	Heat shock protein DnaJ, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82513	0.5053	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.89917	0.997;0.998;0.997;1.0	P;D;P;D	0.72075	0.749;0.928;0.834;0.976	T	0.77736	-0.2476	10	0.13853	T	0.58	-4.1385	18.2734	0.90076	0.0:0.0:1.0:0.0	.	13;71;98;127	Q9P1H1;E9PDM9;Q8WW22;Q8WW22-2	.;.;DNJA4_HUMAN;.	Q	127;98;98;71	ENSP00000378324:R127Q;ENSP00000339581:R98Q;ENSP00000378321:R98Q;ENSP00000413499:R71Q	ENSP00000339581:R98Q	R	+	2	0	DNAJA4	76350054	1.000000	0.71417	0.996000	0.52242	0.858000	0.48976	7.752000	0.85141	2.652000	0.90054	0.655000	0.94253	CGG	.		0.448	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1	NM_018602	
DPY19L2	283417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	64057564	64057564	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr12:64057564G>A	ENST00000324472.4	-	3	607	c.424C>T	c.(424-426)Cgg>Tgg	p.R142W	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	142					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GTCATCTCCCGTTCCAAAGAT	0.328																																					p.R142W		.											.	DPY19L2	515	0			c.C424T						.						62.0	59.0	60.0					12																	64057564		2203	4297	6500	SO:0001583	missense	283417	exon3			TCTCCCGTTCCAA		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.424C>T	12.37:g.64057564G>A	ENSP00000315988:p.Arg142Trp	Somatic	509.0	0.0		WXS	Illumina HiSeq	Phase_I	392.0	47.0	NM_173812	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166839	0.38217	.	.	ENSG00000177990	ENST00000324472	T	0.62941	-0.01	2.5	0.161	0.14977	.	0.067668	0.56097	U	0.000027	T	0.75213	0.3819	M	0.84585	2.705	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.73477	-0.3970	9	.	.	.	.	7.3823	0.26862	0.0:0.0:0.3847:0.6153	.	142	Q6NUT2	D19L2_HUMAN	W	142	ENSP00000315988:R142W	.	R	-	1	2	DPY19L2	62343831	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	4.915000	0.63355	0.347000	0.23924	0.184000	0.17185	CGG	.		0.328	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812	
EEA1	8411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	93170633	93170633	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr12:93170633A>G	ENST00000322349.8	-	28	4364	c.4100T>C	c.(4099-4101)gTa>gCa	p.V1367A		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	1367					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						TCTCACTGTTACTGAAAAGCC	0.338																																					p.V1367A		.											.	EEA1	229	0			c.T4100C						.						206.0	195.0	199.0					12																	93170633		2203	4300	6503	SO:0001583	missense	8411	exon28			ACTGTTACTGAAA	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.4100T>C	12.37:g.93170633A>G	ENSP00000317955:p.Val1367Ala	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	14.0	NM_003566	Q14221	Missense_Mutation	SNP	ENST00000322349.8	37	CCDS31874.1	.	.	.	.	.	.	.	.	.	.	A	16.73	3.203372	0.58234	.	.	ENSG00000102189	ENST00000322349	T	0.71934	-0.61	5.48	5.48	0.80851	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.47852	D	0.000204	T	0.77025	0.4070	L	0.35593	1.075	0.80722	D	1	P	0.50710	0.938	D	0.66716	0.946	T	0.79388	-0.1824	10	0.66056	D	0.02	.	15.5639	0.76273	1.0:0.0:0.0:0.0	.	1367	Q15075	EEA1_HUMAN	A	1367	ENSP00000317955:V1367A	ENSP00000317955:V1367A	V	-	2	0	EEA1	91694764	1.000000	0.71417	0.969000	0.41365	0.122000	0.20287	9.300000	0.96151	2.070000	0.61991	0.528000	0.53228	GTA	.		0.338	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
EIF3E	3646	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	109240530	109240530	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr8:109240530C>G	ENST00000220849.5	-	7	750	c.688G>C	c.(688-690)Gat>Cat	p.D230H	RP11-35G22.1_ENST00000520037.1_RNA|EIF3E_ENST00000519030.1_Missense_Mutation_p.D137H|EIF3E_ENST00000519517.1_5'UTR	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E										EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			ATAATATTATCGCGACCTTTG	0.368																																					p.D230H	GBM(15;360 410 8460 34179 52246)	.											.	EIF3E	188	0			c.G688C						.						104.0	107.0	106.0					8																	109240530		2203	4300	6503	SO:0001583	missense	3646	exon7			TATTATCGCGACC	U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.688G>C	8.37:g.109240530C>G	ENSP00000220849:p.Asp230His	Somatic	251.0	1.0		WXS	Illumina HiSeq	Phase_I	460.0	50.0	NM_001568		Missense_Mutation	SNP	ENST00000220849.5	37	CCDS6308.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.150273|4.150273	0.78001|0.78001	.|.	.|.	ENSG00000104408|ENSG00000104408	ENST00000220849;ENST00000519030;ENST00000519627|ENST00000522352	T;T;T|T	0.47528|0.50813	0.84;0.84;0.84|0.73	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69540|0.69540	0.3122|0.3122	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	D;P|.	0.89917|.	1.0;0.888|.	D;B|.	0.72625|.	0.978;0.364|.	T|T	0.71052|0.71052	-0.4704|-0.4704	10|7	0.62326|0.49607	D|T	0.03|0.09	-24.3332|-24.3332	19.4524|19.4524	0.94873|0.94873	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	230;230|.	B2R806;P60228|.	.;EIF3E_HUMAN|.	H|P	230;137;103|53	ENSP00000220849:D230H;ENSP00000428796:D137H;ENSP00000430839:D103H|ENSP00000428170:R53P	ENSP00000220849:D230H|ENSP00000428170:R53P	D|R	-|-	1|2	0|0	EIF3E|EIF3E	109309706|109309706	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.989000|0.989000	0.77384|0.77384	7.776000|7.776000	0.85560|0.85560	2.661000|2.661000	0.90470|0.90470	0.585000|0.585000	0.79938|0.79938	GAT|CGA	.		0.368	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380612.2	NM_001568	
EPHB1	2047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	134670256	134670256	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr3:134670256G>A	ENST00000398015.3	+	3	537	c.167G>A	c.(166-168)cGc>cAc	p.R56H	EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	56	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.R56L(2)|p.R56P(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						AACACCATCCGCACCTACCAG	0.517																																					p.R56H		.											EPHB1,NS,carcinoma,0	EPHB1	1492	3	Substitution - Missense(3)	lung(3)	c.G167A						.						38.0	43.0	41.0					3																	134670256		2155	4278	6433	SO:0001583	missense	2047	exon3			CCATCCGCACCTA	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.167G>A	3.37:g.134670256G>A	ENSP00000381097:p.Arg56His	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	10.0	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469822	0.84533	.	.	ENSG00000154928	ENST00000460895;ENST00000398015;ENST00000497173;ENST00000473867;ENST00000474732	T;T;T;T;T	0.04360	3.64;3.64;3.64;3.64;3.64	5.64	5.64	0.86602	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.19366	0.0465	L	0.57130	1.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.00563	-1.1669	10	0.29301	T	0.29	.	19.7209	0.96143	0.0:0.0:1.0:0.0	.	56;56	B5A969;P54762	.;EPHB1_HUMAN	H	34;56;34;34;34	ENSP00000417435:R34H;ENSP00000381097:R56H;ENSP00000419688:R34H;ENSP00000417216:R34H;ENSP00000418352:R34H	ENSP00000381097:R56H	R	+	2	0	EPHB1	136152946	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.651000	0.90000	0.650000	0.86243	CGC	.		0.517	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80049392	80049392	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr17:80049392C>T	ENST00000306749.2	-	9	1416	c.1198G>A	c.(1198-1200)Gtg>Atg	p.V400M		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	400	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	ATGATGTGCACGTTGGAGCCC	0.716																																					p.V400M	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.G1198A						.						31.0	32.0	32.0					17																	80049392		2173	4289	6462	SO:0001583	missense	2194	exon9			TGTGCACGTTGGA	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.1198G>A	17.37:g.80049392C>T	ENSP00000304592:p.Val400Met	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	18.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.288358	0.59976	.	.	ENSG00000169710	ENST00000306749	T	0.27402	1.67	5.1	4.13	0.48395	Thiolase-like, subgroup (1);Thiolase-like (1);	0.293303	0.31427	N	0.007679	T	0.59074	0.2167	M	0.90082	3.085	0.54753	D	0.999984	D	0.89917	1.0	D	0.66196	0.942	T	0.67597	-0.5630	10	0.62326	D	0.03	-34.0693	12.9511	0.58401	0.0:0.921:0.0:0.079	.	400	P49327	FAS_HUMAN	M	400	ENSP00000304592:V400M	ENSP00000304592:V400M	V	-	1	0	FASN	77642681	1.000000	0.71417	0.557000	0.28306	0.150000	0.21749	7.317000	0.79018	2.381000	0.81170	0.484000	0.47621	GTG	.		0.716	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
GABRA4	2557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	46976276	46976276	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr4:46976276A>G	ENST00000264318.3	-	6	1676	c.694T>C	c.(694-696)Tca>Cca	p.S232P		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	232					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	GTTTCACTTGATACGGTTTGC	0.383																																					p.S232P	Ovarian(6;283 369 8234 12290 33402)	.											.	GABRA4	156	0			c.T694C						.						122.0	113.0	116.0					4																	46976276		2203	4300	6503	SO:0001583	missense	2557	exon6			CACTTGATACGGT		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.694T>C	4.37:g.46976276A>G	ENSP00000264318:p.Ser232Pro	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	12.0	NM_000809	Q8IYR7	Missense_Mutation	SNP	ENST00000264318.3	37	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.456681	0.84317	.	.	ENSG00000109158	ENST00000264318	T	0.79554	-1.28	5.1	5.1	0.69264	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.88665	0.6498	M	0.75615	2.305	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.88899	0.3351	10	0.48119	T	0.1	.	14.2289	0.65877	1.0:0.0:0.0:0.0	.	232	P48169	GBRA4_HUMAN	P	232	ENSP00000264318:S232P	ENSP00000264318:S232P	S	-	1	0	GABRA4	46671033	1.000000	0.71417	0.760000	0.31359	0.737000	0.42083	7.179000	0.77665	2.147000	0.66899	0.528000	0.53228	TCA	.		0.383	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1		
ISM1	140862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	13279761	13279761	+	Silent	SNP	C	C	T	rs572363345		TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr20:13279761C>T	ENST00000262487.4	+	6	1056	c.1050C>T	c.(1048-1050)gaC>gaT	p.D350D	TASP1_ENST00000539805.1_Intron	NM_080826.1	NP_543016.1	B1AKI9	ISM1_HUMAN	isthmin 1, angiogenesis inhibitor	350	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.					extracellular region (GO:0005576)				NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(8)|lung(5)|urinary_tract(1)	17						GCTGGAAGGACGCCAGCGGGC	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18261	0.0		0.0	False		,,,				2504	0.0				p.D350D		.											.	ISM1	68	0			c.C1050T						.						41.0	47.0	45.0					20																	13279761		2144	4237	6381	SO:0001819	synonymous_variant	140862	exon6			GAAGGACGCCAGC	AL133463	CCDS46579.1	20p12.1	2013-05-15	2013-05-15	2008-12-23	ENSG00000101230	ENSG00000101230			16213	protein-coding gene	gene with protein product		615793	"""chromosome 20 open reading frame 82"", ""isthmin 1 homolog (zebrafish)"""	C20orf82			Standard	NM_080826		Approved	bA149I18.1	uc010gce.1	B1AKI9		ENST00000262487.4:c.1050C>T	20.37:g.13279761C>T		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	6.0	NM_080826	Q8WVH9	Silent	SNP	ENST00000262487.4	37	CCDS46579.1																																																																																			.		0.647	ISM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078039.2		
KIAA1614	57710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	180907742	180907742	+	Missense_Mutation	SNP	C	C	T	rs372082964	byFrequency	TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr1:180907742C>T	ENST00000367588.4	+	6	2868	c.2813C>T	c.(2812-2814)aCg>aTg	p.T938M	KIAA1614_ENST00000367587.1_Missense_Mutation_p.T559M	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	938										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						ATCAACTCCACGGGCATCACC	0.582													C|||	5	0.000998403	0.0	0.0	5008	,	,		22787	0.005		0.0	False		,,,				2504	0.0				p.T938M		.											.	KIAA1614	26	0			c.C2813T						.	C	MET/THR	2,4336		0,2,2167	75.0	80.0	78.0		2813	-0.3	0.0	1		78	0,8564		0,0,4282	no	missense	KIAA1614	NM_020950.1	81	0,2,6449	TT,TC,CC		0.0,0.0461,0.0155	benign	938/1191	180907742	2,12900	2169	4282	6451	SO:0001583	missense	57710	exon6			ACTCCACGGGCAT	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.2813C>T	1.37:g.180907742C>T	ENSP00000356560:p.Thr938Met	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	29.0	NM_020950	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	C	2.837	-0.241378	0.05906	4.61E-4	0.0	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.24151	2.44;1.87	3.97	-0.342	0.12635	.	0.765722	0.11519	N	0.555895	T	0.11707	0.0285	N	0.19112	0.55	0.33091	D	0.537893	B;B	0.28584	0.216;0.065	B;B	0.15870	0.009;0.014	T	0.19289	-1.0310	9	0.44086	T	0.13	-0.0074	2.461	0.04541	0.4086:0.325:0.0:0.2663	.	559;938	Q5VZ46-2;Q5VZ46	.;K1614_HUMAN	M	938;559	ENSP00000356560:T938M;ENSP00000356559:T559M	ENSP00000356559:T559M	T	+	2	0	KIAA1614	179174365	0.000000	0.05858	0.003000	0.11579	0.410000	0.31052	-0.690000	0.05138	-0.160000	0.11002	-0.226000	0.12346	ACG	.		0.582	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
KIF26B	55083	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	245530501	245530501	+	Silent	SNP	G	G	A	rs537827807		TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr1:245530501G>A	ENST00000407071.2	+	3	1271	c.831G>A	c.(829-831)gcG>gcA	p.A277A	KIF26B_ENST00000479506.1_3'UTR	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	277					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCAATGGGGCGGAAAAGAAGA	0.617													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18670	0.0		0.0	False		,,,				2504	0.0				p.A277A		.											.	KIF26B	25	0			c.G831A						.						30.0	41.0	38.0					1																	245530501		2008	4168	6176	SO:0001819	synonymous_variant	55083	exon3			TGGGGCGGAAAAG	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.831G>A	1.37:g.245530501G>A		Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	260.0	23.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	ENST00000407071.2	37	CCDS44342.1																																																																																			.		0.617	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
KRT19	3880	broad.mit.edu;mdanderson.org	37	17	39684492	39684492	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr17:39684492G>A	ENST00000361566.3	-	1	68	c.8C>T	c.(7-9)tCc>tTc	p.S3F		NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	3	Head.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				ATAGCTGTAGGAAGTCATGGC	0.682																																					p.S3F		.											.	KRT19	90	0			c.C8T						.						11.0	12.0	12.0					17																	39684492		1950	3867	5817	SO:0001583	missense	3880	exon1			CTGTAGGAAGTCA		CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.8C>T	17.37:g.39684492G>A	ENSP00000355124:p.Ser3Phe	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	10.0	NM_002276	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Missense_Mutation	SNP	ENST00000361566.3	37	CCDS11399.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407068	0.42715	.	.	ENSG00000171345	ENST00000361566;ENST00000455635	D;D	0.83755	-1.76;-1.64	4.39	3.42	0.39159	.	0.308687	0.23600	N	0.046457	T	0.78451	0.4285	M	0.62723	1.935	0.41399	D	0.98766	B	0.25719	0.132	B	0.21151	0.033	T	0.77405	-0.2600	10	0.87932	D	0	.	8.7967	0.34883	0.0905:0.1971:0.7124:0.0	.	3	P08727	K1C19_HUMAN	F	3	ENSP00000355124:S3F;ENSP00000408759:S3F	ENSP00000355124:S3F	S	-	2	0	KRT19	36938018	0.992000	0.36948	0.979000	0.43373	0.023000	0.10783	1.500000	0.35682	1.199000	0.43173	0.561000	0.74099	TCC	.		0.682	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257285.1	NM_002276	
LRRTM3	347731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	68686790	68686790	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr10:68686790G>T	ENST00000361320.4	+	2	694	c.116G>T	c.(115-117)aGg>aTg	p.R39M	CTNNA3_ENST00000373744.4_Intron|CTNNA3_ENST00000433211.2_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	39	LRRNT.				positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.R39K(2)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						AAGGGCTGTAGGTGTGAAGGC	0.463																																					p.R39M		.											.	LRRTM3	93	2	Substitution - Missense(2)	lung(2)	c.G116T						.						118.0	115.0	116.0					10																	68686790		2203	4300	6503	SO:0001583	missense	347731	exon2			GCTGTAGGTGTGA	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.116G>T	10.37:g.68686790G>T	ENSP00000355187:p.Arg39Met	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	8.0	NM_178011	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	ENST00000361320.4	37	CCDS7270.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628246	0.46944	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	D	0.96427	-4.01	5.23	5.23	0.72850	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98099	0.9373	M	0.80422	2.495	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.98945	1.0792	10	0.87932	D	0	.	17.9434	0.89032	0.0:0.0:1.0:0.0	.	39;39	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	M	39	ENSP00000355187:R39M	ENSP00000355187:R39M	R	+	2	0	LRRTM3	68356796	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.009000	0.88606	2.613000	0.88420	0.655000	0.94253	AGG	.		0.463	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011	
MKI67	4288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	129913861	129913861	+	Missense_Mutation	SNP	C	C	T	rs201650569		TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr10:129913861C>T	ENST00000368654.3	-	7	1186	c.811G>A	c.(811-813)Gca>Aca	p.A271T	MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	271					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.A271T(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTCTCTGTTGCGTAATCAGTT	0.433																																					p.A271T		.											.	MKI67	519	1	Substitution - Missense(1)	endometrium(1)	c.G811A						.	T	,THR/ALA	0,4406		0,0,2203	84.0	88.0	87.0		,811	-7.2	0.0	10		87	1,8599	818.9+/-406.8	0,1,4299	yes	intron,missense	MKI67	NM_001145966.1,NM_002417.4	,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,benign	,271/3257	129913861	1,13005	2203	4300	6503	SO:0001583	missense	4288	exon7			CTGTTGCGTAATC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.811G>A	10.37:g.129913861C>T	ENSP00000357643:p.Ala271Thr	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	18.0	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.511489	0.00984	0.0	1.16E-4	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.21031	2.03	3.59	-7.17	0.01511	.	1.919400	0.02775	N	0.120183	T	0.10766	0.0263	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34502	-0.9826	10	0.87932	D	0	.	7.5658	0.27879	0.0942:0.5353:0.2549:0.1155	.	271	P46013	KI67_HUMAN	T	271	ENSP00000357643:A271T	ENSP00000357643:A271T	A	-	1	0	MKI67	129803851	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.644000	0.00204	-3.899000	0.00093	-1.061000	0.02294	GCA	.		0.433	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
MUC4	4585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195487851	195487851	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr3:195487851A>T	ENST00000346145.4	-	15	2083	c.2044T>A	c.(2044-2046)Tca>Aca	p.S682T	MUC4_ENST00000349607.4_Missense_Mutation_p.S631T|MUC4_ENST00000475231.1_Missense_Mutation_p.S4866T|MUC4_ENST00000463781.3_Missense_Mutation_p.S4918T	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1675					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TAGATGCATGAGCTATCTCCG	0.512																																					p.S4918T		.											.	MUC4	90	0			c.T14752A						.						145.0	125.0	132.0					3																	195487851		2203	4300	6503	SO:0001583	missense	4585	exon16			TGCATGAGCTATC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.2044T>A	3.37:g.195487851A>T	ENSP00000304207:p.Ser682Thr	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	15.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000346145.4	37	CCDS3310.1	.	.	.	.	.	.	.	.	.	.	.	8.711	0.912074	0.17907	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.38077	1.16;1.52;1.5;1.5	4.98	0.731	0.18277	.	0.983616	0.08275	N	0.970793	T	0.23492	0.0568	N	0.22421	0.69	0.09310	N	1	P;B;B;B;B;P	0.36660	0.549;0.306;0.306;0.167;0.167;0.564	B;B;B;B;B;B	0.39562	0.163;0.142;0.142;0.045;0.045;0.303	T	0.22906	-1.0203	10	0.27785	T	0.31	-0.0725	4.0156	0.09642	0.0941:0.4189:0.3461:0.141	.	4790;631;682;4918;4866;1623	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	T	631;682;4918;4866;1418	ENSP00000338109:S631T;ENSP00000304207:S682T;ENSP00000417498:S4918T;ENSP00000420243:S4866T	ENSP00000304207:S682T	S	-	1	0	MUC4	196973522	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.143000	0.16115	0.122000	0.18314	-0.373000	0.07131	TCA	.		0.512	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406	
ATP6V1G2	534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31515977	31515977	+	5'Flank	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr6:31515977G>A	ENST00000303892.5	-	0	0				ATP6V1G2_ENST00000483170.1_5'Flank|NFKBIL1_ENST00000376148.4_Missense_Mutation_p.R32H|NFKBIL1_ENST00000376145.4_Missense_Mutation_p.R32H|ATP6V1G2_ENST00000483251.1_5'Flank|ATP6V1G2-DDX39B_ENST00000475917.1_5'Flank|ATP6V1G2_ENST00000376151.4_5'Flank|ATP6V1G2-DDX39B_ENST00000376185.1_5'Flank	NM_130463.3|NM_138282.2	NP_569730.1|NP_612139.1	O95670	VATG2_HUMAN	ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2						cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			breast(1)|large_intestine(2)|lung(1)|prostate(1)	5						CGCCGCCAACGCCGAGAACGT	0.622																																					p.R32H		.											.	NFKBIL1	90	0			c.G95A						.						78.0	57.0	64.0					6																	31515977		1510	2709	4219	SO:0001631	upstream_gene_variant	4795	exon2			GCCAACGCCGAGA	Y14768	CCDS4698.1, CCDS4699.1, CCDS56413.1	6p21.3	2011-03-29	2006-01-13	2002-05-10	ENSG00000213760	ENSG00000213760		"""ATPases / V-type"""	862	protein-coding gene	gene with protein product		606853	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"", ""ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2"""	ATP6G, ATP6G2		10202016	Standard	NM_138282		Approved	Vma10, NG38, Em:AC004181.3	uc003nua.3	O95670	OTTHUMG00000166618		6.37:g.31515977G>A	Exception_encountered	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	7.0	NM_005007	B5MEF0|Q2L6F8|Q5HYU8|Q5RJ63	Missense_Mutation	SNP	ENST00000303892.5	37	CCDS4698.1	.	.	.	.	.	.	.	.	.	.	g	21.5	4.155963	0.78114	.	.	ENSG00000204498	ENST00000376146;ENST00000542852;ENST00000376148;ENST00000376145	T;T;T	0.35973	1.6;1.28;1.66	5.03	4.15	0.48705	.	0.236672	0.41500	D	0.000877	T	0.22781	0.0550	N	0.08118	0	0.80722	D	1	D;B;D	0.71674	0.998;0.244;0.998	D;B;D	0.69479	0.964;0.022;0.964	T	0.06373	-1.0830	10	0.34782	T	0.22	-9.3574	9.7473	0.40455	0.0993:0.0:0.9007:0.0	.	9;32;32	Q5STV6;Q5STV4;Q9UBC1	.;.;IKBL1_HUMAN	H	9;9;32;32	ENSP00000365316:R9H;ENSP00000365318:R32H;ENSP00000365315:R32H	ENSP00000365315:R32H	R	+	2	0	NFKBIL1	31623956	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.543000	0.45752	2.340000	0.79590	0.651000	0.88453	CGC	.		0.622	ATP6V1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076399.3	NM_130463	
OR10A6	390093	broad.mit.edu;ucsc.edu	37	11	7949333	7949333	+	Nonsense_Mutation	SNP	G	G	A	rs147185885	byFrequency	TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr11:7949333G>A	ENST00000309838.2	-	1	876	c.877C>T	c.(877-879)Cga>Tga	p.R293*		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCACTATTTCGCAAACTGTAG	0.418													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		20042	0.0		0.0	False		,,,				2504	0.0				p.R293X		.											.	OR10A6	70	0			c.C877T						.	G	stop/ARG	0,4402		0,0,2201	162.0	147.0	152.0		877	-6.5	0.0	11	dbSNP_134	152	2,8590	2.2+/-6.3	0,2,4294	yes	stop-gained	OR10A6	NM_001004461.1		0,2,6495	AA,AG,GG		0.0233,0.0,0.0154		293/315	7949333	2,12992	2201	4296	6497	SO:0001587	stop_gained	390093	exon1			TATTTCGCAAACT	AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.877C>T	11.37:g.7949333G>A	ENSP00000312470:p.Arg293*	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	12.0	NM_001004461	Q6IF59	Nonsense_Mutation	SNP	ENST00000309838.2	37	CCDS31420.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	5.803	0.332530	0.10956	0.0	2.33E-4	ENSG00000175393	ENST00000309838	.	.	.	4.43	-6.52	0.01872	.	0.184865	0.25827	N	0.028044	.	.	.	.	.	.	0.42222	D	0.991859	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1114	0.53842	0.0781:0.0:0.1429:0.7789	.	.	.	.	X	293	.	ENSP00000312470:R293X	R	-	1	2	OR10A6	7905909	0.014000	0.17966	0.003000	0.11579	0.001000	0.01503	0.247000	0.18179	-0.885000	0.03971	0.655000	0.94253	CGA	G|1.000;A|0.000		0.418	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385703.1	NM_001004461	
OR2T6	254879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248551768	248551768	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr1:248551768C>T	ENST00000355728.2	+	1	859	c.859C>T	c.(859-861)Cct>Tct	p.P287S		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTTATTAAACCCTCTCATCTA	0.463																																					p.P287S		.											.	OR2T6	71	0			c.C859T						.						89.0	87.0	88.0					1																	248551768		2203	4300	6503	SO:0001583	missense	254879	exon1			TTAAACCCTCTCA	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.859C>T	1.37:g.248551768C>T	ENSP00000347965:p.Pro287Ser	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	34.0	NM_001005471	A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480690	0.63849	.	.	ENSG00000198104	ENST00000355728	T	0.63417	-0.04	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000408	D	0.87075	0.6087	H	0.98754	4.32	0.36589	D	0.873971	D	0.76494	0.999	D	0.68621	0.959	D	0.94373	0.7597	10	0.87932	D	0	.	16.6996	0.85345	0.0:1.0:0.0:0.0	.	287	Q8NHC8	OR2T6_HUMAN	S	287	ENSP00000347965:P287S	ENSP00000347965:P287S	P	+	1	0	OR2T6	246618391	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	3.748000	0.55142	2.330000	0.79161	0.643000	0.83706	CCT	.		0.463	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
OR51I1	390063	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5461996	5461996	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr11:5461996A>G	ENST00000380211.1	-	1	748	c.749T>C	c.(748-750)gTg>gCg	p.V250A	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	250					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAGGCCAGCACTGCACAGAT	0.498																																					p.V250A		.											.	OR51I1	69	0			c.T749C						.						123.0	105.0	111.0					11																	5461996		2201	4297	6498	SO:0001583	missense	390063	exon1			GCCAGCACTGCAC	BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.749T>C	11.37:g.5461996A>G	ENSP00000369559:p.Val250Ala	Somatic	85.0	1.0		WXS	Illumina HiSeq	Phase_I	93.0	29.0	NM_001005288	B9EKW2|Q6IF33	Missense_Mutation	SNP	ENST00000380211.1	37	CCDS31382.1	.	.	.	.	.	.	.	.	.	.	A	19.22	3.785414	0.70337	.	.	ENSG00000167359	ENST00000321307;ENST00000380211	T	0.00362	7.84	5.47	5.47	0.80525	GPCR, rhodopsin-like superfamily (1);	0.129792	0.34853	N	0.003633	T	0.01156	0.0038	H	0.95437	3.67	0.26355	N	0.97715	D	0.69078	0.997	D	0.79108	0.992	T	0.20840	-1.0263	10	0.87932	D	0	.	9.8112	0.40824	0.919:0.0:0.081:0.0	.	250	Q9H343	O51I1_HUMAN	A	247;250	ENSP00000369559:V250A	ENSP00000439622:V247A	V	-	2	0	OR51I1	5418572	0.492000	0.26027	0.657000	0.29651	0.959000	0.62525	4.061000	0.57485	2.096000	0.63516	0.450000	0.29827	GTG	.		0.498	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143399.1	NM_001005288	
PFAS	5198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	8170947	8170947	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr17:8170947G>A	ENST00000314666.6	+	26	3479	c.3346G>A	c.(3346-3348)Ggc>Agc	p.G1116S	PFAS_ENST00000545834.1_Missense_Mutation_p.G692S	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1116	Glutamine amidotransferase type-1.				'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	CTTCGTGGGCGGCTTCAGCTA	0.617																																					p.G1116S		.											.	PFAS	94	0			c.G3346A						.						132.0	118.0	123.0					17																	8170947		2203	4300	6503	SO:0001583	missense	5198	exon26			GTGGGCGGCTTCA	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.3346G>A	17.37:g.8170947G>A	ENSP00000313490:p.Gly1116Ser	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	9.0	NM_012393	A6H8V8	Missense_Mutation	SNP	ENST00000314666.6	37	CCDS11136.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878432	0.72294	.	.	ENSG00000178921	ENST00000545834;ENST00000314666;ENST00000546020	T;T	0.68181	-0.31;0.44	5.68	4.72	0.59763	Glutamine amidotransferase type 1 (1);	0.058138	0.64402	N	0.000002	D	0.86932	0.6052	H	0.97186	3.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90273	0.4309	10	0.87932	D	0	-22.0096	12.2022	0.54333	0.0826:0.0:0.9174:0.0	.	1116;1116	A8K8N7;O15067	.;PUR4_HUMAN	S	692;1116;525	ENSP00000441706:G692S;ENSP00000313490:G1116S	ENSP00000313490:G1116S	G	+	1	0	PFAS	8111672	1.000000	0.71417	0.902000	0.35471	0.192000	0.23643	8.817000	0.91985	1.412000	0.46977	0.563000	0.77884	GGC	.		0.617	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2		
PLEKHM2	23207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	16059140	16059140	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr1:16059140C>T	ENST00000375799.3	+	19	3066	c.2839C>T	c.(2839-2841)Ccc>Tcc	p.P947S	PLEKHM2_ENST00000477849.1_3'UTR|RP11-288I21.1_ENST00000453804.1_RNA|PLEKHM2_ENST00000375793.2_Missense_Mutation_p.P927S	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	947					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GCTCCTCCCGCCCTGGGTCAT	0.622																																					p.P947S		.											.	PLEKHM2	23	0			c.C2839T						.						40.0	46.0	44.0					1																	16059140		1981	4175	6156	SO:0001583	missense	23207	exon19			CTCCCGCCCTGGG	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.2839C>T	1.37:g.16059140C>T	ENSP00000364956:p.Pro947Ser	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	10.0	NM_015164	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	ENST00000375799.3	37	CCDS44063.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107765	0.77096	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.48522	0.82;0.81	5.29	4.38	0.52667	.	0.063735	0.64402	D	0.000006	T	0.49253	0.1546	N	0.20986	0.625	0.53688	D	0.999975	D	0.63046	0.992	P	0.57283	0.817	T	0.53136	-0.8481	10	0.59425	D	0.04	-14.9992	14.1217	0.65192	0.0:0.8398:0.1602:0.0	.	947	Q8IWE5	PKHM2_HUMAN	S	947;927	ENSP00000364956:P947S;ENSP00000364950:P927S	ENSP00000364950:P927S	P	+	1	0	PLEKHM2	15931727	0.989000	0.36119	0.822000	0.32727	0.622000	0.37654	4.311000	0.59147	1.211000	0.43351	0.655000	0.94253	CCC	.		0.622	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164	
PLXDC2	84898	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	20432307	20432307	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr10:20432307A>C	ENST00000377252.4	+	5	1466	c.625A>C	c.(625-627)Agt>Cgt	p.S209R	PLXDC2_ENST00000377242.3_Missense_Mutation_p.S160R|PLXDC2_ENST00000377238.2_3'UTR	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	209					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						TTTCGATCCCAGTGTATCCAG	0.348																																					p.S209R		.											.	PLXDC2	93	0			c.A625C						.						153.0	146.0	148.0					10																	20432307		2203	4300	6503	SO:0001583	missense	84898	exon5			GATCCCAGTGTAT	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.625A>C	10.37:g.20432307A>C	ENSP00000366460:p.Ser209Arg	Somatic	79.0	1.0		WXS	Illumina HiSeq	Phase_I	112.0	15.0	NM_032812	Q96E59|Q96PD9|Q96SU9	Missense_Mutation	SNP	ENST00000377252.4	37	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.645094	0.87859	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	T;T	0.80909	-1.43;-1.43	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.86887	0.6041	L	0.55743	1.74	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	D	0.85192	0.1010	10	0.30854	T	0.27	.	15.8162	0.78604	1.0:0.0:0.0:0.0	.	160;209	Q6UX71-2;Q6UX71	.;PXDC2_HUMAN	R	209;160;72;195	ENSP00000366460:S209R;ENSP00000366450:S160R	ENSP00000366446:S72R	S	+	1	0	PLXDC2	20472313	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.268000	0.95675	2.138000	0.66242	0.460000	0.39030	AGT	.		0.348	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812	
RCC2	55920	broad.mit.edu;bcgsc.ca	37	1	17752173	17752173	+	Silent	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr1:17752173G>A	ENST00000375436.4	-	4	574	c.387C>T	c.(385-387)taC>taT	p.Y129Y	RCC2_ENST00000375433.3_Silent_p.Y129Y	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	129					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)			breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		CGAGATTGCGGTAAGCAGCTG	0.612																																					p.Y129Y		.											.	RCC2	90	0			c.C387T						.						27.0	29.0	28.0					1																	17752173		2202	4297	6499	SO:0001819	synonymous_variant	55920	exon3			ATTGCGGTAAGCA		CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.387C>T	1.37:g.17752173G>A		Somatic	131.0	2.0		WXS	Illumina HiSeq	Phase_I	139.0	42.0	NM_001136204	Q8IVL9|Q9BSN6|Q9NPV8	Silent	SNP	ENST00000375436.4	37	CCDS181.1																																																																																			.		0.612	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1	NM_018715	
PYHIN1	149628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	158908870	158908870	+	Splice_Site	SNP	A	A	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr1:158908870A>C	ENST00000368140.1	+	4	657	c.412A>C	c.(412-414)Aaa>Caa	p.K138Q	PYHIN1_ENST00000368138.3_Splice_Site_p.K129Q|PYHIN1_ENST00000392252.3_Splice_Site_p.K129Q|PYHIN1_ENST00000392254.2_Splice_Site_p.K138Q|PYHIN1_ENST00000368135.4_Splice_Site_p.K138Q	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	138					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					CTACTTGTAGAAAAGAAAAAA	0.363																																					p.K138Q		.											.	PYHIN1	94	0			c.A412C						.						36.0	38.0	37.0					1																	158908870		2203	4300	6503	SO:0001630	splice_region_variant	149628	exon4			TTGTAGAAAAGAA	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.412-1A>C	1.37:g.158908870A>C		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	17.0	NM_152501	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	A	11.98	1.800300	0.31869	.	.	ENSG00000163564	ENST00000458222;ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252;ENST00000368135	T;T;T;T;T;T	0.37915	1.17;3.3;3.32;3.32;3.33;1.29	2.27	1.12	0.20585	.	.	.	.	.	T	0.37972	0.1023	M	0.74881	2.28	0.09310	N	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.99	D;D;D;D;P	0.83275	0.994;0.982;0.996;0.991;0.844	T	0.09271	-1.0682	8	.	.	.	.	4.027	0.09692	0.8189:0.0:0.1811:0.0	.	129;138;129;138;138	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9;Q6K0P9-5	.;.;.;IFIX_HUMAN;.	Q	138;138;129;138;129;138	ENSP00000407616:K138Q;ENSP00000357122:K138Q;ENSP00000357120:K129Q;ENSP00000376083:K138Q;ENSP00000376082:K129Q;ENSP00000357117:K138Q	.	K	+	1	0	PYHIN1	157175494	0.999000	0.42202	0.071000	0.20095	0.008000	0.06430	0.994000	0.29693	0.305000	0.22832	0.455000	0.32223	AAA	.		0.363	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	Missense_Mutation
RPS6KA2	6196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	166912106	166912106	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr6:166912106C>T	ENST00000265678.4	-	8	860	c.637G>A	c.(637-639)Gac>Aac	p.D213N	RPS6KA2_ENST00000405189.3_Missense_Mutation_p.D124N|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.D221N|RPS6KA2_ENST00000481261.2_Missense_Mutation_p.D124N|RPS6KA2_ENST00000366863.2_Missense_Mutation_p.D59N|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.D238N	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	213	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		GCTCTCTTGTCGTGGTCAATG	0.602																																					p.D221N		.											.	RPS6KA2	1405	0			c.G661A						.						208.0	144.0	165.0					6																	166912106		2203	4300	6503	SO:0001583	missense	6196	exon9			TCTTGTCGTGGTC	L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.637G>A	6.37:g.166912106C>T	ENSP00000265678:p.Asp213Asn	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	6.0	NM_001006932	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	ENST00000265678.4	37	CCDS5294.1	.	.	.	.	.	.	.	.	.	.	C	32	5.127325	0.94473	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189;ENST00000366863;ENST00000507350	T;T;T;T;T;T;T	0.71934	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.61	4.99	4.99	0.66335	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61578	0.2358	N	0.11818	0.18	0.80722	D	1	B;B;D	0.89917	0.175;0.012;1.0	B;B;D	0.85130	0.025;0.005;0.997	T	0.60662	-0.7219	10	0.13853	T	0.58	.	17.6519	0.88167	0.0:1.0:0.0:0.0	.	238;221;213	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	N	213;238;221;124;124;59;124	ENSP00000265678:D213N;ENSP00000422435:D238N;ENSP00000427015:D221N;ENSP00000422484:D124N;ENSP00000386050:D124N;ENSP00000355828:D59N;ENSP00000422197:D124N	ENSP00000265678:D213N	D	-	1	0	RPS6KA2	166832096	1.000000	0.71417	0.988000	0.46212	0.996000	0.88848	7.193000	0.77780	2.461000	0.83175	0.655000	0.94253	GAC	.		0.602	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	38993172	38993172	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr19:38993172C>T	ENST00000359596.3	+	48	7640	c.7640C>T	c.(7639-7641)gCg>gTg	p.A2547V	RYR1_ENST00000360985.3_Missense_Mutation_p.A2547V|RYR1_ENST00000355481.4_Missense_Mutation_p.A2547V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2547	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACCGAGATGGCGCTGGCGCTG	0.657																																					p.A2547V		.											.	RYR1	100	0			c.C7640T						.						39.0	32.0	34.0					19																	38993172		2203	4299	6502	SO:0001583	missense	6261	exon48			AGATGGCGCTGGC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7640C>T	19.37:g.38993172C>T	ENSP00000352608:p.Ala2547Val	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	5.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867444	0.51588	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.91068	-2.78;-2.78;-2.78	3.97	3.97	0.46021	.	0.000000	0.64402	U	0.000003	D	0.95188	0.8440	M	0.82823	2.61	0.52501	D	0.999957	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.98	D	0.95903	0.8917	10	0.87932	D	0	.	15.3225	0.74132	0.0:1.0:0.0:0.0	.	2547;2547	P21817-2;P21817	.;RYR1_HUMAN	V	2547	ENSP00000352608:A2547V;ENSP00000347667:A2547V;ENSP00000354254:A2547V	ENSP00000347667:A2547V	A	+	2	0	RYR1	43685012	1.000000	0.71417	0.997000	0.53966	0.743000	0.42351	7.534000	0.82004	2.216000	0.71823	0.313000	0.20887	GCG	.		0.657	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
SCN10A	6336	broad.mit.edu;ucsc.edu	37	3	38791656	38791656	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr3:38791656T>C	ENST00000449082.2	-	12	1774	c.1775A>G	c.(1774-1776)aAg>aGg	p.K592R		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	592					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GAAAGTCTTCTTTTGTCCTGC	0.458																																					p.K592R		.											.	SCN10A	99	0			c.A1775G						.						134.0	118.0	124.0					3																	38791656		2203	4300	6503	SO:0001583	missense	6336	exon12			GTCTTCTTTTGTC	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.1775A>G	3.37:g.38791656T>C	ENSP00000390600:p.Lys592Arg	Somatic	66.0	1.0		WXS	Illumina HiSeq	Phase_I	64.0	11.0	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	T	4.995	0.184742	0.09495	.	.	ENSG00000185313	ENST00000449082	D	0.95724	-3.79	4.63	2.12	0.27331	.	2.339360	0.01581	N	0.021092	D	0.88440	0.6437	N	0.08118	0	0.23076	N	0.998336	B	0.06786	0.001	B	0.04013	0.001	T	0.79487	-0.1783	10	0.05721	T	0.95	.	9.5792	0.39477	0.0:0.0:0.3408:0.6592	.	592	Q9Y5Y9	SCNAA_HUMAN	R	592	ENSP00000390600:K592R	ENSP00000390600:K592R	K	-	2	0	SCN10A	38766660	0.968000	0.33430	0.171000	0.22900	0.533000	0.34776	1.372000	0.34261	0.252000	0.21531	0.533000	0.62120	AAG	.		0.458	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
SCUBE3	222663	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35210863	35210863	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr6:35210863C>A	ENST00000274938.7	+	15	1759	c.1759C>A	c.(1759-1761)Ctc>Atc	p.L587I	SCUBE3_ENST00000394681.1_Missense_Mutation_p.L603I	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						CCTGAAGATGCTCAGAAAGTC	0.627																																					p.L587I		.											.	SCUBE3	91	0			c.C1759A						.						57.0	57.0	57.0					6																	35210863		2203	4300	6503	SO:0001583	missense	222663	exon15			AAGATGCTCAGAA	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.1759C>A	6.37:g.35210863C>A	ENSP00000274938:p.Leu587Ile	Somatic	79.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	28.0	NM_152753		Missense_Mutation	SNP	ENST00000274938.7	37	CCDS4800.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447499	0.63178	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	D;D	0.85258	-1.55;-1.96	5.08	4.21	0.49690	.	0.136879	0.51477	D	0.000095	D	0.87136	0.6102	M	0.74467	2.265	0.54753	D	0.999983	D;P	0.56968	0.978;0.953	P;P	0.56343	0.796;0.551	D	0.87919	0.2702	10	0.52906	T	0.07	.	14.9886	0.71368	0.1437:0.8563:0.0:0.0	.	603;587	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	I	603;587	ENSP00000378174:L603I;ENSP00000274938:L587I	ENSP00000274938:L587I	L	+	1	0	SCUBE3	35318841	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	4.947000	0.63583	1.144000	0.42321	-0.158000	0.13435	CTC	.		0.627	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
SH3PXD2A	9644	broad.mit.edu;mdanderson.org	37	10	105362841	105362841	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr10:105362841A>T	ENST00000369774.4	-	15	2410	c.2134T>A	c.(2134-2136)Tcc>Acc	p.S712T	SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.S684T|SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.S579T|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.S547T			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	712	Ser-rich.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CTGGTTTTGGACAaggaagag	0.582																																					p.S684T		.											.	SH3PXD2A	226	0			c.T2050A						.						67.0	77.0	73.0					10																	105362841		2203	4300	6503	SO:0001583	missense	9644	exon14			TTTTGGACAAGGA	AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.2134T>A	10.37:g.105362841A>T	ENSP00000358789:p.Ser712Thr	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	5.0	NM_014631	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	ENST00000369774.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.342|4.342	0.062884|0.062884	0.08388|0.08388	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130|ENST00000420222	T;T;T;T|.	0.60672|.	0.28;0.17;0.41;0.2|.	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	0.225144|.	0.39146|.	N|.	0.001443|.	T|T	0.42921|0.42921	0.1224|0.1224	L|L	0.40543|0.40543	1.245|1.245	0.27482|0.27482	N|N	0.952541|0.952541	B;P;B;B|.	0.36282|.	0.189;0.546;0.361;0.287|.	B;B;B;B|.	0.32805|.	0.081;0.142;0.107;0.153|.	T|T	0.33445|0.33445	-0.9868|-0.9868	10|5	0.13108|.	T|.	0.6|.	-25.5352|-25.5352	13.4995|13.4995	0.61445|0.61445	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	712;561;557;684|.	Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3|.	SPD2A_HUMAN;.;.;.|.	T|D	712;684;519;627;579;547|638	ENSP00000358789:S712T;ENSP00000348215:S684T;ENSP00000443663:S579T;ENSP00000441514:S547T|.	ENSP00000318135:S519T|.	S|V	-|-	1|2	0|0	SH3PXD2A|SH3PXD2A	105352831|105352831	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.088000|0.088000	0.18126|0.18126	2.670000|2.670000	0.46833|0.46833	1.942000|1.942000	0.56320|0.56320	0.459000|0.459000	0.35465|0.35465	TCC|GTC	.		0.582	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631	
SIGLEC8	27181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51961351	51961351	+	Silent	SNP	T	T	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr19:51961351T>C	ENST00000321424.3	-	1	357	c.291A>G	c.(289-291)caA>caG	p.Q97Q	SIGLEC8_ENST00000430817.1_Silent_p.Q97Q|SIGLEC8_ENST00000597352.1_5'Flank|SIGLEC8_ENST00000340550.5_Silent_p.Q97Q	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	97	Ig-like V-type.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCCCAAGGAGTTGGAATCGGC	0.557																																					p.Q97Q		.											.	SIGLEC8	94	0			c.A291G						.						187.0	167.0	174.0					19																	51961351		2203	4300	6503	SO:0001819	synonymous_variant	27181	exon1			AAGGAGTTGGAAT	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.291A>G	19.37:g.51961351T>C		Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	24.0	NM_014442	Q7Z728	Silent	SNP	ENST00000321424.3	37	CCDS33086.1																																																																																			.		0.557	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
SLC15A2	6565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121630500	121630500	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr3:121630500C>A	ENST00000489711.1	+	4	803	c.415C>A	c.(415-417)Caa>Aaa	p.Q139K	SLC15A2_ENST00000295605.2_Intron	NM_021082.3	NP_066568.3	Q16348	S15A2_HUMAN	solute carrier family 15 (oligopeptide transporter), member 2	139					drug transport (GO:0015893)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|dipeptide transporter activity (GO:0042936)|high-affinity oligopeptide transporter activity (GO:0015334)|peptide:proton symporter activity (GO:0015333)			NS(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(17)|skin(6)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(114;0.0967)	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Fosinopril(DB00492)|Glyburide(DB01016)|Moexipril(DB00691)|Nateglinide(DB00731)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Tranexamic Acid(DB00302)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	ACTGGGAGGACAAGTGGTACA	0.398																																					p.Q139K		.											.	SLC15A2	91	0			c.C415A						.						184.0	147.0	160.0					3																	121630500		2203	4300	6503	SO:0001583	missense	6565	exon4			GGAGGACAAGTGG	BC044572	CCDS3007.1, CCDS54631.1	3q21.1	2013-07-18	2013-07-18		ENSG00000163406	ENSG00000163406		"""Solute carriers"""	10921	protein-coding gene	gene with protein product		602339	"""solute carrier family 15 (H+/peptide transporter), member 2"""			7756356	Standard	NM_021082		Approved	PEPT2	uc003eep.2	Q16348	OTTHUMG00000159423	ENST00000489711.1:c.415C>A	3.37:g.121630500C>A	ENSP00000417085:p.Gln139Lys	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	18.0	NM_021082	A8K1A5|B4E2A7	Missense_Mutation	SNP	ENST00000489711.1	37	CCDS3007.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.593473	0.00126	.	.	ENSG00000163406	ENST00000489711;ENST00000469013	T;T	0.58060	0.36;0.36	5.31	3.38	0.38709	Major facilitator superfamily domain, general substrate transporter (1);	1.306830	0.04625	N	0.402676	T	0.37489	0.1005	N	0.20574	0.59	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.14671	-1.0464	10	0.05620	T	0.96	2.9286	11.4056	0.49896	0.6409:0.359:0.0:0.0	.	139	Q16348	S15A2_HUMAN	K	139;77	ENSP00000417085:Q139K;ENSP00000418704:Q77K	ENSP00000418704:Q77K	Q	+	1	0	SLC15A2	123113190	0.997000	0.39634	0.147000	0.22382	0.056000	0.15407	2.674000	0.46867	0.686000	0.31488	-0.169000	0.13324	CAA	.		0.398	SLC15A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355239.1	NM_021082	
SLC6A19	340024	broad.mit.edu;bcgsc.ca	37	5	1219158	1219158	+	Silent	SNP	C	C	T	rs141604151		TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr5:1219158C>T	ENST00000304460.10	+	9	1370	c.1314C>T	c.(1312-1314)ggC>ggT	p.G438G		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	438					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			ACATGGAGGGCGTCGTTGTGC	0.587																																					p.G438G		.											.	SLC6A19	90	0			c.C1314T						.	C		0,4406		0,0,2203	318.0	250.0	273.0		1314	-8.6	0.4	5	dbSNP_134	273	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	SLC6A19	NM_001003841.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		438/635	1219158	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	340024	exon9			GGAGGGCGTCGTT	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1314C>T	5.37:g.1219158C>T		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	10.0	NM_001003841	A8K446	Silent	SNP	ENST00000304460.10	37	CCDS34130.1																																																																																			C|1.000;T|0.000		0.587	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
SLCO2B1	11309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	74880711	74880711	+	Splice_Site	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr11:74880711G>A	ENST00000289575.5	+	6	1078	c.683G>A	c.(682-684)gGg>gAg	p.G228E	SLCO2B1_ENST00000532236.1_Splice_Site_p.G112E|SLCO2B1_ENST00000428359.2_Splice_Site_p.G206E|SLCO2B1_ENST00000525650.1_Splice_Site_p.G84E|SLCO2B1_ENST00000341411.4_Intron|SLCO2B1_ENST00000531756.1_Intron|SLCO2B1_ENST00000454962.2_Intron|SLCO2B1_ENST00000526660.1_Intron	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	228					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	TGTGTTGTAGGGATCCTGTTT	0.567																																					p.G228E		.											.	SLCO2B1	154	0			c.G683A						.						118.0	119.0	119.0					11																	74880711		2200	4293	6493	SO:0001630	splice_region_variant	11309	exon6			TTGTAGGGATCCT	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.683-1G>A	11.37:g.74880711G>A		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	8.0	NM_007256	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	37	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.358214	0.61403	.	.	ENSG00000137491	ENST00000289575;ENST00000532236;ENST00000525650;ENST00000428359;ENST00000526839	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	4.9	4.9	0.64082	Major facilitator superfamily domain, general substrate transporter (1);	0.062800	0.64402	D	0.000005	T	0.77046	0.4073	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.83944	0.0313	9	.	.	.	.	15.6121	0.76733	0.0:0.0:1.0:0.0	.	84;228	E9PPU8;O94956	.;SO2B1_HUMAN	E	228;112;84;206;104	ENSP00000289575:G228E;ENSP00000434112:G112E;ENSP00000436324:G84E;ENSP00000388912:G206E;ENSP00000434742:G104E	.	G	+	2	0	SLCO2B1	74558359	1.000000	0.71417	0.992000	0.48379	0.651000	0.38670	5.782000	0.68973	2.521000	0.84997	0.650000	0.86243	GGG	.		0.567	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	Missense_Mutation
SMCO2	341346	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	27623645	27623645	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr12:27623645G>T	ENST00000535986.1	+	1	81	c.81G>T	c.(79-81)aaG>aaT	p.K27N	SMCO2_ENST00000298876.4_Missense_Mutation_p.K27N|SMCO2_ENST00000416383.1_Missense_Mutation_p.K27N			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2	27						integral component of membrane (GO:0016021)											AGCTGACTAAGAAAAACAATG	0.453																																					p.K27N		.											.	.	.	0			c.G81T						.						110.0	95.0	100.0					12																	27623645		692	1591	2283	SO:0001583	missense	0	exon2			GACTAAGAAAAAC		CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.81G>T	12.37:g.27623645G>T	ENSP00000441688:p.Lys27Asn	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	4.0	NM_001145010		Missense_Mutation	SNP	ENST00000535986.1	37	CCDS44852.1	.	.	.	.	.	.	.	.	.	.	G	7.882	0.730352	0.15507	.	.	ENSG00000165935	ENST00000298876;ENST00000416383;ENST00000535986	.	.	.	3.18	-1.08	0.09936	.	1.332910	0.05467	N	0.552419	T	0.25568	0.0622	N	0.14661	0.345	0.09310	N	1	B	0.18310	0.027	B	0.14023	0.01	T	0.30909	-0.9962	9	0.72032	D	0.01	0.2392	5.9488	0.19234	0.0:0.3433:0.3068:0.35	.	27	A6NFE2	CL070_HUMAN	N	27	.	ENSP00000298876:K27N	K	+	3	2	C12orf70	27514912	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.532000	0.23067	-0.220000	0.09988	-0.311000	0.09066	AAG	.		0.453	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402867.1	NM_001145010	
SPATA17	128153	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	217955552	217955552	+	Missense_Mutation	SNP	C	C	T	rs145142638	byFrequency	TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr1:217955552C>T	ENST00000366933.4	+	8	815	c.760C>T	c.(760-762)Cgc>Tgc	p.R254C	RP11-415L24.1_ENST00000415765.1_RNA	NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	254						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		ATTAGAACAACGCTACAGGCC	0.458																																					p.R254C		.											.	SPATA17	69	0			c.C760T						.	C	CYS/ARG	1,4405	4.2+/-10.8	0,1,2202	86.0	89.0	88.0		760	4.7	1.0	1	dbSNP_134	88	2,8596	2.2+/-6.3	0,2,4297	yes	missense	SPATA17	NM_138796.2	180	0,3,6499	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	254/362	217955552	3,13001	2203	4299	6502	SO:0001583	missense	128153	exon8			GAACAACGCTACA	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.760C>T	1.37:g.217955552C>T	ENSP00000355900:p.Arg254Cys	Somatic	221.0	0.0		WXS	Illumina HiSeq	Phase_I	290.0	17.0	NM_138796	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772117	0.90108	2.27E-4	2.33E-4	ENSG00000162814	ENST00000366933	T	0.57273	0.41	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.74809	0.3765	M	0.81942	2.565	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.79572	-0.1748	10	0.87932	D	0	-17.8856	18.0694	0.89400	0.0:1.0:0.0:0.0	.	254	Q96L03	SPT17_HUMAN	C	254	ENSP00000355900:R254C	ENSP00000355900:R254C	R	+	1	0	SPATA17	216022175	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	4.546000	0.60705	2.346000	0.79739	0.650000	0.86243	CGC	C|0.999;T|0.001		0.458	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796	
TADA2A	6871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	35804825	35804825	+	Silent	SNP	T	T	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr17:35804825T>C	ENST00000394395.2	+	8	732	c.559T>C	c.(559-561)Ttg>Ctg	p.L187L	TADA2A_ENST00000591992.1_3'UTR|TADA2A_ENST00000225396.6_Silent_p.L187L|TADA2A_ENST00000417170.1_Silent_p.L187L|TADA2A_ENST00000586023.1_Silent_p.L187L	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	187					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						AGAATGGGACTTGAGAGACAT	0.403																																					p.L187L		.											.	TADA2A	230	0			c.T559C						.						235.0	224.0	228.0					17																	35804825		2203	4300	6503	SO:0001819	synonymous_variant	6871	exon8			TGGGACTTGAGAG	AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.559T>C	17.37:g.35804825T>C		Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	21.0	NM_001488	A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Silent	SNP	ENST00000394395.2	37	CCDS11319.1																																																																																			.		0.403	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256677.3	NM_001488	
TENM2	57451	broad.mit.edu;mdanderson.org	37	5	167675304	167675304	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr5:167675304C>T	ENST00000518659.1	+	27	7399	c.7360C>T	c.(7360-7362)Ccc>Tcc	p.P2454S	TENM2_ENST00000520394.1_Missense_Mutation_p.P2215S|TENM2_ENST00000403607.2_Missense_Mutation_p.P2278S|TENM2_ENST00000519204.1_Missense_Mutation_p.P2333S|TENM2_ENST00000545108.1_Missense_Mutation_p.P2453S	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2454					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GGAGCCGGCCCCCTTTAACCT	0.512																																					p.P2445S		.											.	.	.	0			c.C7333T						.						61.0	61.0	61.0					5																	167675304		1939	4135	6074	SO:0001583	missense	57451	exon27			CCGGCCCCCTTTA	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.7360C>T	5.37:g.167675304C>T	ENSP00000429430:p.Pro2454Ser	Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	91.0	9.0	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	C	19.66	3.869621	0.72065	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89343	-2.02;-2.01;-2.13;-2.47;-2.5	4.95	4.95	0.65309	Rhs repeat-associated core (1);	0.000000	0.85682	D	0.000000	D	0.93262	0.7853	L	0.58428	1.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;0.999;0.994	D	0.92686	0.6162	10	0.42905	T	0.14	.	18.6074	0.91271	0.0:1.0:0.0:0.0	.	2453;2454;2215	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	S	2454;2453;2333;2215;2278	ENSP00000429430:P2454S;ENSP00000438635:P2453S;ENSP00000428964:P2333S;ENSP00000427874:P2215S;ENSP00000384905:P2278S	ENSP00000384905:P2278S	P	+	1	0	ODZ2	167607882	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.773000	0.85462	2.475000	0.83589	0.556000	0.70494	CCC	.		0.512	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TJP1	7082	ucsc.edu;bcgsc.ca	37	15	30010303	30010303	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr15:30010303T>C	ENST00000346128.6	-	22	4370	c.3896A>G	c.(3895-3897)aAa>aGa	p.K1299R	TJP1_ENST00000356107.6_Missense_Mutation_p.K1299R|TJP1_ENST00000400011.2_Missense_Mutation_p.K1223R|TJP1_ENST00000545208.2_Missense_Mutation_p.K1219R	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1299					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		ACCTGAAGGTTTAGATGCTAC	0.368																																					p.K1299R	Melanoma(77;681 1843 6309 6570)	.											.	TJP1	95	0			c.A3896G						.						201.0	188.0	192.0					15																	30010303		1837	4078	5915	SO:0001583	missense	7082	exon22			GAAGGTTTAGATG		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.3896A>G	15.37:g.30010303T>C	ENSP00000281537:p.Lys1299Arg	Somatic	105.0	1.0		WXS	Illumina HiSeq	.	134.0	30.0	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.536996	0.45176	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.12361	2.69;2.71	5.79	3.51	0.40186	.	0.342545	0.35067	N	0.003472	T	0.11324	0.0276	L	0.38838	1.175	0.80722	D	1	B;B;B;B	0.22746	0.074;0.056;0.004;0.069	B;B;B;B	0.23018	0.037;0.027;0.004;0.043	T	0.07829	-1.0752	10	0.48119	T	0.1	.	9.4824	0.38908	0.0:0.1412:0.0:0.8588	.	1292;1219;1299;1223	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	R	1299;1223;1299;1219;1219	ENSP00000281537:K1299R;ENSP00000382890:K1223R	ENSP00000281537:K1299R	K	-	2	0	TJP1	27797595	1.000000	0.71417	0.906000	0.35671	0.968000	0.65278	3.977000	0.56874	1.034000	0.39945	0.533000	0.62120	AAA	.		0.368	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
TMC6	11322	broad.mit.edu;bcgsc.ca	37	17	76120700	76120700	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr17:76120700G>C	ENST00000590602.1	-	8	955	c.796C>G	c.(796-798)Ctg>Gtg	p.L266V	TMC6_ENST00000592076.1_5'Flank|TMC6_ENST00000591436.1_5'Flank|TMC6_ENST00000322933.4_5'UTR|TMC6_ENST00000589553.1_Missense_Mutation_p.L39V|TMC6_ENST00000322914.3_Missense_Mutation_p.L266V|TMC6_ENST00000306591.7_Missense_Mutation_p.L266V|TMC6_ENST00000392467.3_Missense_Mutation_p.L266V			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	266				L -> P (in Ref. 2; AAP69874). {ECO:0000305}.	ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AAGGCCACCAGCAGCAGCAGC	0.672																																					p.L266V		.											.	TMC6	90	0			c.C796G						.						19.0	19.0	19.0					17																	76120700		2183	4244	6427	SO:0001583	missense	11322	exon8			CCACCAGCAGCAG	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.796C>G	17.37:g.76120700G>C	ENSP00000465261:p.Leu266Val	Somatic	60.0	1.0		WXS	Illumina HiSeq	Phase_I	91.0	6.0	NM_001127198	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	ENST00000590602.1	37	CCDS32748.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.650996	0.29336	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000306591	T;T;T	0.54279	0.58;0.58;0.58	3.64	1.38	0.22167	.	1.022600	0.07798	N	0.955959	T	0.53498	0.1800	L	0.53249	1.67	0.33038	D	0.531028	P;D;D;D;B	0.58268	0.713;0.981;0.981;0.982;0.23	B;P;P;P;B	0.57101	0.246;0.813;0.761;0.664;0.082	T	0.56974	-0.7890	10	0.06891	T	0.86	-10.1151	4.5808	0.12257	0.211:0.184:0.605:0.0	.	103;266;39;266;266	B4E003;Q7Z403-2;Q7Z403-4;B3KTU5;Q7Z403	.;.;.;.;TMC6_HUMAN	V	266	ENSP00000313408:L266V;ENSP00000376260:L266V;ENSP00000306405:L266V	ENSP00000306405:L266V	L	-	1	2	TMC6	73632295	0.228000	0.23718	0.981000	0.43875	0.146000	0.21551	0.651000	0.24873	0.497000	0.27926	0.462000	0.41574	CTG	.		0.672	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1		
TMEM200A	114801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	130761733	130761733	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr6:130761733C>T	ENST00000296978.3	+	3	1037	c.166C>T	c.(166-168)Cgg>Tgg	p.R56W	TMEM200A_ENST00000545622.1_Missense_Mutation_p.R56W|TMEM200A_ENST00000392429.1_Missense_Mutation_p.R56W	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	56						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		TGGCAAAATCCGGCTTTATTC	0.498																																					p.R56W		.											.	TMEM200A	23	0			c.C166T						.						134.0	133.0	133.0					6																	130761733		2203	4300	6503	SO:0001583	missense	114801	exon3			AAAATCCGGCTTT	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.166C>T	6.37:g.130761733C>T	ENSP00000296978:p.Arg56Trp	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	12.0	NM_001258277	Q96PX5	Missense_Mutation	SNP	ENST00000296978.3	37	CCDS5140.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169103	0.78339	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.45	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.69663	0.3136	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75233	-0.3390	9	0.87932	D	0	.	15.4391	0.75168	0.1402:0.8598:0.0:0.0	.	56	Q86VY9	T200A_HUMAN	W	56	.	ENSP00000296978:R56W	R	+	1	2	TMEM200A	130803426	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.923000	0.56469	1.250000	0.43966	0.650000	0.86243	CGG	.		0.498	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	NM_052913	
TRIM67	440730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	231349708	231349708	+	Silent	SNP	C	C	G			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr1:231349708C>G	ENST00000366653.5	+	9	2271	c.2271C>G	c.(2269-2271)ctC>ctG	p.L757L	TRIM67_ENST00000449018.3_Silent_p.L695L|TRIM67_ENST00000444294.3_Silent_p.L755L|TRIM67_ENST00000366652.2_Intron			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	757	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				CCCTCAGCCTCAACCGCAACG	0.622																																					p.L757L		.											.	TRIM67	229	0			c.C2271G						.						48.0	54.0	52.0					1																	231349708		2123	4222	6345	SO:0001819	synonymous_variant	440730	exon9			CAGCCTCAACCGC	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.2271C>G	1.37:g.231349708C>G		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	23.0	NM_001004342	Q5TER7|Q5TER8|Q7Z4K7	Silent	SNP	ENST00000366653.5	37	CCDS44333.1																																																																																			.		0.622	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342	
TRPM3	80036	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	73477842	73477842	+	Silent	SNP	G	G	A	rs145250735		TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr9:73477842G>A	ENST00000377111.2	-	3	687	c.444C>T	c.(442-444)ggC>ggT	p.G148G	TRPM3_ENST00000396285.1_5'Flank|TRPM3_ENST00000423814.3_Silent_p.G150G|TRPM3_ENST00000396283.1_5'UTR|TRPM3_ENST00000360823.2_5'UTR|TRPM3_ENST00000358082.3_5'Flank|TRPM3_ENST00000396280.5_5'Flank|TRPM3_ENST00000377105.1_5'UTR|TRPM3_ENST00000396292.4_5'Flank|TRPM3_ENST00000377101.1_5'UTR|TRPM3_ENST00000408909.2_5'Flank|TRPM3_ENST00000377097.3_5'UTR|TRPM3_ENST00000377110.3_Silent_p.G148G|TRPM3_ENST00000361823.5_5'UTR|TRPM3_ENST00000437699.3_5'UTR|TRPM3_ENST00000377106.1_5'UTR|TRPM3_ENST00000357533.2_Silent_p.G150G	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	148					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TGTTGGAATGGCCACCTCCTT	0.468																																					p.G148G		.											.	TRPM3	521	0			c.C444T						.						217.0	202.0	207.0					9																	73477842		2203	4300	6503	SO:0001819	synonymous_variant	80036	exon3			GGAATGGCCACCT	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.444C>T	9.37:g.73477842G>A		Somatic	174.0	1.0		WXS	Illumina HiSeq	Phase_I	191.0	25.0	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37		.	.	.	.	.	.	.	.	.	.	G	9.456	1.091807	0.20471	.	.	ENSG00000083067	ENST00000377097	.	.	.	5.95	3.05	0.35203	.	.	.	.	.	T	0.55194	0.1905	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48958	-0.8988	4	.	.	.	-15.6026	6.7636	0.23554	0.2604:0.1166:0.623:0.0	.	.	.	.	V	38	.	.	A	-	2	0	TRPM3	72667662	0.993000	0.37304	1.000000	0.80357	0.991000	0.79684	0.265000	0.18515	0.816000	0.34421	0.655000	0.94253	GCC	G|0.999;T|0.001		0.468	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
TTBK2	146057	broad.mit.edu;ucsc.edu;mdanderson.org	37	15	43164898	43164898	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr15:43164898G>A	ENST00000267890.6	-	3	236	c.128C>T	c.(127-129)aCc>aTc	p.T43I	TTBK2_ENST00000567840.1_Missense_Mutation_p.T43I|TTBK2_ENST00000567485.1_Intron|TTBK2_ENST00000567274.1_Missense_Mutation_p.T43I	NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	43	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		ATTTTCCCTGGTGAGCATGTC	0.418																																					p.T43I		.											.	TTBK2	338	0			c.C128T						.						117.0	107.0	110.0					15																	43164898		1886	4106	5992	SO:0001583	missense	146057	exon3			TCCCTGGTGAGCA	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.128C>T	15.37:g.43164898G>A	ENSP00000267890:p.Thr43Ile	Somatic	71.0	1.0		WXS	Illumina HiSeq	Phase_I	89.0	15.0	NM_173500	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	ENST00000267890.6	37	CCDS42029.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650755	0.67472	.	.	ENSG00000128881	ENST00000267890	T	0.23754	1.89	5.66	5.66	0.87406	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.50154	0.1599	M	0.79343	2.45	0.80722	D	1	P;P	0.46859	0.753;0.885	B;P	0.55011	0.187;0.766	T	0.51702	-0.8672	9	0.87932	D	0	.	19.7604	0.96314	0.0:0.0:1.0:0.0	.	43;43	Q6IQ55-3;Q6IQ55	.;TTBK2_HUMAN	I	43	ENSP00000267890:T43I	ENSP00000267890:T43I	T	-	2	0	TTBK2	40952190	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.013000	0.70776	2.675000	0.91044	0.655000	0.94253	ACC	.		0.418	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	NM_173500	
TUBB4A	10382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6495427	6495427	+	Silent	SNP	C	C	T	rs531220948		TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr19:6495427C>T	ENST00000264071.2	-	4	1454	c.1083G>A	c.(1081-1083)ctG>ctA	p.L361L	CTD-2396E7.9_ENST00000599292.1_RNA|CTD-2396E7.10_ENST00000596027.1_RNA|TUBB4A_ENST00000540257.1_Silent_p.L361L			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	361					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										CGGCCATCTTCAGGCCGCGGG	0.617																																					p.L361L		.											.	.	.	0			c.G1083A						.						172.0	151.0	158.0					19																	6495427		2203	4300	6503	SO:0001819	synonymous_variant	10382	exon4			CATCTTCAGGCCG	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.1083G>A	19.37:g.6495427C>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	10.0	NM_006087	B3KQP4|Q969E5	Silent	SNP	ENST00000264071.2	37	CCDS12168.1																																																																																			.		0.617	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
VPS13B	157680	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	100711796	100711796	+	Silent	SNP	G	G	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr8:100711796G>T	ENST00000358544.2	+	36	6276	c.6165G>T	c.(6163-6165)ctG>ctT	p.L2055L	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.L2030L	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2055					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAGCAAACCTGAGTTTCACCA	0.348																																					p.L2055L	Colon(161;2205 2542 7338 31318)	.											.	VPS13B	301	0			c.G6165T						.						51.0	55.0	54.0					8																	100711796		2202	4299	6501	SO:0001819	synonymous_variant	157680	exon36			AAACCTGAGTTTC	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.6165G>T	8.37:g.100711796G>T		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	6.0	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	CCDS6280.1																																																																																			.		0.348	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
XRN1	54464	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	142103424	142103424	+	Missense_Mutation	SNP	G	G	A	rs141258147		TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr3:142103424G>A	ENST00000264951.4	-	21	2560	c.2443C>T	c.(2443-2445)Cgt>Tgt	p.R815C	XRN1_ENST00000392981.2_Missense_Mutation_p.R815C	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	815					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TTCTCTAGACGAACTTCACCA	0.318																																					p.R815C		.											.	XRN1	93	0			c.C2443T						.	G	CYS/ARG,CYS/ARG	1,4403	2.1+/-5.4	0,1,2201	139.0	138.0	138.0		2443,2443	3.5	0.7	3	dbSNP_134	138	0,8594		0,0,4297	no	missense,missense	XRN1	NM_001042604.1,NM_019001.3	180,180	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	815/1694,815/1707	142103424	1,12997	2202	4297	6499	SO:0001583	missense	54464	exon21			CTAGACGAACTTC	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.2443C>T	3.37:g.142103424G>A	ENSP00000264951:p.Arg815Cys	Somatic	100.0	1.0		WXS	Illumina HiSeq	Phase_I	72.0	11.0	NM_001042604	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.380595	0.61845	2.27E-4	0.0	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.31769	1.48;1.48	5.3	3.47	0.39725	.	0.511281	0.22798	N	0.055508	T	0.20414	0.0491	N	0.14661	0.345	0.80722	D	1	B;P;P	0.52170	0.437;0.951;0.918	B;P;B	0.47162	0.039;0.54;0.339	T	0.03453	-1.1035	10	0.62326	D	0.03	-0.2423	5.4827	0.16733	0.2033:0.0:0.6401:0.1566	.	676;815;815	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	C	815	ENSP00000264951:R815C;ENSP00000376707:R815C	ENSP00000264951:R815C	R	-	1	0	XRN1	143586114	1.000000	0.71417	0.738000	0.30950	0.983000	0.72400	3.840000	0.55843	0.583000	0.29574	-0.157000	0.13467	CGT	G|1.000;A|0.000		0.318	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
YY1	7528	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	100705845	100705845	+	Silent	SNP	G	G	T			TCGA-ED-A66X-01A-11D-A30V-10	TCGA-ED-A66X-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	eb66e2cc-2bbc-465c-8778-a7920ea2c3bc	7b7ee2a3-d880-4f02-a19a-1c79c4b15239	g.chr14:100705845G>T	ENST00000262238.4	+	1	524	c.264G>T	c.(262-264)ccG>ccT	p.P88P	RP11-638I2.4_ENST00000554537.1_RNA	NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	88	Interaction with the SMAD1/SMAD4 complex.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				CTCTGCAGCCGCTGGTCACCG	0.736																																					p.P88P		.											.	YY1	226	0			c.G264T						.						24.0	19.0	21.0					14																	100705845		2182	4273	6455	SO:0001819	synonymous_variant	7528	exon1			GCAGCCGCTGGTC	BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.264G>T	14.37:g.100705845G>T		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	7.0	NM_003403	Q14935	Silent	SNP	ENST00000262238.4	37	CCDS9957.1																																																																																			.		0.736	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318277.1	NM_003403	
