#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
APCDD1	147495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	10471887	10471887	+	Silent	SNP	C	C	T	rs145453912		TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr18:10471887C>T	ENST00000355285.5	+	3	957	c.603C>T	c.(601-603)gcC>gcT	p.A201A	APCDD1_ENST00000578882.1_Intron	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		GCACCAAGGCCGTGAACTTTG	0.607																																					p.A201A		.											.	APCDD1	90	0			c.C603T						.						144.0	132.0	136.0					18																	10471887		2203	4300	6503	SO:0001819	synonymous_variant	147495	exon3			CAAGGCCGTGAAC	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.603C>T	18.37:g.10471887C>T		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	26.0	NM_153000		Silent	SNP	ENST00000355285.5	37	CCDS11849.1																																																																																			C|1.000;G|0.000		0.607	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
APOB	338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	21231993	21231994	+	Frame_Shift_Ins	INS	-	-	CTCTACC			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr2:21231993_21231994insCTCTACC	ENST00000233242.1	-	26	7873_7874	c.7746_7747insGGTAGAG	c.(7744-7749)gagcaafs	p.Q2583fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2583					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGAACCCTTGCTCTACCAATG	0.45																																					p.Q2583fs		.											.	APOB	175	0			c.7747_7748insGGTAGAG						.																																			SO:0001589	frameshift_variant	338	exon26			ACCCTTGCTCTAC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7740_7746dupGGTAGAG	2.37:g.21231994_21232000dupCTCTACC	ENSP00000233242:p.Gln2583fs	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	35.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.450	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
AQP7	364	ucsc.edu;bcgsc.ca	37	9	33386144	33386144	+	Silent	SNP	G	G	A	rs76209395	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr9:33386144G>A	ENST00000537089.1	-	5	498	c.180C>T	c.(178-180)gtC>gtT	p.V60V	AQP7_ENST00000377425.4_Silent_p.V95V|AQP7_ENST00000541274.1_Intron|AQP7_ENST00000539936.1_Silent_p.V152V			O14520	AQP7_HUMAN	aquaporin 7	152					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CAGCTGTAGCGACGGGACCGG	0.582																																					p.V152V		.											.	AQP7	90	0			c.C456T						.						86.0	80.0	82.0					9																	33386144		2203	4300	6503	SO:0001819	synonymous_variant	364	exon6			TGTAGCGACGGGA	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.180C>T	9.37:g.33386144G>A		Somatic	76.0	2.0		WXS	Illumina HiSeq	.	201.0	38.0	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Silent	SNP	ENST00000537089.1	37																																																																																				G|0.375;A|0.625		0.582	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
ARHGAP31	57514	broad.mit.edu;bcgsc.ca	37	3	119101978	119101978	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr3:119101978T>C	ENST00000264245.4	+	6	1119	c.587T>C	c.(586-588)cTt>cCt	p.L196P		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	196	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GCAGCCTTCCTTGCAGTCCGG	0.448																																					p.L196P	Pancreas(7;176 297 5394 51128 51241)	.											.	ARHGAP31	92	0			c.T587C						.						138.0	140.0	140.0					3																	119101978		2021	4177	6198	SO:0001583	missense	57514	exon6			CCTTCCTTGCAGT		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.587T>C	3.37:g.119101978T>C	ENSP00000264245:p.Leu196Pro	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	10.0	NM_020754	Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.224600	0.79576	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.12147	2.71	5.65	5.65	0.86999	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000005	T	0.35913	0.0948	M	0.78801	2.425	0.80722	D	1	D	0.60575	0.988	P	0.61132	0.884	T	0.09885	-1.0654	10	0.59425	D	0.04	.	15.2098	0.73214	0.0:0.0:0.0:1.0	.	196	Q2M1Z3	RHG31_HUMAN	P	196	ENSP00000264245:L196P	ENSP00000264245:L196P	L	+	2	0	ARHGAP31	120584668	1.000000	0.71417	0.984000	0.44739	0.978000	0.69477	3.663000	0.54518	2.371000	0.80710	0.533000	0.62120	CTT	.		0.448	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
CATIP	375307	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	219222268	219222286	+	Frame_Shift_Del	DEL	CTACAGATGCTGTTCTTCT	CTACAGATGCTGTTCTTCT	-	rs376076590		TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	CTACAGATGCTGTTCTTCT	CTACAGATGCTGTTCTTCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr2:219222268_219222286delCTACAGATGCTGTTCTTCT	ENST00000289388.3	+	3	159_177	c.130_148delCTACAGATGCTGTTCTTCT	c.(130-150)ctacagatgctgttcttctctfs	p.LQMLFFS44fs	AC021016.8_ENST00000411433.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		44					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L44L(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAAGGAGGAGCTACAGATGCTGTTCTTCTCTGAGACGCT	0.589																																					p.44_50del		.											.	C2orf62	68	1	Substitution - coding silent(1)	endometrium(1)	c.130_148del						.																																			SO:0001589	frameshift_variant	375307	exon3			GAGGAGCTACAGA																												ENST00000289388.3:c.130_148delCTACAGATGCTGTTCTTCT	2.37:g.219222268_219222286delCTACAGATGCTGTTCTTCT	ENSP00000289388:p.Leu44fs	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	16.0	NM_198559		Frame_Shift_Del	DEL	ENST00000289388.3	37	CCDS2414.1																																																																																			.		0.589	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
CADM1	23705	hgsc.bcm.edu;broad.mit.edu	37	11	115047284	115047285	+	Frame_Shift_Ins	INS	-	-	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr11:115047284_115047285insC	ENST00000452722.3	-	10	1258_1259	c.1238_1239insG	c.(1237-1239)ggafs	p.G413fs	CADM1_ENST00000331581.6_Frame_Shift_Ins_p.G442fs|CADM1_ENST00000537058.1_Frame_Shift_Ins_p.G424fs|CADM1_ENST00000537140.1_Intron|CADM1_ENST00000542447.2_Frame_Shift_Ins_p.G385fs|CADM1_ENST00000536727.1_Frame_Shift_Ins_p.G414fs	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		CGTCATCGGCTCCTTTGGCTTC	0.46																																					p.G413fs		.											.	CADM1	92	0			c.1239_1240insG						.																																			SO:0001589	frameshift_variant	23705	exon10			ATCGGCTCCTTTG	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1239dupG	11.37:g.115047286_115047286dupC	ENSP00000395359:p.Gly413fs	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	547.0	37.0	NM_014333		Frame_Shift_Ins	INS	ENST00000452722.3	37	CCDS8373.1																																																																																			.		0.460	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
CCDC168	643677	hgsc.bcm.edu;ucsc.edu	37	13	103390332	103390332	+	5'Flank	SNP	C	C	T	rs200872789	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr13:103390332C>T	ENST00000322527.2	-	0	0					NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168																		tcttcaacttcgtgatccatt	0.448													C|||	18	0.00359425	0.0008	0.0014	5008	,	,		21577	0.003		0.0	False		,,,				2504	0.0133				p.E4239K		.											.	.	.	0			c.G12715A						.	C	LYS/GLU	2,1382		0,2,690	140.0	111.0	120.0		12715	-0.3	0.0	13		120	1,3181		0,1,1590	yes	missense	CCDC168	NM_001146197.1	56	0,3,2280	TT,TC,CC		0.0314,0.1445,0.0657		4239/7082	103390332	3,4563	692	1591	2283	SO:0001631	upstream_gene_variant	643677	exon4			CAACTTCGTGATC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287		13.37:g.103390332C>T	Exception_encountered	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	924.0	375.0	NM_001146197	Q8N800	Missense_Mutation	SNP	ENST00000322527.2	37																																																																																				.		0.448	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
CCDC57	284001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	80115731	80115731	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr17:80115731G>A	ENST00000389641.4	-	14	2170	c.2134C>T	c.(2134-2136)Cag>Tag	p.Q712*	RP11-1376P16.1_ENST00000582774.1_RNA|CCDC57_ENST00000392343.3_Nonsense_Mutation_p.Q712*|CCDC57_ENST00000327026.3_5'UTR|CCDC57_ENST00000392347.1_Nonsense_Mutation_p.Q712*			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	712										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			TCAGCCACCTGCTTCCGCAGC	0.682																																					p.Q712X		.											.	CCDC57	24	0			c.C2134T						.						25.0	29.0	27.0					17																	80115731		1989	4159	6148	SO:0001587	stop_gained	284001	exon14			CCACCTGCTTCCG	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2134C>T	17.37:g.80115731G>A	ENSP00000374292:p.Gln712*	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	28.0	NM_198082	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Nonsense_Mutation	SNP	ENST00000389641.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.540187|5.540187	0.96474|0.96474	.|.	.|.	ENSG00000176155|ENSG00000176155	ENST00000419322|ENST00000389641;ENST00000392347;ENST00000327026;ENST00000392343	.|.	.|.	.|.	3.19|3.19	2.15|2.15	0.27550|0.27550	.|.	.|0.000000	.|0.38959	.|N	.|0.001517	T|.	0.60932|.	0.2307|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.58918|.	-0.7551|.	4|.	.|0.49607	.|T	.|0.09	-22.0135|-22.0135	8.1007|8.1007	0.30854|0.30854	0.0:0.2506:0.7494:0.0|0.0:0.2506:0.7494:0.0	.|.	.|.	.|.	.|.	V|X	57|712;712;220;712	.|.	.|ENSP00000315967:Q220X	A|Q	-|-	2|1	0|0	CCDC57|CCDC57	77709020|77709020	0.988000|0.988000	0.35896|0.35896	0.645000|0.645000	0.29479|0.29479	0.176000|0.176000	0.22953|0.22953	2.236000|2.236000	0.43052|0.43052	0.612000|0.612000	0.30071|0.30071	0.462000|0.462000	0.41574|0.41574	GCA|CAG	.		0.682	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082	
CDHR1	92211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	85960359	85960359	+	Silent	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr10:85960359C>T	ENST00000372117.3	+	6	544	c.441C>T	c.(439-441)gaC>gaT	p.D147D	CDHR1_ENST00000332904.3_Silent_p.D147D|CDHR1_ENST00000440770.2_5'Flank	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	147	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CCCCTCAGGACATACCTGCTG	0.592																																					p.D147D		.											.	CDHR1	91	0			c.C441T						.						79.0	58.0	65.0					10																	85960359		2203	4300	6503	SO:0001819	synonymous_variant	92211	exon6			TCAGGACATACCT	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.441C>T	10.37:g.85960359C>T		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	62.0	NM_001171971	Q69YZ8|Q8IXY5	Silent	SNP	ENST00000372117.3	37	CCDS7372.1																																																																																			.		0.592	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
CDK13	8621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	40085553	40085553	+	Silent	SNP	T	T	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr7:40085553T>C	ENST00000181839.4	+	6	3077	c.2472T>C	c.(2470-2472)ggT>ggC	p.G824G	CDK13_ENST00000484589.1_3'UTR|CDK13_ENST00000340829.5_Silent_p.G824G	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	824	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						TCATGGAGGGTCTGGATTATT	0.313																																					p.G824G		.											.	CDK13	548	0			c.T2472C						.						131.0	139.0	136.0					7																	40085553		2203	4300	6503	SO:0001819	synonymous_variant	8621	exon6			GGAGGGTCTGGAT	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.2472T>C	7.37:g.40085553T>C		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	74.0	NM_003718	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Silent	SNP	ENST00000181839.4	37	CCDS5461.1																																																																																			.		0.313	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718	
CDO1	1036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	115146946	115146946	+	Silent	SNP	T	T	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr5:115146946T>C	ENST00000250535.4	-	3	871	c.315A>G	c.(313-315)acA>acG	p.T105T	CDO1_ENST00000502631.1_5'UTR	NM_001801.2	NP_001792.2	Q16878	CDO1_HUMAN	cysteine dioxygenase type 1	105					cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|inflammatory response (GO:0006954)|L-cysteine catabolic process (GO:0019448)|lactation (GO:0007595)|oxidation-reduction process (GO:0055114)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid biosynthetic process (GO:0000097)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)	cytosol (GO:0005829)	cysteine dioxygenase activity (GO:0017172)|ferrous iron binding (GO:0008198)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|skin(5)	11		all_cancers(142;0.0046)|all_epithelial(76;0.000161)|Prostate(80;0.0132)|Ovarian(225;0.0776)		OV - Ovarian serous cystadenocarcinoma(64;7.8e-08)|Epithelial(69;7.32e-07)|all cancers(49;3.24e-05)	L-Cysteine(DB00151)	AGGCAAATAATGTCTCCTTTA	0.393																																					p.T105T		.											.	CDO1	154	0			c.A315G						.						218.0	209.0	212.0					5																	115146946		2202	4300	6502	SO:0001819	synonymous_variant	1036	exon3			AAATAATGTCTCC		CCDS4121.1	5q23.2	2013-06-11	2013-06-11		ENSG00000129596	ENSG00000129596	1.13.11.20		1795	protein-coding gene	gene with protein product		603943	"""cysteine dioxygenase, type I"""			7524679	Standard	NM_001801		Approved		uc003krg.3	Q16878	OTTHUMG00000128891	ENST00000250535.4:c.315A>G	5.37:g.115146946T>C		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	302.0	120.0	NM_001801	B2RAK4|P78513|Q6FHZ8|Q8TB64	Silent	SNP	ENST00000250535.4	37	CCDS4121.1																																																																																			.		0.393	CDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250853.2	NM_001801	
CHL1	10752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	440785	440785	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr3:440785A>T	ENST00000256509.2	+	26	3981	c.3339A>T	c.(3337-3339)ttA>ttT	p.L1113F	CHL1_ENST00000397491.2_Missense_Mutation_p.L1097F	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CACTACTATTATTAACTGTTT	0.358																																					p.L1113F		.											.	CHL1	583	0			c.A3339T						.						196.0	188.0	190.0					3																	440785		2203	4300	6503	SO:0001583	missense	10752	exon26			ACTATTATTAACT	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3339A>T	3.37:g.440785A>T	ENSP00000256509:p.Leu1113Phe	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	456.0	196.0	NM_006614	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.92|17.92	3.505650|3.505650	0.64410|0.64410	.|.	.|.	ENSG00000134121|ENSG00000134121	ENST00000256509;ENST00000397491|ENST00000445697	T;T|.	0.70631|.	-0.5;-0.47|.	5.45|5.45	2.24|2.24	0.28232|0.28232	.|.	0.081995|.	0.51477|.	D|.	0.000098|.	T|T	0.63486|0.63486	0.2515|0.2515	M|M	0.63428|0.63428	1.95|1.95	0.39107|0.39107	D|D	0.961404|0.961404	D;D;D|.	0.89917|.	1.0;1.0;0.996|.	D;D;D|.	0.87578|.	0.998;0.993;0.974|.	T|T	0.63976|0.63976	-0.6515|-0.6515	10|5	0.87932|.	D|.	0|.	.|.	12.3397|12.3397	0.55087|0.55087	0.2175:0.0:0.7825:0.0|0.2175:0.0:0.7825:0.0	.|.	1097;1097;1113|.	B3KX75;O00533;O00533-2|.	.;CHL1_HUMAN;.|.	F|F	1113;1097|247	ENSP00000256509:L1113F;ENSP00000380628:L1097F|.	ENSP00000256509:L1113F|.	L|Y	+|+	3|2	2|0	CHL1|CHL1	415785|415785	1.000000|1.000000	0.71417|0.71417	0.160000|0.160000	0.22671|0.22671	0.875000|0.875000	0.50365|0.50365	1.949000|1.949000	0.40313|0.40313	0.672000|0.672000	0.31204|0.31204	-0.146000|-0.146000	0.13790|0.13790	TTA|TAT	.		0.358	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CLEC4F	165530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71047619	71047619	+	Missense_Mutation	SNP	G	G	T	rs575554427		TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr2:71047619G>T	ENST00000272367.2	-	1	113	c.37C>A	c.(37-39)Cag>Aag	p.Q13K	CLEC4F_ENST00000426626.1_Missense_Mutation_p.Q13K	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	13					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						GAGACACACTGGTTATCTGTG	0.617																																					p.Q13K	Colon(107;10 2157 6841 26035)	.											.	CLEC4F	95	0			c.C37A						.						109.0	78.0	89.0					2																	71047619		2203	4299	6502	SO:0001583	missense	165530	exon1			CACACTGGTTATC	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.37C>A	2.37:g.71047619G>T	ENSP00000272367:p.Gln13Lys	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	49.0	NM_173535	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.734209	0.48939	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.03330	3.99;3.97	3.36	2.44	0.29823	.	.	.	.	.	T	0.05547	0.0146	L	0.52573	1.65	0.09310	N	0.999999	P;P	0.51057	0.941;0.941	B;B	0.44224	0.444;0.444	T	0.33650	-0.9860	9	0.87932	D	0	.	8.4551	0.32895	0.0:0.2405:0.7595:0.0	.	13;13	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	K	13	ENSP00000272367:Q13K;ENSP00000390581:Q13K	ENSP00000272367:Q13K	Q	-	1	0	CLEC4F	70901127	0.418000	0.25440	0.167000	0.22817	0.294000	0.27393	2.075000	0.41538	0.954000	0.37851	0.467000	0.42956	CAG	.		0.617	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
COX4I2	84701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	30227827	30227827	+	Silent	SNP	C	C	T	rs539460095		TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr20:30227827C>T	ENST00000376075.3	+	3	249	c.174C>T	c.(172-174)aaC>aaT	p.N58N	COX4I2_ENST00000490030.1_3'UTR	NM_032609.2	NP_115998.2	Q96KJ9	COX42_HUMAN	cytochrome c oxidase subunit IV isoform 2 (lung)	58					cellular respiration (GO:0045333)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)	mitochondrial respiratory chain complex IV (GO:0005751)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	11	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.01e-05)|all cancers(5;9.46e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00121)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			CAGAACTCAACGCTGAGGAGC	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		16861	0.001		0.0	False		,,,				2504	0.0				p.N58N		.											.	COX4I2	227	0			c.C174T						.						61.0	51.0	54.0					20																	30227827		2203	4300	6503	SO:0001819	synonymous_variant	84701	exon3			ACTCAACGCTGAG	AF257180	CCDS13187.1	20q11.21	2011-07-04	2004-08-11		ENSG00000131055	ENSG00000131055		"""Mitochondrial respiratory chain complex / Complex IV"""	16232	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit IV-like 2"""	607976	"""cytochrome c oxidase subunit IV isoform 2"""	COX4L2		11311561, 17937768	Standard	NM_032609		Approved	COXIV-2, COX4B, dJ857M17.2, COX4-2	uc002wwj.1	Q96KJ9	OTTHUMG00000032180	ENST00000376075.3:c.174C>T	20.37:g.30227827C>T		Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	11.0	NM_032609	Q6GTF4|Q9H0Z4	Silent	SNP	ENST00000376075.3	37	CCDS13187.1																																																																																			.		0.612	COX4I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078548.1	NM_032609	
CTNNB1	1499	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266100	41266100	+	Missense_Mutation	SNP	T	T	G	rs121913416		TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr3:41266100T>G	ENST00000349496.5	+	3	377	c.97T>G	c.(97-99)Tct>Gct	p.S33A	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.S33P(47)|p.S33A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.W25_D32del(4)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.D32_S33insS(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33T(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TTACCTGGACTCTGGAATCCA	0.488		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33A	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,-1	CTNNB1	24361	212	Deletion - In frame(115)|Substitution - Missense(70)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(1)	liver(130)|large_intestine(20)|endometrium(14)|stomach(10)|pituitary(9)|pancreas(9)|central_nervous_system(8)|adrenal_gland(2)|small_intestine(2)|biliary_tract(2)|skin(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|breast(1)	c.T97G						.						93.0	77.0	82.0					3																	41266100		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTGGACTCTGGAA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.97T>G	3.37:g.41266100T>G	ENSP00000344456:p.Ser33Ala	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	239.0	105.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.317386	0.81469	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70281	0.3206	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74509	-0.3642	10	0.87932	D	0	-10.7796	16.0677	0.80897	0.0:0.0:0.0:1.0	.	33	P35222	CTNB1_HUMAN	A	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26A;ENSP00000385604:S33A;ENSP00000412219:S33A;ENSP00000379486:S33A;ENSP00000344456:S33A;ENSP00000411226:S26A;ENSP00000379488:S33A;ENSP00000409302:S33A;ENSP00000401599:S33A	ENSP00000344456:S33A	S	+	1	0	CTNNB1	41241104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TCT	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTU2	348180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	88776355	88776355	+	Silent	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr16:88776355C>T	ENST00000453996.2	+	3	221	c.153C>T	c.(151-153)ttC>ttT	p.F51F	CTU2_ENST00000312060.5_Silent_p.F51F|CTU2_ENST00000567949.1_Silent_p.F51F|CTU2_ENST00000378384.3_Intron	NM_001012759.1	NP_001012777.1			cytosolic thiouridylase subunit 2 homolog (S. pombe)											NS(1)|breast(1)|endometrium(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11						GGGACTGTTTCAAGGCCTTCT	0.597																																					p.F51F		.											.	CTU2	23	0			c.C153T						.						170.0	166.0	167.0					16																	88776355		2198	4300	6498	SO:0001819	synonymous_variant	348180	exon3			CTGTTTCAAGGCC	BC021056	CCDS32506.1, CCDS45545.1	16q24.3	2013-10-11	2009-08-19	2009-08-19		ENSG00000174177			28005	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 84"""	C16orf84		19017811	Standard	NM_001012759		Approved	NCS2	uc002flm.3	Q2VPK5		ENST00000453996.2:c.153C>T	16.37:g.88776355C>T		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	44.0	NM_001012759		Silent	SNP	ENST00000453996.2	37	CCDS45545.1																																																																																			.		0.597	CTU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423025.1	NM_001012762	
CUTC	51076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	101503802	101503802	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr10:101503802C>T	ENST00000370476.5	+	5	541	c.412C>T	c.(412-414)Cgc>Tgc	p.R138C		NM_015960.2	NP_057044.2	Q9NTM9	CUTC_HUMAN	cutC copper transporter	138					copper ion homeostasis (GO:0055070)|copper ion transport (GO:0006825)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	copper ion binding (GO:0005507)	p.R138G(1)|p.R138C(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Colorectal(252;0.234)		Epithelial(162;3e-10)|all cancers(201;2.37e-08)		AGCTATTTGCCGCCCTCTGCC	0.338																																					p.R138C		.											.	CUTC	153	2	Substitution - Missense(2)	prostate(1)|lung(1)	c.C412T						.						130.0	123.0	126.0					10																	101503802		2203	4300	6503	SO:0001583	missense	51076	exon5			ATTTGCCGCCCTC	AF132966	CCDS7483.1	10q24.31	2013-07-31	2013-07-31		ENSG00000119929	ENSG00000119929			24271	protein-coding gene	gene with protein product		610101	"""cutC copper transporter homolog (E. coli)"""			16182249	Standard	NM_015960		Approved	CGI-32	uc001kqd.4	Q9NTM9	OTTHUMG00000018889	ENST00000370476.5:c.412C>T	10.37:g.101503802C>T	ENSP00000359507:p.Arg138Cys	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	85.0	NM_015960	Q5TCZ8|Q9Y321	Missense_Mutation	SNP	ENST00000370476.5	37	CCDS7483.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828442	0.50845	.	.	ENSG00000119929	ENST00000370476;ENST00000370472	.	.	.	4.97	4.97	0.65823	Copper homeostasis CutC domain (2);	0.051997	0.85682	D	0.000000	T	0.63780	0.2540	M	0.83223	2.63	0.80722	D	1	P;B	0.36027	0.533;0.101	B;B	0.24269	0.052;0.03	T	0.70092	-0.4967	9	0.48119	T	0.1	-9.0535	18.7716	0.91894	0.0:1.0:0.0:0.0	.	138;138	B4DYM2;Q9NTM9	.;CUTC_HUMAN	C	138;75	.	ENSP00000359503:R75C	R	+	1	0	CUTC	101493792	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	6.643000	0.74334	2.727000	0.93392	0.591000	0.81541	CGC	.		0.338	CUTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049811.1	NM_015960	
CYP39A1	51302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46607278	46607278	+	Silent	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr6:46607278C>T	ENST00000275016.2	-	3	644	c.441G>A	c.(439-441)ctG>ctA	p.L147L		NM_016593.3	NP_057677.2	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A, polypeptide 1	147					bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	24-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033782)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)|steroid 7-alpha-hydroxylase activity (GO:0008387)		EIF3K/CYP39A1(2)	NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)	21						CTAAATTCTCCAGTTGTTCAT	0.353																																					p.L147L		.											.	CYP39A1	91	0			c.G441A						.						139.0	131.0	134.0					6																	46607278		2203	4300	6503	SO:0001819	synonymous_variant	51302	exon3			ATTCTCCAGTTGT	AF237982	CCDS4916.1, CCDS75465.1	6p21.1-p11.2	2008-02-05	2003-01-14		ENSG00000146233	ENSG00000146233		"""Cytochrome P450s"""	17449	protein-coding gene	gene with protein product		605994	"""cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1"""			10748047	Standard	NM_016593		Approved		uc003oyf.1	Q9NYL5	OTTHUMG00000014785	ENST00000275016.2:c.441G>A	6.37:g.46607278C>T		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	336.0	138.0	NM_016593	Q5VTT0|Q96FW5	Silent	SNP	ENST00000275016.2	37	CCDS4916.1																																																																																			.		0.353	CYP39A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040787.1		
CYP4F3	4051	broad.mit.edu;ucsc.edu	37	19	15760906	15760906	+	Silent	SNP	C	C	T	rs28371480	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr19:15760906C>T	ENST00000221307.8	+	7	878	c.831C>T	c.(829-831)acC>acT	p.T277T	CYP4F3_ENST00000591058.1_Silent_p.T277T|CYP4F3_ENST00000586182.2_Silent_p.T277T|CYP4F3_ENST00000585846.1_Silent_p.T277T	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	277					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						GGCGCCGCACCCTCCCTAGCC	0.582													.|||	3	0.000599042	0.0015	0.0014	5008	,	,		19134	0.0		0.0	False		,,,				2504	0.0				p.T277T		.											.	CYP4F3	93	0			c.C831T						.						110.0	99.0	102.0					19																	15760906		2203	4300	6503	SO:0001819	synonymous_variant	4051	exon7			CCGCACCCTCCCT	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.831C>T	19.37:g.15760906C>T		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	39.0	NM_001199209	B7Z8Z3|O60634|Q5U740	Silent	SNP	ENST00000221307.8	37	CCDS12332.1																																																																																			C|0.014;T|0.986		0.582	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
DHX37	57647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	125453127	125453127	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr12:125453127C>A	ENST00000308736.2	-	10	1459	c.1361G>T	c.(1360-1362)gGc>gTc	p.G454V	DHX37_ENST00000544745.1_Missense_Mutation_p.G241V	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	454							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GAAGCACTCGCCACTGTAGTC	0.612																																					p.G454V		.											.	DHX37	227	0			c.G1361T						.						133.0	133.0	133.0					12																	125453127		2203	4300	6503	SO:0001583	missense	57647	exon10			CACTCGCCACTGT	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1361G>T	12.37:g.125453127C>A	ENSP00000311135:p.Gly454Val	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	16.0	NM_032656	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.756702	0.31137	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.03831	3.79;3.79	4.6	4.6	0.57074	.	0.104012	0.64402	D	0.000003	T	0.07773	0.0195	M	0.63428	1.95	0.80722	D	1	B	0.14438	0.01	B	0.17098	0.017	T	0.12372	-1.0550	10	0.32370	T	0.25	-27.7653	13.9708	0.64240	0.0:0.847:0.153:0.0	.	454	Q8IY37	DHX37_HUMAN	V	454;241	ENSP00000311135:G454V;ENSP00000439009:G241V	ENSP00000311135:G454V	G	-	2	0	DHX37	124019080	0.998000	0.40836	0.770000	0.31555	0.759000	0.43091	3.530000	0.53539	2.263000	0.75096	0.561000	0.74099	GGC	.		0.612	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
DLG4	1742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7097812	7097812	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr17:7097812G>A	ENST00000399506.2	-	12	1495	c.1304C>T	c.(1303-1305)gCc>gTc	p.A435V	DLG4_ENST00000302955.6_Missense_Mutation_p.A432V|DLG4_ENST00000399510.2_Missense_Mutation_p.A478V			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	435	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	ATCAAACAGGGCCCTGGAGGG	0.597																																					p.A478V		.											.	DLG4	24	0			c.C1433T						.						28.0	32.0	31.0					17																	7097812		2041	4198	6239	SO:0001583	missense	1742	exon14			AACAGGGCCCTGG	U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.1304C>T	17.37:g.7097812G>A	ENSP00000382425:p.Ala435Val	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	30.0	NM_001365	B7Z1S1|G5E939|Q92941|Q9UKK8	Missense_Mutation	SNP	ENST00000399506.2	37		.	.	.	.	.	.	.	.	.	.	G	35	5.555178	0.96514	.	.	ENSG00000132535	ENST00000399506;ENST00000302955;ENST00000399510;ENST00000293813;ENST00000380912;ENST00000539674	T;T;T	0.80304	-1.36;-1.36;-1.36	5.3	5.3	0.74995	Src homology-3 domain (4);	.	.	.	.	D	0.91358	0.7274	M	0.90309	3.105	0.80722	D	1	D;D;D;D	0.76494	0.995;0.999;0.998;0.989	D;D;D;D	0.79784	0.953;0.972;0.985;0.993	D	0.92680	0.6157	9	0.87932	D	0	.	16.5016	0.84259	0.0:0.0:1.0:0.0	.	475;435;432;478	B9EGL1;P78352;G5E939;P78352-2	.;DLG4_HUMAN;.;.	V	435;432;478;478;375;478	ENSP00000382425:A435V;ENSP00000307471:A432V;ENSP00000382428:A478V	ENSP00000293813:A478V	A	-	2	0	DLG4	7038536	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.601000	0.98297	2.769000	0.95229	0.655000	0.94253	GCC	.		0.597	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000259419.2	NM_001365	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	85043137	85043137	+	Silent	SNP	G	G	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr2:85043137G>A	ENST00000237449.6	+	75	12311	c.12303G>A	c.(12301-12303)aaG>aaA	p.K4101K	DNAH6_ENST00000389394.3_Silent_p.K4101K			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	4101					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AAAACTATAAGCCAAGCCCAA	0.458																																					p.K4101K		.											.	DNAH6	69	0			c.G12303A						.						163.0	143.0	149.0					2																	85043137		692	1591	2283	SO:0001819	synonymous_variant	1768	exon76			CTATAAGCCAAGC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.12303G>A	2.37:g.85043137G>A		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	228.0	85.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.458	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DSPP	1834	hgsc.bcm.edu;broad.mit.edu	37	4	88536644	88536652	+	In_Frame_Del	DEL	AGCAGTGAT	AGCAGTGAT	-	rs373734188|rs370270012		TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	AGCAGTGAT	AGCAGTGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr4:88536644_88536652delAGCAGTGAT	ENST00000282478.7	+	4	2863_2871	c.2830_2838delAGCAGTGAT	c.(2830-2838)agcagtgatdel	p.SSD947del	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_In_Frame_Del_p.SSD947del			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	947	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		cagcagtgacagcagtgatagcagtgaca	0.488																																					p.944_946del		.											.	DSPP	90	0			c.2830_2838del						.			177,2963		17,143,1410						-0.2	0.4			97	21,5613		8,5,2804	no	coding	DSPP	NM_014208.3		25,148,4214	A1A1,A1R,RR		0.3727,5.6369,2.2567				198,8576				SO:0001651	inframe_deletion	1834	exon5			AGTGACAGCAGTG	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2830_2838delAGCAGTGAT	4.37:g.88536644_88536652delAGCAGTGAT	ENSP00000282478:p.Ser947_Asp949del	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	353.0	25.0	NM_014208	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.488	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
EDNRA	1909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	148457097	148457097	+	Silent	SNP	G	G	A	rs200693894		TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr4:148457097G>A	ENST00000324300.5	+	5	1331	c.816G>A	c.(814-816)gcG>gcA	p.A272A	EDNRA_ENST00000506066.1_Silent_p.A163A|EDNRA_ENST00000503721.1_3'UTR|EDNRA_ENST00000358556.4_Silent_p.A163A|EDNRA_ENST00000511804.1_Silent_p.A47A|EDNRA_ENST00000339690.5_3'UTR	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	272					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TGTGCACTGCGATCTTCTACA	0.418																																					p.A272A		.											.	EDNRA	586	0			c.G816A						.						220.0	205.0	210.0					4																	148457097		2203	4300	6503	SO:0001819	synonymous_variant	1909	exon5			CACTGCGATCTTC	D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.816G>A	4.37:g.148457097G>A		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	297.0	127.0	NM_001957	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Silent	SNP	ENST00000324300.5	37	CCDS3769.1																																																																																			.		0.418	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364635.1		
EFCAB14	9813	broad.mit.edu;bcgsc.ca	37	1	47144307	47144307	+	Splice_Site	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:47144307A>G	ENST00000371933.3	-	11	2290	c.1314T>C	c.(1312-1314)gaT>gaC	p.D438D	EFCAB14-AS1_ENST00000418985.1_RNA|EFCAB14_ENST00000544071.1_Intron|EFCAB14-AS1_ENST00000442839.1_RNA	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	438	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)										AATCCTGAAGATCTGTCAAAA	0.388																																					p.D438D		.											.	.	.	0			c.T1314C						.						59.0	60.0	60.0					1																	47144307		2203	4300	6503	SO:0001630	splice_region_variant	9813	exon11			CTGAAGATCTGTC	AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.1313-1T>C	1.37:g.47144307A>G		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	6.0	NM_014774	D3DQ23|Q5SXB8	Silent	SNP	ENST00000371933.3	37	CCDS30706.1																																																																																			.		0.388	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021931.1	NM_014774	Silent
EFEMP2	30008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65638628	65638628	+	Splice_Site	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr11:65638628C>A	ENST00000307998.6	-	4	597	c.367G>T	c.(367-369)Gat>Tat	p.D123Y	EFEMP2_ENST00000528176.1_Splice_Site_p.D123Y	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	123	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		CCCCACTCACCCACACAGCTG	0.632																																					p.D123Y		.											.	EFEMP2	91	0			c.G367T						.						58.0	56.0	57.0					11																	65638628		2201	4296	6497	SO:0001630	splice_region_variant	30008	exon4			ACTCACCCACACA	AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.367+1G>T	11.37:g.65638628C>A		Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	20.0	NM_016938	A8K7R4|B3KM31|B3KQT1|O75967	Missense_Mutation	SNP	ENST00000307998.6	37	CCDS8116.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308672	0.81247	.	.	ENSG00000172638	ENST00000528176;ENST00000307998;ENST00000526624;ENST00000527378	D;D;D;D	0.99080	-5.4;-5.4;-5.4;-5.4	4.58	4.58	0.56647	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.39834	N	0.001260	D	0.99408	0.9791	M	0.93241	3.395	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.70487	0.969;0.966	D	0.98440	1.0586	9	.	.	.	.	14.88	0.70525	0.0:1.0:0.0:0.0	.	123;123	E9PRU1;O95967	.;FBLN4_HUMAN	Y	123	ENSP00000434151:D123Y;ENSP00000309953:D123Y;ENSP00000435419:D123Y;ENSP00000435963:D123Y	.	D	-	1	0	EFEMP2	65395204	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	5.096000	0.64535	2.361000	0.80049	0.655000	0.94253	GAT	.		0.632	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	NM_016938	Missense_Mutation
EXD3	54932	broad.mit.edu;mdanderson.org	37	9	140201464	140201464	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr9:140201464C>A	ENST00000340951.4	-	22	2764	c.2569G>T	c.(2569-2571)Gag>Tag	p.E857*	EXD3_ENST00000342129.4_Nonsense_Mutation_p.E495*	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						GGGGCGCTCTCCAGCATGTCT	0.652																																					p.E857X		.											.	EXD3	90	0			c.G2569T						.						21.0	26.0	24.0					9																	140201464		2009	4148	6157	SO:0001587	stop_gained	54932	exon22			CGCTCTCCAGCAT		CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.2569G>T	9.37:g.140201464C>A	ENSP00000340474:p.Glu857*	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	10.0	NM_017820	Q6P1M1|Q8IXT8	Nonsense_Mutation	SNP	ENST00000340951.4	37	CCDS48066.1	.	.	.	.	.	.	.	.	.	.	C	34	5.310834	0.95629	.	.	ENSG00000187609	ENST00000342129;ENST00000340951	.	.	.	3.6	-2.35	0.06684	.	.	.	.	.	.	.	.	.	.	.	0.20764	N	0.99986	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	4.8787	0.13668	0.0:0.4972:0.1488:0.3539	.	.	.	.	X	495;857	.	ENSP00000340474:E857X	E	-	1	0	EXD3	139321285	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.333000	0.02667	-0.897000	0.03910	-0.291000	0.09656	GAG	.		0.652	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343182.1	NM_017820	
FLAD1	80308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154960711	154960711	+	Missense_Mutation	SNP	A	A	C	rs150372864	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:154960711A>C	ENST00000292180.3	+	2	825	c.503A>C	c.(502-504)aAc>aCc	p.N168T	FLAD1_ENST00000315144.10_Missense_Mutation_p.N71T|FLAD1_ENST00000295530.2_5'UTR|FLAD1_ENST00000368432.1_Missense_Mutation_p.N71T|FLAD1_ENST00000368428.1_5'Flank|FLAD1_ENST00000405236.2_Missense_Mutation_p.N69T|FLAD1_ENST00000368431.3_Missense_Mutation_p.N69T|FLAD1_ENST00000368433.1_Missense_Mutation_p.N168T|FLAD1_ENST00000487371.1_3'UTR	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	168	Molybdenum cofactor biosynthesis protein- like.				FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TCTTTCTCCAACCGCTTCACC	0.577																																					p.N168T		.											.	FLAD1	93	0			c.A503C						.						114.0	102.0	106.0					1																	154960711		2203	4300	6503	SO:0001583	missense	80308	exon2			TCTCCAACCGCTT		CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.503A>C	1.37:g.154960711A>C	ENSP00000292180:p.Asn168Thr	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	257.0	73.0	NM_025207	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	ENST00000292180.3	37	CCDS1078.1	.	.	.	.	.	.	.	.	.	.	A	11.53	1.667216	0.29604	.	.	ENSG00000160688	ENST00000368433;ENST00000315144;ENST00000368432;ENST00000368431;ENST00000292180;ENST00000405236	T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	5.71	1.31	0.21738	Molybdopterin binding (4);	0.638299	0.17105	N	0.186857	T	0.36331	0.0963	N	0.16130	0.375	0.21499	N	0.999663	B;B	0.06786	0.0;0.001	B;B	0.08055	0.0;0.003	T	0.30208	-0.9986	10	0.28530	T	0.3	-6.2245	7.9288	0.29891	0.1781:0.4961:0.3258:0.0	.	168;69	Q8NFF5;Q8NFF5-4	FAD1_HUMAN;.	T	168;71;71;69;168;69	ENSP00000357418:N168T;ENSP00000317296:N71T;ENSP00000357417:N71T;ENSP00000357416:N69T;ENSP00000292180:N168T;ENSP00000384323:N69T	ENSP00000292180:N168T	N	+	2	0	FLAD1	153227335	0.912000	0.30974	0.999000	0.59377	0.983000	0.72400	2.376000	0.44292	0.320000	0.23234	-0.313000	0.08912	AAC	A|1.000;G|0.000;T|0.000		0.577	FLAD1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091089.1	NM_025207	
FCGR3A	2214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161596059	161596059	+	Intron	SNP	A	A	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:161596059A>C	ENST00000540048.1	-	2	94				FCGR2B_ENST00000403078.3_Intron|FCGR3B_ENST00000531221.1_Missense_Mutation_p.F187L|FCGR2B_ENST00000367962.4_Intron|FCGR3B_ENST00000367964.2_Missense_Mutation_p.F151L|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000428605.2_Intron|FCGR3B_ENST00000294800.3_Missense_Mutation_p.F151L			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AATTATGATGAAAATACTTCC	0.443																																					p.F187L		.											.	FCGR3B	22	0			c.T561G						.						152.0	151.0	151.0					1																	161596059		2191	4299	6490	SO:0001627	intron_variant	2215	exon4			ATGATGAAAATAC	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+4098T>G	1.37:g.161596059A>C		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	160.0	NM_001244753	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000540048.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	7.898|7.898	0.733772|0.733772	0.15574|0.15574	.|.	.|.	ENSG00000162747|ENSG00000162747	ENST00000367964;ENST00000294800;ENST00000531221|ENST00000421702	T;T;T|.	0.11821|.	2.74;2.74;2.74|.	2.35|2.35	-2.11|-2.11	0.07187|0.07187	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);|.	0.778704|.	0.10279|.	U|.	0.693741|.	T|T	0.10766|0.10766	0.0263|0.0263	L|L	0.39898|0.39898	1.24|1.24	0.09310|0.09310	N|N	1|1	D|.	0.56287|.	0.975|.	P|.	0.48677|.	0.586|.	T|T	0.34477|0.34477	-0.9827|-0.9827	10|5	0.25106|.	T|.	0.35|.	.|.	2.9454|2.9454	0.05845|0.05845	0.3664:0.2608:0.3728:0.0|0.3664:0.2608:0.3728:0.0	.|.	151|.	O75015|.	FCG3B_HUMAN|.	L|A	151;151;187|172	ENSP00000356941:F151L;ENSP00000294800:F151L;ENSP00000433642:F187L|.	ENSP00000294800:F151L|.	F|S	-|-	3|1	2|0	FCGR3B|FCGR3B	159862683|159862683	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.098000|0.098000	0.18820|0.18820	-0.432000|-0.432000	0.06956|0.06956	-0.170000|-0.170000	0.10816|0.10816	0.155000|0.155000	0.16302|0.16302	TTT|TCA	.		0.443	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569	
FNDC3B	64778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	172098773	172098773	+	Silent	SNP	T	T	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr3:172098773T>C	ENST00000336824.4	+	25	3292	c.3193T>C	c.(3193-3195)Tta>Cta	p.L1065L	FNDC3B_ENST00000415807.2_Silent_p.L1065L|FNDC3B_ENST00000416957.1_Silent_p.L1065L	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	1065	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		AGTAACACAGTTAGAAGGAAA	0.378																																					p.L1065L		.											.	FNDC3B	155	0			c.T3193C						.						168.0	161.0	163.0					3																	172098773		2203	4300	6503	SO:0001819	synonymous_variant	64778	exon25			ACACAGTTAGAAG	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.3193T>C	3.37:g.172098773T>C		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	31.0	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	ENST00000336824.4	37	CCDS3217.1																																																																																			.		0.378	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
GALNT4	8693	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	89916794	89916794	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr12:89916794A>C	ENST00000529983.2	-	1	1789	c.1533T>G	c.(1531-1533)aaT>aaG	p.N511K	POC1B_ENST00000549035.1_Intron|GALNT4_ENST00000413530.1_Missense_Mutation_p.N339K|POC1B-GALNT4_ENST00000547474.1_3'UTR|POC1B_ENST00000541909.1_Intron|POC1B_ENST00000313546.3_Intron|POC1B_ENST00000549504.1_Intron|POC1B-GALNT4_ENST00000548729.1_Missense_Mutation_p.N508K|RP11-734K2.4_ENST00000605233.1_RNA|POC1B_ENST00000393179.4_Intron	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	511	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						TTCCCACATAATTTTTTTGCT	0.363																																					p.N511K		.											.	.	.	0			c.T1533G						.						65.0	62.0	63.0					12																	89916794		1832	4085	5917	SO:0001583	missense	8693	exon1			CACATAATTTTTT	Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.1533T>G	12.37:g.89916794A>C	ENSP00000436604:p.Asn511Lys	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	83.0	NM_003774	B2R775|B4DMX6|O00208	Missense_Mutation	SNP	ENST00000529983.2	37	CCDS53817.1	.	.	.	.	.	.	.	.	.	.	A	8.561	0.877726	0.17395	.	.	ENSG00000259075;ENSG00000259075;ENSG00000257594	ENST00000548729;ENST00000413530;ENST00000529983	T;T;T	0.32023	1.47;1.47;1.47	5.93	-0.841	0.10752	Ricin B-related lectin (1);Ricin B lectin (3);	.	.	.	.	T	0.09730	0.0239	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.29305	-1.0016	9	0.21014	T	0.42	.	0.3181	0.00298	0.3187:0.265:0.1911:0.2253	.	508;511	F8VUJ3;Q8N4A0	.;GALT4_HUMAN	K	508;339;511	ENSP00000447852:N508K;ENSP00000389686:N339K;ENSP00000436604:N511K	ENSP00000436604:N511K	N	-	3	2	GALNT4;RP11-1109F11.4	88440925	0.000000	0.05858	0.000000	0.03702	0.954000	0.61252	-0.508000	0.06344	-0.144000	0.11314	0.482000	0.46254	AAT	.		0.363	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388973.2	NM_003774	
GPR137B	7107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	236368456	236368456	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:236368456T>A	ENST00000366592.3	+	6	1088	c.997T>A	c.(997-999)Ttc>Atc	p.F333I	GPR137B_ENST00000477559.1_3'UTR	NM_003272.3	NP_003263.1	O60478	G137B_HUMAN	G protein-coupled receptor 137B	333						integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			CAGCCATGGATTCAGTCCCAG	0.463																																					p.F333I		.											.	GPR137B	90	0			c.T997A						.						181.0	179.0	180.0					1																	236368456		2203	4300	6503	SO:0001583	missense	7107	exon6			CATGGATTCAGTC	AF027826	CCDS1609.1	1q42-q43	2012-08-10	2006-01-26	2006-01-26	ENSG00000077585	ENSG00000077585			11862	protein-coding gene	gene with protein product		604658	"""transmembrane 7 superfamily member 1 (upregulated in kidney)"""	TM7SF1		9521871	Standard	NM_003272		Approved		uc001hxq.3	O60478	OTTHUMG00000037994	ENST00000366592.3:c.997T>A	1.37:g.236368456T>A	ENSP00000355551:p.Phe333Ile	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	56.0	NM_003272	Q53EK7|Q5TAE6|Q6FHI3	Missense_Mutation	SNP	ENST00000366592.3	37	CCDS1609.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.128649|5.128649	0.94473|0.94473	.|.	.|.	ENSG00000077585|ENSG00000077585	ENST00000454895|ENST00000366592;ENST00000391852;ENST00000419162	.|T;T	.|0.48836	.|0.8;0.82	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	.|0.049214	.|0.85682	.|D	.|0.000000	T|T	0.59729|0.59729	0.2215|0.2215	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|P;P	.|0.51537	.|0.775;0.946	.|B;P	.|0.48840	.|0.225;0.592	T|T	0.65672|0.65672	-0.6111|-0.6111	5|10	.|0.62326	.|D	.|0.03	-35.2765|-35.2765	15.9906|15.9906	0.80202|0.80202	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|196;333	.|Q5TAF1;O60478	.|.;G137B_HUMAN	E|I	196|333;332;115	.|ENSP00000355551:F333I;ENSP00000401841:F115I	.|ENSP00000355551:F333I	D|F	+|+	3|1	2|0	GPR137B|GPR137B	234435079|234435079	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	3.697000|3.697000	0.54764|0.54764	2.257000|2.257000	0.74773|0.74773	0.528000|0.528000	0.53228|0.53228	GAT|TTC	.		0.463	GPR137B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092761.1	NM_003272	
HNRNPL	3191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39328060	39328060	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr19:39328060G>C	ENST00000221419.5	-	12	2041	c.1675C>G	c.(1675-1677)Ctg>Gtg	p.L559V	HNRNPL_ENST00000600873.1_Missense_Mutation_p.L426V|AC104534.3_ENST00000594769.1_Silent_p.L175L	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	559	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			AGGAAGCCCAGAGTCTCCAGG	0.522																																					p.L559V		.											.	HNRNPL	22	0			c.C1675G						.						86.0	82.0	83.0					19																	39328060		2203	4300	6503	SO:0001583	missense	3191	exon12			AGCCCAGAGTCTC	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1675C>G	19.37:g.39328060G>C	ENSP00000221419:p.Leu559Val	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	68.0	NM_001533	A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	37	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390924	0.42410	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	.	.	.	6.06	-3.63	0.04529	Nucleotide-binding, alpha-beta plait (1);	0.129890	0.52532	D	0.000079	T	0.75206	0.3818	M	0.68593	2.085	0.45261	D	0.998266	P;P;D	0.62365	0.869;0.951;0.991	P;P;D	0.72625	0.775;0.701;0.978	T	0.78378	-0.2227	9	0.87932	D	0	.	20.3926	0.98949	0.1295:0.0:0.8705:0.0	.	559;528;542	P14866;B2R959;Q6NTA2	HNRPL_HUMAN;.;.	V	559;426;426	.	ENSP00000221419:L559V	L	-	1	2	HNRNPL	44019900	0.981000	0.34729	0.133000	0.22050	0.921000	0.55340	1.881000	0.39638	-0.563000	0.06078	-0.302000	0.09304	CTG	.		0.522	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
HYAL4	23553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	123508467	123508467	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr7:123508467C>A	ENST00000223026.4	+	3	778	c.140C>A	c.(139-141)cCt>cAt	p.P47H	HYAL4_ENST00000476325.1_Missense_Mutation_p.P47H	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	47					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)	p.P47L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						CAAAGGAAACCTTTTATAGCT	0.353																																					p.P47H		.											.	HYAL4	91	1	Substitution - Missense(1)	endometrium(1)	c.C140A						.						72.0	77.0	75.0					7																	123508467		2203	4300	6503	SO:0001583	missense	23553	exon3			GGAAACCTTTTAT	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.140C>A	7.37:g.123508467C>A	ENSP00000223026:p.Pro47His	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	70.0	NM_012269	D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	ENST00000223026.4	37	CCDS5789.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.090318	0.76756	.	.	ENSG00000106302	ENST00000489978;ENST00000223026;ENST00000476325	T;T	0.55052	0.54;0.54	5.73	5.73	0.89815	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.71324	0.3326	M	0.83483	2.645	0.47621	D	0.999479	P;D	0.56746	0.887;0.977	P;P	0.59546	0.657;0.859	T	0.75593	-0.3264	10	0.87932	D	0	-0.4856	14.5749	0.68238	0.1453:0.8547:0.0:0.0	.	47;47	F8WDH9;Q2M3T9	.;HYAL4_HUMAN	H	47	ENSP00000223026:P47H;ENSP00000417186:P47H	ENSP00000223026:P47H	P	+	2	0	HYAL4	123295703	1.000000	0.71417	0.979000	0.43373	0.964000	0.63967	4.591000	0.61019	2.698000	0.92095	0.655000	0.94253	CCT	.		0.353	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348545.1	NM_012269	
ITPR3	3710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33657110	33657110	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr6:33657110C>A	ENST00000374316.5	+	51	7850	c.6790C>A	c.(6790-6792)Ctc>Atc	p.L2264I	ITPR3_ENST00000605930.1_Missense_Mutation_p.L2264I			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2264					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CATCCGCCCCCTCATCGTGGC	0.612																																					p.L2264I		.											.	ITPR3	1085	0			c.C6790A						.						133.0	112.0	119.0					6																	33657110		2203	4300	6503	SO:0001583	missense	3710	exon50			CGCCCCCTCATCG	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6790C>A	6.37:g.33657110C>A	ENSP00000363435:p.Leu2264Ile	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	32.0	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.060027	0.55325	.	.	ENSG00000096433	ENST00000374316	D	0.92249	-3.0	5.07	4.17	0.49024	.	0.201739	0.42821	D	0.000658	D	0.87708	0.6245	L	0.58669	1.825	0.45464	D	0.998435	B;B	0.22346	0.028;0.068	B;B	0.35312	0.2;0.132	D	0.86469	0.1784	10	0.52906	T	0.07	-35.9732	10.4156	0.44320	0.0:0.7737:0.1477:0.0786	.	2264;1934	Q14573;Q59ES2	ITPR3_HUMAN;.	I	2264	ENSP00000363435:L2264I	ENSP00000363435:L2264I	L	+	1	0	ITPR3	33765088	0.978000	0.34361	1.000000	0.80357	0.960000	0.62799	2.274000	0.43390	2.653000	0.90120	0.561000	0.74099	CTC	.		0.612	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
KIAA0355	9710	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34791740	34791740	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr19:34791740A>C	ENST00000299505.6	+	2	1235	c.362A>C	c.(361-363)cAg>cCg	p.Q121P		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	121										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					AAAGATGTGCAGGAGCATGTC	0.512																																					p.Q121P		.											.	KIAA0355	91	0			c.A362C						.						55.0	46.0	49.0					19																	34791740		2203	4300	6503	SO:0001583	missense	9710	exon2			ATGTGCAGGAGCA		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.362A>C	19.37:g.34791740A>C	ENSP00000299505:p.Gln121Pro	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	21.0	NM_014686	Q2M3W4	Missense_Mutation	SNP	ENST00000299505.6	37	CCDS12436.1	.	.	.	.	.	.	.	.	.	.	A	15.94	2.980051	0.53827	.	.	ENSG00000166398	ENST00000299505	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.65333	0.2681	L	0.27053	0.805	0.80722	D	1	D	0.64830	0.994	D	0.75484	0.986	T	0.69964	-0.5002	9	0.87932	D	0	-11.3164	15.4502	0.75268	1.0:0.0:0.0:0.0	.	121	O15063	K0355_HUMAN	P	121	.	ENSP00000299505:Q121P	Q	+	2	0	KIAA0355	39483580	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.910000	0.92685	2.107000	0.64212	0.459000	0.35465	CAG	.		0.512	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
KIF19	124602	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	72344027	72344027	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr17:72344027A>G	ENST00000389916.4	+	9	1174	c.1036A>G	c.(1036-1038)Att>Gtt	p.I346V		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	346	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GGCCAAGAACATTAAGACTAG	0.622																																					p.I346V		.											.	KIF19	90	0			c.A1036G						.						41.0	35.0	37.0					17																	72344027		2193	4287	6480	SO:0001583	missense	124602	exon9			AAGAACATTAAGA	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1036A>G	17.37:g.72344027A>G	ENSP00000374566:p.Ile346Val	Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	11.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	A	19.62	3.860939	0.71834	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.76968	-1.06;-1.06	5.68	5.68	0.88126	Kinesin, motor domain (3);	.	.	.	.	D	0.87561	0.6208	M	0.76170	2.325	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.999;0.994;0.994	D;D;D;D	0.85130	0.99;0.997;0.986;0.986	D	0.88969	0.3399	9	0.87932	D	0	.	14.9658	0.71193	1.0:0.0:0.0:0.0	.	346;304;304;346	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	V	304;346	ENSP00000449134:I304V;ENSP00000374566:I346V	ENSP00000374566:I346V	I	+	1	0	KIF19	69855622	1.000000	0.71417	1.000000	0.80357	0.434000	0.31775	8.934000	0.92915	2.184000	0.69523	0.454000	0.30748	ATT	.		0.622	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
LCA5L	150082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	40800132	40800132	+	Silent	SNP	T	T	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr21:40800132T>C	ENST00000358268.2	-	4	816	c.288A>G	c.(286-288)aaA>aaG	p.K96K	LCA5L_ENST00000485895.2_Silent_p.K96K|LCA5L_ENST00000288350.3_Silent_p.K96K|LCA5L_ENST00000380671.2_Silent_p.K96K			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	96										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				CATTATACTTTTTCTTCTCCT	0.313																																					p.K96K		.											.	LCA5L	22	0			c.A288G						.						57.0	63.0	61.0					21																	40800132		2201	4297	6498	SO:0001819	synonymous_variant	150082	exon4			ATACTTTTTCTTC	AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.288A>G	21.37:g.40800132T>C		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	303.0	123.0	NM_152505	D3DSI0|Q3ZCT0	Silent	SNP	ENST00000358268.2	37	CCDS13665.1																																																																																			.		0.313	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141807.2	NM_152505	
LCP2	3937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169685155	169685155	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr5:169685155A>G	ENST00000046794.5	-	16	1601	c.986T>C	c.(985-987)tTg>tCg	p.L329S	LCP2_ENST00000521416.1_Missense_Mutation_p.L124S	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	329					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TGGCTGGGGCAAAGGTCTCTG	0.498																																					p.L329S		.											.	LCP2	23	0			c.T986C						.						175.0	173.0	174.0					5																	169685155		1945	4144	6089	SO:0001583	missense	3937	exon16			TGGGGCAAAGGTC		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.986T>C	5.37:g.169685155A>G	ENSP00000046794:p.Leu329Ser	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	63.0	NM_005565	A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	A	14.72	2.620395	0.46736	.	.	ENSG00000043462	ENST00000046794;ENST00000521416;ENST00000520344	T;T	0.48836	0.82;0.8	5.72	4.56	0.56223	.	0.301944	0.29073	N	0.013231	T	0.42494	0.1205	L	0.50333	1.59	0.36232	D	0.852709	P;P	0.44776	0.843;0.469	B;B	0.42653	0.394;0.209	T	0.50988	-0.8762	9	.	.	.	-5.6214	9.5973	0.39582	0.92:0.0:0.08:0.0	.	124;329	E7ESF6;Q13094	.;LCP2_HUMAN	S	329;124;96	ENSP00000046794:L329S;ENSP00000428871:L124S	.	L	-	2	0	LCP2	169617733	0.999000	0.42202	0.984000	0.44739	0.744000	0.42396	2.971000	0.49248	1.108000	0.41662	0.533000	0.62120	TTG	.		0.498	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	
METTL2B	55798	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	128140983	128140984	+	Frame_Shift_Ins	INS	-	-	T	rs139332186	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr7:128140983_128140984insT	ENST00000262432.8	+	8	980_981	c.943_944insT	c.(943-945)gtgfs	p.V315fs	METTL2B_ENST00000480046.1_Frame_Shift_Ins_p.V250fs	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	315					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						AAATTTCTATGTGAGAGGTGAT	0.396																																					p.V315fs		.											.	METTL2B	23	0			c.943_944insT						.																																			SO:0001589	frameshift_variant	55798	exon8			TTCTATGTGAGAG	AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.944dupT	7.37:g.128140984_128140984dupT	ENSP00000262432:p.Val315fs	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	254.0	41.0	NM_018396	B4DZ68|Q0IJ54|Q3B7J1	Frame_Shift_Ins	INS	ENST00000262432.8	37	CCDS5803.2																																																																																			.		0.396	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289817.1	NM_018396	
KMT2C	58508	broad.mit.edu;bcgsc.ca	37	7	151962169	151962169	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr7:151962169G>A	ENST00000262189.6	-	8	1356	c.1138C>T	c.(1138-1140)Cgt>Tgt	p.R380C	KMT2C_ENST00000355193.2_Missense_Mutation_p.R380C	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	380					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R380C(2)									CAACCTGCACGTTTTAATGGA	0.448																																					p.R380C		.											.	MLL3	1398	2	Substitution - Missense(2)	central_nervous_system(2)	c.C1138T						.						418.0	376.0	390.0					7																	151962169		2203	4300	6503	SO:0001583	missense	58508	exon8			CTGCACGTTTTAA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1138C>T	7.37:g.151962169G>A	ENSP00000262189:p.Arg380Cys	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	367.0	16.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.858881	0.32884	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98926	-5.24;-5.24	4.65	4.65	0.58169	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38548	U	0.001645	D	0.99039	0.9671	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.99437	1.0937	10	0.87932	D	0	.	14.4119	0.67119	0.0:0.0:0.852:0.148	.	380	Q8NEZ4	MLL3_HUMAN	C	380	ENSP00000262189:R380C;ENSP00000347325:R380C	ENSP00000262189:R380C	R	-	1	0	MLL3	151593102	1.000000	0.71417	1.000000	0.80357	0.490000	0.33462	3.895000	0.56258	2.271000	0.75665	0.557000	0.71058	CGT	.		0.448	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MLLT1	4298	ucsc.edu;bcgsc.ca	37	19	6270619	6270619	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr19:6270619A>G	ENST00000252674.7	-	2	327	c.164T>C	c.(163-165)cTg>cCg	p.L55P		NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1	55	YEATS. {ECO:0000255|PROSITE- ProRule:PRU00376}.				negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)			endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						GCTGTCGTGCAGCCAGAAGAC	0.622			T	MLL	AL						OREG0025198	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L55P		.		Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	.	MLLT1	658	0			c.T164C						.						102.0	86.0	91.0					19																	6270619		2203	4300	6503	SO:0001583	missense	4298	exon2			TCGTGCAGCCAGA		CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757	ENST00000252674.7:c.164T>C	19.37:g.6270619A>G	ENSP00000252674:p.Leu55Pro	Somatic	36.0	0.0	632	WXS	Illumina HiSeq	.	51.0	4.0	NM_005934	Q14768	Missense_Mutation	SNP	ENST00000252674.7	37	CCDS12160.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.561054	0.86335	.	.	ENSG00000130382	ENST00000252674	.	.	.	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000001	D	0.86944	0.6055	H	0.96239	3.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90725	0.4638	9	0.87932	D	0	-18.4278	13.3955	0.60849	1.0:0.0:0.0:0.0	.	55	Q03111	ENL_HUMAN	P	55	.	ENSP00000252674:L55P	L	-	2	0	MLLT1	6221619	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.228000	0.95250	2.051000	0.60960	0.459000	0.35465	CTG	.		0.622	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452909.1	NM_005934	
MUC4	4585	broad.mit.edu;bcgsc.ca	37	3	195507026	195507026	+	Missense_Mutation	SNP	G	G	T	rs531418622	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr3:195507026G>T	ENST00000463781.3	-	2	11884	c.11425C>A	c.(11425-11427)Ctt>Att	p.L3809I	MUC4_ENST00000475231.1_Missense_Mutation_p.L3809I|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGCC	0.602													.|||	30	0.00599042	0.0219	0.0014	5008	,	,		9944	0.0		0.0	False		,,,				2504	0.0				p.L3809I		.											.	MUC4	90	0			c.C11425A						.						8.0	7.0	7.0					3																	195507026		649	1528	2177	SO:0001583	missense	4585	exon2			CAGGAAGAGGGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11425C>A	3.37:g.195507026G>T	ENSP00000417498:p.Leu3809Ile	Somatic	75.0	1.0		WXS	Illumina HiSeq	Phase_I	168.0	27.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.118	-0.181097	0.06380	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.59224	0.28;0.29	.	.	.	.	.	.	.	.	T	0.33556	0.0867	N	0.19112	0.55	0.09310	N	1	B	0.20671	0.047	B	0.15484	0.013	T	0.15378	-1.0439	7	.	.	.	.	2.8356	0.05513	3.0E-4:2.0E-4:0.5012:0.4983	.	3681	E7ESK3	.	I	3809	ENSP00000417498:L3809I;ENSP00000420243:L3809I	.	L	-	1	0	MUC4	196991805	0.000000	0.05858	0.031000	0.17742	0.031000	0.12232	-0.158000	0.10070	0.064000	0.16427	0.064000	0.15345	CTT	.		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1016213	1016213	+	Silent	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr11:1016213A>G	ENST00000421673.2	-	31	6638	c.6588T>C	c.(6586-6588)ccT>ccC	p.P2196P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2196	Ser-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGGAAAAAGAGGAGATGCAG	0.557																																					p.P2196P		.											.	MUC6	23	0			c.T6588C						.						33.0	37.0	36.0					11																	1016213		2140	4233	6373	SO:0001819	synonymous_variant	4588	exon31			AAAAAGAGGAGAT	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6588T>C	11.37:g.1016213A>G		Somatic	86.0	1.0		WXS	Illumina HiSeq	Phase_I	219.0	84.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			.		0.557	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MYH11	4629	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	15808930	15808930	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr16:15808930delT	ENST00000300036.5	-	40	5731	c.5622delA	c.(5620-5622)aaafs	p.K1874fs	NDE1_ENST00000396355.1_Intron|MYH11_ENST00000396324.3_Frame_Shift_Del_p.K1881fs|NDE1_ENST00000396354.1_Intron|NDE1_ENST00000342673.5_Intron|MYH11_ENST00000576790.2_Frame_Shift_Del_p.K1874fs|MYH11_ENST00000452625.2_Frame_Shift_Del_p.K1881fs	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1874					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TGGCATTGCCTTTCTCTGCCT	0.672			T	CBFB	AML																																p.K1881fs		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	666	0			c.5643delA						.						105.0	101.0	102.0					16																	15808930		2197	4300	6497	SO:0001589	frameshift_variant	4629	exon41			ATTGCCTTTCTCT	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5622delA	16.37:g.15808930delT	ENSP00000300036:p.Lys1874fs	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	39.0	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Frame_Shift_Del	DEL	ENST00000300036.5	37	CCDS10565.1																																																																																			.		0.672	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
NBPF9	400818	broad.mit.edu;ucsc.edu	37	1	144828583	144828583	+	Silent	SNP	G	G	A	rs28712116		TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:144828583G>A	ENST00000281815.8	+	13	1169	c.423G>A	c.(421-423)ttG>ttA	p.L141L	NBPF9_ENST00000440491.2_3'UTR|NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000338347.4_Silent_p.L543L			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	801						cytoplasm (GO:0005737)		p.L543L(3)		NS(2)|prostate(1)	3						CTGAAGTCTTGCAGGACTCAC	0.468																																					.		.											.	.	.	3	Substitution - coding silent(3)	kidney(3)	.						.																																			SO:0001819	synonymous_variant	400818	.			AGTCTTGCAGGAC		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000281815.8:c.423G>A	1.37:g.144828583G>A		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	552.0	119.0	.		Silent	SNP	ENST00000281815.8	37		.	.	.	.	.	.	.	.	.	.	.	0.502	-0.870465	0.02570	.	.	ENSG00000168614	ENST00000375552	.	.	.	0.618	-1.24	0.09435	.	.	.	.	.	T	0.04634	0.0126	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.32214	-0.9915	3	.	.	.	.	.	.	.	rs28712116	.	.	.	Y	617	.	.	C	+	2	0	NBPF9	143539940	0.052000	0.20516	0.001000	0.08648	0.004000	0.04260	-1.779000	0.01777	-2.677000	0.00410	-2.831000	0.00106	TGC	G|0.500;A|0.500		0.468	NBPF9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001037675	
NBPF14	25832	ucsc.edu;bcgsc.ca	37	1	148004749	148004749	+	Silent	SNP	C	C	T	rs77143638	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:148004749C>T	ENST00000369219.1	-	22	2581	c.2565G>A	c.(2563-2565)ttG>ttA	p.L855L				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	855	NBPF 10. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					GTGAGTCCTGCAAGACTTCAG	0.458													-|||	661	0.131989	0.2867	0.0922	5008	,	,		17971	0.0516		0.0964	False		,,,				2504	0.0706				p.L855L		.											.	NBPF14	91	0			c.G2565A						.						108.0	170.0	151.0					1																	148004749		1903	4152	6055	SO:0001819	synonymous_variant	25832	exon22			GTCCTGCAAGACT	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.2565G>A	1.37:g.148004749C>T		Somatic	31.0	0.0		WXS	Illumina HiSeq	.	134.0	45.0	NM_015383	Q5TI23|Q8IX76|Q9UJI9	Silent	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	N	0.300	-0.974481	0.02215	.	.	ENSG00000122497	ENST00000310701	.	.	.	0.464	-0.927	0.10451	.	.	.	.	.	T	0.05640	0.0148	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.38286	-0.9668	3	.	.	.	.	.	.	.	.	.	.	.	Y	861	.	.	C	-	2	0	NBPF14	146471373	0.562000	0.26586	0.001000	0.08648	0.010000	0.07245	-2.181000	0.01257	-1.935000	0.01049	-1.057000	0.02308	TGC	C|0.986;T|0.014		0.458	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
NLRP12	91662	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54313461	54313461	+	Silent	SNP	G	G	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr19:54313461G>A	ENST00000324134.6	-	3	1620	c.1452C>T	c.(1450-1452)caC>caT	p.H484H	NLRP12_ENST00000354278.3_Silent_p.H484H|NLRP12_ENST00000391775.3_Silent_p.H484H|NLRP12_ENST00000535162.1_Silent_p.H484H|NLRP12_ENST00000391772.1_Silent_p.H484H|NLRP12_ENST00000345770.5_Silent_p.H484H|NLRP12_ENST00000351894.4_Silent_p.H484H|NLRP12_ENST00000391773.1_Silent_p.H484H	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	484	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CGTCTAGGCCGTGCTTCCGGA	0.547																																					p.D484D		.											.	NLRP12	211	0			c.C1452T						.						101.0	104.0	103.0					19																	54313461		2203	4300	6503	SO:0001819	synonymous_variant	91662	exon3			TAGGCCGTGCTTC	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1452C>T	19.37:g.54313461G>A		Somatic	60.0	1.0		WXS	Illumina HiSeq	Phase_I	120.0	47.0	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	37	CCDS12864.1																																																																																			.		0.547	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
NOS1	4842	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	117768410	117768410	+	Silent	SNP	G	G	A	rs369224010		TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr12:117768410G>A	ENST00000338101.4	-	1	469	c.465C>T	c.(463-465)ccC>ccT	p.P155P	NOS1_ENST00000549189.1_5'Flank|NOS1_ENST00000317775.6_Silent_p.P155P|NOS1_ENST00000344089.3_Silent_p.P155P			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0	Ala-rich.				cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GCCCATTCCCGGGACCCGAGG	0.701																																					p.P155P	Esophageal Squamous(162;1748 2599 51982 52956)	.											.	NOS1	154	0			c.C465T						.	G	,	1,3821		0,1,1910	39.0	44.0	42.0		465,465	-9.5	0.0	12		42	1,8233		0,1,4116	no	coding-synonymous,coding-synonymous	NOS1	NM_000620.4,NM_001204218.1	,	0,2,6026	AA,AG,GG		0.0121,0.0262,0.0166	,	155/1435,155/1469	117768410	2,12054	1911	4117	6028	SO:0001819	synonymous_variant	4842	exon2			ATTCCCGGGACCC		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.465C>T	12.37:g.117768410G>A		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	22.0	NM_000620		Silent	SNP	ENST00000338101.4	37	CCDS55890.1																																																																																			.		0.701	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
NRCAM	4897	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	107824934	107824934	+	Silent	SNP	G	G	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr7:107824934G>A	ENST00000425651.2	-	18	2159	c.2160C>T	c.(2158-2160)cgC>cgT	p.R720R	NRCAM_ENST00000379022.4_Silent_p.R720R|NRCAM_ENST00000351718.4_Silent_p.R704R|NRCAM_ENST00000413765.2_Silent_p.R701R|NRCAM_ENST00000379028.3_Silent_p.R720R|NRCAM_ENST00000379024.4_Silent_p.R701R	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	720	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CTGCCATCACGCGGAAGGAGT	0.547																																					p.R720R		.											.	NRCAM	156	0			c.C2160T						.						99.0	91.0	94.0					7																	107824934		2203	4300	6503	SO:0001819	synonymous_variant	4897	exon18			CATCACGCGGAAG		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2160C>T	7.37:g.107824934G>A		Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	39.0	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	37	CCDS47686.1																																																																																			.		0.547	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
OR1E1	8387	broad.mit.edu;ucsc.edu	37	17	3300970	3300970	+	Silent	SNP	C	C	G	rs61735439	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr17:3300970C>G	ENST00000322608.2	-	1	734	c.735G>C	c.(733-735)ctG>ctC	p.L245L		NM_003553.2	NP_003544.2	P30953	OR1E1_HUMAN	olfactory receptor, family 1, subfamily E, member 1	245					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(2)|lung(5)	10						ACACCACAGACAGGTGGGAGC	0.458													G|||	33	0.00658946	0.0242	0.0014	5008	,	,		19517	0.0		0.0	False		,,,				2504	0.0				p.L245L		.											.	OR1E1	68	0			c.G735C						.						87.0	84.0	85.0					17																	3300970		2203	4300	6503	SO:0001819	synonymous_variant	8387	exon1			CACAGACAGGTGG	U04642	CCDS11024.1	17p13.3	2012-08-09			ENSG00000180016	ENSG00000180016		"""GPCR / Class A : Olfactory receptors"""	8189	protein-coding gene	gene with protein product				OR1E9P, OR1E5, OR1E6		8004088, 1370859	Standard	NM_003553		Approved	OR17-2, HGM071, OR17-32, OR13-66	uc002fvj.1	P30953	OTTHUMG00000090643	ENST00000322608.2:c.735G>C	17.37:g.3300970C>G		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	59.0	NM_003553	O43884|P47882|P47885|Q6IFA9|Q6IFM5|Q9UBJ1|Q9UM60	Silent	SNP	ENST00000322608.2	37	CCDS11024.1																																																																																			C|0.987;G|0.013		0.458	OR1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207303.1	NM_003553	
OR2L13	284521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	248263611	248263611	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:248263611G>T	ENST00000358120.2	+	2	1079	c.934G>T	c.(934-936)Gaa>Taa	p.E312*	OR2L13_ENST00000366478.2_Nonsense_Mutation_p.E312*			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TTTCCTGAAAGAATAATCATG	0.433																																					p.E312X		.											.	OR2L13	70	0			c.G934T						.						29.0	31.0	30.0					1																	248263611		2203	4300	6503	SO:0001587	stop_gained	284521	exon3			CTGAAAGAATAAT	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.934G>T	1.37:g.248263611G>T	ENSP00000350836:p.Glu312*	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	27.0	NM_175911	Q5VUR5	Nonsense_Mutation	SNP	ENST00000358120.2	37	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032243	0.54790	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	.	.	.	4.12	-8.23	0.01033	.	1.716890	0.03777	N	0.260790	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	1.9389	0.03342	0.1185:0.2183:0.185:0.4783	.	.	.	.	X	312	.	ENSP00000350836:E312X	E	+	1	0	OR2L13	246330234	0.001000	0.12720	0.000000	0.03702	0.011000	0.07611	0.013000	0.13310	-2.305000	0.00654	-1.036000	0.02392	GAA	.		0.433	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911	
OR5F1	338674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55761412	55761412	+	Silent	SNP	C	C	T	rs144082157	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr11:55761412C>T	ENST00000278409.1	-	1	689	c.690G>A	c.(688-690)tcG>tcA	p.S230S		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	230					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S230S(2)		endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					TCCCCTCCCCCGAATGCATAG	0.478													T|||	4	0.000798722	0.0	0.0	5008	,	,		18777	0.003		0.001	False		,,,				2504	0.0				p.S230S		.											.	OR5F1	70	2	Substitution - coding silent(2)	lung(2)	c.G690A						.	T		1,4401	824.5+/-416.5	0,1,2200	59.0	57.0	58.0		690	1.8	0.1	11	dbSNP_134	58	3,8589	818.4+/-406.9	0,3,4293	no	coding-synonymous	OR5F1	NM_003697.1		0,4,6493	TT,TC,CC		0.0349,0.0227,0.0308		230/315	55761412	4,12990	2201	4296	6497	SO:0001819	synonymous_variant	338674	exon1			CTCCCCCGAATGC	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.690G>A	11.37:g.55761412C>T		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	52.0	NM_003697	Q495D1|Q6IFB9	Silent	SNP	ENST00000278409.1	37	CCDS31515.1																																																																																			C|0.999;T|0.001		0.478	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
OSCAR	126014	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	54602893	54602893	+	Intron	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr19:54602893C>A	ENST00000284648.6	-	3	268				OSCAR_ENST00000391760.1_Intron|OSCAR_ENST00000358375.4_Intron|OSCAR_ENST00000351806.4_Intron|OSCAR_ENST00000391761.1_Intron|OSCAR_ENST00000356532.3_Splice_Site|OSCAR_ENST00000359649.4_Splice_Site			Q8IYS5	OSCAR_HUMAN	osteoclast associated, immunoglobulin-like receptor							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(1)|skin(1)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)					ataatgGCCACTAAGgggaat	0.428																																					.		.											.	OSCAR	68	0			c.71-1G>T						.						86.0	81.0	83.0					19																	54602893		2203	4300	6503	SO:0001627	intron_variant	126014	exon4			TGGCCACTAAGGG	AK130199	CCDS12873.1, CCDS12874.1, CCDS12875.1, CCDS12876.1, CCDS62789.1, CCDS74444.1	19q13.42	2013-01-29			ENSG00000170909	ENSG00000170909		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29960	protein-coding gene	gene with protein product		606862				11805147	Standard	NM_206818		Approved		uc002qda.3	Q8IYS5	OTTHUMG00000064966	ENST00000284648.6:c.70+145G>T	19.37:g.54602893C>A		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	50.0	NM_130771	B7WNS2|Q5GRG5|Q8N763|Q8NHL4|Q8WXQ0|Q8WXQ1|Q8WXQ2	Splice_Site	SNP	ENST00000284648.6	37		.	.	.	.	.	.	.	.	.	.	C	5.864	0.343657	0.11126	.	.	ENSG00000170909	ENST00000356532;ENST00000359649	.	.	.	2.17	2.17	0.27698	.	.	.	.	.	.	.	.	.	.	.	0.20403	N	0.99991	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.9473	0.29993	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	OSCAR	59294705	0.015000	0.18098	0.013000	0.15412	0.087000	0.18053	0.337000	0.19841	1.558000	0.49541	0.456000	0.33151	.	.		0.428	OSCAR-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000139493.4	NM_133169	
PABPC4L	132430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	135121534	135121534	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr4:135121534C>A	ENST00000421491.3	-	2	897	c.641G>T	c.(640-642)gGc>gTc	p.G214V	PABPC4L_ENST00000529122.2_Missense_Mutation_p.G272V			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	214	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						CAGAGTTTTGCCATATTTGCT	0.413																																					p.G272V		.											.	.	.	0			c.G815T						.						85.0	70.0	74.0					4																	135121534		692	1591	2283	SO:0001583	missense	132430	exon2			GTTTTGCCATATT	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.641G>T	4.37:g.135121534C>A	ENSP00000463233:p.Gly214Val	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	87.0	NM_001114734		Missense_Mutation	SNP	ENST00000421491.3	37																																																																																				.		0.413	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364399.2	NM_001114734	
PCDHA3	56145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140182753	140182753	+	Silent	SNP	C	C	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr5:140182753C>G	ENST00000522353.2	+	1	1971	c.1971C>G	c.(1969-1971)ccC>ccG	p.P657P	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Silent_p.P657P|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	657	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGGTGAACCCTCATTGACCG	0.692																																					p.P657P		.											.	PCDHA3	98	0			c.C1971G						.						60.0	61.0	61.0					5																	140182753		2203	4300	6503	SO:0001819	synonymous_variant	56145	exon1			TGAACCCTCATTG	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1971C>G	5.37:g.140182753C>G		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	48.0	NM_031497	O75286	Silent	SNP	ENST00000522353.2	37	CCDS54915.1																																																																																			.		0.692	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
PCNT	5116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	47773060	47773060	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr21:47773060A>G	ENST00000359568.5	+	10	1606	c.1499A>G	c.(1498-1500)gAt>gGt	p.D500G	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	500	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CGTGTGGAAGATTTAGAACAG	0.473																																					p.D500G		.											.	PCNT	141	0			c.A1499G						.						56.0	60.0	59.0					21																	47773060		2203	4300	6503	SO:0001583	missense	5116	exon10			TGGAAGATTTAGA	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1499A>G	21.37:g.47773060A>G	ENSP00000352572:p.Asp500Gly	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	25.0	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	A	12.10	1.836279	0.32421	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.02709	4.19	4.68	4.68	0.58851	.	.	.	.	.	T	0.03564	0.0102	L	0.43152	1.355	0.32642	N	0.520569	P;P	0.38978	0.531;0.652	B;B	0.32762	0.152;0.073	T	0.18116	-1.0347	9	0.56958	D	0.05	.	13.3185	0.60421	1.0:0.0:0.0:0.0	.	382;500	O95613-2;O95613	.;PCNT_HUMAN	G	500;487	ENSP00000352572:D500G	ENSP00000338675:D487G	D	+	2	0	PCNT	46597488	0.999000	0.42202	0.024000	0.17045	0.011000	0.07611	4.493000	0.60341	1.732000	0.51606	0.460000	0.39030	GAT	.		0.473	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
PEX10	5192	ucsc.edu;bcgsc.ca	37	1	2337963	2337963	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:2337963A>G	ENST00000447513.2	-	5	940	c.872T>C	c.(871-873)cTg>cCg	p.L291P	PEX10_ENST00000507596.1_Missense_Mutation_p.L291P|PEX10_ENST00000288774.3_Missense_Mutation_p.L311P|PEX10_ENST00000515760.1_5'Flank	NM_002617.3	NP_002608.1	O60683	PEX10_HUMAN	peroxisomal biogenesis factor 10	291					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	integral component of peroxisomal membrane (GO:0005779)|intracellular (GO:0005622)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	7	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		CCAGCAGAACAGGTGGCCGCA	0.677																																					p.L311P	GBM(12;9 508 1649 13619)	.											.	PEX10	90	0			c.T932C						.						39.0	42.0	41.0					1																	2337963		2203	4298	6501	SO:0001583	missense	5192	exon5			CAGAACAGGTGGC	AF060502	CCDS41.1, CCDS44045.1	1p36.32	2013-01-09	2008-08-26		ENSG00000157911	ENSG00000157911		"""RING-type (C3HC4) zinc fingers"""	8851	protein-coding gene	gene with protein product		602859	"""peroxisome biogenesis factor 10"""			9683594	Standard	NM_002617		Approved	RNF69	uc001ajg.3	O60683	OTTHUMG00000001637	ENST00000447513.2:c.872T>C	1.37:g.2337963A>G	ENSP00000407922:p.Leu291Pro	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	56.0	5.0	NM_153818	B3KWD8|Q5T095|Q9BW90	Missense_Mutation	SNP	ENST00000447513.2	37	CCDS44045.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.646981	0.87958	.	.	ENSG00000157911	ENST00000288774;ENST00000447513;ENST00000507596	D;D;D	0.86164	-2.08;-2.08;-2.08	5.02	5.02	0.67125	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.063724	0.64402	D	0.000005	D	0.92724	0.7687	M	0.75085	2.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.93571	0.6904	10	0.87932	D	0	-24.2045	13.8991	0.63792	1.0:0.0:0.0:0.0	.	291;311	O60683;O60683-2	PEX10_HUMAN;.	P	311;291;291	ENSP00000288774:L311P;ENSP00000407922:L291P;ENSP00000424291:L291P	ENSP00000288774:L311P	L	-	2	0	PEX10	2327823	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	8.705000	0.91357	1.875000	0.54330	0.379000	0.24179	CTG	.		0.677	PEX10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367454.1	NM_153818	
PHTF2	57157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	77569480	77569480	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr7:77569480C>A	ENST00000248550.7	+	13	1677	c.1601C>A	c.(1600-1602)tCa>tAa	p.S534*	PHTF2_ENST00000275575.7_Nonsense_Mutation_p.S496*|PHTF2_ENST00000424760.1_Nonsense_Mutation_p.S496*|PHTF2_ENST00000422959.2_Nonsense_Mutation_p.S500*|PHTF2_ENST00000416283.2_Nonsense_Mutation_p.S500*|PHTF2_ENST00000307305.8_Nonsense_Mutation_p.S496*			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	534					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						CATTCTGCTTCAGAACTTTAT	0.373																																					p.S500X		.											.	PHTF2	23	0			c.C1499A						.						126.0	116.0	119.0					7																	77569480		1862	4106	5968	SO:0001587	stop_gained	57157	exon12			CTGCTTCAGAACT	AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.1601C>A	7.37:g.77569480C>A	ENSP00000248550:p.Ser534*	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	495.0	183.0	NM_001127357	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Nonsense_Mutation	SNP	ENST00000248550.7	37		.	.	.	.	.	.	.	.	.	.	C	38	6.899107	0.97920	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000424760;ENST00000275575;ENST00000416283;ENST00000248550	.	.	.	5.67	5.67	0.87782	.	0.344882	0.27482	N	0.019166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.3448	13.9903	0.64362	0.0:0.9275:0.0:0.0725	.	.	.	.	X	500;500;496;496;496;500;534	.	ENSP00000248550:S534X	S	+	2	0	PHTF2	77407416	0.990000	0.36364	0.995000	0.50966	0.969000	0.65631	1.485000	0.35519	2.665000	0.90641	0.557000	0.71058	TCA	.		0.373	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2	NM_020432	
PLXNA1	5361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	126733602	126733602	+	Silent	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr3:126733602C>A	ENST00000393409.2	+	13	2805	c.2805C>A	c.(2803-2805)gcC>gcA	p.A935A	PLXNA1_ENST00000251772.4_Silent_p.A912A	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	935	IPT/TIG 1.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CCCATGACGCCCTGGTGGAGG	0.692																																					p.A935A		.											.	PLXNA1	93	0			c.C2805A						.						62.0	47.0	52.0					3																	126733602		2202	4299	6501	SO:0001819	synonymous_variant	5361	exon13			TGACGCCCTGGTG	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2805C>A	3.37:g.126733602C>A		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	37.0	NM_032242		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			.		0.692	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
PNMA3	29944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152225435	152225435	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chrX:152225435A>G	ENST00000370264.4	+	1	49	c.23A>G	c.(22-24)gAc>gGc	p.D8G	PNMA3_ENST00000370265.4_Missense_Mutation_p.D8G|PNMA3_ENST00000447306.1_Missense_Mutation_p.D8G			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	8					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					ttgttacaggactggtgtcgg	0.567																																					p.D8G		.											.	PNMA3	600	0			c.A23G						.						111.0	87.0	95.0					X																	152225435		2203	4300	6503	SO:0001583	missense	29944	exon2			TACAGGACTGGTG	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.23A>G	X.37:g.152225435A>G	ENSP00000359286:p.Asp8Gly	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	104.0	NM_013364	D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	37	CCDS35435.2	.	.	.	.	.	.	.	.	.	.	a	14.75	2.627457	0.46944	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.31769	1.48;1.48;1.48	1.93	1.93	0.25924	.	.	.	.	.	T	0.49660	0.1570	M	0.75085	2.285	0.20703	N	0.999864	D	0.89917	1.0	D	0.91635	0.999	T	0.22730	-1.0208	9	0.72032	D	0.01	.	5.3241	0.15896	1.0:0.0:0.0:0.0	.	8	Q9UL41	PNMA3_HUMAN	G	8	ENSP00000359288:D8G;ENSP00000407642:D8G;ENSP00000359286:D8G	ENSP00000359286:D8G	D	+	2	0	PNMA3	151976091	0.998000	0.40836	0.468000	0.27192	0.004000	0.04260	1.432000	0.34936	1.028000	0.39785	0.336000	0.21669	GAC	.		0.567	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364	
PRAM1	84106	broad.mit.edu;bcgsc.ca	37	19	8563661	8563661	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr19:8563661T>C	ENST00000423345.4	-	2	1551	c.1031A>G	c.(1030-1032)aAg>aGg	p.K344R	PRAM1_ENST00000255612.3_Missense_Mutation_p.K344R			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	392	Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						CTGCAGCAGCTTCCTGGGGAG	0.667																																					p.K344R		.											.	.	.	0			c.A1031G						.						6.0	7.0	7.0					19																	8563661		2011	4154	6165	SO:0001583	missense	84106	exon2			AGCAGCTTCCTGG	BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.1031A>G	19.37:g.8563661T>C	ENSP00000408342:p.Lys344Arg	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	6.0	NM_032152	Q8N6W7	Missense_Mutation	SNP	ENST00000423345.4	37	CCDS45954.2	.	.	.	.	.	.	.	.	.	.	T	15.48	2.846457	0.51164	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.19105	2.17;2.17	4.65	2.51	0.30379	.	0.483231	0.17555	N	0.170028	T	0.32882	0.0844	M	0.69823	2.125	0.09310	N	1	D;D	0.56746	0.971;0.977	P;P	0.58172	0.725;0.834	T	0.11131	-1.0600	10	0.40728	T	0.16	.	4.3137	0.10982	0.0:0.1842:0.1734:0.6424	.	344;392	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	R	344	ENSP00000255612:K344R;ENSP00000408342:K344R	ENSP00000255612:K344R	K	-	2	0	PRAM1	8469661	0.209000	0.23505	0.006000	0.13384	0.001000	0.01503	1.029000	0.30140	0.346000	0.23899	-0.477000	0.04895	AAG	.		0.667	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397040.3	NM_032152	
PRR14L	253143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32111160	32111160	+	Missense_Mutation	SNP	T	T	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr22:32111160T>G	ENST00000327423.6	-	4	2854	c.2665A>C	c.(2665-2667)Acc>Ccc	p.T889P	PRR14L_ENST00000461722.1_5'Flank|PRR14L_ENST00000434485.1_Missense_Mutation_p.T889P|PRR14L_ENST00000397493.2_Missense_Mutation_p.T889P	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	889										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						GTGTGAATGGTTTTGTTTGAA	0.408																																					p.T889P		.											.	PRR14L	91	0			c.A2665C						.						199.0	149.0	164.0					22																	32111160		692	1591	2283	SO:0001583	missense	253143	exon4			GAATGGTTTTGTT	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.2665A>C	22.37:g.32111160T>G	ENSP00000331845:p.Thr889Pro	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	438.0	208.0	NM_173566	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	ENST00000327423.6	37	CCDS13900.2	.	.	.	.	.	.	.	.	.	.	T	11.09	1.536073	0.27475	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.06849	3.25;3.26;3.25	5.36	-1.29	0.09288	.	0.425905	0.19729	N	0.107386	T	0.06188	0.0160	L	0.47716	1.5	0.09310	N	1	P;B;P	0.35656	0.514;0.226;0.514	B;B;B	0.34138	0.176;0.176;0.176	T	0.29397	-1.0013	9	.	.	.	1.1631	4.9926	0.14222	0.1423:0.3861:0.0:0.4716	.	889;889;889	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	P	889	ENSP00000380630:T889P;ENSP00000331845:T889P;ENSP00000388314:T889P	.	T	-	1	0	PRR14L	30441160	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.068000	0.11561	-0.326000	0.08564	-0.263000	0.10527	ACC	.		0.408	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074993.2	NM_173566	
PTPN22	26191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114380291	114380291	+	Silent	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:114380291A>G	ENST00000359785.5	-	13	1866	c.1731T>C	c.(1729-1731)taT>taC	p.Y577Y	PTPN22_ENST00000420377.2_Silent_p.Y577Y|PTPN22_ENST00000538253.1_Silent_p.Y333Y|PTPN22_ENST00000525799.1_Silent_p.Y450Y|PTPN22_ENST00000528414.1_Silent_p.Y522Y|PTPN22_ENST00000460620.1_Intron	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	577					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGAATTGTAATAAGAGAAGA	0.363																																					p.Y577Y		.											.	PTPN22	227	0			c.T1731C						.						97.0	98.0	98.0					1																	114380291		2203	4300	6503	SO:0001819	synonymous_variant	26191	exon13			ATTGTAATAAGAG	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1731T>C	1.37:g.114380291A>G		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	60.0	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Silent	SNP	ENST00000359785.5	37	CCDS863.1																																																																																			.		0.363	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
RFC1	5981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	39310299	39310299	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr4:39310299C>A	ENST00000381897.1	-	13	1975	c.1842G>T	c.(1840-1842)tgG>tgT	p.W614C	RFC1_ENST00000349703.2_Missense_Mutation_p.W614C	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	614					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						AGTTTCGGAGCCAGCGTAGGA	0.428																																					p.W614C	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	.											.	RFC1	230	0			c.G1842T						.						159.0	166.0	164.0					4																	39310299		2203	4300	6503	SO:0001583	missense	5981	exon13			TCGGAGCCAGCGT	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.1842G>T	4.37:g.39310299C>A	ENSP00000371321:p.Trp614Cys	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	563.0	248.0	NM_002913	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Missense_Mutation	SNP	ENST00000381897.1	37	CCDS56329.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611366	0.87258	.	.	ENSG00000035928	ENST00000381897;ENST00000349703	T;T	0.17854	2.25;2.25	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.54398	0.1856	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.62548	-0.6831	10	0.87932	D	0	-6.9473	20.3053	0.98627	0.0:1.0:0.0:0.0	.	614;614	P35251;P35251-2	RFC1_HUMAN;.	C	614	ENSP00000371321:W614C;ENSP00000261424:W614C	ENSP00000261424:W614C	W	-	3	0	RFC1	38986694	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.502000	0.81614	2.808000	0.96608	0.655000	0.94253	TGG	.		0.428	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
DST	667	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	56470829	56470829	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr6:56470829C>A	ENST00000361203.3	-	36	7971	c.7964G>T	c.(7963-7965)tGt>tTt	p.C2655F	DST_ENST00000446842.2_Missense_Mutation_p.C2329F|DST_ENST00000244364.6_Intron|DST_ENST00000370754.5_Missense_Mutation_p.C2833F|DST_ENST00000312431.6_Missense_Mutation_p.C2655F|DST_ENST00000421834.2_Intron|DST_ENST00000370769.4_Missense_Mutation_p.C2655F|DST_ENST00000370788.2_Intron			Q03001	DYST_HUMAN	dystonin	2655					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TAAAGAGCTACAACTGTGCAT	0.318																																					.		.											.	.	.	0			.						.						123.0	118.0	120.0					6																	56470829		1826	4081	5907	SO:0001583	missense	100873774	.			GAGCTACAACTGT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.7964G>T	6.37:g.56470829C>A	ENSP00000354508:p.Cys2655Phe	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	258.0	94.0	.	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	RNA	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	0.322	-0.961588	0.02249	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;T;T;T	0.79940	0.14;0.14;1.1;-1.32;0.14;-0.09	5.2	-1.68	0.08212	.	1.713730	0.03255	N	0.182475	T	0.27313	0.0670	.	.	.	0.26311	N	0.977821	B	0.02656	0.0	B	0.01281	0.0	T	0.38243	-0.9670	8	0.02654	T	1	.	3.9894	0.09530	0.2589:0.3272:0.0:0.4139	.	2329	Q03001-9	.	F	2833;2655;2329;2655;2655;2329	ENSP00000359790:C2833F;ENSP00000359805:C2655F;ENSP00000393645:C2329F;ENSP00000307959:C2655F;ENSP00000354508:C2655F;ENSP00000404924:C2329F	ENSP00000307959:C2655F	C	-	2	0	DST	56578788	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.645000	0.02000	-0.178000	0.10672	-0.497000	0.04613	TGT	.		0.318	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237774079	237774079	+	Silent	SNP	G	G	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:237774079G>T	ENST00000366574.2	+	36	5018	c.4701G>T	c.(4699-4701)tcG>tcT	p.S1567S	RYR2_ENST00000542537.1_Silent_p.S1551S|RYR2_ENST00000360064.6_Silent_p.S1565S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1567	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGCCTCTCTCGGCGGGATTAT	0.532																																					p.S1567S		.											.	RYR2	158	0			c.G4701T						.						34.0	34.0	34.0					1																	237774079		1897	4104	6001	SO:0001819	synonymous_variant	6262	exon36			TCTCTCGGCGGGA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4701G>T	1.37:g.237774079G>T		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	181.0	52.0	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																			.		0.532	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SLC4A10	57282	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	162627522	162627522	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr2:162627522C>T	ENST00000446997.1	+	2	181	c.88C>T	c.(88-90)Cgt>Tgt	p.R30C	SLC4A10_ENST00000535165.1_Missense_Mutation_p.R30C|SLC4A10_ENST00000272716.5_Missense_Mutation_p.R30C|SLC4A10_ENST00000375514.5_Missense_Mutation_p.R41C|SLC4A10_ENST00000421911.1_Missense_Mutation_p.R30C|SLC4A10_ENST00000415876.2_Missense_Mutation_p.R30C|SLC4A10_ENST00000493021.1_3'UTR	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	30					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	AGGTGGAACTCGTTCTATTCT	0.328																																					p.R41C		.											.	SLC4A10	229	0			c.C121T						.						72.0	69.0	70.0					2																	162627522		1829	4094	5923	SO:0001583	missense	57282	exon3			GGAACTCGTTCTA		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.88C>T	2.37:g.162627522C>T	ENSP00000393066:p.Arg30Cys	Somatic	58.0	1.0		WXS	Illumina HiSeq	Phase_I	137.0	55.0	NM_001178016	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998225	0.93227	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000535165;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T;T	0.79845	-1.3;-1.3;0.52;-1.3;-1.31;-1.3	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.85592	0.5732	L	0.40543	1.245	0.80722	D	1	D;D;D;D	0.71674	0.993;0.998;0.993;0.989	P;P;P;P	0.61275	0.886;0.772;0.886;0.608	D	0.86015	0.1503	10	0.72032	D	0.01	.	20.2704	0.98474	0.0:1.0:0.0:0.0	.	41;30;30;30	F8W675;E7EW28;Q6U841-2;Q6U841	.;.;.;S4A10_HUMAN	C	41;30;30;30;30;30;30;30	ENSP00000364664:R41C;ENSP00000395797:R30C;ENSP00000437527:R30C;ENSP00000272716:R30C;ENSP00000393066:R30C;ENSP00000404486:R30C	ENSP00000272716:R30C	R	+	1	0	SLC4A10	162335768	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.531000	0.73820	2.793000	0.96121	0.591000	0.81541	CGT	.		0.328	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
SLC25A12	8604	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	172693690	172693690	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr2:172693690T>C	ENST00000422440.2	-	6	590	c.553A>G	c.(553-555)Atc>Gtc	p.I185V	SLC25A12_ENST00000392592.4_Missense_Mutation_p.I78V	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	185	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	GTAACCATGATGTCACTGAAA	0.383																																					p.I185V		.											.	SLC25A12	90	0			c.A553G						.						201.0	159.0	173.0					2																	172693690		2203	4300	6503	SO:0001583	missense	8604	exon6			CCATGATGTCACT	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.553A>G	2.37:g.172693690T>C	ENSP00000388658:p.Ile185Val	Somatic	127.0	1.0		WXS	Illumina HiSeq	Phase_I	479.0	198.0	NM_003705	B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	37	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.685095	0.47991	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	T;D	0.81821	0.96;-1.54	6.08	4.94	0.65067	EF-hand-like domain (1);	0.096592	0.64402	N	0.000001	T	0.78604	0.4309	L	0.52905	1.665	0.46849	D	0.99922	B;B	0.22080	0.064;0.064	B;B	0.33392	0.106;0.163	T	0.75241	-0.3387	10	0.62326	D	0.03	-8.9016	10.5213	0.44920	0.0:0.1331:0.0:0.8669	.	78;185	B3KR64;O75746	.;CMC1_HUMAN	V	185;78	ENSP00000388658:I185V;ENSP00000376371:I78V	ENSP00000376371:I78V	I	-	1	0	SLC25A12	172401936	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.145000	0.64839	1.131000	0.42111	0.533000	0.62120	ATC	.		0.383	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
SMURF1	57154	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	98655111	98655111	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr7:98655111delT	ENST00000361125.1	-	4	586	c.267delA	c.(265-267)aaafs	p.K89fs	SMURF1_ENST00000480055.1_5'UTR|SMURF1_ENST00000361368.2_Frame_Shift_Del_p.K89fs	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	89	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			CAGCTCCCTGTTTCTTGTGAA	0.423																																					p.K89fs		.											.	SMURF1	661	0			c.267delA						.						124.0	132.0	129.0					7																	98655111		2203	4300	6503	SO:0001589	frameshift_variant	57154	exon4			TCCCTGTTTCTTG	AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.267delA	7.37:g.98655111delT	ENSP00000354621:p.Lys89fs	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	251.0	89.0	NM_020429	A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Frame_Shift_Del	DEL	ENST00000361125.1	37	CCDS34690.1																																																																																			.		0.423	SMURF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000335001.2	NM_020429	
SPDYE1	285955	broad.mit.edu;bcgsc.ca	37	7	44047000	44047000	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr7:44047000C>T	ENST00000258704.3	+	5	903	c.766C>T	c.(766-768)Ccg>Tcg	p.P256S	AC004951.6_ENST00000447643.1_lincRNA|POLR2J4_ENST00000427076.1_RNA|RP5-1165K10.2_ENST00000454572.1_RNA	NM_001099435.2|NM_175064.2	NP_001092905.2|NP_778234.2	Q8NFV5	SPDE1_HUMAN	speedy/RINGO cell cycle regulator family member E1	256	Arg-rich.									endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	11						TTCCATGAACCCGAGGGCCAG	0.552																																					p.P256S		.											.	SPDYE1	91	0			c.C766T						.						186.0	189.0	188.0					7																	44047000		2203	4300	6503	SO:0001583	missense	285955	exon5			ATGAACCCGAGGG	AF412027	CCDS5475.1	7q11.23	2013-05-08	2013-05-08	2009-02-17	ENSG00000136206	ENSG00000136206		"""Speedy homologs"""	16408	protein-coding gene	gene with protein product	"""Speedy E"""		"""Williams Beuren syndrome chromosome region 19"", ""speedy homolog E1 (Xenopus laevis)"""	WBSCR19		12073013	Standard	NM_175064		Approved	Ringo1, SPDYE	uc003tjf.3	Q8NFV5	OTTHUMG00000128985	ENST00000258704.3:c.766C>T	7.37:g.44047000C>T	ENSP00000258704:p.Pro256Ser	Somatic	133.0	1.0		WXS	Illumina HiSeq	Phase_I	380.0	17.0	NM_175064	Q9NTH5	Missense_Mutation	SNP	ENST00000258704.3	37	CCDS5475.1	.	.	.	.	.	.	.	.	.	.	.	5.631	0.301180	0.10678	.	.	ENSG00000136206	ENST00000258704	.	.	.	.	.	.	.	.	.	.	.	T	0.19167	0.0460	N	0.03608	-0.345	0.09310	N	1	P	0.52061	0.95	P	0.53490	0.727	T	0.15521	-1.0434	6	0.33940	T	0.23	.	.	.	.	.	256	Q8NFV5	SPDE1_HUMAN	S	256	.	ENSP00000258704:P256S	P	+	1	0	SPDYE1	44013525	0.015000	0.18098	0.100000	0.21137	0.101000	0.19017	-0.299000	0.08254	0.088000	0.17205	0.089000	0.15464	CCG	.		0.552	SPDYE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250974.1	NM_175064	
SYCP1	6847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115524051	115524051	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:115524051C>T	ENST00000369522.3	+	29	2717	c.2477C>T	c.(2476-2478)tCa>tTa	p.S826L	SYCP1_ENST00000477590.1_3'UTR|SYCP1_ENST00000369518.1_Missense_Mutation_p.S826L	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	826					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATTTCACATCAGTTGATCAT	0.333																																					p.S826L		.											.	SYCP1	91	0			c.C2477T						.						92.0	92.0	92.0					1																	115524051		2203	4297	6500	SO:0001583	missense	6847	exon29			TCACATCAGTTGA	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2477C>T	1.37:g.115524051C>T	ENSP00000358535:p.Ser826Leu	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	215.0	96.0	NM_003176	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	37	CCDS879.1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.545076	0.27652	.	.	ENSG00000198765	ENST00000369522;ENST00000369518	T;T	0.34072	1.38;1.38	5.52	5.52	0.82312	.	0.552403	0.19046	N	0.124171	T	0.30727	0.0774	M	0.62723	1.935	0.32710	N	0.511757	D;D	0.54047	0.964;0.964	P;P	0.45310	0.476;0.476	T	0.34725	-0.9817	10	0.72032	D	0.01	-3.8726	14.9278	0.70893	0.0:1.0:0.0:0.0	.	826;826	B7ZLS9;Q15431	.;SYCP1_HUMAN	L	826	ENSP00000358535:S826L;ENSP00000358531:S826L	ENSP00000358531:S826L	S	+	2	0	SYCP1	115325574	0.949000	0.32298	0.813000	0.32504	0.039000	0.13416	2.043000	0.41231	2.609000	0.88269	0.591000	0.81541	TCA	.		0.333	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
SYNDIG1L	646658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	74876039	74876039	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr14:74876039C>T	ENST00000554823.1	-	1	470	c.409G>A	c.(409-411)Gaa>Aaa	p.E137K	SYNDIG1L_ENST00000331628.3_Missense_Mutation_p.E137K			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	137					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						ACCTCCTCTTCCTCCTGGTCA	0.512																																					p.E137K		.											.	SYNDIG1L	68	0			c.G409A						.						88.0	94.0	92.0					14																	74876039		2055	4180	6235	SO:0001583	missense	646658	exon2			CCTCTTCCTCCTG		CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.409G>A	14.37:g.74876039C>T	ENSP00000450439:p.Glu137Lys	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	54.0	NM_001105579		Missense_Mutation	SNP	ENST00000554823.1	37	CCDS41970.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348504	0.41599	.	.	ENSG00000183379	ENST00000331628;ENST00000554823	D;D	0.95821	-3.82;-3.82	4.63	2.81	0.32909	.	0.406089	0.25857	N	0.027842	D	0.90181	0.6931	L	0.38175	1.15	0.22001	N	0.999422	B	0.18310	0.027	B	0.14023	0.01	T	0.80236	-0.1466	10	0.35671	T	0.21	-10.8241	6.4673	0.21990	0.0:0.7047:0.0:0.2953	.	137	A6NDD5	SYN1L_HUMAN	K	137	ENSP00000331474:E137K;ENSP00000450439:E137K	ENSP00000331474:E137K	E	-	1	0	SYNDIG1L	73945792	.	.	0.957000	0.39632	0.148000	0.21650	.	.	0.578000	0.29487	-0.373000	0.07131	GAA	.		0.512	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412341.1	XM_938515	
TMTC2	160335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	83358835	83358835	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr12:83358835C>G	ENST00000321196.3	+	5	2338	c.1631C>G	c.(1630-1632)gCa>gGa	p.A544G	TMTC2_ENST00000548305.1_Missense_Mutation_p.A544G|TMTC2_ENST00000549919.1_Missense_Mutation_p.A538G	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	544					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						AGCAGGTTTGCAGAAGCACTA	0.348																																					p.A544G		.											.	TMTC2	92	0			c.C1631G						.						95.0	103.0	101.0					12																	83358835		2203	4300	6503	SO:0001583	missense	160335	exon5			GGTTTGCAGAAGC	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1631C>G	12.37:g.83358835C>G	ENSP00000322300:p.Ala544Gly	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	498.0	193.0	NM_152588	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737144	0.69304	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	T;T;T	0.76578	-1.03;-0.04;-1.03	5.92	5.92	0.95590	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.275758	0.43416	D	0.000577	T	0.74718	0.3753	L	0.45581	1.43	0.40649	D	0.982014	B;B;B	0.17038	0.003;0.006;0.02	B;B;B	0.18871	0.014;0.016;0.023	T	0.67554	-0.5641	10	0.30854	T	0.27	-4.1126	20.3343	0.98733	0.0:1.0:0.0:0.0	.	544;299;544	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	G	544;544;538;299	ENSP00000322300:A544G;ENSP00000448292:A544G;ENSP00000447609:A538G	ENSP00000322300:A544G	A	+	2	0	TMTC2	81882966	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.727000	0.68523	2.822000	0.97130	0.650000	0.86243	GCA	.		0.348	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
TNPO1	3842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	72168474	72168474	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr5:72168474C>T	ENST00000337273.5	+	7	1031	c.605C>T	c.(604-606)gCt>gTt	p.A202V	TNPO1_ENST00000447967.2_Silent_p.L114L|TNPO1_ENST00000523768.1_Missense_Mutation_p.A152V|TNPO1_ENST00000506351.2_Missense_Mutation_p.A194V|TNPO1_ENST00000454282.1_Missense_Mutation_p.A152V	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	202					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		AGGTCTCACGCTGTTGCATGT	0.328																																					p.A202V		.											TNPO1,NS,carcinoma,+1	TNPO1	228	0			c.C605T						.						145.0	127.0	133.0					5																	72168474		2203	4300	6503	SO:0001583	missense	3842	exon7			CTCACGCTGTTGC	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.605C>T	5.37:g.72168474C>T	ENSP00000336712:p.Ala202Val	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	223.0	100.0	NM_002270	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	37	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	C	34	5.336982	0.95758	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72	5.25	5.25	0.73442	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.89114	0.6623	H	0.95780	3.72	0.80722	D	1	D;D	0.67145	0.996;0.992	D;P	0.70487	0.969;0.808	D	0.92131	0.5712	10	0.87932	D	0	-14.3056	19.1933	0.93675	0.0:1.0:0.0:0.0	.	152;202	Q92973-3;Q92973	.;TNPO1_HUMAN	V	202;152;152;194	ENSP00000336712:A202V;ENSP00000398524:A152V;ENSP00000428899:A152V;ENSP00000425118:A194V	ENSP00000336712:A202V	A	+	2	0	TNPO1	72204230	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	5.756000	0.68757	2.626000	0.88956	0.591000	0.81541	GCT	.		0.328	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
TRMT10C	54931	broad.mit.edu;bcgsc.ca	37	3	101283980	101283980	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr3:101283980A>G	ENST00000309922.6	+	2	509	c.355A>G	c.(355-357)Acc>Gcc	p.T119A		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	119					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										AGAGCTCAAAACCCTTATGGA	0.348																																					p.T119A		.											.	.	.	0			c.A355G						.						64.0	58.0	60.0					3																	101283980		1864	4104	5968	SO:0001583	missense	54931	exon2			CTCAAAACCCTTA	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.355A>G	3.37:g.101283980A>G	ENSP00000312356:p.Thr119Ala	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	8.0	NM_017819	Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	ENST00000309922.6	37	CCDS43122.1	.	.	.	.	.	.	.	.	.	.	A	2.592	-0.294944	0.05568	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.47177	0.85;0.85	5.87	3.53	0.40419	.	0.435196	0.26394	N	0.024640	T	0.35653	0.0939	L	0.50333	1.59	0.09310	N	0.999999	B	0.18863	0.031	B	0.13407	0.009	T	0.28138	-1.0053	10	0.08381	T	0.77	-27.358	9.0723	0.36500	0.7318:0.0:0.2682:0.0	.	119	Q7L0Y3	MRRP1_HUMAN	A	119	ENSP00000312356:T119A;ENSP00000419389:T119A	ENSP00000312356:T119A	T	+	1	0	RG9MTD1	102766670	0.858000	0.29795	0.639000	0.29394	0.716000	0.41182	1.874000	0.39568	0.584000	0.29591	0.533000	0.62120	ACC	.		0.348	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819	
TRMT1L	81627	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	185089286	185089287	+	Frame_Shift_Ins	INS	-	-	A			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:185089286_185089287insA	ENST00000367506.5	-	15	2334_2335	c.2066_2067insT	c.(2065-2067)ttafs	p.L689fs	TRMT1L_ENST00000465827.1_5'UTR|TRMT1L_ENST00000367504.3_3'UTR	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	689					adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						TGCTGTACTTTAAAAGGATAGA	0.441																																					p.L689fs		.											.	TRMT1L	92	0			c.2067_2068insT						.																																			SO:0001589	frameshift_variant	81627	exon15			GTACTTTAAAAGG	AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.2067dupT	1.37:g.185089290_185089290dupA	ENSP00000356476:p.Leu689fs	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	410.0	101.0	NM_030934	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Frame_Shift_Ins	INS	ENST00000367506.5	37	CCDS1366.1																																																																																			.		0.441	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085787.1	NM_030934	
TRPC4AP	26133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	33598060	33598060	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr20:33598060G>C	ENST00000252015.2	-	12	1530	c.1441C>G	c.(1441-1443)Ctg>Gtg	p.L481V	TRPC4AP_ENST00000432634.2_Missense_Mutation_p.L442V|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.L473V|TRPC4AP_ENST00000539834.1_Missense_Mutation_p.L83V			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	481					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			AGTTCATTCAGCTCCTGGTTG	0.532																																					p.L481V		.											.	TRPC4AP	91	0			c.C1441G						.						234.0	162.0	186.0					20																	33598060		2203	4300	6503	SO:0001583	missense	26133	exon12			CATTCAGCTCCTG	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.1441C>G	20.37:g.33598060G>C	ENSP00000252015:p.Leu481Val	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	277.0	107.0	NM_015638	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	37	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.155652	0.57259	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	.	.	.	5.67	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.62539	0.2436	M	0.62723	1.935	0.53688	D	0.999975	B;B;B	0.29481	0.245;0.201;0.201	B;B;B	0.35182	0.197;0.138;0.138	T	0.63497	-0.6624	9	0.52906	T	0.07	.	12.8124	0.57647	0.0758:0.0:0.9242:0.0	.	442;473;481	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	V	481;473;83;442;466	.	ENSP00000252015:L481V	L	-	1	2	TRPC4AP	33061721	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.846000	0.62860	1.399000	0.46721	0.555000	0.69702	CTG	.		0.532	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
TTC37	9652	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	94839530	94839530	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr5:94839530C>T	ENST00000358746.2	-	31	3503	c.3205G>A	c.(3205-3207)Gag>Aag	p.E1069K		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	1069						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TTGCTGCTCTCTTTATAAAGC	0.363																																					p.E1069K		.											.	TTC37	94	0			c.G3205A						.						122.0	121.0	121.0					5																	94839530		2203	4300	6503	SO:0001583	missense	9652	exon31			TGCTCTCTTTATA	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.3205G>A	5.37:g.94839530C>T	ENSP00000351596:p.Glu1069Lys	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	63.0	NM_014639	O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	37	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496049	0.85069	.	.	ENSG00000198677	ENST00000358746	T	0.54675	0.56	5.7	5.7	0.88788	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.56187	0.1968	M	0.77616	2.38	0.80722	D	1	P	0.40731	0.728	B	0.36092	0.217	T	0.57768	-0.7754	10	0.29301	T	0.29	.	20.2096	0.98287	0.0:1.0:0.0:0.0	.	1069	Q6PGP7	TTC37_HUMAN	K	1069	ENSP00000351596:E1069K	ENSP00000351596:E1069K	E	-	1	0	TTC37	94865286	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	6.497000	0.73674	2.841000	0.97950	0.637000	0.83480	GAG	.		0.363	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639	
ZNF527	84503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37879212	37879212	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr19:37879212G>T	ENST00000436120.2	+	5	368	c.261G>T	c.(259-261)tgG>tgT	p.W87C	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	87	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTCAGACTGGGAGTCTTGGT	0.383																																					p.W87C		.											.	ZNF527	70	0			c.G261T						.						44.0	42.0	42.0					19																	37879212		1822	4086	5908	SO:0001583	missense	84503	exon5			AGACTGGGAGTCT	AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.261G>T	19.37:g.37879212G>T	ENSP00000390179:p.Trp87Cys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	240.0	92.0	NM_032453	B4DVL5	Missense_Mutation	SNP	ENST00000436120.2	37	CCDS42559.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.413878	0.42817	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	4.72	3.62	0.41486	.	0.000000	0.30501	N	0.009483	T	0.39306	0.1073	N	0.16862	0.45	0.80722	D	1	B;B	0.20988	0.03;0.05	B;B	0.21151	0.015;0.033	T	0.35226	-0.9797	9	0.51188	T	0.08	.	10.1897	0.43019	0.0:0.0:0.8027:0.1973	.	87;55	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	C	87;55;35	.	ENSP00000325231:W55C	W	+	3	0	ZNF527	42571052	0.786000	0.28738	1.000000	0.80357	0.991000	0.79684	0.462000	0.21956	2.455000	0.83008	0.655000	0.94253	TGG	.		0.383	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458434.1	NM_032453	
OR2T4	127074	ucsc.edu;bcgsc.ca	37	1	248525290	248525291	+	Missense_Mutation	DNP	CG	CG	TC	rs386642002|rs28540568|rs374193555|rs141576206|rs57728407|rs202028348	byFrequency	TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr1:248525290_248525291CG>TC	ENST00000366475.1	+	1	408_409	c.408_409CG>TC	c.(406-411)taCGtg>taTCtg	p.V137L		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y136*(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTTCTTCTACGTGACACTAGC	0.52																																					p.V137L		.											.	.	.	1	Substitution - Nonsense(1)	lung(1)	.						.																																			SO:0001583	missense	127074	.			CTTCTACGTGACA	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	Exception_encountered	1.37:g.248525290_248525291delinsTC	ENSP00000355431:p.Val137Leu	Somatic	144.0	1.0		WXS	Illumina HiSeq	.	1506.0	348.0	.	Q6IEZ8	Missense_Mutation	DNP	ENST00000366475.1	37	CCDS31113.1																																																																																			.		0.520	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
SIMC1	375484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	175772304	175772305	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-EP-A12J-01A-11D-A12Z-10	TCGA-EP-A12J-10A-01D-A12Z-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73c7f411-7d71-42ff-a525-9e6b3a2eff55	06c493d1-681d-483a-9c11-20d996f21545	g.chr5:175772304_175772305CC>AA	ENST00000443967.1	+	12	2882_2883	c.2475_2476CC>AA	c.(2473-2478)ttCCgc>ttAAgc	p.825_826FR>LS	RP11-843P14.2_ENST00000508187.1_RNA|KIAA1191_ENST00000393728.2_5'Flank|SIMC1_ENST00000430704.2_Missense_Mutation_p.410_411FR>LS|SIMC1_ENST00000341199.6_Missense_Mutation_p.410_411FR>LS|SIMC1_ENST00000332772.4_Missense_Mutation_p.286_287FR>LS			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	825							SUMO polymer binding (GO:0032184)										TTGAGGCCTTCCGCAGCCGCCT	0.51																																					p.FR825LS		.											.	.	.	0			.						.																																			SO:0001583	missense	375484	.			GGCCTTCCGCAGC	BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	Exception_encountered	5.37:g.175772304_175772305delinsAA	ENSP00000406571:p.F825_R826delinsLS	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	81.0	.	J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Missense_Mutation	DNP	ENST00000443967.1	37																																																																																				.		0.510	SIMC1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000253155.2	NM_198567	
