#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCC10	89845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43401071	43401071	+	Missense_Mutation	SNP	G	G	A	rs367899886		TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr6:43401071G>A	ENST00000372530.4	+	3	1568	c.1353G>A	c.(1351-1353)atG>atA	p.M451I	ABCC10_ENST00000443426.2_3'UTR|ABCC10_ENST00000244533.3_Missense_Mutation_p.M408I	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	451	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	ACCAGGAAATGCTACAGCACA	0.597																																					p.M451I		.											.	ABCC10	96	0			c.G1353A						.	G	ILE/MET,ILE/MET	0,4406		0,0,2203	68.0	58.0	61.0		1353,1224	5.5	1.0	6		61	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ABCC10	NM_001198934.1,NM_033450.2	10,10	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	451/1493,408/1465	43401071	1,13005	2203	4300	6503	SO:0001583	missense	89845	exon3			GGAAATGCTACAG	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1353G>A	6.37:g.43401071G>A	ENSP00000361608:p.Met451Ile	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	8.0	NM_001198934	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202212	0.79127	0.0	1.16E-4	ENSG00000124574	ENST00000372515;ENST00000372530;ENST00000244533	D;D;D	0.89552	-2.53;-2.53;-2.53	5.5	5.5	0.81552	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.88592	0.6478	L	0.56199	1.76	0.80722	D	1	P;P	0.50617	0.937;0.81	P;B	0.54312	0.748;0.433	D	0.85384	0.1121	10	0.18276	T	0.48	-42.0023	19.3941	0.94598	0.0:0.0:1.0:0.0	.	408;451	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	I	7;451;408	ENSP00000361593:M7I;ENSP00000361608:M451I;ENSP00000244533:M408I	ENSP00000244533:M408I	M	+	3	0	ABCC10	43509049	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	9.869000	0.99810	2.593000	0.87608	0.650000	0.86243	ATG	.		0.597	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
ABR	29	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	909328	909328	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr17:909328C>T	ENST00000302538.5	-	23	2718	c.2572G>A	c.(2572-2574)Gac>Aac	p.D858N	ABR_ENST00000572441.1_Intron|ABR_ENST00000543210.2_Missense_Mutation_p.D309N|ABR_ENST00000536794.2_Missense_Mutation_p.D640N|ABR_ENST00000544583.2_Missense_Mutation_p.D812N|ABR_ENST00000574437.1_Missense_Mutation_p.D812N|ABR_ENST00000291107.2_Missense_Mutation_p.D821N	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	858					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GGCTACACGTCGGTGGAGAAG	0.602																																					p.D858N	Esophageal Squamous(197;2016 2115 4129 29033 46447)	.											.	ABR	91	0			c.G2572A						.						49.0	37.0	41.0					17																	909328		2196	4284	6480	SO:0001583	missense	29	exon23			ACACGTCGGTGGA	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.2572G>A	17.37:g.909328C>T	ENSP00000303909:p.Asp858Asn	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	8.0	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	ENST00000302538.5	37	CCDS10999.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039015	0.93630	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794;ENST00000543210	T;T;T;T;T	0.22539	1.96;1.99;1.95;3.19;2.92	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.30947	0.0781	N	0.24115	0.695	0.50467	D	0.999876	P;D;D;P;P	0.69078	0.944;0.994;0.997;0.944;0.602	P;P;P;P;B	0.60789	0.612;0.573;0.879;0.449;0.102	T	0.03739	-1.1008	10	0.66056	D	0.02	.	17.1025	0.86653	0.0:1.0:0.0:0.0	.	640;309;821;768;858	B7Z683;F5H3S2;Q12979-2;B7Z2X0;Q12979	.;.;.;.;ABR_HUMAN	N	858;812;821;640;309	ENSP00000303909:D858N;ENSP00000442048:D812N;ENSP00000291107:D821N;ENSP00000437429:D640N;ENSP00000445198:D309N	ENSP00000291107:D821N	D	-	1	0	ABR	856078	1.000000	0.71417	0.521000	0.27850	0.948000	0.59901	7.420000	0.80191	2.629000	0.89072	0.563000	0.77884	GAC	.		0.602	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
AHSA1	10598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	77931884	77931884	+	Silent	SNP	T	T	G			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr14:77931884T>G	ENST00000216479.3	+	6	724	c.564T>G	c.(562-564)gcT>gcG	p.A188A	AHSA1_ENST00000555457.1_Intron|SNORA46_ENST00000391069.1_RNA|AHSA1_ENST00000535854.2_Silent_p.A188A	NM_012111.2	NP_036243.1	O95433	AHSA1_HUMAN	AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)	188					positive regulation of ATPase activity (GO:0032781)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)			endometrium(1)|kidney(3)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		CTTCACAGGCTAAGCCTGCTC	0.443																																					p.A188A		.											.	AHSA1	226	0			c.T564G						.						99.0	90.0	93.0					14																	77931884		2203	4300	6503	SO:0001819	synonymous_variant	10598	exon6			ACAGGCTAAGCCT	AJ243310	CCDS9863.1	14q	2008-02-05	2003-04-04	2003-04-11		ENSG00000100591			1189	protein-coding gene	gene with protein product		608466	"""chromosome 14 open reading frame 3"""	C14orf3			Standard	NM_012111		Approved	p38	uc001xtw.3	O95433		ENST00000216479.3:c.564T>G	14.37:g.77931884T>G		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	7.0	NM_012111	B2R9L2|B4DUR9|Q96IL6|Q9P060	Silent	SNP	ENST00000216479.3	37	CCDS9863.1	.	.	.	.	.	.	.	.	.	.	T	5.905	0.350993	0.11182	.	.	ENSG00000100591	ENST00000553374	.	.	.	6.07	-3.06	0.05379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2836	3.3522	0.07156	0.1594:0.4833:0.1465:0.2107	.	.	.	.	E	134	.	.	X	+	1	0	AHSA1	77001637	0.019000	0.18553	0.209000	0.23619	0.287000	0.27160	-0.340000	0.07821	-0.420000	0.07427	-0.256000	0.11100	TAA	.		0.443	AHSA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414017.1	NM_012111	
ALDH1A2	8854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	58254254	58254254	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr15:58254254C>A	ENST00000249750.4	-	10	1974	c.1207G>T	c.(1207-1209)Gtg>Ttg	p.V403L	ALDH1A2_ENST00000558231.1_Missense_Mutation_p.V374L|ALDH1A2_ENST00000537372.1_Missense_Mutation_p.V382L|ALDH1A2_ENST00000559517.1_Missense_Mutation_p.V307L|ALDH1A2_ENST00000347587.3_Missense_Mutation_p.V365L	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	403					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	TTGGAAAACACTGTGGGCTCA	0.483																																					p.V403L		.											.	ALDH1A2	226	0			c.G1207T						.						118.0	113.0	115.0					15																	58254254		2192	4292	6484	SO:0001583	missense	8854	exon10			AAAACACTGTGGG	AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.1207G>T	15.37:g.58254254C>A	ENSP00000249750:p.Val403Leu	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	25.0	NM_003888	B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Missense_Mutation	SNP	ENST00000249750.4	37	CCDS10163.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977836	0.92982	.	.	ENSG00000128918	ENST00000249750;ENST00000430119;ENST00000543386;ENST00000347587;ENST00000537372	T;T;T	0.80304	-1.36;-1.36;-1.36	5.87	5.87	0.94306	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.85120	0.5624	L	0.45470	1.425	0.80722	D	1	P;P;D;P	0.60160	0.657;0.605;0.987;0.81	B;B;P;P	0.55391	0.246;0.159;0.775;0.511	D	0.85486	0.1182	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	374;382;365;403	B4DH89;F5H2Y9;O94788-2;O94788	.;.;.;AL1A2_HUMAN	L	403;307;374;365;382	ENSP00000249750:V403L;ENSP00000309623:V365L;ENSP00000438296:V382L	ENSP00000249750:V403L	V	-	1	0	ALDH1A2	56041546	1.000000	0.71417	0.973000	0.42090	0.635000	0.38103	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GTG	.		0.483	ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255869.1		
ANGPT1	284	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	108348431	108348431	+	5'UTR	SNP	C	C	G			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr8:108348431C>G	ENST00000520734.1	-	0	207				ANGPT1_ENST00000520052.1_5'UTR			Q15389	ANGP1_HUMAN	angiopoietin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			GAAGTTGCTTCTCTAGCTTGT	0.323																																					p.E174D		.											.	ANGPT1	521	0			c.G522C						.						123.0	114.0	117.0					8																	108348431		2203	4300	6503	SO:0001623	5_prime_UTR_variant	284	exon3			TTGCTTCTCTAGC	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.-79G>C	8.37:g.108348431C>G		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	32.0	NM_001199859	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	37		.	.	.	.	.	.	.	.	.	.	C	20.6	4.022044	0.75275	.	.	ENSG00000154188	ENST00000517746;ENST00000297450	T;T	0.51071	0.72;0.72	5.74	2.97	0.34412	.	0.000000	0.85682	D	0.000000	T	0.64349	0.2590	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.69142	0.962;0.962	T	0.65721	-0.6099	10	0.66056	D	0.02	.	9.3822	0.38320	0.0:0.6544:0.0:0.3456	.	174;174	Q5HYA0;Q15389	.;ANGP1_HUMAN	D	174	ENSP00000428340:E174D;ENSP00000297450:E174D	ENSP00000297450:E174D	E	-	3	2	ANGPT1	108417607	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.519000	0.45546	0.789000	0.33779	-0.136000	0.14681	GAG	.		0.323	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
AP2A2	161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	985500	985500	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr11:985500C>T	ENST00000448903.2	+	8	1021	c.880C>T	c.(880-882)Ccc>Tcc	p.P294S	AP2A2_ENST00000534328.1_Missense_Mutation_p.P294S|AP2A2_ENST00000332231.5_Missense_Mutation_p.P295S	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	294					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCAAGAACCGCCCAAGTCGAA	0.577																																					p.P295S		.											.	AP2A2	90	0			c.C883T						.						102.0	109.0	106.0					11																	985500		2111	4232	6343	SO:0001583	missense	161	exon8			GAACCGCCCAAGT	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.880C>T	11.37:g.985500C>T	ENSP00000413234:p.Pro294Ser	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	8.0	NM_001242837	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	ENST00000448903.2	37	CCDS44512.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098902	0.56183	.	.	ENSG00000183020	ENST00000534328;ENST00000417081;ENST00000448903;ENST00000332231;ENST00000448757;ENST00000329626	T;T;T	0.37915	1.17;1.17;1.17	3.89	3.89	0.44902	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52517	0.1739	L	0.42008	1.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.58736	-0.7584	10	0.87932	D	0	-26.413	16.2713	0.82622	0.0:1.0:0.0:0.0	.	295;294	O94973-2;O94973	.;AP2A2_HUMAN	S	294;294;294;295;295;167	ENSP00000436059:P294S;ENSP00000413234:P294S;ENSP00000327694:P295S	ENSP00000328024:P167S	P	+	1	0	AP2A2	975500	1.000000	0.71417	0.725000	0.30721	0.012000	0.07955	7.646000	0.83445	1.903000	0.55091	0.655000	0.94253	CCC	.		0.577	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385431.2	NM_012305	
C14orf37	145407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	58478850	58478850	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr14:58478850T>C	ENST00000267485.7	-	6	2302	c.2108A>G	c.(2107-2109)aAa>aGa	p.K703R		NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	703						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						GTCTTTTAATTTTTCCATCCA	0.279																																					p.K703R		.											.	C14orf37	90	0			c.A2108G						.						24.0	27.0	26.0					14																	58478850		2190	4286	6476	SO:0001583	missense	145407	exon6			TTTAATTTTTCCA		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.2108A>G	14.37:g.58478850T>C	ENSP00000267485:p.Lys703Arg	Somatic	446.0	0.0		WXS	Illumina HiSeq	Phase_I	573.0	89.0	NM_001001872	A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	ENST00000267485.7	37	CCDS32089.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171830	0.78452	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.35048	1.33	5.38	5.38	0.77491	.	0.154140	0.46758	D	0.000277	T	0.56804	0.2010	L	0.58101	1.795	0.39110	D	0.961454	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.62595	-0.6821	10	0.87932	D	0	-22.2224	14.9326	0.70929	0.0:0.0:0.0:1.0	.	741;703;703	B4DMS4;A8K990;Q86TY3	.;.;CN037_HUMAN	R	703;741	ENSP00000267485:K703R	ENSP00000267485:K703R	K	-	2	0	C14orf37	57548603	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.086000	0.64474	2.173000	0.68751	0.529000	0.55759	AAA	.		0.279	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412059.1	NM_001001872	
CDH23	64072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73330627	73330627	+	Silent	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr10:73330627C>A	ENST00000224721.6	+	7	725	c.720C>A	c.(718-720)atC>atA	p.I240I	CDH23_ENST00000299366.7_Silent_p.I280I|CDH23_ENST00000398809.4_Silent_p.I235I|CDH23_ENST00000398842.3_Silent_p.I235I|CDH23_ENST00000461841.3_Silent_p.I280I	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	235	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		P -> L (in DFNB12; dbSNP:rs121908354). {ECO:0000269|PubMed:17850630, ECO:0000269|PubMed:22899989, ECO:0000269|PubMed:24767429}.		calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						TGGACCCCATCTTCATCAACC	0.532											OREG0020254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I235I		.											.	CDH23	563	0			c.C705A						.						176.0	174.0	175.0					10																	73330627		2131	4252	6383	SO:0001819	synonymous_variant	64072	exon8			CCCCATCTTCATC	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.720C>A	10.37:g.73330627C>A		Somatic	105.0	0.0	1144	WXS	Illumina HiSeq	Phase_I	83.0	13.0	NM_052836	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	ENST00000224721.6	37																																																																																				.		0.532	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
CENPO	79172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	25016357	25016357	+	5'UTR	SNP	C	C	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr2:25016357C>T	ENST00000380834.2	+	0	344				PTRHD1_ENST00000487316.1_5'Flank|CENPO_ENST00000473706.1_Silent_p.L5L|PTRHD1_ENST00000328379.5_5'Flank|CENPO_ENST00000260662.1_5'UTR			Q9BU64	CENPO_HUMAN	centromere protein O						CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CGGGAATTCTCGCTTCTGGCC	0.617																																					p.L5L		.											.	CENPO	91	0			c.C15T						.						27.0	28.0	28.0					2																	25016357		876	1991	2867	SO:0001623	5_prime_UTR_variant	79172	exon1			AATTCTCGCTTCT	AK027859	CCDS1714.1, CCDS56113.1	2p23.3	2013-11-05			ENSG00000138092	ENSG00000138092			28152	protein-coding gene	gene with protein product		611504				16622420, 16622419	Standard	NM_024322		Approved	MGC11266, CENP-O	uc002rfp.2	Q9BU64	OTTHUMG00000125525	ENST00000380834.2:c.-82C>T	2.37:g.25016357C>T		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	24.0	NM_001199803	B2RDC0|D6W536|Q53T55|Q96JV3	Silent	SNP	ENST00000380834.2	37	CCDS1714.1																																																																																			.		0.617	CENPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246856.2	NM_024322	
CLIP1	6249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	122845703	122845703	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr12:122845703C>T	ENST00000540338.1	-	4	849	c.808G>A	c.(808-810)Ggc>Agc	p.G270S	CLIP1_ENST00000361654.4_Missense_Mutation_p.G270S|CLIP1_ENST00000545889.1_5'UTR|CLIP1_ENST00000537178.1_Missense_Mutation_p.G270S|CLIP1_ENST00000358808.2_Missense_Mutation_p.G270S|CLIP1_ENST00000302528.7_Missense_Mutation_p.G270S			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	270	CAP-Gly 2. {ECO:0000255|PROSITE- ProRule:PRU00045}.				microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GCGAACAAGCCATATTTGGGT	0.418																																					p.G270S		.											.	CLIP1	155	0			c.G808A						.						84.0	90.0	88.0					12																	122845703		2203	4300	6503	SO:0001583	missense	6249	exon5			ACAAGCCATATTT		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.808G>A	12.37:g.122845703C>T	ENSP00000439093:p.Gly270Ser	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	15.0	NM_002956	A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	37	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	C	34	5.364610	0.95877	.	.	ENSG00000130779	ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304;ENST00000537004	D;D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45;-2.45	5.32	5.32	0.75619	Cytoskeleton-associated protein, Gly-rich domain (4);	0.000000	0.85682	D	0.000000	D	0.97167	0.9074	H	0.98754	4.32	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98903	1.0777	10	0.87932	D	0	-14.504	18.9994	0.92828	0.0:1.0:0.0:0.0	.	270;270;270;270	F6VGP8;P30622-2;P30622-1;P30622	.;.;.;CLIP1_HUMAN	S	270;270;115;270;270;270;270	ENSP00000303585:G270S;ENSP00000351665:G270S;ENSP00000445531:G270S;ENSP00000439093:G270S;ENSP00000437786:G270S;ENSP00000441409:G270S	ENSP00000303585:G270S	G	-	1	0	CLIP1	121411656	1.000000	0.71417	0.997000	0.53966	0.960000	0.62799	7.818000	0.86416	2.486000	0.83907	0.561000	0.74099	GGC	.		0.418	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
COL12A1	1303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	75887438	75887438	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr6:75887438A>G	ENST00000322507.8	-	12	2687	c.2378T>C	c.(2377-2379)aTt>aCt	p.I793T	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.I793T|COL12A1_ENST00000483888.2_Missense_Mutation_p.I793T	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	793	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ATATTCAGGAATTACAGATAC	0.438																																					p.I793T		.											.	COL12A1	142	0			c.T2378C						.						238.0	232.0	234.0					6																	75887438		1871	4093	5964	SO:0001583	missense	1303	exon12			TCAGGAATTACAG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2378T>C	6.37:g.75887438A>G	ENSP00000325146:p.Ile793Thr	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	25.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	A	0.097	-1.157645	0.01686	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.52754	0.65;0.65;0.65	5.73	4.57	0.56435	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.157403	0.43260	N	0.000594	T	0.09423	0.0232	N	0.12746	0.255	0.09310	N	0.999997	B;B	0.11235	0.004;0.004	B;B	0.10450	0.005;0.005	T	0.30966	-0.9960	10	0.08599	T	0.76	.	9.5865	0.39519	0.859:0.0:0.141:0.0	.	793;793	D6RGG3;Q99715	.;COCA1_HUMAN	T	793	ENSP00000325146:I793T;ENSP00000412864:I793T;ENSP00000421216:I793T	ENSP00000325146:I793T	I	-	2	0	COL12A1	75944158	1.000000	0.71417	0.987000	0.45799	0.035000	0.12851	2.691000	0.47010	0.991000	0.38814	-0.263000	0.10527	ATT	.		0.438	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
CTNNBL1	56259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36470822	36470822	+	Splice_Site	SNP	G	G	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr20:36470822G>A	ENST00000361383.6	+	13	1509		c.e13+1		CTNNBL1_ENST00000473857.1_Splice_Site|CTNNBL1_ENST00000373473.1_Splice_Site|CTNNBL1_ENST00000373469.1_Splice_Site|CTNNBL1_ENST00000405275.2_Splice_Site	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1						apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				GGAAAAACACGTATGTATCCC	0.483																																					.	Ovarian(184;582 2038 3273 4106 42608)	.											.	CTNNBL1	228	0			c.1392+1G>A						.						189.0	139.0	156.0					20																	36470822		2203	4300	6503	SO:0001630	splice_region_variant	56259	exon13			AAACACGTATGTA	AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1392+1G>A	20.37:g.36470822G>A		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	17.0	NM_030877	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Splice_Site	SNP	ENST00000361383.6	37	CCDS13298.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126312	0.77549	.	.	ENSG00000132792	ENST00000361383;ENST00000405275;ENST00000373473;ENST00000373469	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8358	0.88696	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CTNNBL1	35904236	1.000000	0.71417	0.984000	0.44739	0.956000	0.61745	9.090000	0.94144	2.462000	0.83206	0.650000	0.86243	.	.		0.483	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877	Intron
CUX2	23316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	111655734	111655734	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr12:111655734A>T	ENST00000261726.6	+	3	369	c.215A>T	c.(214-216)cAa>cTa	p.Q72L	CUX2_ENST00000551604.2_3'UTR	NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	72					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						AAAAGCTTCCAAGCCGAGGTA	0.577																																					p.Q72L		.											.	CUX2	140	0			c.A215T						.						76.0	82.0	80.0					12																	111655734		1879	4099	5978	SO:0001583	missense	23316	exon3			GCTTCCAAGCCGA	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.215A>T	12.37:g.111655734A>T	ENSP00000261726:p.Gln72Leu	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	11.0	NM_015267	A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	CCDS41837.1	.	.	.	.	.	.	.	.	.	.	A	19.12	3.764998	0.69878	.	.	ENSG00000111249	ENST00000261726;ENST00000397643;ENST00000552889	T	0.50001	0.76	5.3	5.3	0.74995	.	0.515830	0.19381	N	0.115664	T	0.66346	0.2780	M	0.61703	1.905	0.53005	D	0.999967	D;D	0.89917	1.0;0.993	D;D	0.83275	0.996;0.977	T	0.68849	-0.5300	10	0.87932	D	0	-9.279	14.5312	0.67926	1.0:0.0:0.0:0.0	.	132;72	F5GWR6;O14529	.;CUX2_HUMAN	L	72;132;10	ENSP00000261726:Q72L	ENSP00000261726:Q72L	Q	+	2	0	CUX2	110140117	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.843000	0.86859	2.131000	0.65755	0.533000	0.62120	CAA	.		0.577	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
CWC27	10283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	64079679	64079679	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr5:64079679G>T	ENST00000381070.3	+	4	486	c.269G>T	c.(268-270)cGg>cTg	p.R90L	CWC27_ENST00000508024.1_Missense_Mutation_p.R90L	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	90	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.R90Q(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						TTTCATTCACGGTTGCGTTTT	0.418																																					p.R90L		.											.	CWC27	90	1	Substitution - Missense(1)	large_intestine(1)	c.G269T						.						193.0	187.0	189.0					5																	64079679		2203	4300	6503	SO:0001583	missense	10283	exon4			ATTCACGGTTGCG	AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.269G>T	5.37:g.64079679G>T	ENSP00000370460:p.Arg90Leu	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	18.0	NM_005869	O60529|O60530|Q96EM3	Missense_Mutation	SNP	ENST00000381070.3	37	CCDS3982.2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409288	0.83340	.	.	ENSG00000153015	ENST00000381070;ENST00000508024;ENST00000538793	T;T	0.22743	1.94;1.94	5.45	3.68	0.42216	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.45875	0.1364	M	0.78456	2.415	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.996;0.998	T	0.47471	-0.9115	10	0.87932	D	0	.	11.9914	0.53178	0.1377:0.0:0.8623:0.0	.	90;90;90;90	Q6UX04-2;Q6UX04;F5H636;D6REK3	.;CWC27_HUMAN;.;.	L	90	ENSP00000370460:R90L;ENSP00000426802:R90L	ENSP00000370460:R90L	R	+	2	0	CWC27	64115435	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.195000	0.94971	0.868000	0.35678	0.585000	0.79938	CGG	.		0.418	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157247.4	NM_005869	
DDX5	1655	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	62498310	62498310	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr17:62498310T>C	ENST00000225792.5	-	10	1527	c.1126A>G	c.(1126-1128)Agt>Ggt	p.S376G	DDX5_ENST00000578804.1_Missense_Mutation_p.S376G|MIR5047_ENST00000579212.1_RNA|MIR3064_ENST00000581130.1_RNA|DDX5_ENST00000580026.1_5'Flank|DDX5_ENST00000450599.2_Missense_Mutation_p.S297G	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	376	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TCTTGTTGACTCTTGTCACCA	0.393			T	ETV4	prostate																																p.S376G	NSCLC(22;406 813 4871 19580 40307)	.		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	.	DDX5	228	0			c.A1126G						.						58.0	55.0	56.0					17																	62498310		2203	4300	6503	SO:0001583	missense	1655	exon10			GTTGACTCTTGTC	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1126A>G	17.37:g.62498310T>C	ENSP00000225792:p.Ser376Gly	Somatic	82.0	1.0		WXS	Illumina HiSeq	Phase_I	125.0	16.0	NM_004396	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	ENST00000225792.5	37	CCDS11659.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.167848	0.57476	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	6.17	6.17	0.99709	Helicase, C-terminal (3);	0.034840	0.85682	D	0.000000	T	0.61640	0.2363	L	0.41415	1.275	0.80722	D	1	B;B;B	0.24963	0.06;0.115;0.115	B;B;B	0.35278	0.118;0.141;0.199	T	0.61113	-0.7128	9	0.87932	D	0	-22.7388	16.8222	0.85835	0.0:0.0:0.0:1.0	.	297;376;376	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	G	376;306;365	.	ENSP00000225792:S365G	S	-	1	0	DDX5	59928772	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.553000	0.82203	2.371000	0.80710	0.533000	0.62120	AGT	.		0.393	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	
DOCK8	81704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	371468	371468	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr9:371468G>T	ENST00000453981.1	+	17	2021	c.1909G>T	c.(1909-1911)Gct>Tct	p.A637S	DOCK8_ENST00000382331.1_Intron|DOCK8_ENST00000469391.1_Missense_Mutation_p.A569S|DOCK8_ENST00000432829.2_Missense_Mutation_p.A569S|DOCK8_ENST00000382329.1_Missense_Mutation_p.A104S			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	637	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TAAGCTCCCCGCTAAGCTCAC	0.418																																					p.A637S		.											.	DOCK8	517	0			c.G1909T						.						109.0	101.0	104.0					9																	371468		2203	4300	6503	SO:0001583	missense	81704	exon17			CTCCCCGCTAAGC	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.1909G>T	9.37:g.371468G>T	ENSP00000408464:p.Ala637Ser	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	20.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	G	33	5.221864	0.95139	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.14516	2.5;2.5;2.5;2.5	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.34745	0.0908	L	0.56769	1.78	0.80722	D	1	D;P;D	0.61697	0.99;0.903;0.973	D;P;P	0.65874	0.939;0.787;0.906	T	0.00180	-1.1948	10	0.33141	T	0.24	.	20.3409	0.98764	0.0:0.0:1.0:0.0	.	569;104;637	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	S	637;637;569;569;104	ENSP00000408464:A637S;ENSP00000394888:A569S;ENSP00000419438:A569S;ENSP00000371766:A104S	ENSP00000287364:A637S	A	+	1	0	DOCK8	361468	1.000000	0.71417	0.572000	0.28498	0.971000	0.66376	9.756000	0.98918	2.814000	0.96858	0.655000	0.94253	GCT	.		0.418	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
DDX58	23586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	32489378	32489378	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr9:32489378T>C	ENST00000379883.2	-	6	920	c.763A>G	c.(763-765)Atg>Gtg	p.M255V	DDX58_ENST00000379882.1_Missense_Mutation_p.M210V|DDX58_ENST00000545044.1_Missense_Mutation_p.M52V|DDX58_ENST00000379868.1_Missense_Mutation_p.M52V|DDX58_ENST00000542096.1_Missense_Mutation_p.M184V	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	255	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		TTTCCTTTCATAGCAGGCAAA	0.338																																					p.M255V		.											.	DDX58	230	0			c.A763G						.						141.0	125.0	130.0					9																	32489378		2203	4300	6503	SO:0001583	missense	23586	exon6			CTTTCATAGCAGG	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.763A>G	9.37:g.32489378T>C	ENSP00000369213:p.Met255Val	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	190.0	25.0	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	37	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	T	9.566	1.119783	0.20877	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096;ENST00000545044	T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53	4.99	-1.29	0.09288	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	1.278900	0.05219	N	0.508173	T	0.07279	0.0184	N	0.08118	0	0.09310	N	1	B;B;B;B	0.10296	0.001;0.003;0.002;0.001	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.39921	-0.9590	10	0.62326	D	0.03	-0.0574	5.7646	0.18219	0.3167:0.0:0.4129:0.2705	.	52;210;184;255	F5H5W6;O95786-2;B3KWW1;O95786	.;.;.;DDX58_HUMAN	V	210;255;52;184;52	ENSP00000369212:M210V;ENSP00000369213:M255V;ENSP00000369197:M52V;ENSP00000442160:M184V;ENSP00000443055:M52V	ENSP00000369197:M52V	M	-	1	0	DDX58	32479378	0.001000	0.12720	0.018000	0.16275	0.976000	0.68499	-0.619000	0.05572	0.022000	0.15160	0.533000	0.62120	ATG	.		0.338	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
DYNC2H1	79659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	103006470	103006470	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr11:103006470G>C	ENST00000375735.2	+	17	2511	c.2367G>C	c.(2365-2367)agG>agC	p.R789S	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.R789S|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	789	Stem. {ECO:0000250}.		R -> K (in dbSNP:rs7358374).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TACAATTCAGGCCCCCTTTTG	0.333																																					p.R789S		.											.	DYNC2H1	68	0			c.G2367C						.						37.0	34.0	35.0					11																	103006470		1788	4056	5844	SO:0001583	missense	79659	exon17			ATTCAGGCCCCCT	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.2367G>C	11.37:g.103006470G>C	ENSP00000364887:p.Arg789Ser	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	32.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763448	0.31228	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.28895	1.59;1.59	5.3	-0.564	0.11774	.	0.739342	0.11903	U	0.518428	T	0.24470	0.0593	L	0.60067	1.865	0.47476	D	0.999437	B;B	0.17667	0.023;0.019	B;B	0.17722	0.011;0.019	T	0.21655	-1.0239	10	0.07990	T	0.79	.	9.4185	0.38536	0.6089:0.0:0.3911:0.0	.	789;789	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	S	789	ENSP00000364887:R789S;ENSP00000381167:R789S	ENSP00000364887:R789S	R	+	3	2	DYNC2H1	102511680	0.968000	0.33430	0.997000	0.53966	0.987000	0.75469	0.155000	0.16362	-0.002000	0.14469	0.563000	0.77884	AGG	.		0.333	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
EMR3	84658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14748990	14748990	+	Missense_Mutation	SNP	C	C	T	rs553930762		TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr19:14748990C>T	ENST00000253673.5	-	11	1511	c.1411G>A	c.(1411-1413)Ggc>Agc	p.G471S	EMR3_ENST00000344373.4_Missense_Mutation_p.G419S|EMR3_ENST00000443157.2_Missense_Mutation_p.G345S|EMR3_ENST00000599900.1_Missense_Mutation_p.G256S	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	471					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						ACGCCATAGCCGACTGGGAAC	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21358	0.0		0.0	False		,,,				2504	0.0				p.G471S		.											.	EMR3	528	0			c.G1411A						.						184.0	143.0	157.0					19																	14748990		2203	4300	6503	SO:0001583	missense	84658	exon11			CATAGCCGACTGG	AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1411G>A	19.37:g.14748990C>T	ENSP00000253673:p.Gly471Ser	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	18.0	NM_032571		Missense_Mutation	SNP	ENST00000253673.5	37	CCDS12315.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.320316	0.60634	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	D;D;D	0.84516	-1.86;-1.86;-1.86	4.34	4.34	0.51931	GPCR, family 2-like (1);	.	.	.	.	D	0.92993	0.7770	M	0.89287	3.02	0.38781	D	0.95476	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.83275	0.954;0.975;0.996	D	0.94908	0.8062	9	0.72032	D	0.01	.	14.4024	0.67056	0.0:1.0:0.0:0.0	.	345;419;471	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	S	345;471;419	ENSP00000396208:G345S;ENSP00000253673:G471S;ENSP00000340758:G419S	ENSP00000253673:G471S	G	-	1	0	EMR3	14609990	1.000000	0.71417	0.959000	0.39883	0.064000	0.16182	6.088000	0.71371	2.245000	0.73994	0.650000	0.86243	GGC	.		0.537	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	NM_032571	
ENTPD6	955	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	25203506	25203506	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr20:25203506G>T	ENST00000376652.4	+	12	1241	c.1078G>T	c.(1078-1080)Gtg>Ttg	p.V360L	ENTPD6_ENST00000360031.2_Missense_Mutation_p.V359L|ENTPD6_ENST00000433259.2_Missense_Mutation_p.V326L|ENTPD6_ENST00000485936.1_3'UTR|ENTPD6_ENST00000354989.5_Missense_Mutation_p.V343L			O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6 (putative)	360					response to calcium ion (GO:0051592)|response to magnesium ion (GO:0032026)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	guanosine-5'-triphosphate,3'-diphosphate diphosphatase activity (GO:0008894)|nucleoside-triphosphatase activity (GO:0017111)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|prostate(1)|skin(1)	27						TGCTGCCAGAGTGTCAGAGGT	0.587																																					p.V360L		.											.	ENTPD6	90	0			c.G1078T						.						159.0	131.0	141.0					20																	25203506		2203	4300	6503	SO:0001583	missense	955	exon12			GCCAGAGTGTCAG	AF039916	CCDS13170.1, CCDS46586.1	20p11.21	2010-06-24	2010-06-24		ENSG00000197586	ENSG00000197586			3368	protein-coding gene	gene with protein product		603160	"""interleukin 6 signal transducer-2"""	CD39L2, IL6ST2		9676430	Standard	NM_001247		Approved	NTPDase-6, dJ738P15.3	uc002wuj.2	O75354	OTTHUMG00000032116	ENST00000376652.4:c.1078G>T	20.37:g.25203506G>T	ENSP00000365840:p.Val360Leu	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	12.0	NM_001247	A6NCX6|D3DW49|Q5QPJ2|Q5QPJ5|Q7Z5B5|Q8N3H3|Q8TAS7|Q9UJD1	Missense_Mutation	SNP	ENST00000376652.4	37	CCDS13170.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	12.41|12.41|12.41	1.929468|1.929468|1.929468	0.34096|0.34096|0.34096	.|.|.	.|.|.	ENSG00000197586|ENSG00000197586|ENSG00000197586	ENST00000433417;ENST00000447877|ENST00000376666|ENST00000354989;ENST00000360031;ENST00000525986;ENST00000376641;ENST00000376652;ENST00000433259	.|.|T;T;T;T	.|.|0.19806	.|.|2.68;2.68;2.68;2.12	5.67|5.67|5.67	3.73|3.73|3.73	0.42828|0.42828|0.42828	.|.|.	.|.|0.059782	.|.|0.64402	.|.|D	.|.|0.000002	T|T|T	0.33789|0.33789|0.33789	0.0875|0.0875|0.0875	M|M|M	0.84433|0.84433|0.84433	2.695|2.695|2.695	0.52501|0.52501|0.52501	D|D|D	0.99995|0.99995|0.99995	.|.|B;P;P;P;B;B;P;P	.|.|0.45474	.|.|0.093;0.859;0.553;0.488;0.337;0.29;0.46;0.46	.|.|B;P;B;B;B;B;B;B	.|.|0.46275	.|.|0.036;0.51;0.302;0.277;0.249;0.305;0.147;0.147	T|T|T	0.15206|0.15206|0.15206	-1.0445|-1.0445|-1.0445	5|5|10	.|.|0.36615	.|.|T	.|.|0.2	-17.3432|-17.3432|-17.3432	11.2278|11.2278|11.2278	0.48895|0.48895|0.48895	0.1499:0.0:0.8501:0.0|0.1499:0.0:0.8501:0.0|0.1499:0.0:0.8501:0.0	.|.|.	.|.|108;342;360;326;343;359;359;360	.|.|B4DHS2;B4DDM7;B4DNK6;Q5QPI9;O75354-2;D3DW49;Q5QPJ2;O75354	.|.|.;.;.;.;.;.;.;ENTP6_HUMAN	D|I|L	280;218|183|343;359;280;256;360;326	.|.|ENSP00000347084:V343L;ENSP00000353131:V359L;ENSP00000365840:V360L;ENSP00000401895:V326L	.|.|ENSP00000347084:V343L	E|S|V	+|+|+	3|2|1	2|0|0	ENTPD6|ENTPD6|ENTPD6	25151506|25151506|25151506	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.711000|0.711000|0.711000	0.30485|0.30485|0.30485	0.031000|0.031000|0.031000	0.12232|0.12232|0.12232	6.486000|6.486000|6.486000	0.73629|0.73629|0.73629	0.762000|0.762000|0.762000	0.33152|0.33152|0.33152	0.462000|0.462000|0.462000	0.41574|0.41574|0.41574	GAG|AGT|GTG	.		0.587	ENTPD6-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078414.2		
EWSR1	2130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	29695604	29695604	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr22:29695604G>T	ENST00000397938.2	+	16	2013	c.1694G>T	c.(1693-1695)aGa>aTa	p.R565I	EWSR1_ENST00000331029.7_Missense_Mutation_p.R527I|EWSR1_ENST00000332035.6_Missense_Mutation_p.R509I|EWSR1_ENST00000414183.2_Missense_Mutation_p.R570I|EWSR1_ENST00000332050.6_Missense_Mutation_p.R492I|EWSR1_ENST00000406548.1_Missense_Mutation_p.R564I	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	565	Arg/Gly/Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GATCGTGGCAGAGGTGGCCCT	0.617			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																p.R570I		.		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	.	EWSR1	3375	0			c.G1709T						.						89.0	73.0	78.0					22																	29695604		2203	4300	6503	SO:0001583	missense	2130	exon17			GTGGCAGAGGTGG		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1694G>T	22.37:g.29695604G>T	ENSP00000381031:p.Arg565Ile	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	21.0	NM_013986	B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	ENST00000397938.2	37	CCDS13851.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.91|15.91	2.971664|2.971664	0.53614|0.53614	.|.	.|.	ENSG00000182944|ENSG00000182944	ENST00000360091|ENST00000332050;ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000332035	.|D;D;D;D;D;D	.|0.97161	.|-4.19;-3.65;-3.78;-4.27;-3.79;-3.67	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|0.000000	.|0.85682	.|U	.|0.000000	D|D	0.94879|0.94879	0.8345|0.8345	L|L	0.50333|0.50333	1.59|1.59	0.58432|0.58432	D|D	0.999998|0.999998	.|B;B;B;B;B	.|0.30068	.|0.267;0.267;0.267;0.267;0.267	.|B;B;B;B;B	.|0.24541	.|0.054;0.054;0.054;0.037;0.037	D|D	0.94055|0.94055	0.7321|0.7321	5|10	.|0.66056	.|D	.|0.02	.|.	15.1429|15.1429	0.72623|0.72623	0.0:0.0:0.8583:0.1417|0.0:0.0:0.8583:0.1417	.|.	.|509;564;509;570;565	.|Q96MN4;Q96FE8;B0QYK1;Q96MX4;Q01844	.|.;.;.;.;EWS_HUMAN	H|I	216|492;565;564;527;570;509	.|ENSP00000330896:R492I;ENSP00000381031:R565I;ENSP00000385726:R564I;ENSP00000330516:R527I;ENSP00000400142:R570I;ENSP00000331699:R509I	.|ENSP00000330516:R527I	Q|R	+|+	3|2	2|0	EWSR1|EWSR1	28025604|28025604	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.890000|0.890000	0.51754|0.51754	4.766000|4.766000	0.62279|0.62279	2.423000|2.423000	0.82170|0.82170	0.313000|0.313000	0.20887|0.20887	CAG|AGA	.		0.617	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243	
FAF1	11124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	51323604	51323604	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr1:51323604T>A	ENST00000396153.2	-	2	562	c.111A>T	c.(109-111)ttA>ttT	p.L37F	FAF1_ENST00000371778.4_Missense_Mutation_p.L37F	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	37	UBA.				apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.0?(5)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		TACTTACCACTAAGTCCCAAT	0.294																																					p.L37F		.											.	FAF1	652	5	Whole gene deletion(5)	central_nervous_system(3)|thyroid(1)|haematopoietic_and_lymphoid_tissue(1)	c.A111T						.						84.0	84.0	84.0					1																	51323604		2202	4287	6489	SO:0001583	missense	11124	exon2			TACCACTAAGTCC	AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.111A>T	1.37:g.51323604T>A	ENSP00000379457:p.Leu37Phe	Somatic	223.0	0.0		WXS	Illumina HiSeq	Phase_I	260.0	42.0	NM_007051	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Missense_Mutation	SNP	ENST00000396153.2	37	CCDS554.1	.	.	.	.	.	.	.	.	.	.	T	16.96	3.266682	0.59540	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000371780;ENST00000543607	.	.	.	5.4	0.405	0.16361	.	0.267967	0.31636	N	0.007302	T	0.68952	0.3057	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.67833	-0.5568	9	0.87932	D	0	-19.6609	9.2373	0.37475	0.0:0.4175:0.0:0.5825	.	37	Q9UNN5	FAF1_HUMAN	F	37;37;29;37	.	ENSP00000360843:L37F	L	-	3	2	FAF1	51096192	1.000000	0.71417	0.999000	0.59377	0.781000	0.44180	0.902000	0.28459	0.070000	0.16634	-0.467000	0.05162	TTA	.		0.294	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021807.1	NM_007051	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152281994	152281994	+	Missense_Mutation	SNP	G	G	T	rs200622741		TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr1:152281994G>T	ENST00000368799.1	-	3	5403	c.5368C>A	c.(5368-5370)Caa>Aaa	p.Q1790K	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1790	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGGATCTTTGTCTTCCTCCA	0.602									Ichthyosis																												p.Q1790K		.											.	FLG	106	0			c.C5368A						.						227.0	234.0	232.0					1																	152281994		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ATCTTTGTCTTCC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5368C>A	1.37:g.152281994G>T	ENSP00000357789:p.Gln1790Lys	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	31.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	9.568	1.120337	0.20877	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.03330	3.97	4.33	4.33	0.51752	.	.	.	.	.	T	0.08891	0.0220	M	0.82923	2.615	0.09310	N	1	P	0.40332	0.713	P	0.54815	0.761	T	0.01583	-1.1319	9	0.62326	D	0.03	-0.7334	12.5761	0.56365	0.0:0.0:1.0:0.0	.	1790	P20930	FILA_HUMAN	K	1790;25	ENSP00000357789:Q1790K	ENSP00000271820:Q25K	Q	-	1	0	FLG	150548618	0.000000	0.05858	0.015000	0.15790	0.014000	0.08584	0.027000	0.13621	2.411000	0.81874	0.558000	0.71614	CAA	.		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
GPR112	139378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135441570	135441570	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chrX:135441570T>C	ENST00000394143.1	+	11	7391	c.7100T>C	c.(7099-7101)tTg>tCg	p.L2367S	GPR112_ENST00000287534.4_Intron|GPR112_ENST00000394141.1_Missense_Mutation_p.L2162S|GPR112_ENST00000412101.1_Missense_Mutation_p.L2162S|GPR112_ENST00000370652.1_Missense_Mutation_p.L2367S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2367					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CAAGATCAATTGACGTTATTA	0.338																																					p.L2367S		.											.	GPR112	183	0			c.T7100C						.						134.0	114.0	121.0					X																	135441570		2203	4300	6503	SO:0001583	missense	139378	exon11			ATCAATTGACGTT	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.7100T>C	X.37:g.135441570T>C	ENSP00000377699:p.Leu2367Ser	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	63.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	T	10.29	1.308371	0.23821	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000394141	T;T;T;T	0.44482	0.96;0.96;0.92;0.92	6.08	3.38	0.38709	.	.	.	.	.	T	0.39226	0.1070	N	0.08118	0	0.09310	N	1	D;D	0.71674	0.998;0.997	D;D	0.68943	0.961;0.957	T	0.13899	-1.0492	9	0.66056	D	0.02	.	6.8344	0.23927	0.0:0.2132:0.0:0.7867	.	2162;2367	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	S	2367;2367;2162;2162	ENSP00000377699:L2367S;ENSP00000359686:L2367S;ENSP00000416526:L2162S;ENSP00000377697:L2162S	ENSP00000359686:L2367S	L	+	2	0	GPR112	135269236	0.139000	0.22563	0.006000	0.13384	0.015000	0.08874	1.294000	0.33365	0.889000	0.36185	0.486000	0.48141	TTG	.		0.338	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
HEATR5B	54497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37295937	37295937	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr2:37295937C>T	ENST00000233099.5	-	8	1159	c.1064G>A	c.(1063-1065)cGa>cAa	p.R355Q	HEATR5B_ENST00000354531.2_Missense_Mutation_p.R355Q	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	355						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				GGAAACACATCGTCTGGAGTA	0.488																																					p.R355Q		.											.	HEATR5B	142	0			c.G1064A						.						86.0	76.0	79.0					2																	37295937		2203	4300	6503	SO:0001583	missense	54497	exon8			ACACATCGTCTGG	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.1064G>A	2.37:g.37295937C>T	ENSP00000233099:p.Arg355Gln	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	13.0	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.143512	0.77888	.	.	ENSG00000008869	ENST00000233099;ENST00000354531;ENST00000424416	T;T	0.08193	3.12;3.12	5.81	4.93	0.64822	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.09992	0.0245	L	0.49350	1.555	0.58432	D	0.999999	P	0.51057	0.941	B	0.38327	0.271	T	0.10497	-1.0627	10	0.37606	T	0.19	-11.206	16.8801	0.86060	0.0:0.8717:0.1283:0.0	.	355	Q9P2D3	HTR5B_HUMAN	Q	355	ENSP00000233099:R355Q;ENSP00000346531:R355Q	ENSP00000233099:R355Q	R	-	2	0	HEATR5B	37149441	1.000000	0.71417	0.996000	0.52242	0.961000	0.63080	4.899000	0.63245	1.445000	0.47624	0.655000	0.94253	CGA	.		0.488	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
HECW2	57520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	197081786	197081786	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr2:197081786C>A	ENST00000260983.3	-	27	4622	c.4440G>T	c.(4438-4440)tgG>tgT	p.W1480C	HECW2_ENST00000409111.1_Missense_Mutation_p.W1124C|snoU13_ENST00000459047.1_RNA	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1480	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CAGCCCAGAACCACCGAATTA	0.348																																					p.W1480C		.											.	HECW2	668	0			c.G4440T						.						175.0	163.0	167.0					2																	197081786		2203	4300	6503	SO:0001583	missense	57520	exon27			CCAGAACCACCGA	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4440G>T	2.37:g.197081786C>A	ENSP00000260983:p.Trp1480Cys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	18.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335301	0.81801	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.49432	0.78;0.78	4.85	4.85	0.62838	HECT (4);	0.060243	0.64402	D	0.000001	T	0.76133	0.3945	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82176	-0.0587	10	0.87932	D	0	.	18.535	0.91008	0.0:1.0:0.0:0.0	.	1480	Q9P2P5	HECW2_HUMAN	C	1124;1480	ENSP00000386775:W1124C;ENSP00000260983:W1480C	ENSP00000260983:W1480C	W	-	3	0	HECW2	196790031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.272000	0.78516	2.674000	0.91012	0.655000	0.94253	TGG	.		0.348	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
HELZ2	85441	broad.mit.edu;bcgsc.ca	37	20	62194883	62194883	+	Silent	SNP	C	C	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr20:62194883C>T	ENST00000467148.1	-	8	5361	c.5292G>A	c.(5290-5292)acG>acA	p.T1764T	HELZ2_ENST00000427522.2_Silent_p.T1195T	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1764					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GGTCAGGCAGCGTCTCCCGGT	0.741																																					p.T1764T		.											.	.	.	0			c.G5292A						.						5.0	8.0	7.0					20																	62194883		2050	4083	6133	SO:0001819	synonymous_variant	85441	exon9			AGGCAGCGTCTCC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.5292G>A	20.37:g.62194883C>T		Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	6.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			.		0.741	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	185902929	185902929	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr1:185902929G>A	ENST00000271588.4	+	11	2030	c.1801G>A	c.(1801-1803)Gcc>Acc	p.A601T	HMCN1_ENST00000367492.2_Missense_Mutation_p.A601T	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	601	Ig-like C2-type 2.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGGATCATCAGCCGCTTCAGT	0.398																																					p.A601T		.											.	HMCN1	113	0			c.G1801A						.						149.0	147.0	147.0					1																	185902929		2203	4300	6503	SO:0001583	missense	83872	exon11			TCATCAGCCGCTT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1801G>A	1.37:g.185902929G>A	ENSP00000271588:p.Ala601Thr	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	10.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	1.786	-0.480608	0.04383	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.63580	-0.05;-0.05	5.67	0.0917	0.14469	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.484771	0.23805	N	0.044397	T	0.28466	0.0704	N	0.04636	-0.2	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.16012	-1.0417	10	0.09590	T	0.72	.	4.2845	0.10848	0.3279:0.0:0.427:0.2451	.	601	Q96RW7	HMCN1_HUMAN	T	601	ENSP00000271588:A601T;ENSP00000356462:A601T	ENSP00000271588:A601T	A	+	1	0	HMCN1	184169552	0.000000	0.05858	0.075000	0.20258	0.215000	0.24574	-0.182000	0.09726	0.318000	0.23185	0.655000	0.94253	GCC	.		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HTR3C	170572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	183772621	183772621	+	Nonsense_Mutation	SNP	C	C	A	rs180785188	byFrequency	TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr3:183772621C>A	ENST00000318351.1	+	2	214	c.180C>A	c.(178-180)taC>taA	p.Y60*		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	60					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	TCACCAACTACAGCATCCCTA	0.502																																					p.Y60X		.											.	HTR3C	154	0			c.C180A						.						150.0	123.0	132.0					3																	183772621		2203	4300	6503	SO:0001587	stop_gained	170572	exon2			CAACTACAGCATC	AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	ENST00000318351.1:c.180C>A	3.37:g.183772621C>A	ENSP00000322617:p.Tyr60*	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	16.0	NM_130770	A2RRR5	Nonsense_Mutation	SNP	ENST00000318351.1	37	CCDS3250.1	.	.	.	.	.	.	.	.	.	.	.	19.11	3.763495	0.69763	.	.	ENSG00000178084	ENST00000318351	.	.	.	4.43	3.53	0.40419	.	1.328610	0.04740	N	0.422591	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.3392	10.8101	0.46543	0.0:0.6269:0.3731:0.0	.	.	.	.	X	60	.	ENSP00000322617:Y60X	Y	+	3	2	HTR3C	185255315	0.201000	0.23410	0.058000	0.19502	0.777000	0.43975	0.731000	0.26058	1.041000	0.40125	0.561000	0.74099	TAC	C|0.999;T|0.001		0.502	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346296.1	NM_130770	
IGFN1	91156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201196308	201196308	+	Silent	SNP	A	A	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr1:201196308A>T	ENST00000335211.4	+	23	11215	c.11085A>T	c.(11083-11085)gcA>gcT	p.A3695A	IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1238						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGGGCCAGGCAGTCAGCACTG	0.637																																					p.A3695A		.											.	IGFN1	71	0			c.A11085T						.						35.0	22.0	26.0					1																	201196308		2201	4299	6500	SO:0001819	synonymous_variant	91156	exon23			CCAGGCAGTCAGC	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.11085A>T	1.37:g.201196308A>T		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	17.0	NM_001164586	F8WAI1|Q9NT72	Silent	SNP	ENST00000335211.4	37	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	A	0.379	-0.929845	0.02359	.	.	ENSG00000163395	ENST00000412892	.	.	.	5.19	-10.4	0.00318	.	.	.	.	.	T	0.33265	0.0857	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	T	0.39961	-0.9588	4	.	.	.	.	2.2452	0.04030	0.1875:0.4022:0.1592:0.2512	.	.	.	.	C	1113	.	.	S	+	1	0	IGFN1	199462931	0.000000	0.05858	0.047000	0.18901	0.028000	0.11728	-7.115000	0.00044	-2.294000	0.00663	-1.392000	0.01152	AGT	.		0.637	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
KCNH5	27133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	63468076	63468076	+	Missense_Mutation	SNP	G	G	T	rs527943803		TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr14:63468076G>T	ENST00000322893.7	-	4	674	c.406C>A	c.(406-408)Cag>Aag	p.Q136K	KCNH5_ENST00000394964.2_Missense_Mutation_p.Q78K|KCNH5_ENST00000394968.1_Missense_Mutation_p.Q78K|KCNH5_ENST00000420622.2_Missense_Mutation_p.Q136K	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	136	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TCTATTGGCTGTTTGAACAAC	0.338																																					p.Q136K		.											.	KCNH5	98	0			c.C406A						.						110.0	99.0	103.0					14																	63468076		2203	4300	6503	SO:0001583	missense	27133	exon4			TTGGCTGTTTGAA	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.406C>A	14.37:g.63468076G>T	ENSP00000321427:p.Gln136Lys	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	16.0	NM_172375	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322019	0.81580	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	D;D;D;D	0.98947	-5.26;-5.06;-5.03;-5.04	5.64	5.64	0.86602	PAS-associated, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98686	0.9559	M	0.74881	2.28	0.80722	D	1	B;P;P;D	0.56035	0.188;0.739;0.739;0.974	B;B;B;P	0.55615	0.074;0.259;0.259;0.78	D	0.98760	1.0724	10	0.25106	T	0.35	.	19.7059	0.96071	0.0:0.0:1.0:0.0	.	78;78;136;136	Q86XI1;Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;.;KCNH5_HUMAN	K	136;136;78;78	ENSP00000321427:Q136K;ENSP00000395439:Q136K;ENSP00000378419:Q78K;ENSP00000378415:Q78K	ENSP00000321427:Q136K	Q	-	1	0	KCNH5	62537829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.673000	0.90976	0.591000	0.81541	CAG	.		0.338	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
KIAA1211	57482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	57180856	57180856	+	Silent	SNP	G	G	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr4:57180856G>A	ENST00000504228.1	+	6	1293	c.1188G>A	c.(1186-1188)gcG>gcA	p.A396A	KIAA1211_ENST00000541073.1_Silent_p.A389A|KIAA1211_ENST00000264229.6_Silent_p.A396A			Q6ZU35	K1211_HUMAN	KIAA1211	396	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					ggcggggcgcggaggaggagg	0.687																																					p.A396A		.											.	KIAA1211	70	0			c.G1188A						.						9.0	11.0	10.0					4																	57180856		1922	4039	5961	SO:0001819	synonymous_variant	57482	exon8			GGGCGCGGAGGAG	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1188G>A	4.37:g.57180856G>A		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	15.0	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	37	CCDS43230.1																																																																																			.		0.687	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
KIAA1524	57650	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	108281998	108281998	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr3:108281998G>C	ENST00000295746.8	-	13	1685	c.1609C>G	c.(1609-1611)Cca>Gca	p.P537A	KIAA1524_ENST00000491772.1_Missense_Mutation_p.P378A|KIAA1524_ENST00000487834.1_5'UTR	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	537					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P537S(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCTGGCAGTGGAGCAGCCTCC	0.403																																					p.P537A		.											.	KIAA1524	92	1	Substitution - Missense(1)	kidney(1)	c.C1609G						.						148.0	151.0	150.0					3																	108281998		2203	4300	6503	SO:0001583	missense	57650	exon13			GCAGTGGAGCAGC	AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.1609C>G	3.37:g.108281998G>C	ENSP00000295746:p.Pro537Ala	Somatic	174.0	1.0		WXS	Illumina HiSeq	Phase_I	200.0	34.0	NM_020890	A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	ENST00000295746.8	37	CCDS33812.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.558597	0.86231	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	T;T	0.70282	-0.47;-0.47	5.62	5.62	0.85841	.	0.048819	0.85682	D	0.000000	D	0.82926	0.5143	M	0.64997	1.995	0.80722	D	1	D	0.71674	0.998	D	0.71184	0.972	D	0.83423	0.0034	10	0.62326	D	0.03	-11.6132	19.6484	0.95791	0.0:0.0:1.0:0.0	.	537	Q8TCG1	CIP2A_HUMAN	A	378;537	ENSP00000419487:P378A;ENSP00000295746:P537A	ENSP00000295746:P537A	P	-	1	0	KIAA1524	109764688	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.852000	0.75430	2.646000	0.89796	0.557000	0.71058	CCA	.		0.403	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353975.2	NM_020890	
KIAA1549	57670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	138603314	138603314	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr7:138603314G>A	ENST00000422774.1	-	2	1106	c.1058C>T	c.(1057-1059)gCa>gTa	p.A353V	KIAA1549_ENST00000440172.1_Missense_Mutation_p.A353V|KIAA1549_ENST00000242365.4_Missense_Mutation_p.A303V			Q9HCM3	K1549_HUMAN	KIAA1549	353						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CCTGCTGAATGCAAGGGCTGC	0.488			O	BRAF	pilocytic astrocytoma																																p.A353V	NSCLC(119;1534 1718 44213 46230 50068)	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549	369	0			c.C1058T						.						193.0	203.0	200.0					7																	138603314		2164	4259	6423	SO:0001583	missense	57670	exon2			CTGAATGCAAGGG		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1058C>T	7.37:g.138603314G>A	ENSP00000416040:p.Ala353Val	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	9.0	NM_020910	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	G	9.553	1.116425	0.20795	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.26518	1.73;1.74;1.74	4.56	1.7	0.24286	.	0.463200	0.18261	N	0.146605	T	0.15825	0.0381	L	0.27053	0.805	0.09310	N	1	B;B	0.12630	0.006;0.002	B;B	0.15052	0.005;0.012	T	0.18398	-1.0338	10	0.51188	T	0.08	.	6.4708	0.22007	0.0777:0.1288:0.659:0.1345	.	353;353	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	V	353;303;353	ENSP00000406661:A353V;ENSP00000242365:A303V;ENSP00000416040:A353V	ENSP00000242365:A303V	A	-	2	0	KIAA1549	138253854	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.055000	0.11807	-0.059000	0.13154	-1.471000	0.01009	GCA	.		0.488	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
KIF14	9928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200562884	200562884	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr1:200562884A>C	ENST00000367350.4	-	15	3001	c.2563T>G	c.(2563-2565)Ttt>Gtt	p.F855V		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	855	FHA.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						GTCCCACCAAAATTTTTGATA	0.333																																					p.F855V		.											.	KIF14	140	0			c.T2563G						.						135.0	126.0	129.0					1																	200562884		2203	4300	6503	SO:0001583	missense	9928	exon15			CACCAAAATTTTT	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.2563T>G	1.37:g.200562884A>C	ENSP00000356319:p.Phe855Val	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	14.0	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	37	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	A	5.104	0.204786	0.09704	.	.	ENSG00000118193	ENST00000367350	D	0.86366	-2.11	5.15	4.01	0.46588	Forkhead-associated (FHA) domain (3);SMAD/FHA domain (1);	0.323428	0.29924	N	0.010856	T	0.68357	0.2992	N	0.04768	-0.165	0.22728	N	0.998803	B	0.02656	0.0	B	0.09377	0.004	T	0.52845	-0.8521	10	0.14656	T	0.56	.	5.6288	0.17497	0.4903:0.258:0.0:0.2518	.	855	Q15058	KIF14_HUMAN	V	855	ENSP00000356319:F855V	ENSP00000356319:F855V	F	-	1	0	KIF14	198829507	0.016000	0.18221	0.072000	0.20136	0.694000	0.40290	0.195000	0.17155	0.770000	0.33336	0.460000	0.39030	TTT	.		0.333	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
KLHL35	283212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	75134789	75134789	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr11:75134789A>T	ENST00000539798.1	-	5	1509	c.1510T>A	c.(1510-1512)Tat>Aat	p.Y504N	KLHL35_ENST00000376292.4_Missense_Mutation_p.Y284N	NM_001039548.2	NP_001034637.2	Q6PF15	KLH35_HUMAN	kelch-like family member 35	504										lung(2)|stomach(1)	3						CCTGGATCATAGGTGAAGATT	0.587																																					p.Y504N	Colon(77;683 1691 18820 23811)	.											.	.	.	0			c.T1510A						.						125.0	132.0	130.0					11																	75134789		1988	4161	6149	SO:0001583	missense	283212	exon5			GATCATAGGTGAA		CCDS44685.1, CCDS44685.2	11q13.4	2013-02-22	2013-02-22		ENSG00000149243	ENSG00000149243		"""Kelch-like"", ""BTB/POZ domain containing"""	26597	protein-coding gene	gene with protein product			"""kelch-like 35 (Drosophila)"""				Standard	NM_001039548		Approved	FLJ33790	uc001owm.2	Q6PF15	OTTHUMG00000133573	ENST00000539798.1:c.1510T>A	11.37:g.75134789A>T	ENSP00000438526:p.Tyr504Asn	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	9.0	NM_001039548	A2RU06|F5H412|Q86XM7|Q8NBB1	Missense_Mutation	SNP	ENST00000539798.1	37	CCDS44685.2	.	.	.	.	.	.	.	.	.	.	A	24.2	4.503140	0.85176	.	.	ENSG00000149243	ENST00000376292;ENST00000539798	T;T	0.74106	-0.81;-0.81	5.12	5.12	0.69794	Kelch-type beta propeller (1);	0.082416	0.50627	D	0.000118	D	0.89199	0.6647	H	0.94345	3.525	0.58432	D	0.999997	D	0.76494	0.999	D	0.76071	0.987	D	0.91799	0.5450	10	0.87932	D	0	.	12.9174	0.58213	1.0:0.0:0.0:0.0	.	284	Q6PF15	KLH35_HUMAN	N	284;504	ENSP00000365469:Y284N;ENSP00000438526:Y504N	ENSP00000365469:Y284N	Y	-	1	0	KLHL35	74812437	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	7.159000	0.77483	2.152000	0.67230	0.528000	0.53228	TAT	.		0.587	KLHL35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173583	
LCA5	167691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	80197406	80197406	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr6:80197406T>C	ENST00000392959.1	-	9	2020	c.1409A>G	c.(1408-1410)aAa>aGa	p.K470R	LCA5_ENST00000369846.4_Missense_Mutation_p.K470R	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	470					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		TTCATTCAGTTTAGCAAGTAG	0.373																																					p.K470R		.											.	LCA5	90	0			c.A1409G						.						140.0	140.0	140.0					6																	80197406		2203	4300	6503	SO:0001583	missense	167691	exon8			TTCAGTTTAGCAA		CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.1409A>G	6.37:g.80197406T>C	ENSP00000376686:p.Lys470Arg	Somatic	242.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	49.0	NM_001122769	E1P542|Q9BWX7	Missense_Mutation	SNP	ENST00000392959.1	37	CCDS4990.1	.	.	.	.	.	.	.	.	.	.	T	16.75	3.208625	0.58343	.	.	ENSG00000135338	ENST00000369846;ENST00000392959	T;T	0.51325	0.71;0.71	5.94	5.94	0.96194	.	0.053073	0.64402	D	0.000001	T	0.60792	0.2296	M	0.66939	2.045	0.42502	D	0.99293	D	0.89917	1.0	D	0.87578	0.998	T	0.65311	-0.6199	10	0.66056	D	0.02	-28.0041	15.5756	0.76380	0.0:0.0:0.0:1.0	.	470	Q86VQ0	LCA5_HUMAN	R	470	ENSP00000358861:K470R;ENSP00000376686:K470R	ENSP00000358861:K470R	K	-	2	0	LCA5	80254125	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	3.191000	0.50981	2.265000	0.75225	0.482000	0.46254	AAA	.		0.373	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259269.1	NM_181714	
MUC4	4585	broad.mit.edu;bcgsc.ca	37	3	195512519	195512519	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr3:195512519A>G	ENST00000463781.3	-	2	6391	c.5932T>C	c.(5932-5934)Tcc>Ccc	p.S1978P	MUC4_ENST00000475231.1_Missense_Mutation_p.S1978P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACCTGTGGACACTGAGGAA	0.597																																					p.S1978P		.											.	MUC4	90	0			c.T5932C						.						51.0	42.0	45.0					3																	195512519		689	1589	2278	SO:0001583	missense	4585	exon2			CTGTGGACACTGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5932T>C	3.37:g.195512519A>G	ENSP00000417498:p.Ser1978Pro	Somatic	114.0	1.0		WXS	Illumina HiSeq	Phase_I	159.0	7.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	A	4.790	0.146945	0.09134	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37584	1.31;1.19	.	.	.	.	.	.	.	.	T	0.18215	0.0437	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.25117	-1.0141	7	.	.	.	.	4.4578	0.11652	0.3364:0.0:0.6636:0.0	.	1978	E7ESK3	.	P	1978	ENSP00000417498:S1978P;ENSP00000420243:S1978P	.	S	-	1	0	MUC4	196996914	0.211000	0.23529	0.002000	0.10522	0.056000	0.15407	0.876000	0.28092	-0.423000	0.07394	0.055000	0.15244	TCC	.		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MYB	4602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	135515497	135515497	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr6:135515497C>A	ENST00000367814.4	+	8	1033	c.847C>A	c.(847-849)Cac>Aac	p.H283N	MYB_ENST00000341911.5_Missense_Mutation_p.H283N|MYB_ENST00000533624.1_Intron|MYB_ENST00000534044.1_Missense_Mutation_p.H283N|MYB_ENST00000420123.2_Missense_Mutation_p.H259N|MYB_ENST00000527615.1_Missense_Mutation_p.H283N|MYB_ENST00000525369.1_Missense_Mutation_p.H283N|MYB-AS1_ENST00000455534.1_RNA|MYB_ENST00000442647.2_Missense_Mutation_p.H283N|MYB_ENST00000316528.8_Missense_Mutation_p.H283N|MYB_ENST00000534121.1_Missense_Mutation_p.H283N|MYB_ENST00000528774.1_Missense_Mutation_p.H283N|MYB_ENST00000531845.1_3'UTR	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	283	Transcription activation domain (PubMed:2189102). {ECO:0000269|PubMed:2189102}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		ATTTCAGAGACACTATAATGA	0.423			T	NFIB	adenoid cystic carcinoma																																p.H283N		.		Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	.	MYB	838	0			c.C847A						.						75.0	75.0	75.0					6																	135515497		2203	4300	6503	SO:0001583	missense	4602	exon8			CAGAGACACTATA		CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.847C>A	6.37:g.135515497C>A	ENSP00000356788:p.His283Asn	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	9.0	NM_001161656	E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	ENST00000367814.4	37	CCDS5174.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.645697	0.47258	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000420123;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000430686	T;T;T;T;T;T;T;T;T	0.31769	2.73;2.25;2.23;2.25;1.48;2.01;2.73;2.72;1.9	5.46	5.46	0.80206	Transcription regulator Wos2-domain (1);	0.000000	0.85682	D	0.000000	T	0.35711	0.0941	L	0.46157	1.445	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D	0.76494	0.997;0.999;0.997;0.999;0.971;0.996;0.998;0.971;0.997	D;D;D;D;P;D;D;P;D	0.87578	0.992;0.996;0.99;0.998;0.9;0.955;0.993;0.9;0.994	T	0.05354	-1.0890	10	0.08381	T	0.77	-10.4564	19.3016	0.94146	0.0:1.0:0.0:0.0	.	283;259;283;283;283;283;283;283;283	E9PLZ5;E9PMQ0;P10242-2;E9PNL6;E9PRS2;E9PNA4;P10242-4;P10242;Q708E1	.;.;.;.;.;.;.;MYB_HUMAN;.	N	283;283;283;283;283;283;259;283;283;283;283;237	ENSP00000339992:H283N;ENSP00000410825:H283N;ENSP00000326328:H283N;ENSP00000356788:H283N;ENSP00000433227:H283N;ENSP00000435938:H283N;ENSP00000434723:H283N;ENSP00000432851:H283N;ENSP00000435055:H283N	ENSP00000237302:H283N	H	+	1	0	MYB	135557190	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.089000	0.71384	2.552000	0.86080	0.561000	0.74099	CAC	.		0.423	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042347.4		
NAGK	55577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71304745	71304745	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr2:71304745A>T	ENST00000244204.6	+	9	885	c.823A>T	c.(823-825)Agc>Tgc	p.S275C	NAGK_ENST00000443938.2_Missense_Mutation_p.S271C|NAGK_ENST00000418807.3_Missense_Mutation_p.S224C|NAGK_ENST00000443872.2_Missense_Mutation_p.S127C|NAGK_ENST00000455662.2_Missense_Mutation_p.S321C			Q9UJ70	NAGK_HUMAN	N-acetylglucosamine kinase	275					carbohydrate phosphorylation (GO:0046835)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|N-acetylglucosamine kinase activity (GO:0045127)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|urinary_tract(1)	18					N-Acetyl-D-glucosamine(DB00141)	TGTGTGGAAGAGCTGGGAGCT	0.612																																					p.S321C		.											.	NAGK	115	0			c.A961T						.						52.0	46.0	48.0					2																	71304745		2203	4300	6503	SO:0001583	missense	55577	exon9			TGGAAGAGCTGGG	AJ242910	CCDS33220.1, CCDS33220.2	2p24.3-p24.1	2008-02-05			ENSG00000124357	ENSG00000124357	2.7.1.59		17174	protein-coding gene	gene with protein product		606828				10824116	Standard	NM_017567		Approved	GNK	uc002shp.4	Q9UJ70	OTTHUMG00000153239	ENST00000244204.6:c.823A>T	2.37:g.71304745A>T	ENSP00000244204:p.Ser275Cys	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	10.0	NM_017567	B4DLZ5|Q53HD5|Q6IA84|Q9BS29|Q9BVP0|Q9NV37	Missense_Mutation	SNP	ENST00000244204.6	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	29.2|29.2|29.2	4.988801|4.988801|4.988801	0.93106|0.93106|0.93106	.|.|.	.|.|.	ENSG00000124357|ENSG00000124357|ENSG00000124357	ENST00000524537|ENST00000443938|ENST00000244204;ENST00000455662;ENST00000418807	.|.|T;T;T	.|.|0.32272	.|.|1.46;1.46;1.46	5.63|5.63|5.63	5.63|5.63|5.63	0.86233|0.86233|0.86233	.|.|ATPase, BadF/BadG/BcrA/BcrD type (1);	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.60392|0.60392|0.60392	0.2265|0.2265|0.2265	M|M|M	0.86651|0.86651|0.86651	2.83|2.83|2.83	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D	.|.|0.89917	.|.|1.0	.|.|D	.|.|0.79784	.|.|0.993	T|T|T	0.67277|0.67277|0.67277	-0.5711|-0.5711|-0.5711	5|5|10	.|.|0.66056	.|.|D	.|.|0.02	-6.7711|-6.7711|-6.7711	13.794|13.794|13.794	0.63160|0.63160|0.63160	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	.|.|275	.|.|Q9UJ70	.|.|NAGK_HUMAN	V|S|C	39|292|275;321;224	.|.|ENSP00000244204:S275C;ENSP00000389087:S321C;ENSP00000396070:S224C	.|.|ENSP00000244204:S275C	E|R|S	+|+|+	2|3|1	0|2|0	NAGK|NAGK|NAGK	71158253|71158253|71158253	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.982000|0.982000|0.982000	0.71751|0.71751|0.71751	7.966000|7.966000|7.966000	0.87956|0.87956|0.87956	2.137000|2.137000|2.137000	0.66172|0.66172|0.66172	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	GAG|AGA|AGC	.		0.612	NAGK-032	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471889.1		
OR10H5	284433	broad.mit.edu;mdanderson.org	37	19	15905584	15905584	+	Silent	SNP	T	T	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr19:15905584T>C	ENST00000308940.8	+	1	824	c.726T>C	c.(724-726)tgT>tgC	p.C242C		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						TCTCCACCTGTGCCTCTCACC	0.557																																					p.C242C		.											.	OR10H5	69	0			c.T726C						.						67.0	56.0	60.0					19																	15905584		2203	4296	6499	SO:0001819	synonymous_variant	284433	exon1			CACCTGTGCCTCT	AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.726T>C	19.37:g.15905584T>C		Somatic	84.0	1.0		WXS	Illumina HiSeq	Phase_I	114.0	16.0	NM_001004466	Q6IFJ0|Q96R60	Silent	SNP	ENST00000308940.8	37	CCDS32940.1																																																																																			.		0.557	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1		
OR2A5	393046	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143748366	143748366	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr7:143748366G>T	ENST00000408906.2	+	1	906	c.872G>T	c.(871-873)aGc>aTc	p.S291I		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	291						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					TTGATCTATAGCCTGAGGAAC	0.517																																					p.S291I		.											.	OR2A5	93	0			c.G872T						.						108.0	105.0	106.0					7																	143748366		1960	4170	6130	SO:0001583	missense	393046	exon1			TCTATAGCCTGAG	U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.872G>T	7.37:g.143748366G>T	ENSP00000386208:p.Ser291Ile	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	5.0	NM_012365	B9EGX2|O43885|O43888	Missense_Mutation	SNP	ENST00000408906.2	37	CCDS43668.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721908	0.48728	.	.	ENSG00000221836	ENST00000408906	T	0.36878	1.23	5.37	5.37	0.77165	.	0.000000	0.37955	U	0.001877	T	0.62380	0.2423	M	0.92026	3.265	0.32635	N	0.521427	D	0.57899	0.981	P	0.58820	0.846	T	0.76656	-0.2879	10	0.87932	D	0	.	12.2068	0.54356	0.0:0.1711:0.8289:0.0	.	291	Q96R48	OR2A5_HUMAN	I	291	ENSP00000386208:S291I	ENSP00000386208:S291I	S	+	2	0	OR2A5	143379299	0.955000	0.32602	1.000000	0.80357	0.272000	0.26649	4.309000	0.59135	2.797000	0.96272	0.650000	0.86243	AGC	.		0.517	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1		
PDE3A	5139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	20769305	20769305	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr12:20769305G>A	ENST00000359062.3	+	4	1451	c.1411G>A	c.(1411-1413)Gca>Aca	p.A471T	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	471					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	ACTGCAGGAAGCACCTTCATC	0.507																																					p.A471T		.											.	PDE3A	94	0			c.G1411A						.						106.0	91.0	96.0					12																	20769305		2203	4300	6503	SO:0001583	missense	5139	exon4			CAGGAAGCACCTT		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1411G>A	12.37:g.20769305G>A	ENSP00000351957:p.Ala471Thr	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	9.0	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	G	2.253	-0.371105	0.05034	.	.	ENSG00000172572	ENST00000359062	T	0.52983	0.64	5.26	4.34	0.51931	.	14.108600	0.00166	N	0.000000	T	0.44286	0.1286	L	0.48642	1.525	0.09310	N	1	B	0.19583	0.037	B	0.18263	0.021	T	0.24764	-1.0151	10	0.22109	T	0.4	.	7.3806	0.26854	0.0785:0.0:0.4891:0.4325	.	471	Q14432	PDE3A_HUMAN	T	471	ENSP00000351957:A471T	ENSP00000351957:A471T	A	+	1	0	PDE3A	20660572	0.044000	0.20184	0.985000	0.45067	0.053000	0.15095	0.556000	0.23438	1.304000	0.44892	0.655000	0.94253	GCA	.		0.507	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
PDE4B	5142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	66713174	66713174	+	Missense_Mutation	SNP	C	C	G	rs367809652		TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr1:66713174C>G	ENST00000329654.4	+	4	500	c.313C>G	c.(313-315)Cgg>Ggg	p.R105G	PDE4B_ENST00000371049.3_Missense_Mutation_p.R105G|PDE4B_ENST00000423207.2_Missense_Mutation_p.R90G	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	105					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	TTCCCCAGGTCGGAGTCCACT	0.527																																					p.R105G		.											.	PDE4B	92	0			c.C313G						.						168.0	181.0	177.0					1																	66713174		2203	4300	6503	SO:0001583	missense	5142	exon4			CCAGGTCGGAGTC	L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.313C>G	1.37:g.66713174C>G	ENSP00000332116:p.Arg105Gly	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	26.0	NM_001037341	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	ENST00000329654.4	37	CCDS632.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126219	0.77549	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000412480	T;T;T;T;D	0.82167	-0.58;-0.58;-0.58;-0.61;-1.58	5.95	4.98	0.66077	.	0.151906	0.64402	D	0.000010	T	0.78407	0.4278	L	0.43923	1.385	0.58432	D	0.99999	P;P;P	0.46327	0.876;0.803;0.802	P;B;B	0.48840	0.592;0.388;0.388	T	0.78802	-0.2061	10	0.45353	T	0.12	.	15.9685	0.79995	0.1354:0.8646:0.0:0.0	.	90;95;105	Q07343-3;Q59GM8;Q07343	.;.;PDE4B_HUMAN	G	105;105;105;90;13	ENSP00000332116:R105G;ENSP00000342637:R105G;ENSP00000360088:R105G;ENSP00000392947:R90G;ENSP00000397548:R13G	ENSP00000332116:R105G	R	+	1	2	PDE4B	66485762	0.813000	0.29090	1.000000	0.80357	0.985000	0.73830	1.613000	0.36900	2.817000	0.96982	0.563000	0.77884	CGG	.		0.527	PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3	NM_002600	
PEAK1	79834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	77407661	77407661	+	Splice_Site	SNP	T	T	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr15:77407661T>A	ENST00000560626.2	-	7	4553	c.4078A>T	c.(4078-4080)Atc>Ttc	p.I1360F	PEAK1_ENST00000312493.4_Splice_Site_p.I1360F			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1360	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CTCTTACAGATCTGAAAGATA	0.413																																					p.I1360F		.											.	.	.	0			c.A4078T						.						44.0	39.0	41.0					15																	77407661		1874	4108	5982	SO:0001630	splice_region_variant	0	exon8			TACAGATCTGAAA		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.4078-1A>T	15.37:g.77407661T>A		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	8.0	NM_024776	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	ENST00000560626.2	37	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.391983	0.83011	.	.	ENSG00000173517	ENST00000312493	T	0.75154	-0.91	5.35	5.35	0.76521	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84795	0.5551	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.86626	0.1882	10	0.87932	D	0	-7.2398	15.328	0.74182	0.0:0.0:0.0:1.0	.	1360	Q9H792	PEAK1_HUMAN	F	1360	ENSP00000309230:I1360F	ENSP00000309230:I1360F	I	-	1	0	AC087465.1	75194716	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.040000	0.89188	2.044000	0.60594	0.459000	0.35465	ATC	.		0.413	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		Missense_Mutation
PLAG1	5324	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	57080762	57080762	+	Missense_Mutation	SNP	G	G	A	rs144724863		TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr8:57080762G>A	ENST00000316981.3	-	4	546	c.67C>T	c.(67-69)Cgt>Tgt	p.R23C	PLAG1_ENST00000423799.2_Intron|PLAG1_ENST00000429357.2_Missense_Mutation_p.R23C	NM_001114634.1|NM_002655.2	NP_001108106.1|NP_002646.2	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1	23	Interacts with KPNA2.				gland morphogenesis (GO:0022612)|multicellular organism growth (GO:0035264)|negative regulation of gene expression (GO:0010629)|organ growth (GO:0035265)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R23C(1)	CTNNB1/PLAG1(60)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|FGFR1_ENST00000447712/PLAG1(28)|COL1A2/PLAG1(3)|CHCHD7/PLAG1(12)|TCEA1_ENST00000521604/PLAG1(3)	breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			CCACGCTTACGTTTCCCTGAA	0.448			T	"""TCEA1, LIFR, CTNNB1, CHCHD7"""	salivary adenoma																																p.R23C		.		Dom	yes		8	8q12	5324	pleiomorphic adenoma gene 1		E	.	PLAG1	1107	1	Substitution - Missense(1)	large_intestine(1)	c.C67T						.	G	CYS/ARG,,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	115.0	104.0	108.0		67,,67	5.5	1.0	8	dbSNP_134	108	0,8600		0,0,4300	no	missense,intron,missense	PLAG1	NM_001114634.1,NM_001114635.1,NM_002655.2	180,,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,,probably-damaging	23/501,,23/501	57080762	1,13005	2203	4300	6503	SO:0001583	missense	5324	exon3			GCTTACGTTTCCC	U65002	CCDS6165.1, CCDS47860.1	8q12	2010-07-30				ENSG00000181690		"""Zinc fingers, C2H2-type"""	9045	protein-coding gene	gene with protein product		603026				9268638	Standard	NM_002655		Approved	ZNF912	uc010lyi.3	Q6DJT9		ENST00000316981.3:c.67C>T	8.37:g.57080762G>A	ENSP00000325546:p.Arg23Cys	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	8.0	NM_001114634	B4DLC2|Q59GH8|Q9Y4L2	Missense_Mutation	SNP	ENST00000316981.3	37	CCDS6165.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509050	0.64410	2.27E-4	0.0	ENSG00000181690	ENST00000316981;ENST00000429357	T;T	0.13901	2.55;2.55	5.46	5.46	0.80206	.	0.052285	0.85682	D	0.000000	T	0.20820	0.0501	N	0.14661	0.345	0.80722	D	1	D	0.89917	1.0	P	0.58928	0.848	T	0.05852	-1.0860	10	0.87932	D	0	-17.9986	19.6662	0.95894	0.0:0.0:1.0:0.0	.	23	Q6DJT9	PLAG1_HUMAN	C	23	ENSP00000325546:R23C;ENSP00000416537:R23C	ENSP00000325546:R23C	R	-	1	0	PLAG1	57243316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.650000	0.83521	2.695000	0.91970	0.563000	0.77884	CGT	G|1.000;A|0.000		0.448	PLAG1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378212.1	NM_002655	
PLXNB1	5364	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	48451118	48451118	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr3:48451118C>A	ENST00000358536.4	-	33	6069	c.5800G>T	c.(5800-5802)Gat>Tat	p.D1934Y	PLXNB1_ENST00000358459.4_Missense_Mutation_p.D1751Y|PLXNB1_ENST00000296440.6_Missense_Mutation_p.D1934Y|PLXNB1_ENST00000456774.1_Missense_Mutation_p.D1751Y|PLXNB1_ENST00000448774.2_Missense_Mutation_p.D545Y	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1934					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AACAGGTCATCCACGAACTTC	0.617																																					p.D1934Y		.											.	PLXNB1	293	0			c.G5800T						.						54.0	52.0	53.0					3																	48451118		2203	4300	6503	SO:0001583	missense	5364	exon33			GGTCATCCACGAA	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.5800G>T	3.37:g.48451118C>A	ENSP00000351338:p.Asp1934Tyr	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	10.0	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	37	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	c	15.15	2.748711	0.49257	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000448774;ENST00000456774	T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24	4.16	4.16	0.48862	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.000000	0.85682	D	0.000000	T	0.52370	0.1730	M	0.93420	3.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68224	-0.5465	10	0.87932	D	0	.	15.4419	0.75190	0.0:1.0:0.0:0.0	.	1934;1751	O43157;O43157-2	PLXB1_HUMAN;.	Y	1934;1751;1934;545;1751	ENSP00000296440:D1934Y;ENSP00000351242:D1751Y;ENSP00000351338:D1934Y;ENSP00000389320:D545Y;ENSP00000414199:D1751Y	ENSP00000296440:D1934Y	D	-	1	0	PLXNB1	48426122	1.000000	0.71417	0.998000	0.56505	0.022000	0.10575	7.683000	0.84093	1.868000	0.54150	0.306000	0.20318	GAT	.		0.617	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	68864764	68864764	+	Silent	SNP	G	G	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr8:68864764G>T	ENST00000288368.4	+	1	412	c.135G>T	c.(133-135)ctG>ctT	p.L45L	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	45	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGGAGTTCCTGGTGTCGGTGA	0.701																																					p.L45L		.											.	PREX2	390	0			c.G135T						.						27.0	27.0	27.0					8																	68864764		2202	4297	6499	SO:0001819	synonymous_variant	80243	exon1			GTTCCTGGTGTCG	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.135G>T	8.37:g.68864764G>T		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	14.0	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	CCDS6201.1																																																																																			.		0.701	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
RAI2	10742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	17819379	17819379	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chrX:17819379G>A	ENST00000545871.1	-	3	1212	c.752C>T	c.(751-753)cCg>cTg	p.P251L	RAI2_ENST00000451717.1_Missense_Mutation_p.P251L|RAI2_ENST00000360011.1_Missense_Mutation_p.P251L|RAI2_ENST00000331511.1_Missense_Mutation_p.P251L|RAI2_ENST00000415486.3_Missense_Mutation_p.P201L	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	251	Pro-rich.				embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					CTGAGGCATCGGGATGGGGAT	0.592																																					p.P251L		.											.	RAI2	131	0			c.C752T						.						85.0	83.0	84.0					X																	17819379		2203	4300	6503	SO:0001583	missense	10742	exon3			GGCATCGGGATGG	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.752C>T	X.37:g.17819379G>A	ENSP00000444210:p.Pro251Leu	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	19.0	NM_001172739	B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	ENST00000545871.1	37	CCDS14183.1	.	.	.	.	.	.	.	.	.	.	g	13.05	2.122722	0.37436	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;0.06	5.29	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.74733	0.3755	L	0.61218	1.895	0.58432	D	0.999998	D;D	0.69078	0.997;0.997	P;P	0.57324	0.726;0.818	T	0.77480	-0.2572	10	0.72032	D	0.01	-9.9766	12.9581	0.58442	0.0806:0.0:0.9194:0.0	.	201;251	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	L	251;251;251;251;201	ENSP00000333456:P251L;ENSP00000353106:P251L;ENSP00000444210:P251L;ENSP00000401323:P251L;ENSP00000392578:P201L	ENSP00000333456:P251L	P	-	2	0	RAI2	17729300	1.000000	0.71417	0.822000	0.32727	0.918000	0.54935	8.691000	0.91279	1.218000	0.43458	0.597000	0.82753	CCG	.		0.592	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1	NM_021785	
PTCHD1	139411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	23398175	23398175	+	Silent	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chrX:23398175C>A	ENST00000379361.4	+	2	1679	c.819C>A	c.(817-819)gtC>gtA	p.V273V		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	273	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						GTTACCTGGTCACCAGCCTGA	0.527																																					p.V273V		.											.	PTCHD1	135	0			c.C819A						.						161.0	137.0	145.0					X																	23398175		2203	4300	6503	SO:0001819	synonymous_variant	139411	exon2			CCTGGTCACCAGC	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.819C>A	X.37:g.23398175C>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	21.0	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Silent	SNP	ENST00000379361.4	37	CCDS35215.2																																																																																			.		0.527	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
RSL24D1	51187	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	55475581	55475581	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr15:55475581T>C	ENST00000260443.4	-	5	526	c.350A>G	c.(349-351)gAg>gGg	p.E117G		NM_016304.2	NP_057388.1	Q9UHA3	RLP24_HUMAN	ribosomal L24 domain containing 1	117					ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)				central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	7						TTTCTGTAGCTCTTTATTTTT	0.343																																					p.E117G		.											.	RSL24D1	91	0			c.A350G						.						60.0	56.0	57.0					15																	55475581		2193	4292	6485	SO:0001583	missense	51187	exon5			TGTAGCTCTTTAT	AF201949	CCDS10152.1	15q21	2009-02-27	2009-02-27	2009-02-27	ENSG00000137876	ENSG00000137876			18479	protein-coding gene	gene with protein product		613262	"""chromosome 15 open reading frame 15"""	C15orf15		12808088, 11707418	Standard	NM_016304		Approved	HRP-L30-iso, L30, RPL24L, RPL24	uc002acn.3	Q9UHA3	OTTHUMG00000131957	ENST00000260443.4:c.350A>G	15.37:g.55475581T>C	ENSP00000260443:p.Glu117Gly	Somatic	130.0	1.0		WXS	Illumina HiSeq	Phase_I	166.0	25.0	NM_016304	B2RD72|Q561V8|Q8N6S8|Q96B04|Q96C76|Q96HJ1	Missense_Mutation	SNP	ENST00000260443.4	37	CCDS10152.1	.	.	.	.	.	.	.	.	.	.	T	16.59	3.167078	0.57476	.	.	ENSG00000137876	ENST00000260443	.	.	.	5.46	5.46	0.80206	.	0.350989	0.33670	N	0.004666	T	0.61961	0.2389	M	0.72576	2.205	0.58432	D	0.999999	B	0.09022	0.002	B	0.06405	0.002	T	0.60924	-0.7166	9	0.51188	T	0.08	-23.3541	13.4883	0.61379	0.0:0.0:0.0:1.0	.	117	Q9UHA3	RLP24_HUMAN	G	117	.	ENSP00000260443:E117G	E	-	2	0	RSL24D1	53262873	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	6.941000	0.75922	2.054000	0.61138	0.533000	0.62120	GAG	.		0.343	RSL24D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254916.1	NM_016304	
S1PR3	1903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	91616133	91616133	+	Silent	SNP	G	G	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr9:91616133G>A	ENST00000375846.3	+	1	4713	c.18G>A	c.(16-18)ccG>ccA	p.P6P	S1PR3_ENST00000358157.2_Silent_p.P6P			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	6					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						CTGCCCTCCCGCCGCGTCTCC	0.622											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P6P		.											.	S1PR3	949	0			c.G18A						.						54.0	63.0	60.0					9																	91616133		2203	4299	6502	SO:0001819	synonymous_variant	1903	exon2			CCTCCCGCCGCGT	AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.18G>A	9.37:g.91616133G>A		Somatic	43.0	0.0	1283	WXS	Illumina HiSeq	Phase_I	48.0	10.0	NM_005226	Q5SQD8|Q7Z5I2	Silent	SNP	ENST00000375846.3	37	CCDS6680.1																																																																																			.		0.622	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2	NM_005226	
SLC7A9	11136	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	33349420	33349420	+	Silent	SNP	A	A	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr19:33349420A>T	ENST00000023064.4	-	9	1094	c.903T>A	c.(901-903)gcT>gcA	p.A301A	SLC7A9_ENST00000590341.1_Silent_p.A301A|SLC7A9_ENST00000587772.1_Silent_p.A301A	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	301					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	CGATCCAAGAAGCAGGATAGA	0.562																																					p.A301A	GBM(181;1335 2108 9644 44178 46689)	.											.	SLC7A9	91	0			c.T903A						.						94.0	75.0	81.0					19																	33349420		2203	4300	6503	SO:0001819	synonymous_variant	11136	exon9			CCAAGAAGCAGGA	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.903T>A	19.37:g.33349420A>T		Somatic	11.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	5.0	NM_001243036	B2R9A6	Silent	SNP	ENST00000023064.4	37	CCDS12425.1																																																																																			.		0.562	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1		
SLCO4C1	353189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	101592902	101592902	+	Silent	SNP	T	T	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr5:101592902T>C	ENST00000310954.6	-	8	1672	c.1386A>G	c.(1384-1386)ggA>ggG	p.G462G		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TAAGTGCAACTCCAGATGTGA	0.373																																					p.G462G		.											.	SLCO4C1	93	0			c.A1386G						.						109.0	107.0	108.0					5																	101592902		2203	4300	6503	SO:0001819	synonymous_variant	353189	exon8			TGCAACTCCAGAT	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1386A>G	5.37:g.101592902T>C		Somatic	272.0	0.0		WXS	Illumina HiSeq	Phase_I	353.0	73.0	NM_180991		Silent	SNP	ENST00000310954.6	37	CCDS34205.1																																																																																			.		0.373	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	NM_180991	
SMIM5	643008	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	73636388	73636389	+	Frame_Shift_Ins	INS	-	-	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr17:73636388_73636389insA	ENST00000537494.1	+	1	3714_3715	c.107_108insA	c.(106-111)tcagtcfs	p.V37fs	RECQL5_ENST00000423245.2_Intron|RECQL5_ENST00000317905.5_Intron|SMIM5_ENST00000375215.3_Frame_Shift_Ins_p.V37fs			Q71RC9	SMIM5_HUMAN	small integral membrane protein 5	37						integral component of membrane (GO:0016021)											GTGGCCTTCTCAGTCATCATCC	0.634																																					p.S36fs		.											.	.	.	0			c.107_108insA						.																																			SO:0001589	frameshift_variant	643008	exon2			CCTTCTCAGTCAT		CCDS54165.1	17q25.1	2014-01-02	2012-10-23	2012-10-23	ENSG00000204323	ENSG00000204323			40030	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 109"""	C17orf109		24318988	Standard	NM_001162995		Approved		uc002jow.2	Q71RC9	OTTHUMG00000167882	ENST00000537494.1:c.108dupA	17.37:g.73636389_73636389dupA	ENSP00000477017:p.Val37fs	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	10.0	NM_001162995		Frame_Shift_Ins	INS	ENST00000537494.1	37	CCDS54165.1																																																																																			.		0.634	SMIM5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396808.2	NM_001162995	
SNAP91	9892	broad.mit.edu;ucsc.edu	37	6	84270663	84270663	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr6:84270663C>A	ENST00000439399.2	-	27	2762	c.2446G>T	c.(2446-2448)Gga>Tga	p.G816*	SNAP91_ENST00000521743.1_Nonsense_Mutation_p.G816*|SNAP91_ENST00000369694.2_Nonsense_Mutation_p.G816*|SNAP91_ENST00000428679.2_Nonsense_Mutation_p.G816*|SNAP91_ENST00000195649.6_Nonsense_Mutation_p.G811*|SNAP91_ENST00000520302.1_Nonsense_Mutation_p.G786*|SNAP91_ENST00000521485.1_Nonsense_Mutation_p.G811*|SNAP91_ENST00000520213.1_Nonsense_Mutation_p.G509*|SNAP91_ENST00000437520.1_Nonsense_Mutation_p.G509*	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	816	Pro-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GGTACAGCTCCTTGCTacaca	0.428																																					p.G816X		.											.	SNAP91	23	0			c.G2446T						.						43.0	43.0	43.0					6																	84270663		1948	4152	6100	SO:0001587	stop_gained	9892	exon26			CAGCTCCTTGCTA	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2446G>T	6.37:g.84270663C>A	ENSP00000400459:p.Gly816*	Somatic	116.0	1.0		WXS	Illumina HiSeq	Phase_I	120.0	27.0	NM_001242792	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Nonsense_Mutation	SNP	ENST00000439399.2	37	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	C	42	9.518513	0.99193	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000523448	.	.	.	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.0938	18.8976	0.92430	0.0:1.0:0.0:0.0	.	.	.	.	X	811;816;816;811;816;509;786;816;509;157	.	ENSP00000195649:G811X	G	-	1	0	SNAP91	84327382	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.230000	0.65321	2.542000	0.85734	0.555000	0.69702	GGA	.		0.428	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
SPTBN2	6712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66460755	66460755	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr11:66460755C>A	ENST00000533211.1	-	24	5087	c.4756G>T	c.(4756-4758)Gat>Tat	p.D1586Y	SPTBN2_ENST00000309996.2_Missense_Mutation_p.D1586Y|SPTBN2_ENST00000529997.1_Missense_Mutation_p.D1586Y			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1586					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CGCAGGGCATCCTCCAGTCGC	0.627																																					p.D1586Y		.											.	SPTBN2	155	0			c.G4756T						.						69.0	71.0	70.0					11																	66460755		2200	4295	6495	SO:0001583	missense	6712	exon23			GGGCATCCTCCAG	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.4756G>T	11.37:g.66460755C>A	ENSP00000432568:p.Asp1586Tyr	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	15.0	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818476	0.50633	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.53423	0.62;0.62;0.62	4.38	4.38	0.52667	.	0.199359	0.42420	D	0.000713	T	0.62245	0.2412	M	0.66560	2.04	0.21675	N	0.999591	P	0.39376	0.67	P	0.55455	0.776	T	0.57063	-0.7875	10	0.87932	D	0	.	12.3561	0.55176	0.0:0.8284:0.1716:0.0	.	1586	O15020	SPTN2_HUMAN	Y	1586	ENSP00000432568:D1586Y;ENSP00000311489:D1586Y;ENSP00000433593:D1586Y	ENSP00000311489:D1586Y	D	-	1	0	SPTBN2	66217331	0.847000	0.29606	0.989000	0.46669	0.710000	0.40934	3.765000	0.55272	2.268000	0.75426	0.462000	0.41574	GAT	.		0.627	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
TAS1R3	83756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	1266874	1266874	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr1:1266874G>A	ENST00000339381.5	+	1	181	c.149G>A	c.(148-150)gGc>gAc	p.G50D		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	50					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GAGGAGGCTGGCCTCCGCAGC	0.697																																					p.G50D		.											.	TAS1R3	22	0			c.G149A						.						8.0	9.0	9.0					1																	1266874		2153	4233	6386	SO:0001583	missense	83756	exon1			AGGCTGGCCTCCG	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.149G>A	1.37:g.1266874G>A	ENSP00000344411:p.Gly50Asp	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	6.0	NM_152228	Q5TA49|Q8NGW9	Missense_Mutation	SNP	ENST00000339381.5	37	CCDS30556.1	.	.	.	.	.	.	.	.	.	.	G	2.293	-0.362003	0.05103	.	.	ENSG00000169962	ENST00000339381	D	0.86030	-2.06	4.11	-6.03	0.02185	.	1.914590	0.02568	N	0.097455	T	0.62853	0.2462	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.58086	-0.7698	10	0.10111	T	0.7	.	2.2584	0.04060	0.3662:0.3453:0.1774:0.1111	.	50	Q7RTX0	TS1R3_HUMAN	D	50	ENSP00000344411:G50D	ENSP00000344411:G50D	G	+	2	0	TAS1R3	1256737	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.572000	0.02136	-0.703000	0.05049	-0.802000	0.03209	GGC	.		0.697	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008493.1		
TKTL2	84076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	164393739	164393739	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr4:164393739C>A	ENST00000280605.3	-	1	1308	c.1148G>T	c.(1147-1149)cGt>cTt	p.R383L		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	383						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GGTTCGACCACGTGTAGCACA	0.438																																					p.R383L		.											.	TKTL2	95	0			c.G1148T						.						87.0	87.0	87.0					4																	164393739		2203	4300	6503	SO:0001583	missense	84076	exon1			CGACCACGTGTAG	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.1148G>T	4.37:g.164393739C>A	ENSP00000280605:p.Arg383Leu	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	11.0	NM_032136	A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	ENST00000280605.3	37	CCDS3805.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.738952	0.69304	.	.	ENSG00000151005	ENST00000280605	T	0.44083	0.93	4.29	3.42	0.39159	Transketolase-like, pyrimidine-binding domain (2);	0.064498	0.64402	D	0.000012	T	0.62490	0.2432	M	0.78637	2.42	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.66968	-0.5789	10	0.59425	D	0.04	-6.503	12.3612	0.55205	0.0:0.8283:0.1717:0.0	.	383	Q9H0I9	TKTL2_HUMAN	L	383	ENSP00000280605:R383L	ENSP00000280605:R383L	R	-	2	0	TKTL2	164613189	0.948000	0.32251	0.060000	0.19600	0.995000	0.86356	3.072000	0.50049	1.351000	0.45789	0.655000	0.94253	CGT	.		0.438	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136	
TNRC6A	27327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	24831569	24831569	+	Silent	SNP	G	G	A	rs552703108		TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr16:24831569G>A	ENST00000395799.3	+	22	5319	c.5190G>A	c.(5188-5190)ccG>ccA	p.P1730P	TNRC6A_ENST00000432286.2_Silent_p.P208P|TNRC6A_ENST00000315183.7_Silent_p.P1681P|CTD-2515A14.1_ENST00000568895.1_RNA	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1730	Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TCACTGCTCCGTCCCGCCCAC	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		18949	0.001		0.0	False		,,,				2504	0.0				p.P1730P		.											.	TNRC6A	92	0			c.G5190A						.						131.0	124.0	126.0					16																	24831569		2197	4300	6497	SO:0001819	synonymous_variant	27327	exon22			TGCTCCGTCCCGC	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.5190G>A	16.37:g.24831569G>A		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	28.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	37	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	G	10.32	1.317944	0.23994	.	.	ENSG00000090905	ENST00000450465	.	.	.	5.79	2.8	0.32819	.	.	.	.	.	T	0.55257	0.1909	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48779	-0.9005	4	.	.	.	-6.5693	7.0156	0.24887	0.2073:0.1262:0.6665:0.0	.	.	.	.	I	621	.	.	V	+	1	0	TNRC6A	24739070	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.533000	0.36040	0.797000	0.33971	0.655000	0.94253	GTC	.		0.527	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577511	7577511	+	Missense_Mutation	SNP	A	A	G	rs28934577		TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr17:7577511A>G	ENST00000269305.4	-	7	959	c.770T>C	c.(769-771)cTg>cCg	p.L257P	TP53_ENST00000420246.2_Missense_Mutation_p.L257P|TP53_ENST00000413465.2_Missense_Mutation_p.L257P|TP53_ENST00000359597.4_Missense_Mutation_p.L257P|TP53_ENST00000455263.2_Missense_Mutation_p.L257P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.L257P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	257	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> P (in sporadic cancers; somatic mutation).|L -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934577).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L257Q(8)|p.L257P(8)|p.L257fs*6(2)|p.?(1)|p.T256fs*87(1)|p.L257R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAGTCTTCCAGTGTGATGAT	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.L257P	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	29	Substitution - Missense(17)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(1)	large_intestine(4)|oesophagus(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|central_nervous_system(2)|liver(2)|upper_aerodigestive_tract(1)|stomach(1)|biliary_tract(1)|kidney(1)|breast(1)|skin(1)|pancreas(1)	c.T770C	GRCh37	CD941800|CM941332	TP53	D|M	rs28934577	.						139.0	99.0	113.0					17																	7577511		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TCTTCCAGTGTGA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.770T>C	17.37:g.7577511A>G	ENSP00000269305:p.Leu257Pro	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	17.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	15.36	2.810004	0.50421	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99905	-7.7;-7.7;-7.7;-7.7;-7.7;-7.7;-7.7	4.62	3.53	0.40419	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.64402	D	0.000001	D	0.99904	0.9954	M	0.92507	3.315	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0	D	0.96890	0.9652	10	0.87932	D	0	-7.3975	9.0966	0.36642	0.8362:0.0:0.0:0.1638	.	257;257;257;257;257	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	P	257;257;257;257;257;257;246;125	ENSP00000410739:L257P;ENSP00000352610:L257P;ENSP00000269305:L257P;ENSP00000398846:L257P;ENSP00000391127:L257P;ENSP00000391478:L257P;ENSP00000425104:L125P	ENSP00000269305:L257P	L	-	2	0	TP53	7518236	1.000000	0.71417	0.981000	0.43875	0.405000	0.30901	9.087000	0.94110	0.889000	0.36185	0.379000	0.24179	CTG	A|1.000;|0.000		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
UBR4	23352	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19408022	19408022	+	Silent	SNP	C	C	A			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr1:19408022C>A	ENST00000375254.3	-	103	15081	c.15054G>T	c.(15052-15054)ctG>ctT	p.L5018L	UBR4_ENST00000543981.1_Silent_p.L682L|UBR4_ENST00000375217.2_Silent_p.L5011L|UBR4_ENST00000429347.2_Silent_p.L541L|AL137127.1_ENST00000582644.1_RNA|UBR4_ENST00000375226.2_Silent_p.L4994L|UBR4_ENST00000375267.2_Silent_p.L5018L|UBR4_ENST00000375225.3_Silent_p.L93L|UBR4_ENST00000375224.1_Silent_p.L725L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	5018					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L5018L(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGGGCTGTTCCAGAAAGCCTT	0.537																																					p.L5018L		.											.	UBR4	612	1	Substitution - coding silent(1)	large_intestine(1)	c.G15054T						.						159.0	164.0	162.0					1																	19408022		2203	4300	6503	SO:0001819	synonymous_variant	23352	exon103			CTGTTCCAGAAAG	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.15054G>T	1.37:g.19408022C>A		Somatic	56.0	1.0		WXS	Illumina HiSeq	Phase_I	91.0	24.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1																																																																																			.		0.537	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82836639	82836639	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr5:82836639A>G	ENST00000265077.3	+	8	8382	c.7817A>G	c.(7816-7818)cAt>cGt	p.H2606R	VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.H1619R|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2606	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TCAGAACCACATGACAGTAAT	0.363																																					p.H2606R		.											.	VCAN	238	0			c.A7817G						.						90.0	91.0	90.0					5																	82836639		2203	4300	6503	SO:0001583	missense	1462	exon8			AACCACATGACAG	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7817A>G	5.37:g.82836639A>G	ENSP00000265077:p.His2606Arg	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	21.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	2.180	-0.387810	0.04932	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.30981	1.51;1.51	5.68	1.98	0.26296	.	0.737333	0.13013	N	0.420682	T	0.24661	0.0598	L	0.59436	1.845	0.09310	N	0.999997	B;B	0.18013	0.01;0.025	B;B	0.14023	0.01;0.008	T	0.34279	-0.9835	10	0.14656	T	0.56	.	5.8658	0.18775	0.7039:0.1491:0.1471:0.0	.	1619;2606	P13611-2;P13611	.;CSPG2_HUMAN	R	2606;1619	ENSP00000265077:H2606R;ENSP00000340062:H1619R	ENSP00000265077:H2606R	H	+	2	0	VCAN	82872395	0.028000	0.19301	0.002000	0.10522	0.147000	0.21601	1.508000	0.35769	0.102000	0.17638	0.379000	0.24179	CAT	.		0.363	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
WDR19	57728	broad.mit.edu;bcgsc.ca	37	4	39246144	39246144	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr4:39246144G>T	ENST00000399820.3	+	23	2771	c.2617G>T	c.(2617-2619)Gca>Tca	p.A873S	WDR19_ENST00000288634.7_Missense_Mutation_p.A713S	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	873					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						CGATAAAGCAGCATCTGTTTA	0.398																																					p.A873S		.											.	WDR19	67	0			c.G2617T						.						118.0	113.0	115.0					4																	39246144		1884	4103	5987	SO:0001583	missense	57728	exon23			AAAGCAGCATCTG	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.2617G>T	4.37:g.39246144G>T	ENSP00000382717:p.Ala873Ser	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	7.0	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	ENST00000399820.3	37	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	G	34	5.385727	0.95967	.	.	ENSG00000157796	ENST00000399820;ENST00000288634	T;T	0.79845	-1.31;-1.31	5.5	5.5	0.81552	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.91888	0.7432	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.92434	0.5956	10	0.52906	T	0.07	-16.8082	19.3995	0.94621	0.0:0.0:1.0:0.0	.	873	Q8NEZ3	WDR19_HUMAN	S	873;713	ENSP00000382717:A873S;ENSP00000288634:A713S	ENSP00000288634:A713S	A	+	1	0	WDR19	38922539	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.887000	0.87295	2.573000	0.86826	0.585000	0.79938	GCA	.		0.398	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
WDR17	116966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	177041041	177041041	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr4:177041041T>C	ENST00000280190.4	+	5	559	c.403T>C	c.(403-405)Tgc>Cgc	p.C135R	WDR17_ENST00000393643.2_Missense_Mutation_p.C111R|WDR17_ENST00000508596.1_Missense_Mutation_p.C111R|WDR17_ENST00000507824.2_Missense_Mutation_p.C135R			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	135										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TCTTAGTTGGTGCTGGAATGC	0.408																																					p.C135R		.											.	WDR17	95	0			c.T403C						.						164.0	156.0	158.0					4																	177041041		2203	4300	6503	SO:0001583	missense	116966	exon5			AGTTGGTGCTGGA	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.403T>C	4.37:g.177041041T>C	ENSP00000280190:p.Cys135Arg	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	20.0	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.821275	0.32237	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.64438	-0.1;-0.1;-0.1	5.18	3.99	0.46301	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76140	0.3946	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.74633	-0.3600	10	0.39692	T	0.17	-9.5264	11.4386	0.50083	0.1352:0.0:0.0:0.8648	.	111;135	E7EQX0;Q8IZU2	.;WDR17_HUMAN	R	111;111;135;135	ENSP00000422763:C111R;ENSP00000377258:C111R;ENSP00000280190:C135R	ENSP00000280190:C135R	C	+	1	0	WDR17	177278035	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	5.758000	0.68776	0.792000	0.33850	-0.301000	0.09380	TGC	.		0.408	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
ZIC4	84107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	147113833	147113833	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A7XO-01A-11D-A34Z-10	TCGA-ED-A7XO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3d6c15a-8dd7-4b2c-b41a-33c2d4412d80	a83a44f3-45ec-4725-bef7-e1656fef6932	g.chr3:147113833C>G	ENST00000383075.3	-	3	1006	c.494G>C	c.(493-495)gGc>gCc	p.G165A	ZIC4_ENST00000484399.1_Missense_Mutation_p.G165A|ZIC4_ENST00000525172.2_Missense_Mutation_p.G215A|ZIC4_ENST00000473123.1_Missense_Mutation_p.G165A|ZIC4_ENST00000425731.3_Missense_Mutation_p.G203A|ZIC4_ENST00000491672.1_Intron	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	165						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CTGTTCCGGGCCGCCGACGTG	0.612																																					p.G215A		.											.	ZIC4	91	0			c.G644C						.						97.0	108.0	104.0					3																	147113833		2203	4300	6503	SO:0001583	missense	84107	exon3			TCCGGGCCGCCGA	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.494G>C	3.37:g.147113833C>G	ENSP00000372553:p.Gly165Ala	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	8.0	NM_001168378	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833095	0.91036	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748	D;D;D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75;-2.75;-2.75	5.2	5.2	0.72013	.	0.000000	0.47093	D	0.000256	D	0.91348	0.7271	N	0.13327	0.33	0.80722	D	1	P;D	0.89917	0.84;1.0	B;D	0.91635	0.399;0.999	D	0.93223	0.6610	10	0.66056	D	0.02	.	18.7355	0.91753	0.0:1.0:0.0:0.0	.	215;165	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	A	165;203;215;165;165;165	ENSP00000372553:G165A;ENSP00000397695:G203A;ENSP00000435509:G215A;ENSP00000417855:G165A;ENSP00000420775:G165A;ENSP00000420627:G165A	ENSP00000372553:G165A	G	-	2	0	ZIC4	148596523	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.425000	0.82216	0.511000	0.50034	GGC	.		0.612	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1		
