#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AADAT	51166	hgsc.bcm.edu;bcgsc.ca	37	4	170999725	170999725	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:170999725T>C	ENST00000337664.4	-	4	655	c.379A>G	c.(379-381)Atg>Gtg	p.M127V	AADAT_ENST00000509167.1_Missense_Mutation_p.M131V|AADAT_ENST00000515480.1_Missense_Mutation_p.M127V|AADAT_ENST00000353187.2_Missense_Mutation_p.M127V	NM_016228.3	NP_057312.1	Q8N5Z0	AADAT_HUMAN	aminoadipate aminotransferase	127					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	mitochondrial matrix (GO:0005759)	2-aminoadipate transaminase activity (GO:0047536)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|pancreas(1)|stomach(1)	11		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0355)|LUSC - Lung squamous cell carcinoma(193;0.118)		TTAATGATCATTTCAAACACC	0.373																																					p.M127V		.											.	AADAT	90	0			c.A379G						.						105.0	102.0	103.0					4																	170999725		2203	4300	6503	SO:0001583	missense	51166	exon5			TGATCATTTCAAA	AF097994	CCDS3814.1, CCDS75209.1	4q33	2010-12-09			ENSG00000109576	ENSG00000109576	2.6.1.39		17929	protein-coding gene	gene with protein product	"""kynurenine aminotransferase II"", ""L kynurenine/alpha aminoadipate aminotransferase"""	611754				12126930, 10441733	Standard	NM_182662		Approved	KATII, KAT2	uc003isr.3	Q8N5Z0	OTTHUMG00000160912	ENST00000337664.4:c.379A>G	4.37:g.170999725T>C	ENSP00000336808:p.Met127Val	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	4.0	NM_182662	B3KP84|Q9UL02	Missense_Mutation	SNP	ENST00000337664.4	37	CCDS3814.1	.	.	.	.	.	.	.	.	.	.	T	16.91	3.254043	0.59212	.	.	ENSG00000109576	ENST00000337664;ENST00000515480;ENST00000509167;ENST00000353187;ENST00000510340;ENST00000507375;ENST00000502392	D;D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	5.42	5.42	0.78866	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.84678	0.5525	L	0.42744	1.35	0.58432	D	0.999998	P;P	0.47302	0.554;0.893	B;B	0.42593	0.272;0.392	T	0.82583	-0.0385	10	0.10636	T	0.68	-26.7196	15.7937	0.78388	0.0:0.0:0.0:1.0	.	131;127	Q8N5Z0-2;Q8N5Z0	.;AADAT_HUMAN	V	127;127;131;127;118;127;127	ENSP00000336808:M127V;ENSP00000423341:M127V;ENSP00000423190:M131V;ENSP00000226840:M127V;ENSP00000425067:M118V;ENSP00000421389:M127V;ENSP00000423843:M127V	ENSP00000336808:M127V	M	-	1	0	AADAT	171236300	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.211000	0.77933	2.188000	0.69820	0.528000	0.53228	ATG	.		0.373	AADAT-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362952.1	NM_016228	
ABCA12	26154	hgsc.bcm.edu;bcgsc.ca	37	2	215797448	215797448	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:215797448G>T	ENST00000272895.7	-	53	7917	c.7698C>A	c.(7696-7698)gcC>gcA	p.A2566A	ABCA12_ENST00000389661.4_Silent_p.A2248A|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2566					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCTGGTCTTTGGCAAAGTTGA	0.408																																					p.A2566A	Ovarian(66;664 1488 5121 34295)	.											.	ABCA12	99	0			c.C7698A						.						112.0	107.0	109.0					2																	215797448		2203	4300	6503	SO:0001819	synonymous_variant	26154	exon53			GTCTTTGGCAAAG	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7698C>A	2.37:g.215797448G>T		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	4.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	37	CCDS33372.1																																																																																			.		0.408	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ABCA13	154664	hgsc.bcm.edu;bcgsc.ca	37	7	48312768	48312768	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:48312768A>G	ENST00000435803.1	+	17	3529	c.3505A>G	c.(3505-3507)Atg>Gtg	p.M1169V		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1169					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TAAGTTTGACATGAATGTTTT	0.383																																					p.M1169V		.											.	ABCA13	521	0			c.A3505G						.						95.0	91.0	92.0					7																	48312768		1843	4092	5935	SO:0001583	missense	154664	exon17			TTTGACATGAATG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.3505A>G	7.37:g.48312768A>G	ENSP00000411096:p.Met1169Val	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	5.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	1.760	-0.487001	0.04352	.	.	ENSG00000179869	ENST00000435803	D	0.84442	-1.85	5.64	-7.85	0.01192	.	1.722330	0.03242	N	0.180484	T	0.73273	0.3566	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.55560	-0.8122	9	.	.	.	.	1.7537	0.02977	0.2465:0.1869:0.3627:0.2039	.	1169	Q86UQ4	ABCAD_HUMAN	V	1169	ENSP00000411096:M1169V	.	M	+	1	0	ABCA13	48283314	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.146000	0.03191	-1.461000	0.01909	-1.783000	0.00646	ATG	.		0.383	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABCA4	24	hgsc.bcm.edu;bcgsc.ca	37	1	94517230	94517230	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:94517230C>A	ENST00000370225.3	-	17	2698	c.2612G>T	c.(2611-2613)tGg>tTg	p.W871L	ABCA4_ENST00000535735.1_Missense_Mutation_p.W797L	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	871					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AAGAAAGTACCAAGGAAGTGG	0.413																																					p.W871L		.											.	ABCA4	162	0			c.G2612T						.						74.0	69.0	71.0					1																	94517230		2203	4300	6503	SO:0001583	missense	24	exon17			AAGTACCAAGGAA	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.2612G>T	1.37:g.94517230C>A	ENSP00000359245:p.Trp871Leu	Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	5.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.376159	0.61735	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	T;T	0.76186	-1.0;-1.0	5.82	5.82	0.92795	.	0.174267	0.53938	D	0.000050	T	0.82222	0.4990	M	0.72576	2.205	0.37227	D	0.905509	D;B	0.61697	0.99;0.058	P;B	0.59546	0.859;0.049	D	0.83885	0.0281	10	0.87932	D	0	.	20.0852	0.97797	0.0:1.0:0.0:0.0	.	797;871	F5H6E5;P78363	.;ABCA4_HUMAN	L	871;797	ENSP00000359245:W871L;ENSP00000437682:W797L	ENSP00000359245:W871L	W	-	2	0	ABCA4	94289818	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	5.039000	0.64185	2.752000	0.94435	0.655000	0.94253	TGG	.		0.413	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
ADAM18	8749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	39495084	39495084	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr8:39495084T>C	ENST00000265707.5	+	9	734	c.689T>C	c.(688-690)aTa>aCa	p.I230T	ADAM18_ENST00000541111.1_5'UTR|ADAM18_ENST00000379866.1_Missense_Mutation_p.I206T	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	230	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TTGACTGTTATACTGTCTTCC	0.303																																					p.I230T		.											.	ADAM18	228	0			c.T689C						.						84.0	80.0	81.0					8																	39495084		2203	4299	6502	SO:0001583	missense	8749	exon9			CTGTTATACTGTC	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.689T>C	8.37:g.39495084T>C	ENSP00000265707:p.Ile230Thr	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	81.0	NM_014237	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	ENST00000265707.5	37	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	T	8.687	0.906443	0.17833	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000522198	T;T	0.63096	-0.02;-0.02	5.18	-0.21	0.13176	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	1.402720	0.04412	N	0.366199	T	0.50051	0.1593	L	0.35487	1.065	0.09310	N	1	B;B	0.26445	0.149;0.087	B;B	0.30572	0.111;0.117	T	0.39099	-0.9630	10	0.49607	T	0.09	.	3.0133	0.06051	0.304:0.1712:0.0:0.5247	.	206;230	Q9Y3Q7-2;Q9Y3Q7	.;ADA18_HUMAN	T	230;206;162	ENSP00000265707:I230T;ENSP00000369195:I206T	ENSP00000265707:I230T	I	+	2	0	ADAM18	39614241	0.051000	0.20477	0.001000	0.08648	0.842000	0.47809	0.209000	0.17435	-0.154000	0.11118	-0.256000	0.11100	ATA	.		0.303	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	
ADAM20	8748	hgsc.bcm.edu;bcgsc.ca	37	14	70989894	70989894	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:70989894A>G	ENST00000256389.3	-	2	1975	c.1731T>C	c.(1729-1731)tcT>tcC	p.S577S	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	527	Cys-rich.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		AGCAACTCTGAGATGCACTCC	0.408																																					p.S577S		.											.	ADAM20	226	0			c.T1731C						.						197.0	142.0	161.0					14																	70989894		2203	4300	6503	SO:0001819	synonymous_variant	8748	exon2			ACTCTGAGATGCA	AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.1731T>C	14.37:g.70989894A>G		Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	5.0	NM_003814	Q6GTZ1|Q9UKJ9	Silent	SNP	ENST00000256389.3	37	CCDS32111.1																																																																																			.		0.408	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395004.2		
ADAMTS5	11096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	28296553	28296553	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr21:28296553C>A	ENST00000284987.5	-	8	2733	c.2612G>T	c.(2611-2613)gGa>gTa	p.G871V	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	871	Spacer.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						AGTGTGTGATCCCACTTTATT	0.522																																					p.G871V	Esophageal Squamous(53;683 1080 10100 14424 45938)	.											.	ADAMTS5	229	0			c.G2612T						.						108.0	103.0	105.0					21																	28296553		2203	4300	6503	SO:0001583	missense	11096	exon8			TGTGATCCCACTT	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2612G>T	21.37:g.28296553C>A	ENSP00000284987:p.Gly871Val	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	51.0	NM_007038	Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	C	0.265	-0.996879	0.02145	.	.	ENSG00000154736	ENST00000284987	T	0.63096	-0.02	5.54	2.69	0.31865	.	0.846026	0.10799	N	0.632875	T	0.34629	0.0904	N	0.04203	-0.255	0.34851	D	0.741686	B	0.02656	0.0	B	0.04013	0.001	T	0.30208	-0.9986	10	0.30078	T	0.28	.	3.8348	0.08889	0.3709:0.392:0.1617:0.0755	.	871	Q9UNA0	ATS5_HUMAN	V	871	ENSP00000284987:G871V	ENSP00000284987:G871V	G	-	2	0	ADAMTS5	27218424	0.343000	0.24818	0.416000	0.26546	0.125000	0.20455	1.929000	0.40114	0.401000	0.25424	-0.274000	0.10170	GGA	.		0.522	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
AGMAT	79814	hgsc.bcm.edu;bcgsc.ca	37	1	15901266	15901266	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:15901266G>T	ENST00000375826.3	-	6	1113	c.971C>A	c.(970-972)cCg>cAg	p.P324Q	DNAJC16_ENST00000483270.1_3'UTR|DNAJC16_ENST00000375849.1_Missense_Mutation_p.R654L	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	324					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		AAGATCATACGGTGGTGAAAC	0.468																																					p.P324Q	NSCLC(126;1678 1780 25805 43508 49531)	.											.	AGMAT	91	0			c.C971A						.						110.0	96.0	100.0					1																	15901266		2203	4300	6503	SO:0001583	missense	79814	exon6			TCATACGGTGGTG	AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.971C>A	1.37:g.15901266G>T	ENSP00000364986:p.Pro324Gln	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_024758	Q5TDH1|Q9H5J3	Missense_Mutation	SNP	ENST00000375826.3	37	CCDS160.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.566|9.566	1.119660|1.119660	0.20877|0.20877	.|.	.|.	ENSG00000116771|ENSG00000116138	ENST00000375826|ENST00000375849	D|T	0.84223|0.70631	-1.82|-0.5	5.93|5.93	-4.84|-4.84	0.03151|0.03151	Ureohydrolase domain (1);|.	1.007650|.	0.07957|.	N|.	0.981860|.	T|T	0.67268|0.67268	0.2875|0.2875	L|L	0.61218|0.61218	1.895|1.895	0.09310|0.09310	N|N	1|1	B|.	0.23854|.	0.092|.	B|.	0.36808|.	0.233|.	T|T	0.62690|0.62690	-0.6801|-0.6801	10|6	0.72032|.	D|.	0.01|.	0.0126|0.0126	8.29|8.29	0.31952|0.31952	0.3792:0.0:0.5066:0.1143|0.3792:0.0:0.5066:0.1143	.|.	324|.	Q9BSE5|.	SPEB_HUMAN|.	Q|L	324|654	ENSP00000364986:P324Q|ENSP00000365009:R654L	ENSP00000364986:P324Q|.	P|R	-|+	2|2	0|0	AGMAT|DNAJC16	15773853|15773853	0.005000|0.005000	0.15991|0.15991	0.000000|0.000000	0.03702|0.03702	0.055000|0.055000	0.15305|0.15305	1.808000|1.808000	0.38912|0.38912	-0.729000|-0.729000	0.04875|0.04875	-0.332000|-0.332000	0.08345|0.08345	CCG|CGG	.		0.468	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
AGO3	192669	hgsc.bcm.edu;bcgsc.ca	37	1	36439085	36439085	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:36439085A>G	ENST00000373191.4	+	5	980	c.631A>G	c.(631-633)Atg>Gtg	p.M211V	AGO3_ENST00000324350.5_Missense_Mutation_p.M211V|AGO3_ENST00000397828.2_Missense_Mutation_p.M211V|AGO3_ENST00000246314.6_Intron	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	211					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										TCGGCCTGCCATGTGGAAAAT	0.448																																					p.M211V		.											.	.	.	0			c.A631G						.						202.0	200.0	201.0					1																	36439085		2203	4300	6503	SO:0001583	missense	192669	exon5			CCTGCCATGTGGA	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.631A>G	1.37:g.36439085A>G	ENSP00000362287:p.Met211Val	Somatic	236.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	6.0	NM_024852	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	CCDS399.1	.	.	.	.	.	.	.	.	.	.	A	16.69	3.192029	0.58017	.	.	ENSG00000126070	ENST00000324350;ENST00000373191;ENST00000397828	T;T;T	0.09073	3.02;3.02;3.02	5.62	5.62	0.85841	Domain of unknown function DUF1785 (1);	0.000000	0.85682	D	0.000000	T	0.07954	0.0199	N	0.12502	0.225	0.80722	D	1	B;B	0.23249	0.082;0.005	B;B	0.33121	0.158;0.008	T	0.36089	-0.9762	10	0.54805	T	0.06	-32.6353	15.8286	0.78733	1.0:0.0:0.0:0.0	.	211;211	Q9H9G7;Q5TA56	AGO3_HUMAN;.	V	211	ENSP00000317425:M211V;ENSP00000362287:M211V;ENSP00000380928:M211V	ENSP00000317425:M211V	M	+	1	0	EIF2C3	36211672	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.024000	0.70857	2.141000	0.66446	0.460000	0.39030	ATG	.		0.448	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852	
AKAP13	11214	hgsc.bcm.edu;bcgsc.ca	37	15	86286858	86286858	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:86286858A>G	ENST00000394518.2	+	36	8289	c.8194A>G	c.(8194-8196)Aac>Gac	p.N2732D	AKAP13_ENST00000560579.1_3'UTR|RP11-158M2.3_ENST00000558375.1_RNA|AKAP13_ENST00000394510.2_Missense_Mutation_p.N977D|AKAP13_ENST00000361243.2_Missense_Mutation_p.N2736D	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2732	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CCCAAAAAGGAACAGCATCTC	0.532																																					p.N2736D	Melanoma(94;603 1453 3280 32295 32951)	.											.	AKAP13	258	0			c.A8206G						.						159.0	162.0	161.0					15																	86286858		2202	4299	6501	SO:0001583	missense	11214	exon36			AAAAGGAACAGCA	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.8194A>G	15.37:g.86286858A>G	ENSP00000378026:p.Asn2732Asp	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	4.0	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	A	13.26	2.183948	0.38609	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.49139	0.79;0.79;0.79	5.72	4.6	0.57074	.	.	.	.	.	T	0.41236	0.1150	M	0.63843	1.955	0.38449	D	0.94691	P;P	0.41524	0.639;0.753	B;B	0.37091	0.122;0.241	T	0.38845	-0.9642	9	0.35671	T	0.21	.	8.371	0.32415	0.8496:0.0:0.1504:0.0	.	2732;2736	Q12802;Q12802-2	AKP13_HUMAN;.	D	2736;2732;2735;2711;977	ENSP00000354718:N2736D;ENSP00000378026:N2732D;ENSP00000378018:N977D	ENSP00000354718:N2736D	N	+	1	0	AKAP13	84087862	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	4.156000	0.58138	1.001000	0.39076	-0.297000	0.09499	AAC	.		0.532	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
ANK2	287	hgsc.bcm.edu;bcgsc.ca	37	4	114279607	114279607	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:114279607C>A	ENST00000357077.4	+	38	9886	c.9833C>A	c.(9832-9834)cCa>cAa	p.P3278Q	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.P3245Q|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3278					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GATTCTTCCCCAGAAGAACAG	0.443																																					p.P3278Q		.											.	ANK2	583	0			c.C9833A						.						101.0	98.0	99.0					4																	114279607		2203	4300	6503	SO:0001583	missense	287	exon38			CTTCCCCAGAAGA	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9833C>A	4.37:g.114279607C>A	ENSP00000349588:p.Pro3278Gln	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	6.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980398	0.74474	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	T;T;D	0.96265	-0.33;-0.34;-3.96	5.71	5.71	0.89125	.	0.000000	0.56097	D	0.000024	D	0.97854	0.9295	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96981	0.9715	10	0.32370	T	0.25	.	19.8625	0.96789	0.0:1.0:0.0:0.0	.	3245;3278	Q01484;Q01484-4	ANK2_HUMAN;.	Q	3278;3245;288	ENSP00000349588:P3278Q;ENSP00000264366:P3245Q;ENSP00000422498:P288Q	ENSP00000264366:P3245Q	P	+	2	0	ANK2	114499056	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.487000	0.81328	2.689000	0.91719	0.655000	0.94253	CCA	.		0.443	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ANKLE2	23141	hgsc.bcm.edu;bcgsc.ca	37	12	133313525	133313525	+	Missense_Mutation	SNP	G	G	T	rs201586661		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:133313525G>T	ENST00000357997.5	-	8	1636	c.1547C>A	c.(1546-1548)cCg>cAg	p.P516Q	ANKLE2_ENST00000542374.1_5'Flank|ANKLE2_ENST00000337516.5_Missense_Mutation_p.P516Q|ANKLE2_ENST00000539605.1_Missense_Mutation_p.P454Q	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	516					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		GGTCAGTACCGGGTCTCTGGG	0.622																																					p.P516Q		.											.	ANKLE2	68	0			c.C1547A						.						65.0	78.0	74.0					12																	133313525		1982	4154	6136	SO:0001583	missense	23141	exon8			AGTACCGGGTCTC	AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.1547C>A	12.37:g.133313525G>T	ENSP00000350686:p.Pro516Gln	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_015114	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	ENST00000357997.5	37	CCDS41869.1	.	.	.	.	.	.	.	.	.	.	g	21.1	4.102404	0.76983	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000337516;ENST00000535036	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.75287	0.3829	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77161	-0.2689	10	0.87932	D	0	-19.8516	19.9201	0.97084	0.0:0.0:1.0:0.0	.	516;516	Q86XL3-2;Q86XL3	.;ANKL2_HUMAN	Q	454;516;516;79	ENSP00000446268:P454Q;ENSP00000350686:P516Q;ENSP00000337651:P516Q;ENSP00000437585:P79Q	ENSP00000337651:P516Q	P	-	2	0	ANKLE2	131823598	1.000000	0.71417	0.913000	0.36048	0.294000	0.27393	9.005000	0.93587	2.785000	0.95823	0.650000	0.86243	CCG	.		0.622	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397712.1		
ANXA13	312	hgsc.bcm.edu;bcgsc.ca	37	8	124693533	124693533	+	Missense_Mutation	SNP	G	G	T	rs201212750		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr8:124693533G>T	ENST00000419625.1	-	11	970	c.898C>A	c.(898-900)Cgc>Agc	p.R300S	ANXA13_ENST00000262219.6_Missense_Mutation_p.R341S	NM_004306.2	NP_004297.2	P27216	ANX13_HUMAN	annexin A13	300					cell differentiation (GO:0030154)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|exocytic vesicle (GO:0070382)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylglycerol binding (GO:1901611)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	25	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			GTATCTGAGCGAACCATGTCA	0.493																																					p.R341S		.											.	ANXA13	93	0			c.C1021A						.						212.0	220.0	217.0					8																	124693533		2203	4300	6503	SO:0001583	missense	312	exon12			CTGAGCGAACCAT	Z11502	CCDS34939.1, CCDS47917.1	8q24.13	2005-11-09			ENSG00000104537	ENSG00000104537		"""Annexins"""	536	protein-coding gene	gene with protein product		602573		ANX13		9503022	Standard	NM_004306		Approved		uc003yqt.3	P27216	OTTHUMG00000164987	ENST00000419625.1:c.898C>A	8.37:g.124693533G>T	ENSP00000390809:p.Arg300Ser	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	5.0	NM_001003954	Q9BQR5	Missense_Mutation	SNP	ENST00000419625.1	37	CCDS47917.1	.	.	.	.	.	.	.	.	.	.	G	0.913	-0.718427	0.03182	.	.	ENSG00000104537	ENST00000262219;ENST00000419625	T;T	0.03152	4.03;4.03	5.71	3.83	0.44106	Annexin repeat, conserved site (1);	0.766484	0.13479	N	0.384821	T	0.01905	0.0060	N	0.10685	0.025	0.24403	N	0.994693	B;B	0.10296	0.003;0.002	B;B	0.12837	0.008;0.005	T	0.45760	-0.9239	10	0.02654	T	1	.	8.6176	0.33842	0.0:0.1495:0.5417:0.3088	.	300;341	P27216;P27216-2	ANX13_HUMAN;.	S	341;300	ENSP00000262219:R341S;ENSP00000390809:R300S	ENSP00000262219:R341S	R	-	1	0	ANXA13	124762714	0.627000	0.27129	0.983000	0.44433	0.595000	0.36748	0.298000	0.19120	0.677000	0.31305	0.655000	0.94253	CGC	G|0.999;A|0.000		0.493	ANXA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381308.1	NM_004306	
AP1AR	55435	hgsc.bcm.edu;bcgsc.ca	37	4	113174413	113174413	+	Splice_Site	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:113174413G>A	ENST00000274000.5	+	2	487		c.e2+1		AP1AR_ENST00000309703.6_Splice_Site	NM_018569.4	NP_061039.3	Q63HQ0	AP1AR_HUMAN	adaptor-related protein complex 1 associated regulatory protein						cellular protein localization (GO:0034613)|negative regulation of cell motility (GO:2000146)|negative regulation of receptor recycling (GO:0001920)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|transport vesicle (GO:0030133)	AP-1 adaptor complex binding (GO:0035650)|kinesin binding (GO:0019894)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	9						AACAATAGAGGTAAGTAGTCC	0.353																																					.		.											.	AP1AR	90	0			c.132+1G>A						.						62.0	64.0	63.0					4																	113174413		2203	4299	6502	SO:0001630	splice_region_variant	55435	exon2			ATAGAGGTAAGTA	AL136628	CCDS3696.1, CCDS47125.1	4q25	2009-09-28	2009-09-25	2009-09-25	ENSG00000138660	ENSG00000138660			28808	protein-coding gene	gene with protein product	"""gamma1-adaptin brefeldin A resistance"""	610851	"""chromosome 4 open reading frame 16"""	C4orf16		15775984	Standard	NM_018569		Approved	PRO0971, 2C18, gamma-BAR	uc003iaj.4	Q63HQ0	OTTHUMG00000132849	ENST00000274000.5:c.132+1G>A	4.37:g.113174413G>A		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	5.0	NM_001128426	B2RCV7|Q96GG6|Q9H0V0|Q9P1L4	Splice_Site	SNP	ENST00000274000.5	37	CCDS3696.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416841	0.83449	.	.	ENSG00000138660	ENST00000274000;ENST00000309703	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2417	0.93887	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AP1AR	113393862	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.582000	0.82546	2.619000	0.88677	0.650000	0.86243	.	.		0.353	AP1AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256323.2	NM_018569	Intron
AP3D1	8943	hgsc.bcm.edu;bcgsc.ca	37	19	2138617	2138617	+	Splice_Site	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:2138617C>T	ENST00000345016.5	-	2	424		c.e2+1		AP3D1_ENST00000350812.6_Splice_Site|AP3D1_ENST00000355272.6_Splice_Site|AP3D1_ENST00000356926.4_Splice_Site	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGCACTTACATACGTCAGC	0.537																																					.		.											.	AP3D1	90	0			c.192+1G>A						.						104.0	110.0	108.0					19																	2138617		2179	4260	6439	SO:0001630	splice_region_variant	8943	exon3			CACTTACATACGT	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.192+1G>A	19.37:g.2138617C>T		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	7.0	NM_003938	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Splice_Site	SNP	ENST00000345016.5	37	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673503	0.67928	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2978	0.90153	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AP3D1	2089617	1.000000	0.71417	0.110000	0.21437	0.587000	0.36485	7.379000	0.79691	2.633000	0.89246	0.563000	0.77884	.	.		0.537	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1		Intron
ARAF	369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	47430811	47430811	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:47430811T>A	ENST00000377045.4	+	16	1970	c.1776T>A	c.(1774-1776)gaT>gaA	p.D592E	ARAF_ENST00000470206.1_Intron	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	592					cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	CCCAGGCCGATGAGTTGCCTG	0.647																																					p.D595E		.											.	ARAF	1557	0			c.T1785A						.						57.0	39.0	45.0					X																	47430811		2203	4300	6503	SO:0001583	missense	369	exon16			GGCCGATGAGTTG	X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.1776T>A	X.37:g.47430811T>A	ENSP00000366244:p.Asp592Glu	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	73.0	NM_001256196	P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	ENST00000377045.4	37	CCDS35232.1	.	.	.	.	.	.	.	.	.	.	t	3.051	-0.195418	0.06259	.	.	ENSG00000078061	ENST00000377045	T	0.72942	-0.7	5.26	-6.7	0.01766	.	0.059749	0.64402	D	0.000004	T	0.27384	0.0672	N	0.02011	-0.69	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.41142	-0.9525	10	0.02654	T	1	.	5.3103	0.15828	0.1124:0.5063:0.1977:0.1836	.	592	P10398	ARAF_HUMAN	E	592	ENSP00000366244:D592E	ENSP00000366244:D592E	D	+	3	2	ARAF	47315755	0.969000	0.33509	0.946000	0.38457	0.994000	0.84299	0.003000	0.13083	-1.053000	0.03218	0.427000	0.28365	GAT	.		0.647	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1		
AR	367	hgsc.bcm.edu;bcgsc.ca	37	X	66766306	66766306	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:66766306A>G	ENST00000374690.3	+	1	1842	c.1318A>G	c.(1318-1320)Aca>Gca	p.T440A	AR_ENST00000504326.1_Missense_Mutation_p.T440A|AR_ENST00000396044.3_Missense_Mutation_p.T440A|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	438	Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CACTCTCTTCACAGCCGAAGA	0.746									Androgen Insensitivity Syndrome																												p.T440A		.											.	AR	661	0			c.A1318G						.						4.0	4.0	4.0					X																	66766306		1370	2920	4290	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	CTCTTCACAGCCG	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1318A>G	X.37:g.66766306A>G	ENSP00000363822:p.Thr440Ala	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	4.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	13.33	2.205347	0.39003	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	D;D;D	0.95035	-3.59;-3.59;-3.59	5.06	2.67	0.31697	.	0.840433	0.10974	N	0.613442	D	0.92545	0.7632	M	0.74881	2.28	0.27541	N	0.9508	B;B;P	0.43701	0.01;0.005;0.815	B;B;B	0.42214	0.074;0.042;0.38	D	0.84511	0.0622	10	0.29301	T	0.29	.	4.8744	0.13650	0.6413:0.0:0.3587:0.0	.	440;440;438	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	A	250;440;440;440;432	ENSP00000363822:T440A;ENSP00000421155:T440A;ENSP00000379359:T440A	ENSP00000363822:T440A	T	+	1	0	AR	66683031	0.991000	0.36638	0.950000	0.38849	0.951000	0.60555	0.992000	0.29667	0.759000	0.33084	0.414000	0.27820	ACA	.		0.746	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
ARHGAP20	57569	hgsc.bcm.edu;bcgsc.ca	37	11	110479748	110479748	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:110479748C>A	ENST00000260283.4	-	9	1019	c.735G>T	c.(733-735)tgG>tgT	p.W245C	ARHGAP20_ENST00000528829.1_Missense_Mutation_p.W209C|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.W209C|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.W219C|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.W222C|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.W219C	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	245	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		CAGAATTGACCCACAACTGGT	0.333																																					p.W245C		.											.	ARHGAP20	230	0			c.G735T						.						118.0	129.0	125.0					11																	110479748		2201	4298	6499	SO:0001583	missense	57569	exon9			ATTGACCCACAAC	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.735G>T	11.37:g.110479748C>A	ENSP00000260283:p.Trp245Cys	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	5.0	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489791	0.44249	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32;2.32	5.76	5.76	0.90799	Ras-association (2);	0.000000	0.85682	D	0.000000	T	0.47154	0.1430	M	0.79011	2.435	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.40683	-0.9550	10	0.87932	D	0	.	19.9345	0.97131	0.0:1.0:0.0:0.0	.	245;222	Q9P2F6;Q9P2F6-3	RHG20_HUMAN;.	C	245;219;222;209;219;209	ENSP00000260283:W245C;ENSP00000349660:W219C;ENSP00000432076:W222C;ENSP00000436319:W209C;ENSP00000436522:W219C;ENSP00000431399:W209C	ENSP00000260283:W245C	W	-	3	0	ARHGAP20	109984958	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	6.588000	0.74076	2.882000	0.98803	0.655000	0.94253	TGG	.		0.333	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27106505	27106506	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:27106505_27106506insT	ENST00000324856.7	+	20	6487_6488	c.6116_6117insT	c.(6115-6120)caagggfs	p.QG2039fs	ARID1A_ENST00000457599.2_Frame_Shift_Ins_p.QG1822fs|ARID1A_ENST00000374152.2_Frame_Shift_Ins_p.QG1656fs|ARID1A_ENST00000540690.1_Frame_Shift_Ins_p.QG367fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2039					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GAACAGGACCAAGGGGTGAGCT	0.569			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q2039fs		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	584	0			c.6116_6117insT						.																																			SO:0001589	frameshift_variant	8289	exon20			AGGACCAAGGGGT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	Exception_encountered	1.37:g.27106505_27106506insT	ENSP00000320485:p.Gln2039fs	Somatic	276.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	126.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Ins	INS	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.569	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ART1	417	hgsc.bcm.edu;broad.mit.edu	37	11	3681383	3681383	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:3681383C>T	ENST00000250693.1	+	3	735	c.634C>T	c.(634-636)Cag>Tag	p.Q212*		NM_004314.2	NP_004305.2	P52961	NAR1_HUMAN	ADP-ribosyltransferase 1	212					innate immune response (GO:0045087)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|skin(1)	8		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)		TGCAGCCCAGCAGTTTGGTGA	0.652																																					p.Q212X		.											.	ART1	90	0			c.C634T						.						41.0	38.0	39.0					11																	3681383		2201	4298	6499	SO:0001587	stop_gained	417	exon3			GCCCAGCAGTTTG	S74683	CCDS7744.1	11p15	2006-02-23			ENSG00000129744	ENSG00000129744		"""CD molecules"""	723	protein-coding gene	gene with protein product		601625				8812442	Standard	NM_004314		Approved	ART2, CD296	uc001lye.1	P52961	OTTHUMG00000011845	ENST00000250693.1:c.634C>T	11.37:g.3681383C>T	ENSP00000250693:p.Gln212*	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	6.0	NM_004314	Q6NTD2|Q96KT9	Nonsense_Mutation	SNP	ENST00000250693.1	37	CCDS7744.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.261029	0.59431	.	.	ENSG00000129744	ENST00000250693	.	.	.	5.28	0.88	0.19161	.	1.067370	0.07168	N	0.851914	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.5498	0.27790	0.5685:0.3517:0.0:0.0798	.	.	.	.	X	212	.	.	Q	+	1	0	ART1	3637959	0.000000	0.05858	0.392000	0.26245	0.713000	0.41058	-1.075000	0.03423	-0.094000	0.12374	0.467000	0.42956	CAG	.		0.652	ART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032765.1	NM_004314	
ASIC3	9311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150747908	150747908	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:150747908C>G	ENST00000349064.5	+	4	1075	c.877C>G	c.(877-879)Cca>Gca	p.P293A	ASIC3_ENST00000357922.4_Missense_Mutation_p.P293A|ASIC3_ENST00000297512.8_Missense_Mutation_p.P293A	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	293					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										CAACTATGAGCCAGAGCCCTC	0.647																																					p.P293A		.											.	.	.	0			c.C877G						.						29.0	33.0	32.0					7																	150747908		2203	4300	6503	SO:0001583	missense	9311	exon4			TATGAGCCAGAGC	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.877C>G	7.37:g.150747908C>G	ENSP00000344838:p.Pro293Ala	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	15.0	NM_020322	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Missense_Mutation	SNP	ENST00000349064.5	37	CCDS5916.1	.	.	.	.	.	.	.	.	.	.	C	0.305	-0.971659	0.02215	.	.	ENSG00000213199	ENST00000357922;ENST00000349064;ENST00000297512	T;T;T	0.61859	0.07;0.07;0.07	4.84	0.71	0.18157	.	972.779000	0.00855	N	0.001860	T	0.47875	0.1469	L	0.54323	1.7	0.09310	N	1	B;B;B	0.28128	0.114;0.039;0.201	B;B;B	0.24701	0.053;0.023;0.055	T	0.05616	-1.0874	10	0.15952	T	0.53	-1.1147	1.8255	0.03119	0.139:0.4629:0.1363:0.2617	.	293;293;293	Q9UHC3-2;Q9UHC3-3;Q9UHC3	.;.;ACCN3_HUMAN	A	293	ENSP00000350600:P293A;ENSP00000344838:P293A;ENSP00000297512:P293A	ENSP00000297512:P293A	P	+	1	0	ACCN3	150378841	0.068000	0.21057	0.014000	0.15608	0.027000	0.11550	0.424000	0.21330	0.201000	0.20466	0.650000	0.86243	CCA	.		0.647	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
ATP2A1	487	hgsc.bcm.edu;bcgsc.ca	37	16	28914131	28914131	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:28914131C>A	ENST00000357084.3	+	19	2910	c.2643C>A	c.(2641-2643)acC>acA	p.T881T	ATP2A1_ENST00000536376.1_Silent_p.T756T|ATP2A1_ENST00000395503.4_Silent_p.T881T	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	881					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						AGGACAACACCCACTTTGAGG	0.602																																					p.T881T		.											.	ATP2A1	93	0			c.C2643A						.						91.0	78.0	82.0					16																	28914131		2197	4300	6497	SO:0001819	synonymous_variant	487	exon19			CAACACCCACTTT		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2643C>A	16.37:g.28914131C>A		Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	5.0	NM_004320	A8K5J9|B3KY17|O14984	Silent	SNP	ENST00000357084.3	37	CCDS10643.1																																																																																			.		0.602	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	
ATP2A2	488	hgsc.bcm.edu;bcgsc.ca	37	12	110729905	110729905	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:110729905C>A	ENST00000539276.2	+	4	409	c.300C>A	c.(298-300)gcC>gcA	p.A100A	ATP2A2_ENST00000395494.2_Silent_p.A100A|ATP2A2_ENST00000552636.1_5'UTR|ATP2A2_ENST00000308664.6_Silent_p.A100A			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	100					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TATTAGTAGCCAATGCAATTG	0.348																																					p.A100A		.											.	ATP2A2	94	0			c.C300A						.						114.0	111.0	112.0					12																	110729905		2203	4300	6503	SO:0001819	synonymous_variant	488	exon4			AGTAGCCAATGCA		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.300C>A	12.37:g.110729905C>A		Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	200.0	8.0	NM_001681	A6NDN7|B4DF05|P16614|Q86VJ2	Silent	SNP	ENST00000539276.2	37	CCDS9144.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.292457	0.23564	.	.	ENSG00000174437	ENST00000548169	.	.	.	5.33	4.44	0.53790	.	.	.	.	.	T	0.68952	0.3057	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67726	-0.5596	4	.	.	.	.	13.1455	0.59459	0.2912:0.7088:0.0:0.0	.	.	.	.	K	18	.	.	Q	+	1	0	ATP2A2	109214288	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.750000	0.26334	1.228000	0.43614	0.563000	0.77884	CAA	.		0.348	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
ATP8A2	51761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	26273474	26273474	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr13:26273474T>C	ENST00000381655.2	+	25	2517	c.2375T>C	c.(2374-2376)aTa>aCa	p.I792T	ATP8A2_ENST00000255283.8_Missense_Mutation_p.I752T|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	752					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AAAGCGGTCATATGCTGCAGG	0.532																																					p.I792T		.											.	ATP8A2	138	0			c.T2375C						.						63.0	62.0	63.0					13																	26273474		1946	4136	6082	SO:0001583	missense	51761	exon25			CGGTCATATGCTG	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.2375T>C	13.37:g.26273474T>C	ENSP00000371070:p.Ile792Thr	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	48.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	T	19.00	3.741347	0.69304	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	D;D	0.82803	-1.65;-1.65	5.88	5.88	0.94601	HAD-like domain (2);	0.049064	0.85682	D	0.000000	D	0.94627	0.8268	H	0.98111	4.15	0.80722	D	1	D;D;D	0.62365	0.991;0.989;0.991	D;D;D	0.72625	0.978;0.962;0.967	D	0.96526	0.9389	10	0.87932	D	0	.	16.2824	0.82697	0.0:0.0:0.0:1.0	.	752;572;752	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	T	792;752;572	ENSP00000371070:I792T;ENSP00000255283:I752T	ENSP00000255283:I752T	I	+	2	0	ATP8A2	25171474	1.000000	0.71417	0.498000	0.27564	0.450000	0.32258	8.035000	0.88872	2.250000	0.74265	0.533000	0.62120	ATA	.		0.532	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
ATR	545	hgsc.bcm.edu;bcgsc.ca	37	3	142281918	142281918	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:142281918C>A	ENST00000350721.4	-	4	447	c.326G>T	c.(325-327)cGg>cTg	p.R109L	ATR_ENST00000383101.3_Missense_Mutation_p.R109L	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	109					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R109L(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TGCTGCAATCCGCAGAAGTCT	0.308								Other conserved DNA damage response genes																													p.R109L		.											.	ATR	1139	1	Substitution - Missense(1)	lung(1)	c.G326T						.						89.0	102.0	98.0					3																	142281918		2143	4277	6420	SO:0001583	missense	545	exon4			GCAATCCGCAGAA	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.326G>T	3.37:g.142281918C>A	ENSP00000343741:p.Arg109Leu	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.472384	0.63737	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.40476	1.03;1.03	5.62	5.62	0.85841	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65281	0.2676	M	0.65975	2.015	0.40605	D	0.981619	D	0.89917	1.0	D	0.81914	0.995	T	0.66532	-0.5900	10	0.59425	D	0.04	-12.9653	19.6544	0.95831	0.0:1.0:0.0:0.0	.	109	Q13535	ATR_HUMAN	L	109	ENSP00000343741:R109L;ENSP00000372581:R109L	ENSP00000343741:R109L	R	-	2	0	ATR	143764608	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.683000	0.74533	2.647000	0.89833	0.467000	0.42956	CGG	.		0.308	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
BAAT	570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	104130448	104130448	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:104130448A>G	ENST00000395051.3	-	2	693	c.623T>C	c.(622-624)tTg>tCg	p.L208S	BAAT_ENST00000259407.2_Missense_Mutation_p.L208S			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	208					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	AAAATATTCCAAATCTGTTAC	0.468																																					p.L208S		.											.	BAAT	228	0			c.T623C						.						74.0	80.0	78.0					9																	104130448		2203	4300	6503	SO:0001583	missense	570	exon3			TATTCCAAATCTG	L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.623T>C	9.37:g.104130448A>G	ENSP00000378491:p.Leu208Ser	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	65.0	NM_001127610	Q3B7W9|Q96L31	Missense_Mutation	SNP	ENST00000395051.3	37	CCDS6752.1	.	.	.	.	.	.	.	.	.	.	A	18.26	3.583815	0.65992	.	.	ENSG00000136881	ENST00000259407;ENST00000395051	T;T	0.38722	1.12;1.12	4.38	4.38	0.52667	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.155821	0.25575	N	0.029736	T	0.65176	0.2666	M	0.82517	2.595	0.26564	N	0.973674	D	0.89917	1.0	D	0.83275	0.996	T	0.60772	-0.7197	10	0.87932	D	0	-15.8757	11.6118	0.51064	1.0:0.0:0.0:0.0	.	208	Q14032	BAAT_HUMAN	S	208	ENSP00000259407:L208S;ENSP00000378491:L208S	ENSP00000259407:L208S	L	-	2	0	BAAT	103170269	1.000000	0.71417	0.268000	0.24571	0.880000	0.50808	8.507000	0.90522	1.850000	0.53721	0.459000	0.35465	TTG	.		0.468	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053433.1		
PABPN1	8106	hgsc.bcm.edu;bcgsc.ca	37	14	23794468	23794468	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:23794468A>G	ENST00000216727.4	+	7	1075	c.894A>G	c.(892-894)agA>agG	p.R298R	BCL2L2-PABPN1_ENST00000557008.1_Silent_p.R325R|AL049829.1_ENST00000594872.1_5'Flank|PABPN1_ENST00000397276.2_3'UTR|PABPN1_ENST00000556821.1_Silent_p.R170R|BCL2L2-PABPN1_ENST00000553781.1_Silent_p.R325R	NM_004643.3	NP_004634.1	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	298	Interacts with PAPOLA. {ECO:0000250}.|Necessary for homooligomerization.				gene expression (GO:0010467)|modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|muscle contraction (GO:0006936)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			large_intestine(1)|lung(1)|ovary(2)	4	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		GCCGGGCTAGAGCGACATCAT	0.428																																					p.R325R		.											.	.	.	0			c.A975G						.						109.0	108.0	108.0					14																	23794468		2203	4300	6503	SO:0001819	synonymous_variant	100529063	exon9			GGCTAGAGCGACA	AF026029	CCDS9592.1	14q11.2	2013-02-12	2001-11-28		ENSG00000100836	ENSG00000100836		"""RNA binding motif (RRM) containing"""	8565	protein-coding gene	gene with protein product		602279	"""poly(A)-binding protein, nuclear 1"""	OPMD, PABP2		7795598	Standard	NM_004643		Approved	PAB2		Q86U42	OTTHUMG00000028739	ENST00000216727.4:c.894A>G	14.37:g.23794468A>G		Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	5.0	NM_001199864	D3DS49|O43484	Silent	SNP	ENST00000216727.4	37	CCDS9592.1																																																																																			.		0.428	PABPN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071767.4	NM_004643	
BHLHA15	168620	hgsc.bcm.edu;bcgsc.ca	37	7	97842082	97842082	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:97842082A>G	ENST00000609256.1	+	2	587	c.461A>G	c.(460-462)cAg>cGg	p.Q154R	BHLHA15_ENST00000314018.2_Missense_Mutation_p.Q154R			Q7RTS1	BHA15_HUMAN	basic helix-loop-helix family, member a15	154					calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|Golgi organization (GO:0007030)|intracellular distribution of mitochondria (GO:0048312)|mitochondrial calcium ion transport (GO:0006851)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)										CAGCACTACCAGCAGCAGCAG	0.662																																					p.Q154R		.											.	BHLHA15	90	0			c.A461G						.						9.0	9.0	9.0					7																	97842082		2125	4180	6305	SO:0001583	missense	168620	exon1			ACTACCAGCAGCA	BK000276	CCDS5655.1	7q21.3	2009-01-12	2009-01-12	2009-01-12	ENSG00000180535	ENSG00000180535		"""Basic helix-loop-helix proteins"""	22265	protein-coding gene	gene with protein product		608606	"""basic helix-loop-helix domain containing, class B, 8"""	BHLHB8		14516699, 18557763	Standard	NM_177455		Approved	MIST1, bHLHa15	uc003upf.1	Q7RTS1	OTTHUMG00000154289	ENST00000609256.1:c.461A>G	7.37:g.97842082A>G	ENSP00000476312:p.Gln154Arg	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_177455	A4D271|Q14DE4	Missense_Mutation	SNP	ENST00000609256.1	37	CCDS5655.1	.	.	.	.	.	.	.	.	.	.	A	17.37	3.373778	0.61624	.	.	ENSG00000180535	ENST00000314018	D	0.93763	-3.28	3.33	3.33	0.38152	Helix-loop-helix DNA-binding (1);	0.499336	0.18937	U	0.127043	D	0.92427	0.7596	L	0.27053	0.805	0.58432	D	0.999997	D	0.71674	0.998	D	0.75484	0.986	D	0.88226	0.2900	10	0.14252	T	0.57	-9.3665	11.1497	0.48451	1.0:0.0:0.0:0.0	.	154	Q7RTS1	BHA15_HUMAN	R	154	ENSP00000326391:Q154R	ENSP00000326391:Q154R	Q	+	2	0	BHLHA15	97680018	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	5.744000	0.68664	1.270000	0.44297	0.402000	0.26972	CAG	.		0.662	BHLHA15-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472733.1	NM_177455	
BLM	641	hgsc.bcm.edu;bcgsc.ca	37	15	91304196	91304196	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:91304196A>G	ENST00000355112.3	+	7	1711	c.1593A>G	c.(1591-1593)aaA>aaG	p.K531K	BLM_ENST00000560509.1_Silent_p.K531K	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	531	Necessary for interaction with SPIDR.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			CTGCTGTGAAAGATCAGAATA	0.353			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.K531K		.	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	BLM	664	0			c.A1593G						.						60.0	62.0	61.0					15																	91304196		2198	4298	6496	SO:0001819	synonymous_variant	641	exon7	Familial Cancer Database		TGTGAAAGATCAG	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.1593A>G	15.37:g.91304196A>G		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	4.0	NM_000057	Q52M96	Silent	SNP	ENST00000355112.3	37	CCDS10363.1																																																																																			.		0.353	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
BMPER	168667	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	34101636	34101636	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:34101636G>T	ENST00000297161.2	+	12	1429	c.1055G>T	c.(1054-1056)gGa>gTa	p.G352V	BMPER_ENST00000426693.1_Missense_Mutation_p.G352V	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	352	VWFC 5. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						AACAGAAAAGGATGCTGTCCT	0.303																																					p.G352V		.											.	BMPER	92	0			c.G1055T						.						94.0	91.0	92.0					7																	34101636		2203	4299	6502	SO:0001583	missense	168667	exon12			GAAAAGGATGCTG		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1055G>T	7.37:g.34101636G>T	ENSP00000297161:p.Gly352Val	Somatic	151.0	1.0		WXS	Illumina HiSeq	Phase_I	102.0	44.0	NM_133468	A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	37	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592388	0.86953	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.71698	-0.59;-0.59	6.06	6.06	0.98353	von Willebrand factor, type C (4);	0.000000	0.85682	D	0.000000	D	0.88683	0.6503	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.90038	0.4140	10	0.87932	D	0	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	352	Q8N8U9	BMPER_HUMAN	V	352	ENSP00000297161:G352V;ENSP00000393950:G352V	ENSP00000297161:G352V	G	+	2	0	BMPER	34068161	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.082000	0.89513	2.880000	0.98712	0.650000	0.86243	GGA	.		0.303	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
BOD1L1	259282	hgsc.bcm.edu;bcgsc.ca	37	4	13602619	13602619	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:13602619T>C	ENST00000040738.5	-	10	6040	c.5905A>G	c.(5905-5907)Aca>Gca	p.T1969A		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1969						nucleus (GO:0005634)	DNA binding (GO:0003677)										GGAACTGGTGTCACTTCATCC	0.463																																					p.T1969A		.											.	.	.	0			c.A5905G						.						147.0	141.0	143.0					4																	13602619		2203	4300	6503	SO:0001583	missense	259282	exon10			CTGGTGTCACTTC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.5905A>G	4.37:g.13602619T>C	ENSP00000040738:p.Thr1969Ala	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.957397	0.00465	.	.	ENSG00000038219	ENST00000040738	T	0.05580	3.42	5.28	2.29	0.28610	.	0.728860	0.12720	N	0.444822	T	0.01800	0.0057	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46679	-0.9174	10	0.02654	T	1	-0.033	5.1288	0.14899	0.0:0.4699:0.2731:0.257	.	1969	Q8NFC6	BOD1L_HUMAN	A	1969	ENSP00000040738:T1969A	ENSP00000040738:T1969A	T	-	1	0	BOD1L	13211717	0.000000	0.05858	0.003000	0.11579	0.476000	0.33039	0.733000	0.26087	0.105000	0.17753	0.379000	0.24179	ACA	.		0.463	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
C10orf12	26148	hgsc.bcm.edu;bcgsc.ca	37	10	98741962	98741962	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr10:98741962T>C	ENST00000286067.2	+	1	922	c.815T>C	c.(814-816)gTt>gCt	p.V272A		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	272										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		GGTGGAGACGTTTCACCTCGA	0.532																																					p.V272A		.											.	C10orf12	92	0			c.T815C						.						85.0	87.0	86.0					10																	98741962		2203	4300	6503	SO:0001583	missense	26148	exon1			GAGACGTTTCACC	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.815T>C	10.37:g.98741962T>C	ENSP00000286067:p.Val272Ala	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	6.0	NM_015652	Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.684454	0.00745	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.06142	3.34	6.05	2.0	0.26442	.	1.252050	0.05965	N	0.641308	T	0.02418	0.0074	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.42413	-0.9453	10	0.02654	T	1	0.2746	1.7815	0.03032	0.1436:0.4815:0.1393:0.2357	.	106;272	A0PJI9;Q8N655	.;CJ012_HUMAN	A	272;106	ENSP00000286067:V272A	ENSP00000286067:V272A	V	+	2	0	C10orf12	98731952	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-0.470000	0.06639	0.102000	0.17638	0.533000	0.62120	GTT	.		0.532	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
BTRC	8945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	103281409	103281409	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr10:103281409A>T	ENST00000370187.3	+	5	456	c.338A>T	c.(337-339)aAt>aTt	p.N113I	BTRC_ENST00000393441.4_Missense_Mutation_p.N72I|BTRC_ENST00000408038.2_Missense_Mutation_p.N77I	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	113					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		AAACTTGCCAATGGCACTTCC	0.378																																					p.N113I		.											.	BTRC	659	0			c.A338T						.						72.0	68.0	69.0					10																	103281409		2203	4300	6503	SO:0001583	missense	8945	exon5			TTGCCAATGGCAC	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.338A>T	10.37:g.103281409A>T	ENSP00000359206:p.Asn113Ile	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	53.0	NM_033637	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	37	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	A	15.17	2.752726	0.49362	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038;ENST00000370183	T;T;T	0.60920	0.3;0.29;0.15	5.6	5.6	0.85130	.	0.137255	0.50627	D	0.000112	T	0.48660	0.1512	L	0.29908	0.895	0.38130	D	0.938118	B;B;B	0.16396	0.001;0.0;0.017	B;B;B	0.12156	0.005;0.003;0.007	T	0.50355	-0.8838	10	0.62326	D	0.03	-17.033	16.1249	0.81386	1.0:0.0:0.0:0.0	.	87;77;113	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	I	113;72;77;95	ENSP00000359206:N113I;ENSP00000377088:N72I;ENSP00000385339:N77I	ENSP00000359202:N95I	N	+	2	0	BTRC	103271399	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.547000	0.90665	2.262000	0.75019	0.529000	0.55759	AAT	.		0.378	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
C18orf42	642597	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	5145618	5145618	+	Silent	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr18:5145618G>A	ENST00000434239.3	-	2	324	c.153C>T	c.(151-153)aaC>aaT	p.N51N	C18orf42_ENST00000580650.1_Silent_p.N58N	NM_001145194.1	NP_001138666.1	P0CW23	CR042_HUMAN	chromosome 18 open reading frame 42	51																	TGTGGTCCCGGTTGTCACTGA	0.498																																					p.N51N		.											.	.	.	0			c.C153T						.						235.0	200.0	211.0					18																	5145618		692	1591	2283	SO:0001819	synonymous_variant	642597	exon2			GTCCCGGTTGTCA		CCDS54179.1	18p11.31	2012-10-24			ENSG00000231824	ENSG00000231824			28285	protein-coding gene	gene with protein product							Standard	NM_001145194		Approved		uc010wzc.1	P0CW23	OTTHUMG00000178457	ENST00000434239.3:c.153C>T	18.37:g.5145618G>A		Somatic	283.0	2.0		WXS	Illumina HiSeq	Phase_I	257.0	145.0	NM_001145194		Silent	SNP	ENST00000434239.3	37	CCDS54179.1																																																																																			.		0.498	C18orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442071.1	NM_001145194	
C2orf16	84226	hgsc.bcm.edu;bcgsc.ca	37	2	27803792	27803792	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:27803792T>C	ENST00000408964.2	+	1	4404	c.4353T>C	c.(4351-4353)ccT>ccC	p.P1451P	ZNF512_ENST00000416005.2_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000556601.1_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000355467.4_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1451						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					AACCCAGACCTCTTCGACTGC	0.512																																					p.P1451P		.											.	C2orf16	67	0			c.T4353C						.						93.0	97.0	96.0					2																	27803792		1966	4152	6118	SO:0001819	synonymous_variant	84226	exon1			CAGACCTCTTCGA	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.4353T>C	2.37:g.27803792T>C		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	ENST00000408964.2	37	CCDS42666.1																																																																																			.		0.512	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
C2orf81	388963	hgsc.bcm.edu;bcgsc.ca	37	2	74643206	74643206	+	De_novo_Start_InFrame	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:74643206C>A	ENST00000517883.1	-	0	504				C2orf81_ENST00000290390.5_Missense_Mutation_p.G64W			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81											endometrium(3)|kidney(1)	4						AAGATGTCCCCTACGACGTCC	0.627																																					p.G64W		.											.	.	.	0			c.G190T						.						34.0	42.0	39.0					2																	74643206		692	1591	2283			388963	exon2			TGTCCCCTACGAC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184		2.37:g.74643206C>A		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_001145054		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	C	16.12	3.033153	0.54896	.	.	ENSG00000159239	ENST00000290390;ENST00000517896;ENST00000518401	.	.	.	5.52	5.52	0.82312	.	0.000000	0.45361	D	0.000366	T	0.78142	0.4237	M	0.66939	2.045	0.41080	D	0.985515	D	0.89917	1.0	D	0.91635	0.999	T	0.76083	-0.3089	9	0.39692	T	0.17	-43.0883	18.5729	0.91142	0.0:1.0:0.0:0.0	.	64	G3XAA6	.	W	64;64;89	.	ENSP00000290390:G64W	G	-	1	0	C2orf81	74496714	0.986000	0.35501	1.000000	0.80357	0.956000	0.61745	3.183000	0.50918	2.762000	0.94881	0.467000	0.42956	GGG	.		0.627	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
CACNA1I	8911	hgsc.bcm.edu;bcgsc.ca	37	22	39994207	39994207	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:39994207T>C	ENST00000402142.3	+	2	288	c.288T>C	c.(286-288)ctT>ctC	p.L96L	CACNA1I_ENST00000400164.3_Silent_p.L96L|CACNA1I_ENST00000407673.1_Silent_p.L96L|CACNA1I_ENST00000401624.1_Silent_p.L96L|CACNA1I_ENST00000336649.4_Silent_p.L96L|CACNA1I_ENST00000404898.1_Silent_p.L96L	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	96					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GCGTGACACTTGGCATGTACC	0.642																																					p.L96L		.											.	CACNA1I	135	0			c.T288C						.						74.0	80.0	78.0					22																	39994207		2163	4255	6418	SO:0001819	synonymous_variant	8911	exon2			GACACTTGGCATG	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.288T>C	22.37:g.39994207T>C		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_001003406	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	CCDS46710.1																																																																																			.		0.642	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
CADM2	253559	hgsc.bcm.edu;bcgsc.ca	37	3	85932563	85932563	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:85932563delA	ENST00000407528.2	+	3	396	c.334delA	c.(334-336)aaafs	p.K112fs	CADM2_ENST00000405615.2_Frame_Shift_Del_p.K114fs|CADM2_ENST00000383699.3_Frame_Shift_Del_p.K121fs	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	112	Ig-like V-type.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		AATGCCTGTCAAAACTTCCAA	0.413																																					p.K121fs		.											.	CADM2	228	0			c.361delA						.						97.0	80.0	86.0					3																	85932563		2203	4300	6503	SO:0001589	frameshift_variant	253559	exon4			CCTGTCAAAACTT	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.334delA	3.37:g.85932563delA	ENSP00000384575:p.Lys112fs	Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	29.0	NM_001167675	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Frame_Shift_Del	DEL	ENST00000407528.2	37	CCDS54614.1																																																																																			.		0.413	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
CADM2	253559	hgsc.bcm.edu;bcgsc.ca	37	3	85932567	85932567	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:85932567C>T	ENST00000407528.2	+	3	400	c.338C>T	c.(337-339)aCt>aTt	p.T113I	CADM2_ENST00000405615.2_Missense_Mutation_p.T115I|CADM2_ENST00000383699.3_Missense_Mutation_p.T122I	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	113	Ig-like V-type.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		CCTGTCAAAACTTCCAAGGCA	0.403																																					p.T122I		.											.	CADM2	228	0			c.C365T						.						97.0	81.0	87.0					3																	85932567		2203	4300	6503	SO:0001583	missense	253559	exon4			TCAAAACTTCCAA	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.338C>T	3.37:g.85932567C>T	ENSP00000384575:p.Thr113Ile	Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	31.0	NM_001167675	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009951	0.54361	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.28454	1.61;1.61;1.61	5.54	5.54	0.83059	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.043673	0.85682	D	0.000000	T	0.64023	0.2561	M	0.87547	2.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.988;0.998;0.999	T	0.68887	-0.5290	10	0.72032	D	0.01	.	19.8568	0.96762	0.0:1.0:0.0:0.0	.	115;122;113	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	I	122;113;115	ENSP00000373200:T122I;ENSP00000384575:T113I;ENSP00000384193:T115I	ENSP00000373200:T122I	T	+	2	0	CADM2	86015257	1.000000	0.71417	0.952000	0.39060	0.016000	0.09150	5.721000	0.68477	2.764000	0.94973	0.650000	0.86243	ACT	.		0.403	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
CAND1	55832	hgsc.bcm.edu;bcgsc.ca	37	12	67699020	67699020	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:67699020G>T	ENST00000545606.1	+	10	2009	c.1572G>T	c.(1570-1572)gtG>gtT	p.V524V		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	524					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TTCCTCCAGTGGTGGCTTGTG	0.423																																					p.V524V		.											.	CAND1	516	0			c.G1572T						.						202.0	176.0	185.0					12																	67699020		2203	4300	6503	SO:0001819	synonymous_variant	55832	exon10			TCCAGTGGTGGCT		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1572G>T	12.37:g.67699020G>T		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	7.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Silent	SNP	ENST00000545606.1	37	CCDS8977.1																																																																																			.		0.423	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
CBLN1	869	hgsc.bcm.edu;bcgsc.ca	37	16	49313350	49313350	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:49313350A>G	ENST00000219197.6	-	3	912	c.547T>C	c.(547-549)Tcg>Ccg	p.S183P	CBLN1_ENST00000536749.1_Missense_Mutation_p.S183P	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	183	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Necessary for interaction with CBLN3, and homotrimerization. {ECO:0000250}.				cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)				breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				GAGAAGGTCGAGTACTTCCAG	0.602																																					p.S183P		.											.	CBLN1	90	0			c.T547C						.						109.0	103.0	105.0					16																	49313350		2200	4300	6500	SO:0001583	missense	869	exon3			AGGTCGAGTACTT	M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.547T>C	16.37:g.49313350A>G	ENSP00000219197:p.Ser183Pro	Somatic	214.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	6.0	NM_004352	B2RAN9|P02682|Q52M09	Missense_Mutation	SNP	ENST00000219197.6	37	CCDS10736.1	.	.	.	.	.	.	.	.	.	.	A	19.83	3.900943	0.72754	.	.	ENSG00000102924	ENST00000219197;ENST00000536749	T;T	0.44881	0.91;0.91	5.49	5.49	0.81192	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.064023	0.64402	D	0.000004	T	0.55226	0.1907	M	0.86805	2.84	0.58432	D	0.999999	B	0.20052	0.041	B	0.30716	0.119	T	0.59506	-0.7442	10	0.72032	D	0.01	-6.1619	15.88	0.79197	1.0:0.0:0.0:0.0	.	183	P23435	CBLN1_HUMAN	P	183	ENSP00000219197:S183P;ENSP00000444651:S183P	ENSP00000219197:S183P	S	-	1	0	CBLN1	47870851	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.183000	0.94887	2.193000	0.70182	0.533000	0.62120	TCG	.		0.602	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256845.4	NM_004352	
CCDC158	339965	hgsc.bcm.edu;bcgsc.ca	37	4	77255317	77255317	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:77255317A>G	ENST00000388914.3	-	18	2820	c.2668T>C	c.(2668-2670)Tct>Cct	p.S890P		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	890										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						GCTTTTGTAGAGTGCTGAGTT	0.373																																					p.S890P		.											.	CCDC158	96	0			c.T2668C						.						153.0	145.0	148.0					4																	77255317		1891	4122	6013	SO:0001583	missense	339965	exon18			TTGTAGAGTGCTG	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.2668T>C	4.37:g.77255317A>G	ENSP00000373566:p.Ser890Pro	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	5.0	NM_001042784	Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	37	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	A	6.993	0.553351	0.13374	.	.	ENSG00000163749	ENST00000388914	T	0.33216	1.42	5.19	4.01	0.46588	.	0.308471	0.23670	N	0.045733	T	0.13628	0.0330	N	0.08118	0	0.80722	D	1	B	0.14805	0.011	B	0.13407	0.009	T	0.10497	-1.0627	10	0.26408	T	0.33	.	6.204	0.20591	0.8875:0.0:0.1125:0.0	.	890	Q5M9N0	CD158_HUMAN	P	890	ENSP00000373566:S890P	ENSP00000373566:S890P	S	-	1	0	CCDC158	77474341	0.998000	0.40836	0.982000	0.44146	0.035000	0.12851	1.977000	0.40589	2.188000	0.69820	0.533000	0.62120	TCT	.		0.373	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784	
CFAP45	25790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159846466	159846466	+	Missense_Mutation	SNP	C	C	T	rs377248471		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:159846466C>T	ENST00000368099.4	-	10	1296	c.1232G>A	c.(1231-1233)cGg>cAg	p.R411Q	CCDC19_ENST00000476696.1_5'UTR|CCDC19_ENST00000426543.2_Missense_Mutation_p.R326Q	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			CATCTTCTTCCGCGCATTTTC	0.572																																					p.R411Q		.											.	CCDC19	91	0			c.G1232A						.	T	GLN/ARG	0,4406		0,0,2203	134.0	105.0	115.0		1232	2.7	1.0	1		115	1,8599		0,1,4299	no	missense	CCDC19	NM_012337.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	411/552	159846466	1,13005	2203	4300	6503	SO:0001583	missense	25790	exon10			TTCTTCCGCGCAT																												ENST00000368099.4:c.1232G>A	1.37:g.159846466C>T	ENSP00000357079:p.Arg411Gln	Somatic	851.0	1.0		WXS	Illumina HiSeq	Phase_I	1191.0	239.0	NM_012337		Missense_Mutation	SNP	ENST00000368099.4	37	CCDS30914.1	.	.	.	.	.	.	.	.	.	.	N	0.937	-0.710762	0.03230	0.0	1.16E-4	ENSG00000213085	ENST00000368099;ENST00000426543	T;T	0.09445	2.98;2.98	5.16	2.68	0.31781	.	0.524332	0.21595	N	0.072030	T	0.00845	0.0028	N	0.01297	-0.9	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48281	-0.9049	9	.	.	.	-30.5358	6.4566	0.21934	0.1391:0.0828:0.0:0.778	.	411	Q9UL16	CCD19_HUMAN	Q	411;326	ENSP00000357079:R411Q;ENSP00000403044:R326Q	.	R	-	2	0	CCDC19	158113090	0.454000	0.25728	0.985000	0.45067	0.362000	0.29581	0.222000	0.17699	0.900000	0.36469	-0.599000	0.04106	CGG	.		0.572	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085979.1		
CCIN	881	hgsc.bcm.edu;bcgsc.ca	37	9	36170794	36170794	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:36170794G>T	ENST00000335119.2	+	1	1406	c.1295G>T	c.(1294-1296)cGg>cTg	p.R432L		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	432					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			GTCACTGGACGGTGCTTGGTG	0.552																																					p.R432L		.											.	CCIN	92	0			c.G1295T						.						141.0	107.0	119.0					9																	36170794		2203	4300	6503	SO:0001583	missense	881	exon1			CTGGACGGTGCTT	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.1295G>T	9.37:g.36170794G>T	ENSP00000334996:p.Arg432Leu	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	5.0	NM_005893	Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	37	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.291280	0.59976	.	.	ENSG00000185972	ENST00000335119	T	0.66099	-0.19	5.73	5.73	0.89815	Kelch-type beta propeller (1);	0.000000	0.51477	D	0.000095	T	0.65729	0.2719	L	0.27053	0.805	0.37591	D	0.920177	D	0.60160	0.987	D	0.67725	0.953	T	0.62586	-0.6823	10	0.18276	T	0.48	.	15.3816	0.74661	0.0:0.0:1.0:0.0	.	432	Q13939	CALI_HUMAN	L	432	ENSP00000334996:R432L	ENSP00000334996:R432L	R	+	2	0	CCIN	36160794	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	5.491000	0.66887	2.699000	0.92147	0.491000	0.48974	CGG	.		0.552	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893	
CCSER1	401145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	91230222	91230222	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:91230222T>C	ENST00000509176.1	+	2	1075	c.787T>C	c.(787-789)Ttg>Ctg	p.L263L	CCSER1_ENST00000333691.8_Silent_p.L263L|CCSER1_ENST00000432775.2_Silent_p.L263L	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	263																	ATTTTTAGCCTTGACTGAAGA	0.433																																					p.L263L		.											.	.	.	0			c.T787C						.						151.0	140.0	143.0					4																	91230222		1859	4119	5978	SO:0001819	synonymous_variant	401145	exon2			TTAGCCTTGACTG		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.787T>C	4.37:g.91230222T>C		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	4.0	NM_001145065	Q4W5M0|Q86V57	Silent	SNP	ENST00000509176.1	37	CCDS47099.1																																																																																			.		0.433	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
CCT8L2	150160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	17072001	17072001	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:17072001C>A	ENST00000359963.3	-	1	1699	c.1440G>T	c.(1438-1440)gtG>gtT	p.V480V		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	480					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CTTCAGTTCCCACACCCATTA	0.512																																					p.V480V		.											.	CCT8L2	69	0			c.G1440T						.						145.0	141.0	143.0					22																	17072001		2203	4300	6503	SO:0001819	synonymous_variant	150160	exon1			AGTTCCCACACCC	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1440G>T	22.37:g.17072001C>A		Somatic	285.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	113.0	NM_014406	A4QPH3|Q9UJS3	Silent	SNP	ENST00000359963.3	37	CCDS13738.1																																																																																			.		0.512	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1		
CDC42	998	hgsc.bcm.edu;bcgsc.ca	37	1	22417973	22417973	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:22417973C>T	ENST00000344548.3	+	7	790	c.539C>T	c.(538-540)cCa>cTa	p.P180L	CDC42_ENST00000400259.1_Missense_Mutation_p.P180L|CDC42_ENST00000421089.2_Missense_Mutation_p.P222L	NM_001039802.1	NP_001034891.1	P60953	CDC42_HUMAN	cell division cycle 42	180					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cellular protein localization (GO:0034613)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell-cell adhesion (GO:0090136)|epithelial-mesenchymal cell signaling (GO:0060684)|establishment of Golgi localization (GO:0051683)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|keratinization (GO:0031424)|keratinocyte development (GO:0003334)|macrophage differentiation (GO:0030225)|multicellular organism growth (GO:0035264)|muscle cell differentiation (GO:0042692)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of gene expression (GO:0010629)|negative regulation of protein complex assembly (GO:0031333)|neuron fate determination (GO:0048664)|nuclear migration (GO:0007097)|nucleus localization (GO:0051647)|organelle transport along microtubule (GO:0072384)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of JNK cascade (GO:0046330)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of synapse structural plasticity (GO:0051835)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of filopodium assembly (GO:0051489)|regulation of mitosis (GO:0007088)|regulation of protein catabolic process (GO:0042176)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein kinase activity (GO:0045859)|regulation of protein stability (GO:0031647)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|sprouting angiogenesis (GO:0002040)|submandibular salivary gland formation (GO:0060661)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	apical part of cell (GO:0045177)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|spindle midzone (GO:0051233)	apolipoprotein A-I receptor binding (GO:0034191)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)	12		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0452)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.35e-07)|COAD - Colon adenocarcinoma(152;7.73e-06)|GBM - Glioblastoma multiforme(114;8.62e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000649)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00767)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.207)		CTGGAGCCTCCAGAACCGAAG	0.453																																					p.P180L		.											.	CDC42	1084	0			c.C539T						.						55.0	60.0	59.0					1																	22417973		2203	4300	6503	SO:0001583	missense	998	exon6			AGCCTCCAGAACC	BC018266	CCDS221.1, CCDS222.1	1p36.1	2013-01-17	2013-01-17		ENSG00000070831	ENSG00000070831			1736	protein-coding gene	gene with protein product	"""GTP binding protein, 25kDa"""	116952	"""cell division cycle 42 (GTP-binding protein, 25kD)"", ""cell division cycle 42 (GTP binding protein, 25kDa)"""			2124704, 2122236	Standard	NM_001039802		Approved	G25K, CDC42Hs	uc001bfr.3	P60953	OTTHUMG00000002753	ENST00000344548.3:c.539C>T	1.37:g.22417973C>T	ENSP00000341072:p.Pro180Leu	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_001791	P21181|P25763|Q7L8R5|Q9UDI2	Missense_Mutation	SNP	ENST00000344548.3	37	CCDS221.1	.	.	.	.	.	.	.	.	.	.	c	15.69	2.908707	0.52439	.	.	ENSG00000070831	ENST00000400259;ENST00000344548;ENST00000421089	T;T;T	0.67171	-0.25;-0.25;0.11	5.22	5.22	0.72569	.	0.102632	0.64402	D	0.000002	T	0.67702	0.2921	M	0.74647	2.275	0.80722	D	1	B;B;B;B	0.28178	0.202;0.009;0.202;0.003	B;B;B;B	0.21151	0.025;0.033;0.025;0.005	T	0.69774	-0.5054	10	0.66056	D	0.02	.	17.3462	0.87310	0.0:1.0:0.0:0.0	.	222;225;222;180	E7ETU3;B4E1U9;B4DMH5;P60953	.;.;.;CDC42_HUMAN	L	180;180;222	ENSP00000383118:P180L;ENSP00000341072:P180L;ENSP00000398592:P222L	ENSP00000341072:P180L	P	+	2	0	CDC42	22290560	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.426000	0.80270	2.443000	0.82685	0.455000	0.32223	CCA	.		0.453	CDC42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007787.1	NM_001791	
CDK14	5218	hgsc.bcm.edu;bcgsc.ca	37	7	90747440	90747440	+	Missense_Mutation	SNP	G	G	T	rs74839397	byFrequency	TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:90747440G>T	ENST00000380050.3	+	14	1486	c.1355G>T	c.(1354-1356)cGg>cTg	p.R452L	CDK14_ENST00000265741.3_Missense_Mutation_p.R434L|CDK14_ENST00000436577.2_Missense_Mutation_p.R323L|CDK14_ENST00000406263.1_Missense_Mutation_p.R406L			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	452					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						GAAAGCATGCGGGCCTTTGGG	0.403																																					p.R434L	GBM(83;1228 1256 8311 16577 31299)	.											.	CDK14	970	0			c.G1301T						.						84.0	85.0	85.0					7																	90747440		2203	4300	6503	SO:0001583	missense	5218	exon13			GCATGCGGGCCTT		CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.1355G>T	7.37:g.90747440G>T	ENSP00000369390:p.Arg452Leu	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	4.0	NM_012395	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	ENST00000380050.3	37		.	.	.	.	.	.	.	.	.	.	G	12.57	1.976929	0.34848	.	.	ENSG00000058091	ENST00000380050;ENST00000265741;ENST00000406263;ENST00000436577	T;T;T;T	0.71934	-0.5;-0.52;-0.5;-0.61	5.87	5.87	0.94306	.	0.063724	0.64402	D	0.000009	T	0.56934	0.2019	L	0.29908	0.895	0.42726	D	0.993693	B;P;B	0.41748	0.18;0.761;0.18	B;B;B	0.35278	0.03;0.199;0.018	T	0.57985	-0.7716	10	0.31617	T	0.26	-12.2164	14.7159	0.69269	0.069:0.0:0.931:0.0	.	323;434;452	E7EUK8;O94921-2;O94921	.;.;CDK14_HUMAN	L	452;434;406;323	ENSP00000369390:R452L;ENSP00000265741:R434L;ENSP00000385034:R406L;ENSP00000398936:R323L	ENSP00000265741:R434L	R	+	2	0	CDK14	90585376	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.148000	0.64857	2.941000	0.99782	0.655000	0.94253	CGG	G|0.999;A|0.001		0.403	CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000059970.5	NM_012395	
CDHR3	222256	hgsc.bcm.edu;bcgsc.ca	37	7	105621574	105621574	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:105621574C>A	ENST00000317716.9	+	3	490	c.410C>A	c.(409-411)gCa>gAa	p.A137E	CDHR3_ENST00000343407.5_5'UTR|CDHR3_ENST00000542731.1_Missense_Mutation_p.A137E|CDHR3_ENST00000478080.1_Missense_Mutation_p.A49E|CDHR3_ENST00000541203.1_Missense_Mutation_p.A137E|CDHR3_ENST00000470188.1_3'UTR	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	137	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						GGCAACTTGGCAGAAGGTAGG	0.502																																					p.A137E		.											.	CDHR3	23	0			c.C410A						.						69.0	63.0	65.0					7																	105621574		2020	4176	6196	SO:0001583	missense	222256	exon3			ACTTGGCAGAAGG	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.410C>A	7.37:g.105621574C>A	ENSP00000325954:p.Ala137Glu	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_152750	Q8TCI7	Missense_Mutation	SNP	ENST00000317716.9	37	CCDS47684.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.277273	0.59758	.	.	ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080;ENST00000541203	T;T;T;T	0.57107	0.44;0.44;0.42;1.0	5.02	4.12	0.48240	Cadherin (1);	0.078618	0.52532	D	0.000061	T	0.67832	0.2935	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.989;0.997	T	0.65734	-0.6096	10	0.13470	T	0.59	-12.075	14.5236	0.67870	0.0:0.8518:0.1482:0.0	.	124;137	B3KYA0;Q6ZTQ4	.;CDHR3_HUMAN	E	137;137;49;137	ENSP00000439766:A137E;ENSP00000325954:A137E;ENSP00000417771:A49E;ENSP00000443733:A137E	ENSP00000325954:A137E	A	+	2	0	CDHR3	105408810	0.991000	0.36638	0.881000	0.34555	0.540000	0.34992	2.119000	0.41958	1.442000	0.47568	0.561000	0.74099	GCA	.		0.502	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750	
CDRT15	146822	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	14139241	14139241	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:14139241A>G	ENST00000420162.2	-	3	514	c.499T>C	c.(499-501)Tgg>Cgg	p.W167R	CDRT15_ENST00000431716.2_Missense_Mutation_p.W101R	NM_001007530.1	NP_001007531.1	Q96T59	CDRTF_HUMAN	CMT1A duplicated region transcript 15	167										endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	6				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		ACCCGCATCCATGCCTGGAGG	0.612																																					p.W167R		.											.	CDRT15	90	0			c.T499C						.						12.0	12.0	12.0					17																	14139241		1993	3893	5886	SO:0001583	missense	146822	exon3			GCATCCATGCCTG	AF355097	CCDS32569.1	17p12	2012-11-19			ENSG00000223510	ENSG00000223510			14395	protein-coding gene	gene with protein product						11381029	Standard	NM_001007530		Approved		uc010vvu.2	Q96T59	OTTHUMG00000179686	ENST00000420162.2:c.499T>C	17.37:g.14139241A>G	ENSP00000402355:p.Trp167Arg	Somatic	311.0	0.0		WXS	Illumina HiSeq	Phase_I	357.0	81.0	NM_001007530	B2RUU5	Missense_Mutation	SNP	ENST00000420162.2	37	CCDS32569.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.962593	0.00461	.	.	ENSG00000223510	ENST00000431716;ENST00000420162	T	0.57907	0.37	.	.	.	.	.	.	.	.	T	0.42200	0.1192	N	0.14661	0.345	0.09310	N	1	D	0.54397	0.966	P	0.55667	0.781	T	0.32052	-0.9921	7	0.24483	T	0.36	.	.	.	.	.	167	Q96T59	CDRTF_HUMAN	R	101;167	ENSP00000402355:W167R	ENSP00000402355:W167R	W	-	1	0	CDRT15	14079966	0.019000	0.18553	0.011000	0.14972	0.011000	0.07611	0.140000	0.16056	0.103000	0.17682	0.102000	0.15555	TGG	.		0.612	CDRT15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252853.1	NM_001007530	
CDS1	1040	hgsc.bcm.edu;bcgsc.ca	37	4	85562071	85562071	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:85562071A>G	ENST00000295887.5	+	10	1383	c.960A>G	c.(958-960)gaA>gaG	p.E320E		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		TCGTGACAGAATGTGAGCCCT	0.413																																					p.E320E		.											.	CDS1	155	0			c.A960G						.						161.0	149.0	153.0					4																	85562071		2203	4300	6503	SO:0001819	synonymous_variant	1040	exon10			GACAGAATGTGAG	U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.960A>G	4.37:g.85562071A>G		Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_001263	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	SNP	ENST00000295887.5	37	CCDS3608.1																																																																																			.		0.413	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252817.2		
CELSR2	1952	hgsc.bcm.edu;bcgsc.ca	37	1	109794818	109794818	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:109794818A>G	ENST00000271332.3	+	1	2178	c.2117A>G	c.(2116-2118)aAc>aGc	p.N706S		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	706	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		ACCGACGCCAACACCCATCGT	0.572																																					p.N706S	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.A2117G						.						73.0	67.0	69.0					1																	109794818		2203	4300	6503	SO:0001583	missense	1952	exon1			ACGCCAACACCCA	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.2117A>G	1.37:g.109794818A>G	ENSP00000271332:p.Asn706Ser	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	18.65	3.669841	0.67814	.	.	ENSG00000143126	ENST00000271332	T	0.70749	-0.51	4.95	4.95	0.65309	Cadherin (3);Cadherin-like (1);	.	.	.	.	D	0.87212	0.6121	H	0.96142	3.775	0.58432	D	0.999993	D	0.76494	0.999	D	0.85130	0.997	D	0.91307	0.5071	9	0.87932	D	0	.	14.8253	0.70107	1.0:0.0:0.0:0.0	.	706	Q9HCU4	CELR2_HUMAN	S	706	ENSP00000271332:N706S	ENSP00000271332:N706S	N	+	2	0	CELSR2	109596341	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.709000	0.91379	2.102000	0.63906	0.529000	0.55759	AAC	.		0.572	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CEP192	55125	hgsc.bcm.edu;bcgsc.ca	37	18	13015339	13015339	+	5'UTR	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr18:13015339G>T	ENST00000325971.8	+	0	612				CEP192_ENST00000506447.1_Missense_Mutation_p.D178Y			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa						centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGTTGTGCTTGATGCTGGAAA	0.378																																					p.D178Y		.											.	CEP192	27	0			c.G532T						.						192.0	141.0	156.0					18																	13015339		692	1591	2283	SO:0001623	5_prime_UTR_variant	55125	exon6			GTGCTTGATGCTG	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.-982G>T	18.37:g.13015339G>T		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37		.	.	.	.	.	.	.	.	.	.	G	9.907	1.208592	0.22205	.	.	ENSG00000101639	ENST00000506447	T	0.07444	3.19	4.37	3.49	0.39957	.	.	.	.	.	T	0.09113	0.0225	L	0.27053	0.805	0.22266	N	0.999246	P	0.48016	0.904	P	0.46253	0.509	T	0.18335	-1.0340	9	0.66056	D	0.02	.	10.2776	0.43519	0.0:0.2188:0.7812:0.0	.	178	E9PF99	.	Y	178	ENSP00000427550:D178Y	ENSP00000427550:D178Y	D	+	1	0	CEP192	13005339	0.047000	0.20315	0.002000	0.10522	0.015000	0.08874	2.120000	0.41968	1.184000	0.42957	0.563000	0.77884	GAT	.		0.378	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
CEP250	11190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34067549	34067549	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr20:34067549G>T	ENST00000397527.1	+	19	3087	c.2367G>T	c.(2365-2367)caG>caT	p.Q789H	CEP250_ENST00000342580.4_Missense_Mutation_p.Q789H|RP3-477O4.14_ENST00000444933.1_RNA|RP3-477O4.14_ENST00000453914.1_RNA|RP3-477O4.14_ENST00000416260.1_RNA	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	789	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CCAAGGGGCAGCTGGAGGTCC	0.488																																					p.Q789H		.											.	CEP250	27	0			c.G2367T						.						104.0	103.0	104.0					20																	34067549		2203	4300	6503	SO:0001583	missense	11190	exon19			GGGGCAGCTGGAG	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.2367G>T	20.37:g.34067549G>T	ENSP00000380661:p.Gln789His	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	41.0	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	37	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404417	0.62288	.	.	ENSG00000126001	ENST00000397527;ENST00000342580	T;T	0.16597	2.33;2.33	5.15	0.996	0.19844	.	0.000000	0.56097	D	0.000035	T	0.38374	0.1038	M	0.87180	2.865	0.33820	D	0.628968	D	0.89917	1.0	D	0.87578	0.998	T	0.46816	-0.9164	10	0.45353	T	0.12	.	5.1638	0.15075	0.3723:0.0:0.4954:0.1323	.	789	Q9BV73	CP250_HUMAN	H	789	ENSP00000380661:Q789H;ENSP00000341541:Q789H	ENSP00000341541:Q789H	Q	+	3	2	CEP250	33530963	0.985000	0.35326	1.000000	0.80357	0.997000	0.91878	0.006000	0.13152	0.354000	0.24105	0.655000	0.94253	CAG	.		0.488	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
CEP350	9857	hgsc.bcm.edu;bcgsc.ca	37	1	180013222	180013222	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:180013222A>G	ENST00000367607.3	+	21	4954	c.4536A>G	c.(4534-4536)gaA>gaG	p.E1512E		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1512	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AGAGTAAAGAAGGGACCCTTG	0.323																																					p.E1512E		.											.	CEP350	26	0			c.A4536G						.						49.0	44.0	46.0					1																	180013222		2197	4283	6480	SO:0001819	synonymous_variant	9857	exon21			TAAAGAAGGGACC	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.4536A>G	1.37:g.180013222A>G		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	5.0	NM_014810	O75068|Q8TDK3|Q8WY20	Silent	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	A	4.179	0.031740	0.08101	.	.	ENSG00000135837	ENST00000418229	.	.	.	5.69	0.932	0.19466	.	.	.	.	.	T	0.55049	0.1896	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45352	-0.9267	4	.	.	.	.	7.9455	0.29985	0.5415:0.0:0.4585:0.0	.	.	.	.	G	121	.	.	R	+	1	2	CEP350	178279845	1.000000	0.71417	0.897000	0.35233	0.414000	0.31173	1.396000	0.34531	0.124000	0.18369	0.454000	0.30748	AGG	.		0.323	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
CEP55	55165	hgsc.bcm.edu;bcgsc.ca	37	10	95275260	95275260	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr10:95275260G>T	ENST00000371485.3	+	5	931	c.627G>T	c.(625-627)acG>acT	p.T209T		NM_001127182.1|NM_018131.4	NP_001120654|NP_060601	Q53EZ4	CEP55_HUMAN	centrosomal protein 55kDa	209	Interaction with PDCD6IP.|Interaction with TSG101.				establishment of protein localization (GO:0045184)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|midbody (GO:0030496)				kidney(1)|large_intestine(5)|lung(6)|stomach(1)	13		Colorectal(252;0.207)				AAAAGAAAACGGAAACAGCTG	0.428																																					p.T209T		.											.	CEP55	90	0			c.G627T						.						90.0	97.0	95.0					10																	95275260		2203	4300	6503	SO:0001819	synonymous_variant	55165	exon5			GAAAACGGAAACA	AK001402	CCDS7428.1	10q24.1	2014-02-20	2005-12-01	2005-12-01	ENSG00000138180	ENSG00000138180			1161	protein-coding gene	gene with protein product	"""cancer/testis antigen 111"""	610000	"""chromosome 10 open reading frame 3"""	C10orf3		16198290	Standard	NM_018131		Approved	FLJ10540, CT111	uc009xug.3	Q53EZ4	OTTHUMG00000018774	ENST00000371485.3:c.627G>T	10.37:g.95275260G>T		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	6.0	NM_001127182	B2RDG8|Q32WF5|Q3MV20|Q5VY28|Q6N034|Q96H32|Q9NVS7	Silent	SNP	ENST00000371485.3	37	CCDS7428.1	.	.	.	.	.	.	.	.	.	.	G	6.531	0.466146	0.12402	.	.	ENSG00000138180	ENST00000445435	.	.	.	5.15	-1.78	0.07957	.	.	.	.	.	T	0.58495	0.2126	.	.	.	0.42839	D	0.994042	.	.	.	.	.	.	T	0.57528	-0.7796	4	.	.	.	0.731	12.3702	0.55250	0.7186:0.0:0.2814:0.0	.	.	.	.	L	49	.	.	R	+	2	0	CEP55	95265250	0.001000	0.12720	0.816000	0.32577	0.858000	0.48976	-0.134000	0.10436	-0.200000	0.10300	0.655000	0.94253	CGG	.		0.428	CEP55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049434.1	NM_018131	
CHADL	150356	hgsc.bcm.edu;bcgsc.ca	37	22	41634867	41634867	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:41634867T>C	ENST00000216241.9	-	3	261	c.209A>G	c.(208-210)cAg>cGg	p.Q70R		NM_138481.1	NP_612490.1	Q6NUI6	CHADL_HUMAN	chondroadherin-like	70						proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(1)|skin(1)	4						CAAATTGCCCTGCAGGTCCAG	0.662																																					p.Q70R		.											.	CHADL	68	0			c.A209G						.						10.0	14.0	13.0					22																	41634867		692	1590	2282	SO:0001583	missense	150356	exon3			TTGCCCTGCAGGT	BC012882	CCDS46715.1	22q13.2	2008-10-31			ENSG00000100399	ENSG00000100399			25165	protein-coding gene	gene with protein product						12477932	Standard	NM_138481		Approved	SLRR4B	uc003azq.4	Q6NUI6	OTTHUMG00000150936	ENST00000216241.9:c.209A>G	22.37:g.41634867T>C	ENSP00000216241:p.Gln70Arg	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	4.0	NM_138481	Q05CY2|Q4G0S0|Q5JY13|Q86XY1|Q96E60	Missense_Mutation	SNP	ENST00000216241.9	37	CCDS46715.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.654|5.654	0.305258|0.305258	0.10678|0.10678	.|.	.|.	ENSG00000100399|ENSG00000100399	ENST00000216241|ENST00000417999	T|.	0.55930|.	0.49|.	4.9|4.9	2.76|2.76	0.32466|0.32466	.|.	0.220792|.	0.36591|.	N|.	0.002509|.	T|T	0.25827|0.25827	0.0629|0.0629	N|N	0.26042|0.26042	0.785|0.785	0.24963|0.24963	N|N	0.991712|0.991712	B;B|.	0.16603|.	0.013;0.018|.	B;B|.	0.20577|.	0.022;0.03|.	T|T	0.21518|0.21518	-1.0243|-1.0243	10|5	0.02654|.	T|.	1|.	.|.	7.1332|7.1332	0.25512|0.25512	0.0:0.4217:0.0:0.5783|0.0:0.4217:0.0:0.5783	.|.	70;70|.	Q6NUI6-2;Q6NUI6|.	.;CHADL_HUMAN|.	R|G	70|68	ENSP00000216241:Q70R|.	ENSP00000216241:Q70R|.	Q|R	-|-	2|1	0|2	CHADL|CHADL	39964813|39964813	0.997000|0.997000	0.39634|0.39634	0.998000|0.998000	0.56505|0.56505	0.451000|0.451000	0.32288|0.32288	1.894000|1.894000	0.39768|0.39768	0.235000|0.235000	0.21160|0.21160	-0.464000|-0.464000	0.05259|0.05259	CAG|AGG	.		0.662	CHADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320597.1	NM_138481	
CHD7	55636	hgsc.bcm.edu;bcgsc.ca	37	8	61757431	61757431	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr8:61757431G>T	ENST00000423902.2	+	22	5338	c.4859G>T	c.(4858-4860)cGg>cTg	p.R1620L	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1620					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AGTTGGGGACGGTGGACAGAC	0.468																																					p.R1620L		.											.	CHD7	141	0			c.G4859T						.						65.0	61.0	63.0					8																	61757431		1951	4151	6102	SO:0001583	missense	55636	exon22			GGGGACGGTGGAC	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.4859G>T	8.37:g.61757431G>T	ENSP00000392028:p.Arg1620Leu	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	5.0	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	G	35	5.421990	0.96111	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	T	0.74632	-0.86	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.88680	0.6502	M	0.88775	2.98	0.80722	D	1	D	0.60575	0.988	D	0.66979	0.948	D	0.89906	0.4048	10	0.87932	D	0	-18.7363	20.054	0.97641	0.0:0.0:1.0:0.0	.	1620	Q9P2D1	CHD7_HUMAN	L	1620	ENSP00000392028:R1620L	ENSP00000307304:R1620L	R	+	2	0	CHD7	61919985	1.000000	0.71417	0.936000	0.37596	0.991000	0.79684	9.869000	0.99810	2.808000	0.96608	0.655000	0.94253	CGG	.		0.468	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
CHSY1	22856	hgsc.bcm.edu;bcgsc.ca	37	15	101718547	101718547	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:101718547A>G	ENST00000254190.3	-	3	1930	c.1455T>C	c.(1453-1455)caT>caC	p.H485H	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	485					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCAGCTCCTCATGCTCCACAA	0.478																																					p.H485H		.											.	CHSY1	90	0			c.T1455C						.						51.0	51.0	51.0					15																	101718547		2203	4300	6503	SO:0001819	synonymous_variant	22856	exon3			CTCCTCATGCTCC	AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.1455T>C	15.37:g.101718547A>G		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_014918	Q6UX38|Q7LFU5|Q9Y2J5	Silent	SNP	ENST00000254190.3	37	CCDS10390.1																																																																																			.		0.478	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313624.1	NM_014918	
CLCA2	9635	hgsc.bcm.edu;bcgsc.ca	37	1	86900325	86900325	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:86900325C>T	ENST00000370565.4	+	6	1031	c.869C>T	c.(868-870)cCc>cTc	p.P290L		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	290					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		CACAGCTTTCCCATGAATGGG	0.507																																					p.P290L	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	.											.	CLCA2	155	0			c.C869T						.						215.0	181.0	192.0					1																	86900325		2203	4300	6503	SO:0001583	missense	9635	exon6			GCTTTCCCATGAA		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.869C>T	1.37:g.86900325C>T	ENSP00000359596:p.Pro290Leu	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_006536	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	CCDS708.1	.	.	.	.	.	.	.	.	.	.	C	35	5.553198	0.96501	.	.	ENSG00000137975	ENST00000370565	T	0.03689	3.84	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.19327	0.0464	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00795	-1.1563	10	0.54805	T	0.06	-15.4545	19.4432	0.94831	0.0:1.0:0.0:0.0	.	290	Q9UQC9	CLCA2_HUMAN	L	290	ENSP00000359596:P290L	ENSP00000359596:P290L	P	+	2	0	CLCA2	86672913	0.954000	0.32549	0.272000	0.24630	0.640000	0.38277	3.925000	0.56484	2.941000	0.99782	0.655000	0.94253	CCC	.		0.507	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
CLCN1	1180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143016896	143016896	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:143016896G>A	ENST00000343257.2	+	2	316	c.229G>A	c.(229-231)Ggg>Agg	p.G77R		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	77					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GCAGGACATAGGGATGCCCAA	0.443																																					p.G77R		.											.	CLCN1	156	0			c.G229A						.						192.0	160.0	171.0					7																	143016896		2203	4300	6503	SO:0001583	missense	1180	exon2			GACATAGGGATGC	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.229G>A	7.37:g.143016896G>A	ENSP00000339867:p.Gly77Arg	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	39.0	NM_000083	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	.	7.643	0.681360	0.14907	.	.	ENSG00000188037	ENST00000343257	D	0.84800	-1.9	5.45	3.66	0.41972	.	0.651527	0.15301	N	0.269603	T	0.77212	0.4097	L	0.47716	1.5	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.59337	-0.7473	10	0.16420	T	0.52	.	7.5381	0.27723	0.2616:0.0:0.7384:0.0	.	77	P35523	CLCN1_HUMAN	R	77	ENSP00000339867:G77R	ENSP00000339867:G77R	G	+	1	0	CLCN1	142727018	0.000000	0.05858	0.162000	0.22713	0.249000	0.25844	0.554000	0.23407	0.705000	0.31890	0.650000	0.86243	GGG	.		0.443	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
COL4A4	1286	hgsc.bcm.edu;bcgsc.ca	37	2	227895215	227895215	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:227895215G>A	ENST00000396625.3	-	41	4124	c.3917C>T	c.(3916-3918)cCa>cTa	p.P1306L	COL4A4_ENST00000329662.7_Missense_Mutation_p.P1306L	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1306	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGGAGGGCCTGGTGGGCCAGG	0.547																																					p.P1306L		.											.	COL4A4	142	0			c.C3917T						.						113.0	112.0	112.0					2																	227895215		1913	4107	6020	SO:0001583	missense	1286	exon41			GGGCCTGGTGGGC		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.3917C>T	2.37:g.227895215G>A	ENSP00000379866:p.Pro1306Leu	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	G	8.997	0.979168	0.18812	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.95412	-3.7;-3.7	5.45	4.54	0.55810	.	.	.	.	.	D	0.96367	0.8815	M	0.72353	2.195	0.48087	D	0.999583	D	0.58620	0.983	P	0.58266	0.836	D	0.95538	0.8609	9	0.45353	T	0.12	.	11.9533	0.52966	0.0:0.1751:0.8249:0.0	.	1306	P53420	CO4A4_HUMAN	L	1306	ENSP00000379866:P1306L;ENSP00000328553:P1306L	ENSP00000328553:P1306L	P	-	2	0	COL4A4	227603459	0.963000	0.33076	0.903000	0.35520	0.304000	0.27724	0.954000	0.29175	1.255000	0.44051	0.609000	0.83330	CCA	.		0.547	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
COL5A3	50509	hgsc.bcm.edu;bcgsc.ca	37	19	10106242	10106242	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:10106242T>C	ENST00000264828.3	-	16	1670	c.1585A>G	c.(1585-1587)Atg>Gtg	p.M529V	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	529	Collagen-like 2.|Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TCACTCACCATCTTGCCCACT	0.552																																					p.M529V		.											.	COL5A3	99	0			c.A1585G						.						75.0	59.0	64.0					19																	10106242		2203	4300	6503	SO:0001583	missense	50509	exon16			TCACCATCTTGCC	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1585A>G	19.37:g.10106242T>C	ENSP00000264828:p.Met529Val	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	T	13.23	2.174270	0.38413	.	.	ENSG00000080573	ENST00000264828	D	0.89617	-2.54	5.06	3.93	0.45458	.	0.370933	0.26069	N	0.026526	T	0.78457	0.4286	N	0.16166	0.38	0.21675	N	0.999594	B	0.27013	0.166	B	0.28916	0.096	T	0.69359	-0.5166	10	0.48119	T	0.1	.	8.2267	0.31572	0.0:0.0:0.2636:0.7364	.	529	P25940	CO5A3_HUMAN	V	529	ENSP00000264828:M529V	ENSP00000264828:M529V	M	-	1	0	COL5A3	9967242	0.989000	0.36119	1.000000	0.80357	0.933000	0.57130	1.365000	0.34182	2.038000	0.60285	0.533000	0.62120	ATG	.		0.552	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
COL7A1	1294	hgsc.bcm.edu;bcgsc.ca	37	3	48625362	48625362	+	Silent	SNP	T	T	C	rs201566458		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:48625362T>C	ENST00000328333.8	-	21	2828	c.2721A>G	c.(2719-2721)gaA>gaG	p.E907E	COL7A1_ENST00000454817.1_Silent_p.E907E	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	907	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCCGGGACTGTTCCTGGCCAC	0.652																																					p.E907E		.											.	COL7A1	160	0			c.A2721G						.						12.0	14.0	13.0					3																	48625362		2193	4288	6481	SO:0001819	synonymous_variant	1294	exon21			GGACTGTTCCTGG	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.2721A>G	3.37:g.48625362T>C		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_000094	Q14054|Q16507	Silent	SNP	ENST00000328333.8	37	CCDS2773.1																																																																																			.		0.652	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
COX5A	9377	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75221502	75221502	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:75221502T>C	ENST00000322347.6	-	2	325	c.172A>G	c.(172-174)Aca>Gca	p.T58A	COX5A_ENST00000564811.1_Missense_Mutation_p.T58A|COX5A_ENST00000568517.1_5'UTR|COX5A_ENST00000562233.1_Missense_Mutation_p.T58A|COX5A_ENST00000568783.1_Missense_Mutation_p.T58A|COX5A_ENST00000567270.1_Intron	NM_004255.3	NP_004246.2	P20674	COX5A_HUMAN	cytochrome c oxidase subunit Va	58					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|pancreas(1)	3						TTGAAGTATGTTACCCAGCGA	0.398																																					p.T58A		.											.	COX5A	90	0			c.A172G						.						155.0	141.0	146.0					15																	75221502		2197	4295	6492	SO:0001583	missense	9377	exon2			AGTATGTTACCCA	M22760	CCDS10273.1	15q25	2011-07-04			ENSG00000178741	ENSG00000178741	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2267	protein-coding gene	gene with protein product		603773				10072584, 2853101	Standard	NM_004255		Approved		uc002azi.4	P20674	OTTHUMG00000142825	ENST00000322347.6:c.172A>G	15.37:g.75221502T>C	ENSP00000317780:p.Thr58Ala	Somatic	183.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	39.0	NM_004255	P30045|Q8TB65	Missense_Mutation	SNP	ENST00000322347.6	37	CCDS10273.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.628961	0.67015	.	.	ENSG00000178741	ENST00000322347	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.35393	0.0930	N	0.05467	-0.045	0.58432	D	0.999997	B	0.09022	0.002	B	0.19666	0.026	T	0.26849	-1.0091	9	0.06625	T	0.88	-10.27	14.6722	0.68953	0.0:0.0:0.0:1.0	.	58	P20674	COX5A_HUMAN	A	58	.	ENSP00000317780:T58A	T	-	1	0	COX5A	73008555	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.454000	0.80714	2.150000	0.67090	0.528000	0.53228	ACA	.		0.398	COX5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286417.1	NM_004255	
CR1L	1379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207890960	207890960	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:207890960C>T	ENST00000508064.2	+	11	1626	c.1566C>T	c.(1564-1566)atC>atT	p.I522I		NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	522	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AGAGCACCATCCGCCGCACAA	0.542																																					p.I522I		.											.	CR1L	46	0			c.C1566T						.						152.0	150.0	151.0					1																	207890960		1960	4142	6102	SO:0001819	synonymous_variant	1379	exon11			CACCATCCGCCGC	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1566C>T	1.37:g.207890960C>T		Somatic	361.0	0.0		WXS	Illumina HiSeq	Phase_I	546.0	77.0	NM_175710	Q32MC9|Q8NEU7	Silent	SNP	ENST00000508064.2	37	CCDS44310.1																																																																																			.		0.542	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735	
CRB2	286204	hgsc.bcm.edu;bcgsc.ca	37	9	126133645	126133645	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:126133645G>T	ENST00000373631.3	+	8	2225	c.2224G>T	c.(2224-2226)Ggg>Tgg	p.G742W	CRB2_ENST00000359999.3_Missense_Mutation_p.G742W|CRB2_ENST00000373629.2_Missense_Mutation_p.G410W	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	742	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						GCAGGACCTGGGGCAGCACGT	0.692																																					p.G742W		.											.	CRB2	91	0			c.G2224T						.						69.0	72.0	71.0					9																	126133645		2203	4299	6502	SO:0001583	missense	286204	exon8			GACCTGGGGCAGC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.2224G>T	9.37:g.126133645G>T	ENSP00000362734:p.Gly742Trp	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	6.0	NM_173689	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	.	18.97	3.735415	0.69189	.	.	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	T;T;T	0.79940	-1.32;-1.32;-1.32	4.92	3.81	0.43845	Concanavalin A-like lectin/glucanase (1);Laminin G domain (1);	0.341780	0.21813	N	0.068728	D	0.90501	0.7024	M	0.89414	3.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	D	0.92209	0.5774	10	0.87932	D	0	.	14.1206	0.65184	0.0866:0.0:0.9134:0.0	.	742;742	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	W	742;742;410	ENSP00000353092:G742W;ENSP00000362734:G742W;ENSP00000362732:G410W	ENSP00000353092:G742W	G	+	1	0	CRB2	125173466	0.998000	0.40836	0.994000	0.49952	0.959000	0.62525	2.542000	0.45744	2.276000	0.75962	0.563000	0.77884	GGG	.		0.692	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
CSMD1	64478	hgsc.bcm.edu;bcgsc.ca	37	8	2949044	2949044	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr8:2949044A>G	ENST00000520002.1	-	49	7837	c.7282T>C	c.(7282-7284)Tat>Cat	p.Y2428H	CSMD1_ENST00000537824.1_Missense_Mutation_p.Y2427H|CSMD1_ENST00000602723.1_Missense_Mutation_p.Y2428H|CSMD1_ENST00000400186.3_Missense_Mutation_p.Y2428H|CSMD1_ENST00000542608.1_Missense_Mutation_p.Y2427H|CSMD1_ENST00000602557.1_Missense_Mutation_p.Y2428H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2428	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTACCTGCATAGCGAATCTTG	0.303																																					p.Y2427H		.											.	CSMD1	86	0			c.T7279C						.						110.0	103.0	105.0					8																	2949044		1831	4081	5912	SO:0001583	missense	64478	exon48			CTGCATAGCGAAT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7282T>C	8.37:g.2949044A>G	ENSP00000430733:p.Tyr2428His	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.7|22.7	4.321693|4.321693	0.81580|0.81580	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.|T;T;T;T	.|0.57107	.|0.42;0.42;0.42;0.42	5.78|5.78	5.78|5.78	0.91487|0.91487	.|CUB (5);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.78020|0.78020	0.4218|0.4218	M|M	0.92649|0.92649	3.33|3.33	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|0.999;1.0;0.999	T|T	0.79524|0.79524	-0.1768|-0.1768	5|10	.|0.24483	.|T	.|0.36	.|.	16.0976|16.0976	0.81139|0.81139	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|2428;2428;2427	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	P|H	1844|2428;2428;2289;2427;2427	.|ENSP00000383047:Y2428H;ENSP00000430733:Y2428H;ENSP00000441462:Y2427H;ENSP00000446243:Y2427H	.|ENSP00000320445:Y2289H	L|Y	-|-	2|1	0|0	CSMD1|CSMD1	2936451|2936451	1.000000|1.000000	0.71417|0.71417	0.093000|0.093000	0.20910|0.20910	0.878000|0.878000	0.50629|0.50629	9.011000|9.011000	0.93618|0.93618	2.198000|2.198000	0.70561|0.70561	0.443000|0.443000	0.29094|0.29094	CTA|TAT	.		0.303	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSPG4	1464	hgsc.bcm.edu;bcgsc.ca	37	15	75982391	75982391	+	Missense_Mutation	SNP	G	G	T	rs200187536		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:75982391G>T	ENST00000308508.5	-	3	1107	c.1015C>A	c.(1015-1017)Cgc>Agc	p.R339S		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	339	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						AGGCCCAGGCGGTGTTCCTGG	0.642																																					p.R339S		.											.	CSPG4	229	0			c.C1015A						.						17.0	15.0	16.0					15																	75982391		2192	4283	6475	SO:0001583	missense	1464	exon3			CCAGGCGGTGTTC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1015C>A	15.37:g.75982391G>T	ENSP00000312506:p.Arg339Ser	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	14.64	2.596974	0.46318	.	.	ENSG00000173546	ENST00000308508	T	0.18502	2.21	5.26	4.26	0.50523	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.181054	0.36815	N	0.002398	T	0.19167	0.0460	L	0.29908	0.895	0.32592	N	0.527029	P	0.52170	0.951	P	0.50934	0.654	T	0.05146	-1.0903	10	0.19590	T	0.45	.	15.6861	0.77411	0.0:0.0:0.8538:0.1462	.	339	Q6UVK1	CSPG4_HUMAN	S	339	ENSP00000312506:R339S	ENSP00000312506:R339S	R	-	1	0	CSPG4	73769446	0.996000	0.38824	1.000000	0.80357	0.667000	0.39255	2.026000	0.41069	2.463000	0.83235	0.555000	0.69702	CGC	G|0.999;A|0.001		0.642	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
CSRP2	1466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	77253334	77253334	+	Silent	SNP	A	A	G	rs202057442	byFrequency	TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:77253334A>G	ENST00000311083.5	-	5	621	c.498T>C	c.(496-498)taT>taC	p.Y166Y	CSRP2_ENST00000552330.1_Silent_p.Y216Y|CSRP2_ENST00000546966.1_Silent_p.Y166Y|CSRP2_ENST00000547435.1_Silent_p.Y166Y	NM_001321.1	NP_001312.1	Q16527	CSRP2_HUMAN	cysteine and glycine-rich protein 2	166	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|ovary(1)|prostate(1)|skin(1)	8						TACCTTTACAATAGATTTCAC	0.353													A|||	4	0.000798722	0.0	0.0	5008	,	,		20252	0.0		0.0	False		,,,				2504	0.0041				p.Y166Y		.											.	CSRP2	91	0			c.T498C						.						76.0	70.0	72.0					12																	77253334		2203	4300	6503	SO:0001819	synonymous_variant	1466	exon5			TTTACAATAGATT	BC000992	CCDS9015.1	12q21.1	2005-10-30				ENSG00000175183			2470	protein-coding gene	gene with protein product		601871				7499425, 9286703	Standard	XM_006719258		Approved	SmLIM, CRP2, LMO5	uc001syl.1	Q16527		ENST00000311083.5:c.498T>C	12.37:g.77253334A>G		Somatic	333.0	1.0		WXS	Illumina HiSeq	Phase_I	332.0	161.0	NM_001321	Q93030	Silent	SNP	ENST00000311083.5	37	CCDS9015.1																																																																																			A|0.999;G|0.001		0.353	CSRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406572.1	NM_001321	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	17142090	17142090	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr10:17142090C>G	ENST00000377833.4	-	14	1744	c.1679G>C	c.(1678-1680)aGt>aCt	p.S560T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	560	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGCATTGTCACTGCTGAGGAG	0.428																																					p.S560T		.											.	CUBN	166	0			c.G1679C						.						115.0	115.0	115.0					10																	17142090		2203	4300	6503	SO:0001583	missense	8029	exon14			TTGTCACTGCTGA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1679G>C	10.37:g.17142090C>G	ENSP00000367064:p.Ser560Thr	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	264.0	116.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366420	0.61513	.	.	ENSG00000107611	ENST00000377833	T	0.60672	0.17	5.51	5.51	0.81932	CUB (5);	0.000000	0.50627	D	0.000111	T	0.57651	0.2068	L	0.41961	1.31	0.80722	D	1	P	0.38827	0.649	P	0.46940	0.532	T	0.50398	-0.8833	10	0.19590	T	0.45	.	14.894	0.70630	0.0:0.7463:0.2537:0.0	.	560	O60494	CUBN_HUMAN	T	560	ENSP00000367064:S560T	ENSP00000367064:S560T	S	-	2	0	CUBN	17182096	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	3.996000	0.57009	2.586000	0.87340	0.650000	0.86243	AGT	.		0.428	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
CXADR	1525	hgsc.bcm.edu;bcgsc.ca	37	21	18919456	18919456	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr21:18919456C>A	ENST00000284878.7	+	2	903	c.155C>A	c.(154-156)cCg>cAg	p.P52Q	CXADR_ENST00000400166.1_Missense_Mutation_p.P52Q|CXADR_ENST00000400169.1_Missense_Mutation_p.P52Q|CXADR_ENST00000306618.10_Missense_Mutation_p.P52Q|CXADR_ENST00000356275.6_Missense_Mutation_p.P52Q|CXADR_ENST00000400165.1_Missense_Mutation_p.P52Q	NM_001338.4	NP_001329.1	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	52	Ig-like C2-type 1.				actin cytoskeleton reorganization (GO:0031532)|AV node cell to bundle of His cell communication (GO:0086067)|blood coagulation (GO:0007596)|cardiac muscle fiber development (GO:0048739)|cell-cell junction organization (GO:0045216)|defense response to virus (GO:0051607)|epithelial structure maintenance (GO:0010669)|gamma-delta T cell activation (GO:0046629)|germ cell migration (GO:0008354)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|homotypic cell-cell adhesion (GO:0034109)|leukocyte migration (GO:0050900)|mitochondrion organization (GO:0007005)|neutrophil chemotaxis (GO:0030593)|regulation of immune response (GO:0050776)|transepithelial transport (GO:0070633)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|adherens junction (GO:0005912)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|filopodium (GO:0030175)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|cell adhesion molecule binding (GO:0050839)|connexin binding (GO:0071253)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|virus receptor activity (GO:0001618)			endometrium(2)|large_intestine(5)|lung(1)|ovary(1)|prostate(2)	11				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		GACCAGGGACCGCTGGACATC	0.468																																					p.P52Q		.											.	CXADR	227	0			c.C155A						.						91.0	77.0	82.0					21																	18919456		2203	4300	6503	SO:0001583	missense	1525	exon2			AGGGACCGCTGGA	Y07593	CCDS33519.1, CCDS56204.1, CCDS56205.1, CCDS56206.1, CCDS56207.1	21q21.1	2013-01-29			ENSG00000154639	ENSG00000154639		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2559	protein-coding gene	gene with protein product		602621				9036860, 9096397	Standard	NM_001338		Approved	CAR	uc002yki.3	P78310	OTTHUMG00000074508	ENST00000284878.7:c.155C>A	21.37:g.18919456C>A	ENSP00000284878:p.Pro52Gln	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_001207065	B2R8V8|B7WPI3|D3YHP0|O00694|Q8WWT6|Q8WWT7|Q8WWT8|Q9UKV4	Missense_Mutation	SNP	ENST00000284878.7	37	CCDS33519.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.153859	0.57259	.	.	ENSG00000154639	ENST00000284878;ENST00000400166;ENST00000356275;ENST00000400169;ENST00000400165;ENST00000306618	T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	5.11	4.21	0.49690	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.145075	0.64402	D	0.000006	D	0.84960	0.5588	M	0.72894	2.215	0.54753	D	0.999982	D;D;D;D;D	0.89917	0.974;1.0;0.998;0.989;1.0	P;D;D;P;D	0.75020	0.768;0.978;0.977;0.905;0.985	T	0.82470	-0.0441	10	0.13853	T	0.58	.	14.7428	0.69469	0.1461:0.8539:0.0:0.0	.	52;52;52;52;52	P78310-3;P78310-4;B7WPI3;P78310;P78310-5	.;.;.;CXAR_HUMAN;.	Q	52	ENSP00000284878:P52Q;ENSP00000383030:P52Q;ENSP00000348620:P52Q;ENSP00000383033:P52Q;ENSP00000383029:P52Q;ENSP00000303395:P52Q	ENSP00000284878:P52Q	P	+	2	0	CXADR	17841327	0.998000	0.40836	0.635000	0.29338	0.466000	0.32739	6.588000	0.74076	1.449000	0.47699	0.655000	0.94253	CCG	.		0.468	CXADR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000158209.1		
CXorf22	170063	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	35971756	35971756	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:35971756A>G	ENST00000297866.5	+	7	1160	c.1094A>G	c.(1093-1095)gAc>gGc	p.D365G		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	365										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TACAGACAGGACTATGCTCTC	0.318																																					p.D365G		.											.	CXorf22	131	0			c.A1094G						.						114.0	103.0	107.0					X																	35971756		2202	4298	6500	SO:0001583	missense	170063	exon7			GACAGGACTATGC	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1094A>G	X.37:g.35971756A>G	ENSP00000297866:p.Asp365Gly	Somatic	433.0	2.0		WXS	Illumina HiSeq	Phase_I	362.0	122.0	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	A	14.37	2.514892	0.44763	.	.	ENSG00000165164	ENST00000297866	T	0.58940	0.3	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.74673	0.3747	M	0.78801	2.425	0.39317	D	0.965176	D	0.89917	1.0	D	0.97110	1.0	T	0.75175	-0.3410	10	0.28530	T	0.3	-35.0913	13.6367	0.62227	1.0:0.0:0.0:0.0	.	365	Q6ZTR5	CX022_HUMAN	G	365	ENSP00000297866:D365G	ENSP00000297866:D365G	D	+	2	0	CXorf22	35881677	1.000000	0.71417	0.991000	0.47740	0.014000	0.08584	6.495000	0.73665	1.905000	0.55150	0.441000	0.28932	GAC	.		0.318	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
CYP4A11	1579	hgsc.bcm.edu;bcgsc.ca	37	1	47406949	47406949	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:47406949A>G	ENST00000310638.4	-	1	188	c.157T>C	c.(157-159)Tgc>Cgc	p.C53R	CYP4A11_ENST00000371905.1_Missense_Mutation_p.C53R|CYP4A11_ENST00000457840.2_5'UTR|CYP4A11_ENST00000462347.1_Missense_Mutation_p.C53R|CYP4A11_ENST00000371904.4_Missense_Mutation_p.C53R	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	53					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	GAGGGAGGGCACGGGAACTGC	0.617																																					p.C53R		.											.	CYP4A11	94	0			c.T157C						.						67.0	60.0	63.0					1																	47406949		2203	4300	6503	SO:0001583	missense	1579	exon1			GAGGGCACGGGAA	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.157T>C	1.37:g.47406949A>G	ENSP00000311095:p.Cys53Arg	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_000778	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	37	CCDS543.1	.	.	.	.	.	.	.	.	.	.	-	7.618	0.676158	0.14841	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	T;T;T	0.67865	-0.29;-0.29;-0.29	4.92	-0.772	0.10998	.	0.378318	0.25200	N	0.032389	T	0.56992	0.2023	L	0.43923	1.385	0.09310	N	0.999993	B	0.34255	0.445	B	0.41412	0.356	T	0.53514	-0.8428	10	0.62326	D	0.03	.	6.1817	0.20476	0.3094:0.4541:0.0:0.2365	.	53	Q02928	CP4AB_HUMAN	R	53	ENSP00000311095:C53R;ENSP00000360971:C53R;ENSP00000360972:C53R	ENSP00000311095:C53R	C	-	1	0	CYP4A11	47179536	0.002000	0.14202	0.009000	0.14445	0.031000	0.12232	1.745000	0.38278	0.068000	0.16574	-0.331000	0.08364	TGC	.		0.617	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778	
DACH2	117154	hgsc.bcm.edu;bcgsc.ca	37	X	85404070	85404070	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:85404070G>T	ENST00000373125.4	+	1	446	c.446G>T	c.(445-447)aGg>aTg	p.R149M	DACH2_ENST00000373131.1_Missense_Mutation_p.R149M	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	149	DACHbox-N.				development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CTCATCACCAGGAAAGACTTC	0.557																																					p.R149M		.											.	DACH2	136	0			c.G446T						.						46.0	47.0	46.0					X																	85404070		2203	4300	6503	SO:0001583	missense	117154	exon1			TCACCAGGAAAGA	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.446G>T	X.37:g.85404070G>T	ENSP00000362217:p.Arg149Met	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_001139514	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.958200	0.73902	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125	D;D	0.84370	-1.84;-1.84	4.5	4.5	0.54988	DNA binding domain, putative (1);Transforming protein Ski (2);	0.000000	0.56097	D	0.000037	D	0.92166	0.7516	M	0.81497	2.545	0.80722	D	1	D;D	0.76494	0.991;0.999	D;D	0.77557	0.984;0.99	D	0.92951	0.6380	10	0.54805	T	0.06	.	16.1211	0.81357	0.0:0.0:1.0:0.0	.	149;149	Q96NX9-2;Q96NX9	.;DACH2_HUMAN	M	149	ENSP00000362223:R149M;ENSP00000362217:R149M	ENSP00000345134:R149M	R	+	2	0	DACH2	85290726	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.806000	0.91930	2.071000	0.62044	0.544000	0.68410	AGG	.		0.557	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
DALRD3	55152	hgsc.bcm.edu;bcgsc.ca	37	3	49053492	49053492	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:49053492T>C	ENST00000341949.4	-	10	1363	c.1357A>G	c.(1357-1359)Atc>Gtc	p.I453V	DALRD3_ENST00000313778.5_Missense_Mutation_p.I286V|DALRD3_ENST00000441576.2_Splice_Site_p.Y444C|DALRD3_ENST00000496568.1_5'Flank|DALRD3_ENST00000395462.4_Missense_Mutation_p.I286V|DALRD3_ENST00000440857.1_Missense_Mutation_p.I286V	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	453					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AAGGGGAGGATACTGTTGAAG	0.592																																					p.I453V		.											.	DALRD3	90	0			c.A1357G						.						58.0	63.0	61.0					3																	49053492		2203	4300	6503	SO:0001583	missense	55152	exon10			GGAGGATACTGTT	BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.1357A>G	3.37:g.49053492T>C	ENSP00000344989:p.Ile453Val	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	4.0	NM_001009996	Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	ENST00000341949.4	37	CCDS33754.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.342|2.342	-0.350941|-0.350941	0.05173|0.05173	.|.	.|.	ENSG00000178149|ENSG00000178149	ENST00000341949;ENST00000395462;ENST00000440857;ENST00000313778|ENST00000438585;ENST00000441576	T;T;T;T|T	0.77229|0.48836	-1.08;-1.08;-1.08;-1.08|0.8	5.48|5.48	-2.95|-2.95	0.05564|0.05564	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);DALR anticodon binding (2);|.	0.556527|.	0.19877|.	N|.	0.104049|.	T|T	0.33731|0.33731	0.0873|0.0873	L|L	0.45352|0.45352	1.415|1.415	0.09310|0.09310	N|N	0.999999|0.999999	B;B|B	0.13594|0.02656	0.008;0.004|0.0	B;B|B	0.13407|0.04013	0.007;0.009|0.001	T|T	0.28902|0.28902	-1.0029|-1.0029	10|8	0.13853|.	T|.	0.58|.	-13.1072|-13.1072	8.2195|8.2195	0.31532|0.31532	0.0:0.3099:0.1596:0.5304|0.0:0.3099:0.1596:0.5304	.|.	286;453|444	C9JJG6;Q5D0E6|Q5D0E6-2	.;DALD3_HUMAN|.	V|C	453;286;286;286|99;444	ENSP00000344989:I453V;ENSP00000378846:I286V;ENSP00000403770:I286V;ENSP00000323265:I286V|ENSP00000410623:Y444C	ENSP00000323265:I286V|.	I|Y	-|-	1|2	0|0	DALRD3|DALRD3	49028496|49028496	0.008000|0.008000	0.16893|0.16893	0.053000|0.053000	0.19242|0.19242	0.539000|0.539000	0.34962|0.34962	-0.019000|-0.019000	0.12546|0.12546	-0.208000|-0.208000	0.10171|0.10171	-0.451000|-0.451000	0.05528|0.05528	ATC|TAT	.		0.592	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345581.1	NM_018114	
DAPP1	27071	hgsc.bcm.edu;bcgsc.ca	37	4	100756811	100756811	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:100756811G>T	ENST00000512369.1	+	2	201	c.133G>T	c.(133-135)Gct>Tct	p.A45S	DAPP1_ENST00000296414.7_Missense_Mutation_p.A45S	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	45	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		ACGCCATGCTGCTGAAGCTCT	0.552																																					p.A45S		.											.	DAPP1	93	0			c.G133T						.						147.0	146.0	146.0					4																	100756811		2096	4222	6318	SO:0001583	missense	27071	exon2			CATGCTGCTGAAG	AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.133G>T	4.37:g.100756811G>T	ENSP00000423602:p.Ala45Ser	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	5.0	NM_014395	Q8TCK5|Q9UHF2	Missense_Mutation	SNP	ENST00000512369.1	37	CCDS47112.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399565	0.62177	.	.	ENSG00000070190	ENST00000296414;ENST00000512369	D;D	0.92099	-2.97;-2.97	5.9	5.9	0.94986	SH2 motif (5);	0.051911	0.85682	D	0.000000	D	0.95059	0.8400	L	0.59967	1.855	0.80722	D	1	P;D;D	0.76494	0.905;0.999;0.991	P;D;P	0.65443	0.751;0.935;0.876	D	0.93983	0.7260	10	0.44086	T	0.13	-0.2833	19.8893	0.96923	0.0:0.0:1.0:0.0	.	45;45;45	B4DW38;Q9UN19-2;Q9UN19	.;.;DAPP1_HUMAN	S	45	ENSP00000296414:A45S;ENSP00000423602:A45S	ENSP00000296414:A45S	A	+	1	0	DAPP1	100975834	1.000000	0.71417	0.060000	0.19600	0.017000	0.09413	8.816000	0.91979	2.788000	0.95919	0.650000	0.86243	GCT	.		0.552	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363215.1		
DCAF7	10238	hgsc.bcm.edu;bcgsc.ca	37	17	61666468	61666468	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:61666468G>T	ENST00000310827.4	+	8	1180	c.963G>T	c.(961-963)tgG>tgT	p.W321C	DCAF7_ENST00000577702.1_3'UTR|DCAF7_ENST00000415273.2_Missense_Mutation_p.W121C|DCAF7_ENST00000431926.1_Intron	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7	321					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						ATGTGCAGTGGGCATCAACTC	0.567																																					p.W321C		.											.	DCAF7	91	0			c.G963T						.						107.0	104.0	105.0					17																	61666468		2063	4198	6261	SO:0001583	missense	10238	exon8			GCAGTGGGCATCA	U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.963G>T	17.37:g.61666468G>T	ENSP00000308344:p.Trp321Cys	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	5.0	NM_005828	B4E039|D3DU14|O15491|Q9DAE4	Missense_Mutation	SNP	ENST00000310827.4	37		.	.	.	.	.	.	.	.	.	.	G	21.7	4.182068	0.78677	.	.	ENSG00000136485	ENST00000310827;ENST00000415273	T;T	0.61510	0.1;1.4	5.31	5.31	0.75309	WD40/YVTN repeat-like-containing domain (1);	0.113458	0.64402	D	0.000004	T	0.78610	0.4310	.	.	.	0.80722	D	1	D;D	0.89917	1.0;0.984	D;D	0.91635	0.999;0.929	T	0.80670	-0.1279	9	0.72032	D	0.01	-17.8074	19.1619	0.93537	0.0:0.0:1.0:0.0	.	121;321	B4E039;P61962	.;DCAF7_HUMAN	C	321;121	ENSP00000308344:W321C;ENSP00000403920:W121C	ENSP00000308344:W321C	W	+	3	0	DCAF7	59020200	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.657000	0.98554	2.758000	0.94735	0.563000	0.77884	TGG	.		0.567	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005828	
DCDC1	341019	hgsc.bcm.edu;bcgsc.ca	37	11	30938424	30938424	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:30938424T>C	ENST00000597505.1	-	24	3444	c.3445A>G	c.(3445-3447)Aaa>Gaa	p.K1149E	DCDC1_ENST00000406071.2_5'UTR|DCDC1_ENST00000339794.5_Missense_Mutation_p.K228E			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TACCTGTGTTTCTTCTGTGGT	0.403																																					p.K256E		.											.	DCDC5	23	0			c.A766G						.						129.0	128.0	128.0					11																	30938424		2202	4299	6501	SO:0001583	missense	100506627	exon7			TGTGTTTCTTCTG	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.3445A>G	11.37:g.30938424T>C	ENSP00000472625:p.Lys1149Glu	Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	6.0	NM_020869	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000597505.1	37		.	.	.	.	.	.	.	.	.	.	T	15.07	2.724805	0.48833	.	.	ENSG00000170959	ENST00000339794	.	.	.	5.65	0.485	0.16830	.	0.321787	0.26400	N	0.024598	T	0.24122	0.0584	N	0.20986	0.625	0.09310	N	1	B	0.20052	0.041	B	0.26202	0.067	T	0.12451	-1.0547	9	0.44086	T	0.13	-3.6689	4.0866	0.09950	0.1432:0.2426:0.0:0.6142	.	228	Q6ZRR9	DCDC5_HUMAN	E	228	.	ENSP00000341700:K228E	K	-	1	0	DCDC5	30895000	0.517000	0.26226	0.096000	0.21009	0.727000	0.41649	0.621000	0.24418	0.098000	0.17522	0.459000	0.35465	AAA	.		0.403	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807	
DCUN1D4	23142	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	52740446	52740446	+	Missense_Mutation	SNP	G	G	T	rs142966675		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:52740446G>T	ENST00000334635.5	+	4	326	c.146G>T	c.(145-147)cGg>cTg	p.R49L	DCUN1D4_ENST00000513800.1_3'UTR|DCUN1D4_ENST00000381441.3_Missense_Mutation_p.R49L|DCUN1D4_ENST00000451288.2_Missense_Mutation_p.R93L|DCUN1D4_ENST00000381437.4_5'UTR	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	49						nucleus (GO:0005634)		p.R49P(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			GGAAGTCTGCGGTCTTGCAGT	0.383													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17024	0.0		0.0	False		,,,				2504	0.0				p.R49L		.											DCUN1D4,NS,carcinoma,0	DCUN1D4	92	1	Substitution - Missense(1)	ovary(1)	c.G146T						.	G	LEU/ARG,LEU/ARG	1,4405	2.1+/-5.4	0,1,2202	125.0	122.0	123.0		146,146	4.3	1.0	4	dbSNP_134	123	0,8600		0,0,4300	no	missense,missense	DCUN1D4	NM_001040402.1,NM_015115.2	102,102	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	49/293,49/258	52740446	1,13005	2203	4300	6503	SO:0001583	missense	23142	exon4			GTCTGCGGTCTTG	D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.146G>T	4.37:g.52740446G>T	ENSP00000334625:p.Arg49Leu	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	4.0	NM_015115	B4DH25|Q7Z3F3|Q7Z6B8	Missense_Mutation	SNP	ENST00000334635.5	37	CCDS33982.1	.	.	.	.	.	.	.	.	.	.	g	21.0	4.077896	0.76528	2.27E-4	0.0	ENSG00000109184	ENST00000334635;ENST00000381441;ENST00000505403;ENST00000451288	.	.	.	5.18	4.34	0.51931	.	0.394763	0.26971	N	0.021575	T	0.40743	0.1129	N	0.22421	0.69	0.80722	D	1	P;P;P	0.42785	0.499;0.79;0.473	B;B;B	0.43838	0.072;0.433;0.122	T	0.13899	-1.0492	9	0.25751	T	0.34	-8.7843	11.2283	0.48897	0.0843:0.0:0.9157:0.0	.	93;49;49	B4DH25;Q92564-2;Q92564	.;.;DCNL4_HUMAN	L	49;49;93;93	.	ENSP00000334625:R49L	R	+	2	0	DCUN1D4	52435203	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.188000	0.77739	1.194000	0.43101	0.651000	0.88453	CGG	G|1.000;T|0.000		0.383	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250599.2	NM_015115	
DEF8	54849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	90023996	90023996	+	Silent	SNP	C	C	A	rs377269615		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:90023996C>A	ENST00000268676.7	+	5	572	c.483C>A	c.(481-483)ccC>ccA	p.P161P	DEF8_ENST00000418391.2_Silent_p.P100P|DEF8_ENST00000567874.1_Silent_p.P40P|DEF8_ENST00000563594.1_Silent_p.P100P|DEF8_ENST00000569453.1_Silent_p.P100P|DEF8_ENST00000563795.1_Silent_p.P100P|DEF8_ENST00000570182.1_Silent_p.P90P	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)	161					intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		TGGAGCTGCCCGAGCAGTCGG	0.682																																					p.P161P		.											.	DEF8	68	0			c.C483A						.						33.0	29.0	31.0					16																	90023996		2188	4291	6479	SO:0001819	synonymous_variant	54849	exon5			GCTGCCCGAGCAG	AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.483C>A	16.37:g.90023996C>A		Somatic	421.0	0.0		WXS	Illumina HiSeq	Phase_I	273.0	232.0	NM_207514	B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Silent	SNP	ENST00000268676.7	37	CCDS10989.1																																																																																			.		0.682	DEF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000272878.1	NM_207514	
DENND4B	9909	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	153906108	153906108	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:153906108G>A	ENST00000361217.4	-	20	3599	c.3181C>T	c.(3181-3183)Ctc>Ttc	p.L1061F	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	1061					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGCTGTTGGAGGCGGGCACCC	0.711																																					p.L1061F		.											.	DENND4B	69	0			c.C3181T						.						5.0	8.0	7.0					1																	153906108		1897	4013	5910	SO:0001583	missense	9909	exon20			GTTGGAGGCGGGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.3181C>T	1.37:g.153906108G>A	ENSP00000354597:p.Leu1061Phe	Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	379.0	219.0	NM_014856	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.490643	0.44249	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.13538	2.84;2.58	5.09	4.12	0.48240	.	0.628844	0.16048	N	0.232095	T	0.04182	0.0116	L	0.27053	0.805	0.42662	D	0.993486	B	0.32968	0.392	B	0.27076	0.076	T	0.26780	-1.0093	10	0.56958	D	0.05	-18.3115	11.4825	0.50333	0.0:0.0:0.6125:0.3875	.	1061	O75064	DEN4B_HUMAN	F	1061;1072	ENSP00000354597:L1061F;ENSP00000357635:L1072F	ENSP00000354597:L1061F	L	-	1	0	DENND4B	152172732	0.997000	0.39634	1.000000	0.80357	0.940000	0.58332	1.030000	0.30153	1.191000	0.43056	0.462000	0.41574	CTC	.		0.711	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
DEPDC5	9681	hgsc.bcm.edu;bcgsc.ca	37	22	32217607	32217607	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:32217607C>T	ENST00000382112.3	+	22	2060	c.1990C>T	c.(1990-1992)Cat>Tat	p.H664Y	DEPDC5_ENST00000266091.3_Missense_Mutation_p.H664Y|DEPDC5_ENST00000400249.2_Missense_Mutation_p.H664Y|DEPDC5_ENST00000400248.2_Missense_Mutation_p.H664Y|DEPDC5_ENST00000536766.1_Intron|DEPDC5_ENST00000382105.2_Intron|DEPDC5_ENST00000535622.1_Intron|DEPDC5_ENST00000382111.2_Missense_Mutation_p.H664Y|DEPDC5_ENST00000400246.1_Missense_Mutation_p.H664Y	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	664					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GTTAGCATATCATGAAGCTGC	0.542																																					p.H664Y		.											.	DEPDC5	519	0			c.C1990T						.						128.0	135.0	133.0					22																	32217607		2116	4242	6358	SO:0001583	missense	9681	exon22			GCATATCATGAAG	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1990C>T	22.37:g.32217607C>T	ENSP00000371546:p.His664Tyr	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_001136029	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.18|19.18	3.777990|3.777990	0.70107|0.70107	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000266091;ENST00000400249;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248|ENST00000433147	T;T;T;T;T;T|.	0.24151|.	1.89;1.91;1.87;1.91;1.87;1.91|.	5.91|5.91	4.83|4.83	0.62350|0.62350	.|.	0.151077|.	0.64402|.	D|.	0.000018|.	T|T	0.69646|0.69646	0.3134|0.3134	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	P;P;B;P|.	0.47604|.	0.867;0.898;0.031;0.837|.	B;B;B;B|.	0.43867|.	0.317;0.434;0.01;0.335|.	T|T	0.66858|0.66858	-0.5817|-0.5817	10|5	0.40728|.	T|.	0.16|.	.|.	14.9866|14.9866	0.71353|0.71353	0.143:0.857:0.0:0.0|0.143:0.857:0.0:0.0	.|.	664;664;664;664|.	B9EGN9;O75140-4;A8MPX9;O75140|.	.;.;.;DEPD5_HUMAN|.	Y|L	664|61	ENSP00000266091:H664Y;ENSP00000383108:H664Y;ENSP00000383105:H664Y;ENSP00000371546:H664Y;ENSP00000371545:H664Y;ENSP00000383107:H664Y|.	ENSP00000266091:H664Y|.	H|S	+|+	1|2	0|0	DEPDC5|DEPDC5	30547607|30547607	1.000000|1.000000	0.71417|0.71417	0.916000|0.916000	0.36221|0.36221	0.997000|0.997000	0.91878|0.91878	5.554000|5.554000	0.67294|0.67294	2.801000|2.801000	0.96364|0.96364	0.655000|0.655000	0.94253|0.94253	CAT|TCA	.		0.542	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
DEPTOR	64798	hgsc.bcm.edu;bcgsc.ca	37	8	120977517	120977517	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr8:120977517A>G	ENST00000286234.5	+	4	601	c.471A>G	c.(469-471)gaA>gaG	p.E157E	DEPTOR_ENST00000523492.1_Silent_p.E56E	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	157	DEP 2. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)				endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						GGGAGGAGGAAGGGGTCAAGT	0.517																																					p.E157E		.											.	DEPTOR	227	0			c.A471G						.						106.0	94.0	98.0					8																	120977517		2203	4300	6503	SO:0001819	synonymous_variant	64798	exon4			GGAGGAAGGGGTC		CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.471A>G	8.37:g.120977517A>G		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	4.0	NM_022783	B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Silent	SNP	ENST00000286234.5	37	CCDS6331.1																																																																																			.		0.517	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381601.1	NM_022783	
DHX9	1660	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182847265	182847265	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:182847265C>G	ENST00000367549.3	+	20	2418	c.2308C>G	c.(2308-2310)Cct>Gct	p.P770A	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	770	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.			VRP -> STA (in Ref. 1; AAB48855 and 3; CAA71668). {ECO:0000305}.	ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						CCGAGTACGGCCTGGATTCTG	0.478																																					p.P770A	Colon(69;210 1162 3697 13559 39565)	.											.	DHX9	92	0			c.C2308G						.						88.0	84.0	85.0					1																	182847265		1933	4134	6067	SO:0001583	missense	1660	exon20			GTACGGCCTGGAT	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2308C>G	1.37:g.182847265C>G	ENSP00000356520:p.Pro770Ala	Somatic	174.0	1.0		WXS	Illumina HiSeq	Phase_I	256.0	27.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.175184	0.57692	.	.	ENSG00000135829	ENST00000367549	T	0.02837	4.14	5.78	5.78	0.91487	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.06188	0.0160	M	0.63428	1.95	0.58432	D	0.999999	B;B	0.20164	0.042;0.034	B;B	0.26614	0.071;0.049	T	0.22138	-1.0225	10	0.42905	T	0.14	.	16.488	0.84190	0.0:0.8605:0.1395:0.0	.	49;770	B3KU66;Q08211	.;DHX9_HUMAN	A	770	ENSP00000356520:P770A	ENSP00000356520:P770A	P	+	1	0	DHX9	181113888	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	4.570000	0.60872	2.722000	0.93159	0.655000	0.94253	CCT	.		0.478	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
DLG4	1742	hgsc.bcm.edu;bcgsc.ca	37	17	7097797	7097797	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:7097797T>C	ENST00000399506.2	-	12	1510	c.1319A>G	c.(1318-1320)gAc>gGc	p.D440G	DLG4_ENST00000399510.2_Missense_Mutation_p.D483G|DLG4_ENST00000302955.6_Missense_Mutation_p.D437G			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	440	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	CTTGGTCTTGTCGTAATCAAA	0.602																																					p.D483G		.											.	DLG4	24	0			c.A1448G						.						32.0	37.0	36.0					17																	7097797		2067	4218	6285	SO:0001583	missense	1742	exon14			GTCTTGTCGTAAT	U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.1319A>G	17.37:g.7097797T>C	ENSP00000382425:p.Asp440Gly	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	4.0	NM_001365	B7Z1S1|G5E939|Q92941|Q9UKK8	Missense_Mutation	SNP	ENST00000399506.2	37		.	.	.	.	.	.	.	.	.	.	T	27.3	4.815425	0.90790	.	.	ENSG00000132535	ENST00000399506;ENST00000302955;ENST00000399510;ENST00000293813;ENST00000380912;ENST00000539674	T;T;T	0.50813	0.73;0.73;0.73	5.3	5.3	0.74995	Src homology-3 domain (4);	.	.	.	.	T	0.73984	0.3657	M	0.91561	3.22	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.989	D;D;D;D	0.91635	0.994;0.98;0.999;0.995	T	0.79964	-0.1581	9	0.66056	D	0.02	.	13.2525	0.60060	0.0:0.0:0.0:1.0	.	480;440;437;483	B9EGL1;P78352;G5E939;P78352-2	.;DLG4_HUMAN;.;.	G	440;437;483;483;380;483	ENSP00000382425:D440G;ENSP00000307471:D437G;ENSP00000382428:D483G	ENSP00000293813:D483G	D	-	2	0	DLG4	7038521	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.077000	0.71275	2.235000	0.73313	0.533000	0.62120	GAC	.		0.602	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000259419.2	NM_001365	
DMD	1756	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	32715997	32715997	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:32715997A>T	ENST00000357033.4	-	9	1156	c.950T>A	c.(949-951)tTt>tAt	p.F317Y	DMD_ENST00000378677.2_Missense_Mutation_p.F313Y|DMD_ENST00000288447.4_Missense_Mutation_p.F309Y	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	317					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTGTGAAGGAAATGGGCTCCG	0.448																																					p.F317Y		.											.	DMD	265	0			c.T950A						.						136.0	106.0	116.0					X																	32715997		2202	4300	6502	SO:0001583	missense	1756	exon9			GAAGGAAATGGGC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.950T>A	X.37:g.32715997A>T	ENSP00000354923:p.Phe317Tyr	Somatic	232.0	2.0		WXS	Illumina HiSeq	Phase_I	177.0	88.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	A	6.530	0.465951	0.12402	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.72725	0.13;0.13;-0.68	5.63	3.02	0.34903	.	0.610989	0.12207	N	0.489722	T	0.52338	0.1728	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.38757	-0.9646	10	0.36615	T	0.2	.	9.7246	0.40324	0.7139:0.0:0.0:0.2861	.	309;309;317;313	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	Y	309;313;317;317;194;309	ENSP00000367948:F313Y;ENSP00000354923:F317Y;ENSP00000288447:F309Y	ENSP00000288447:F309Y	F	-	2	0	DMD	32625918	1.000000	0.71417	0.950000	0.38849	0.967000	0.64934	2.913000	0.48790	0.723000	0.32274	0.437000	0.28790	TTT	.		0.448	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DNAH9	1770	hgsc.bcm.edu;bcgsc.ca	37	17	11661007	11661007	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:11661007C>T	ENST00000262442.4	+	35	7061	c.6993C>T	c.(6991-6993)acC>acT	p.T2331T	DNAH9_ENST00000454412.2_Silent_p.T2331T	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2331	AAA 2. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CACTCAGAACCAGGTAGGCCA	0.463																																					p.T2331T		.											.	DNAH9	168	0			c.C6993T						.						84.0	72.0	77.0					17																	11661007		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon35			CAGAACCAGGTAG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6993C>T	17.37:g.11661007C>T		Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	6.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																			.		0.463	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DNAJB5	25822	hgsc.bcm.edu;bcgsc.ca	37	9	34990809	34990809	+	5'UTR	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:34990809G>T	ENST00000541010.1	+	0	591				DNAJB5_ENST00000335998.3_Splice_Site_p.R23L|DNAJB5_ENST00000312316.5_Intron|DNAJB5_ENST00000453597.3_Splice_Site_p.R103L|DNAJB5_ENST00000545841.1_Intron|DNAJB5_ENST00000454002.2_Splice_Site_p.R61L			O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)			kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(32;0.00575)			GTAAAGTTTCGGTAAGTCCCT	0.527																																					p.R103L		.											.	DNAJB5	226	0			c.G308T						.						42.0	40.0	40.0					9																	34990809		692	1591	2283	SO:0001623	5_prime_UTR_variant	25822	exon2			AGTTTCGGTAAGT	AF088982	CCDS35007.1, CCDS47959.1, CCDS47960.1, CCDS47960.2	9p	2011-09-02			ENSG00000137094	ENSG00000137094		"""Heat shock proteins / DNAJ (HSP40)"""	14887	protein-coding gene	gene with protein product		611328				10570961, 11147971	Standard	NM_001135004		Approved	Hsc40	uc003zvs.4	O75953	OTTHUMG00000019840	ENST00000541010.1:c.-2422G>T	9.37:g.34990809G>T		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_001135004	B3KN14|B4DSA6|J3KQM9|J3KR08|Q5T656|Q8TDR7|Q96EM4	Missense_Mutation	SNP	ENST00000541010.1	37	CCDS35007.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039055	0.55003	.	.	ENSG00000137094	ENST00000453597;ENST00000335998;ENST00000454002	T;T;T	0.57107	0.42;0.53;0.46	4.59	4.59	0.56863	.	.	.	.	.	T	0.45915	0.1366	N	0.08118	0	0.80722	D	1	D	0.53745	0.962	P	0.53450	0.726	T	0.57283	-0.7838	9	0.87932	D	0	.	14.5683	0.68194	0.0:0.0:1.0:0.0	.	61	B4DSA6	.	L	103;23;61	ENSP00000404079:R103L;ENSP00000337626:R23L;ENSP00000413684:R61L	ENSP00000337626:R23L	R	+	2	0	DNAJB5	34980809	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.954000	0.70298	2.102000	0.63906	0.561000	0.74099	CGA	.		0.527	DNAJB5-008	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401397.1		
DNAJC8	22826	hgsc.bcm.edu;bcgsc.ca	37	1	28536549	28536549	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:28536549C>T	ENST00000263697.4	-	5	359	c.333G>A	c.(331-333)ctG>ctA	p.L111L	DNAJC8_ENST00000489277.1_5'UTR	NM_014280.2	NP_055095.2	O75937	DNJC8_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 8	111	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)				kidney(1)|large_intestine(3)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)		GCTCCTGATCCAGTAGCAACT	0.413																																					p.L111L		.											.	DNAJC8	90	0			c.G333A						.						108.0	93.0	98.0					1																	28536549		1854	4099	5953	SO:0001819	synonymous_variant	22826	exon5			CTGATCCAGTAGC	AF083190	CCDS41292.1	1p35	2011-09-02			ENSG00000126698	ENSG00000126698		"""Heat shock proteins / DNAJ (HSP40)"""	15470	protein-coding gene	gene with protein product						11147971	Standard	NM_014280		Approved	SPF31	uc001bpn.3	O75937	OTTHUMG00000003538	ENST00000263697.4:c.333G>A	1.37:g.28536549C>T		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_014280	B4DUU4|D3DPM0|Q6IBA4|Q8N4Z5|Q9P051|Q9P067	Silent	SNP	ENST00000263697.4	37	CCDS41292.1																																																																																			.		0.413	DNAJC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009860.1	NM_014280	
DOCK3	1795	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	51297588	51297588	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:51297588C>A	ENST00000266037.9	+	23	2209	c.2186C>A	c.(2185-2187)gCc>gAc	p.A729D		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	729					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ACTTTTCAGGCCTTGGAGTAC	0.443																																					p.A729D		.											.	DOCK3	22	0			c.C2186A						.						84.0	80.0	81.0					3																	51297588		1930	4149	6079	SO:0001630	splice_region_variant	1795	exon23			TTCAGGCCTTGGA	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2185-1C>A	3.37:g.51297588C>A		Somatic	193.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	8.0	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022119	0.93462	.	.	ENSG00000088538	ENST00000266037	T	0.68624	-0.34	5.93	5.05	0.67936	.	0.046361	0.85682	D	0.000000	T	0.81941	0.4929	M	0.89287	3.02	0.80722	D	1	D	0.54047	0.964	P	0.58391	0.838	D	0.84894	0.0838	10	0.66056	D	0.02	.	15.4007	0.74838	0.0:0.9326:0.0:0.0674	.	729	Q8IZD9	DOCK3_HUMAN	D	729	ENSP00000266037:A729D	ENSP00000266037:A729D	A	+	2	0	DOCK3	51272628	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	6.082000	0.71318	2.805000	0.96524	0.655000	0.94253	GCC	.		0.443	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	Missense_Mutation
DYNC2H1	79659	hgsc.bcm.edu;bcgsc.ca	37	11	103152947	103152947	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:103152947T>C	ENST00000375735.2	+	72	10945	c.10801T>C	c.(10801-10803)Tta>Cta	p.L3601L	DYNC2H1_ENST00000398093.3_Silent_p.L3608L|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3601					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGGAGACATGTTACGGAAAGC	0.299																																					p.L3608L		.											.	DYNC2H1	68	0			c.T10822C						.						90.0	89.0	89.0					11																	103152947		1800	4054	5854	SO:0001819	synonymous_variant	79659	exon73			GACATGTTACGGA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10801T>C	11.37:g.103152947T>C		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_001080463	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	CCDS53701.1																																																																																			.		0.299	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
EFCAB14	9813	hgsc.bcm.edu;bcgsc.ca	37	1	47149060	47149060	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:47149060C>T	ENST00000371933.3	-	10	2200	c.1224G>A	c.(1222-1224)ttG>ttA	p.L408L	EFCAB14-AS1_ENST00000442839.1_RNA|EFCAB14_ENST00000484461.1_5'Flank|EFCAB14_ENST00000544071.1_Silent_p.L344L|EFCAB14-AS1_ENST00000418985.1_RNA	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	408							calcium ion binding (GO:0005509)										AAAATTTTGGCAATGCTGATG	0.353																																					p.L408L		.											.	.	.	0			c.G1224A						.						112.0	114.0	113.0					1																	47149060		2203	4300	6503	SO:0001819	synonymous_variant	9813	exon10			TTTTGGCAATGCT	AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.1224G>A	1.37:g.47149060C>T		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_014774	D3DQ23|Q5SXB8	Silent	SNP	ENST00000371933.3	37	CCDS30706.1																																																																																			.		0.353	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021931.1	NM_014774	
EGFR	1956	hgsc.bcm.edu;bcgsc.ca	37	7	55224338	55224338	+	Silent	SNP	G	G	T	rs2302536	byFrequency	TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:55224338G>T	ENST00000275493.2	+	9	1296	c.1119G>T	c.(1117-1119)ccG>ccT	p.P373P	EGFR_ENST00000420316.2_Silent_p.P373P|EGFR_ENST00000455089.1_Silent_p.P328P|EGFR_ENST00000344576.2_Silent_p.P373P|EGFR_ENST00000442591.1_Silent_p.P373P|EGFR_ENST00000454757.2_Silent_p.P320P|EGFR_ENST00000342916.3_Silent_p.P373P	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	373					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.P373P(2)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	ACATCCTGCCGGTGGCATTTA	0.408		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.P373P		.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	EGFR	44910	2	Substitution - coding silent(2)	large_intestine(2)	c.G1119T						.						80.0	82.0	82.0					7																	55224338		2203	4300	6503	SO:0001819	synonymous_variant	1956	exon9	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	CCTGCCGGTGGCA		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1119G>T	7.37:g.55224338G>T		Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	5.0	NM_201283	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	ENST00000275493.2	37	CCDS5514.1																																																																																			G|0.997;A|0.003		0.408	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
ELTD1	64123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	79404924	79404924	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:79404924G>T	ENST00000370742.3	-	4	408	c.345C>A	c.(343-345)tgC>tgA	p.C115*		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	115					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TATCTAAATGGCAGTTTGCAT	0.249																																					p.C115X		.											.	ELTD1	24	0			c.C345A						.						41.0	41.0	41.0					1																	79404924		1780	4030	5810	SO:0001587	stop_gained	64123	exon4			TAAATGGCAGTTT	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.345C>A	1.37:g.79404924G>T	ENSP00000359778:p.Cys115*	Somatic	450.0	1.0		WXS	Illumina HiSeq	Phase_I	278.0	219.0	NM_022159	B1AR71|Q5KU34	Nonsense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904360	0.92035	.	.	ENSG00000162618	ENST00000370742	.	.	.	6.07	1.66	0.24008	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3662	0.44026	0.3935:0.0:0.6065:0.0	.	.	.	.	X	115	.	.	C	-	3	2	ELTD1	79177512	0.995000	0.38212	0.933000	0.37362	0.892000	0.51952	0.478000	0.22212	0.466000	0.27193	-0.237000	0.12165	TGC	.		0.249	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
EML3	256364	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	62370651	62370651	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:62370651A>G	ENST00000394773.2	-	20	2633	c.2326T>C	c.(2326-2328)Tac>Cac	p.Y776H	EML3_ENST00000531557.1_Missense_Mutation_p.Y559H|EML3_ENST00000278845.4_Missense_Mutation_p.Y777H|MTA2_ENST00000278823.2_5'Flank|RP11-831H9.3_ENST00000532626.1_RNA|EML3_ENST00000438258.1_5'Flank|MTA2_ENST00000527204.1_5'Flank|EML3_ENST00000494176.2_Missense_Mutation_p.Y748H|EML3_ENST00000529309.1_Missense_Mutation_p.Y776H	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	776						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						ACACAGGTGTAGGTAGCCCAT	0.632																																					p.Y776H		.											.	EML3	91	0			c.T2326C						.						120.0	114.0	116.0					11																	62370651		2202	4299	6501	SO:0001583	missense	256364	exon20			AGGTGTAGGTAGC	AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.2326T>C	11.37:g.62370651A>G	ENSP00000378254:p.Tyr776His	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_153265	Q6ZQW7|Q8NA55	Missense_Mutation	SNP	ENST00000394773.2	37	CCDS8023.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.72|17.72	3.458939|3.458939	0.63401|0.63401	.|.	.|.	ENSG00000149499|ENSG00000149499	ENST00000394776|ENST00000439994;ENST00000394773;ENST00000278845;ENST00000531557;ENST00000494176;ENST00000529309	.|T;T;T;T;T	.|0.29917	.|1.71;1.67;1.55;1.69;1.62	4.78|4.78	4.78|4.78	0.61160|0.61160	.|WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	.|0.071188	.|0.64402	.|D	.|0.000020	T|T	0.44993|0.44993	0.1320|0.1320	L|L	0.43152|0.43152	1.355|1.355	0.47276|0.47276	D|D	0.999371|0.999371	.|D;D;B;D;D	.|0.89917	.|1.0;0.999;0.02;0.999;1.0	.|D;D;B;D;D	.|0.91635	.|0.999;0.979;0.039;0.994;0.974	T|T	0.23726|0.23726	-1.0180|-1.0180	5|10	.|0.32370	.|T	.|0.25	-28.4302|-28.4302	12.2654|12.2654	0.54674|0.54674	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|776;776;559;777;748	.|Q32P44-2;Q32P44;G3V195;B7WPE2;G3V1D0	.|.;EMAL3_HUMAN;.;.;.	P|H	770|27;776;777;559;748;776	.|ENSP00000378254:Y776H;ENSP00000278845:Y777H;ENSP00000433417:Y559H;ENSP00000435064:Y748H;ENSP00000434513:Y776H	.|ENSP00000278845:Y777H	L|Y	-|-	2|1	0|0	EML3|EML3	62127227|62127227	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.696000|5.696000	0.68287|0.68287	1.787000|1.787000	0.52448|0.52448	0.459000|0.459000	0.35465|0.35465	CTA|TAC	.		0.632	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313432.1	NM_153265	
EMR3	84658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	14765979	14765979	+	Splice_Site	SNP	T	T	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:14765979T>A	ENST00000253673.5	-	6	494		c.e6-2		EMR3_ENST00000443157.2_Intron|EMR3_ENST00000599900.1_Intron|EMR3_ENST00000344373.4_Splice_Site	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						CTTTTGCAGCTTTGAAGACAT	0.378																																					.		.											.	EMR3	528	0			c.394-2A>T						.						80.0	78.0	79.0					19																	14765979		2202	4299	6501	SO:0001630	splice_region_variant	84658	exon7			TGCAGCTTTGAAG	AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.394-2A>T	19.37:g.14765979T>A		Somatic	259.0	1.0		WXS	Illumina HiSeq	Phase_I	309.0	135.0	NM_032571		Splice_Site	SNP	ENST00000253673.5	37	CCDS12315.1	.	.	.	.	.	.	.	.	.	.	T	14.57	2.574356	0.45902	.	.	ENSG00000131355	ENST00000253673;ENST00000344373	.	.	.	2.99	2.99	0.34606	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.835	0.29365	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	EMR3	14626979	1.000000	0.71417	0.880000	0.34516	0.430000	0.31655	2.085000	0.41634	1.623000	0.50342	0.533000	0.62120	.	.		0.378	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	NM_032571	Intron
ENGASE	64772	hgsc.bcm.edu;bcgsc.ca	37	17	77073755	77073755	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:77073755T>C	ENST00000579016.1	+	3	225	c.225T>C	c.(223-225)taT>taC	p.Y75Y	ENGASE_ENST00000539857.2_5'UTR	NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	75						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						TTAGATATTATGACAAGGACA	0.433																																					p.Y75Y		.											.	ENGASE	91	0			c.T225C						.						120.0	122.0	121.0					17																	77073755		1927	4129	6056	SO:0001819	synonymous_variant	64772	exon3			ATATTATGACAAG	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.225T>C	17.37:g.77073755T>C		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	4.0	NM_001042573	Q659F0|Q8TB86|Q9H6U4	Silent	SNP	ENST00000579016.1	37	CCDS42394.1																																																																																			.		0.433	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	NM_022759	
ERC2	26059	hgsc.bcm.edu;bcgsc.ca	37	3	56207475	56207475	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:56207475T>C	ENST00000288221.6	-	4	1403	c.1148A>G	c.(1147-1149)aAg>aGg	p.K383R		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	383						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		AGTTCCTACCTTCATTTCGAT	0.453																																					p.K383R		.											.	ERC2	24	0			c.A1148G						.						89.0	92.0	91.0					3																	56207475		2104	4235	6339	SO:0001630	splice_region_variant	26059	exon4			CCTACCTTCATTT	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1149+1A>G	3.37:g.56207475T>C		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	4.0	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	37	CCDS46851.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.32|18.32	3.597176|3.597176	0.66332|0.66332	.|.	.|.	ENSG00000187672|ENSG00000187672	ENST00000288221|ENST00000492584	T|.	0.56611|.	0.45|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.044301|.	0.85682|.	D|.	0.000000|.	T|T	0.77274|0.77274	0.4106|0.4106	M|M	0.81497|0.81497	2.545|2.545	0.47183|0.47183	D|D	0.999347|0.999347	D|.	0.57257|.	0.979|.	D|.	0.71414|.	0.973|.	T|T	0.79017|0.79017	-0.1975|-0.1975	10|5	0.56958|.	D|.	0.05|.	-28.8882|-28.8882	15.7711|15.7711	0.78170|0.78170	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	383|.	O15083|.	ERC2_HUMAN|.	R|G	383|22	ENSP00000288221:K383R|.	ENSP00000288221:K383R|.	K|R	-|-	2|1	0|2	ERC2|ERC2	56182515|56182515	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	7.553000|7.553000	0.82203|0.82203	2.182000|2.182000	0.69389|0.69389	0.455000|0.455000	0.32223|0.32223	AAG|AGG	.		0.453	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	Missense_Mutation
ERCC3	2071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128051105	128051105	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:128051105G>A	ENST00000285398.2	-	2	312	c.218C>T	c.(217-219)tCc>tTc	p.S73F	ERCC3_ENST00000493187.2_Missense_Mutation_p.S9F	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	73					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		GAGGGGCCTGGAGGTGTGGTC	0.592			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.S73F		.	yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	.	ERCC3	723	0			c.C218T						.						77.0	68.0	71.0					2																	128051105		2203	4300	6503	SO:0001583	missense	2071	exon2	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GGCCTGGAGGTGT	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.218C>T	2.37:g.128051105G>A	ENSP00000285398:p.Ser73Phe	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	54.0	NM_000122	Q53QM0	Missense_Mutation	SNP	ENST00000285398.2	37	CCDS2144.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721592	0.68959	.	.	ENSG00000163161	ENST00000285398;ENST00000493187	T;T	0.66995	-0.24;-0.21	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.64702	0.2622	L	0.54323	1.7	0.80722	D	1	B;B	0.18013	0.025;0.025	B;B	0.20767	0.031;0.031	T	0.65483	-0.6157	10	0.62326	D	0.03	-17.7841	17.448	0.87584	0.0:0.0:1.0:0.0	.	73;73	A8K359;P19447	.;ERCC3_HUMAN	F	73;9	ENSP00000285398:S73F;ENSP00000444796:S9F	ENSP00000285398:S73F	S	-	2	0	ERCC3	127767575	1.000000	0.71417	0.159000	0.22649	0.969000	0.65631	8.939000	0.92951	2.347000	0.79759	0.655000	0.94253	TCC	.		0.592	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1	NM_000122	
ESYT1	23344	hgsc.bcm.edu;bcgsc.ca	37	12	56530663	56530663	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:56530663A>G	ENST00000394048.5	+	16	2032	c.1768A>G	c.(1768-1770)Aaa>Gaa	p.K590E	ESYT1_ENST00000267113.4_Missense_Mutation_p.K600E|ESYT1_ENST00000541590.1_Missense_Mutation_p.K600E	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	590					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						ACTCTATATGAAACTAGTCAT	0.527																																					p.K600E		.											.	ESYT1	95	0			c.A1798G						.						69.0	70.0	69.0					12																	56530663		2203	4300	6503	SO:0001583	missense	23344	exon16			TATATGAAACTAG	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.1768A>G	12.37:g.56530663A>G	ENSP00000377612:p.Lys590Glu	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_001184796	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	A	18.27	3.587028	0.66105	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.69685	-0.42;-0.42;-0.42	4.95	4.95	0.65309	C2 calcium/lipid-binding domain, CaLB (1);	0.094256	0.64402	D	0.000001	T	0.71567	0.3355	M	0.78456	2.415	0.51767	D	0.999936	P;B	0.38129	0.619;0.307	P;B	0.44359	0.447;0.138	T	0.70306	-0.4908	10	0.25751	T	0.34	-12.5496	13.8923	0.63747	1.0:0.0:0.0:0.0	.	600;590	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	E	590;544;600;600	ENSP00000377612:K590E;ENSP00000267113:K600E;ENSP00000445952:K600E	ENSP00000267113:K600E	K	+	1	0	ESYT1	54816930	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	8.098000	0.89540	1.991000	0.58162	0.533000	0.62120	AAA	.		0.527	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
F5	2153	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	169515769	169515769	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:169515769T>C	ENST00000367797.3	-	11	1874	c.1673A>G	c.(1672-1674)tAc>tGc	p.Y558C	F5_ENST00000546081.1_3'UTR|F5_ENST00000367796.3_Missense_Mutation_p.Y558C	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	558	F5/8 type A 2.|Plastocyanin-like 4.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GTCCTCAAGGTACCAGCTTTT	0.428																																					p.Y558C		.											.	F5	157	0			c.A1673G	GRCh37	CM014861	F5	M		.						207.0	160.0	176.0					1																	169515769		2203	4300	6503	SO:0001583	missense	2153	exon11			TCAAGGTACCAGC	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.1673A>G	1.37:g.169515769T>C	ENSP00000356771:p.Tyr558Cys	Somatic	153.0	1.0		WXS	Illumina HiSeq	Phase_I	239.0	22.0	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	t	24.1	4.488890	0.84962	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.99818	-6.92;-6.92	6.17	6.17	0.99709	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	M	0.94063	3.49	0.45439	D	0.998415	D	0.89917	1.0	D	0.91635	0.999	D	0.96359	0.9264	9	0.87932	D	0	-19.1918	16.8222	0.85835	0.0:0.0:0.0:1.0	.	558	P12259	FA5_HUMAN	C	558	ENSP00000356771:Y558C;ENSP00000356770:Y558C	ENSP00000356770:Y558C	Y	-	2	0	F5	167782393	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.552000	0.82192	2.371000	0.80710	0.533000	0.62120	TAC	.		0.428	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
FAM111B	374393	hgsc.bcm.edu;bcgsc.ca	37	11	58877115	58877115	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:58877115C>A	ENST00000343597.3	+	3	208	c.17C>A	c.(16-18)aCt>aAt	p.T6N	FAM111B_ENST00000529618.1_Intron|FAM111B_ENST00000411426.1_Intron	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	6							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TCCATGAAGACTGAAGAAAAC	0.368																																					p.T6N		.											.	FAM111B	92	0			c.C17A						.						97.0	88.0	91.0					11																	58877115		2201	4295	6496	SO:0001583	missense	374393	exon3			TGAAGACTGAAGA	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.17C>A	11.37:g.58877115C>A	ENSP00000341565:p.Thr6Asn	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_198947	B4E2G2|Q6P661	Missense_Mutation	SNP	ENST00000343597.3	37	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	C	0.627	-0.818934	0.02776	.	.	ENSG00000189057	ENST00000343597	T	0.31769	1.48	1.65	-0.869	0.10649	.	.	.	.	.	T	0.14917	0.0360	N	0.22421	0.69	0.09310	N	1	B	0.27594	0.182	B	0.15870	0.014	T	0.18209	-1.0344	9	0.37606	T	0.19	.	2.8272	0.05488	0.0:0.4:0.3498:0.2503	.	6	Q6SJ93	F111B_HUMAN	N	6	ENSP00000341565:T6N	ENSP00000341565:T6N	T	+	2	0	FAM111B	58633691	0.039000	0.19947	0.011000	0.14972	0.005000	0.04900	-0.073000	0.11468	-0.208000	0.10171	-0.378000	0.06908	ACT	.		0.368	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947	
FAM188A	80013	hgsc.bcm.edu;bcgsc.ca	37	10	15883432	15883432	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr10:15883432T>C	ENST00000277632.3	-	4	622	c.402A>G	c.(400-402)gaA>gaG	p.E134E	FAM188A_ENST00000477891.1_5'UTR	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A	134					apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						TACAAGAATGTTCCACTTGGC	0.318																																					p.E134E	Pancreas(159;946 1953 2111 4475 22008)	.											.	FAM188A	228	0			c.A402G						.						68.0	66.0	67.0					10																	15883432		2203	4300	6503	SO:0001819	synonymous_variant	80013	exon4			AGAATGTTCCACT	AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.402A>G	10.37:g.15883432T>C		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	6.0	NM_024948	Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Silent	SNP	ENST00000277632.3	37	CCDS7110.1																																																																																			.		0.318	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046990.2	NM_024948	
FAM208A	23272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	56658883	56658883	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:56658883G>C	ENST00000493960.2	-	22	4301	c.4291C>G	c.(4291-4293)Cag>Gag	p.Q1431E	FAM208A_ENST00000431842.2_Missense_Mutation_p.Q994E|FAM208A_ENST00000355628.5_Missense_Mutation_p.Q1370E|FAM208A_ENST00000485156.1_Intron	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1431							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TGTCGTTGCTGTATGTTCTGA	0.383																																					p.Q1431E		.											.	.	.	0			c.C4291G						.						127.0	125.0	126.0					3																	56658883		2203	4300	6503	SO:0001583	missense	23272	exon22			GTTGCTGTATGTT	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.4291C>G	3.37:g.56658883G>C	ENSP00000417509:p.Gln1431Glu	Somatic	360.0	1.0		WXS	Illumina HiSeq	Phase_I	326.0	167.0	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279138	0.80692	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.53206	0.63;0.63;0.63	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000008	T	0.52613	0.1745	L	0.38838	1.175	0.47245	D	0.999367	P;B;D;B	0.61697	0.629;0.045;0.99;0.435	B;B;P;B	0.55011	0.382;0.094;0.766;0.104	T	0.54070	-0.8348	10	0.72032	D	0.01	-0.4466	14.6453	0.68756	0.0:0.0:0.8544:0.1456	.	1431;1370;994;1431	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	E	994;1431;1370	ENSP00000399410:Q994E;ENSP00000417509:Q1431E;ENSP00000347845:Q1370E	ENSP00000347845:Q1370E	Q	-	1	0	C3orf63	56633923	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.500000	0.81588	2.685000	0.91497	0.655000	0.94253	CAG	.		0.383	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
FAM217A	222826	hgsc.bcm.edu;bcgsc.ca	37	6	4070154	4070154	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:4070154C>A	ENST00000274673.3	-	7	706	c.303G>T	c.(301-303)agG>agT	p.R101S	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	101																	TTTTGAATTCCCtttaaaaaa	0.284																																					p.R101S		.											.	.	.	0			c.G303T						.						18.0	19.0	19.0					6																	4070154		2192	4267	6459	SO:0001630	splice_region_variant	222826	exon7			GAATTCCCTTTAA	BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.303-1G>T	6.37:g.4070154C>A		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	4.0	NM_173563	Q5JYK1	Missense_Mutation	SNP	ENST00000274673.3	37	CCDS4489.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535360	0.45176	.	.	ENSG00000145975	ENST00000274673;ENST00000470599;ENST00000498677	T	0.18016	2.24	5.54	4.66	0.58398	.	0.153207	0.43919	D	0.000515	T	0.05090	0.0136	N	0.24115	0.695	0.33064	D	0.534462	B	0.31931	0.347	B	0.31751	0.135	T	0.14504	-1.0470	10	0.87932	D	0	.	9.3285	0.38008	0.0:0.9029:0.0:0.0971	.	101	Q8IXS0	CF146_HUMAN	S	101;229;38	ENSP00000274673:R101S	ENSP00000274673:R101S	R	-	3	2	C6orf146	4015153	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.640000	0.37186	1.546000	0.49388	0.650000	0.86243	AGG	.		0.284	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352577.2	NM_173563	Missense_Mutation
FAM71E1	112703	hgsc.bcm.edu;bcgsc.ca	37	19	50971076	50971076	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:50971076A>G	ENST00000600100.1	-	4	914	c.550T>C	c.(550-552)Ttg>Ctg	p.L184L	FAM71E1_ENST00000595790.1_Silent_p.L168L			Q6IPT2	F71E1_HUMAN	family with sequence similarity 71, member E1	184										breast(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		ACGAACTTCAAGGGGAACAGC	0.637																																					p.L168L		.											.	FAM71E1	44	0			c.T502C						.						25.0	24.0	24.0					19																	50971076		2203	4300	6503	SO:0001819	synonymous_variant	112703	exon4			ACTTCAAGGGGAA		CCDS33081.1	19q13.33	2007-11-20				ENSG00000142530			25107	protein-coding gene	gene with protein product							Standard	XM_005258472		Approved		uc002psg.3	Q6IPT2		ENST00000600100.1:c.550T>C	19.37:g.50971076A>G		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_138411	Q96EJ5|Q9BSM9	Silent	SNP	ENST00000600100.1	37																																																																																				.		0.637	FAM71E1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464754.2		
FARP2	9855	hgsc.bcm.edu;bcgsc.ca	37	2	242432429	242432429	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:242432429T>C	ENST00000264042.3	+	25	3043	c.2873T>C	c.(2872-2874)tTg>tCg	p.L958S	STK25_ENST00000316586.4_3'UTR|STK25_ENST00000478403.1_5'Flank	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	958	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		AACTTCTGTTTGTTCTTCTAC	0.448																																					p.L958S		.											.	FARP2	93	0			c.T2873C						.						127.0	120.0	122.0					2																	242432429		2203	4300	6503	SO:0001583	missense	9855	exon25			TCTGTTTGTTCTT	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.2873T>C	2.37:g.242432429T>C	ENSP00000264042:p.Leu958Ser	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	37	CCDS33424.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216431	0.79352	.	.	ENSG00000006607	ENST00000264042	T	0.46819	0.86	4.88	4.88	0.63580	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000007	T	0.74176	0.3682	M	0.94063	3.49	0.80722	D	1	D	0.63880	0.993	D	0.63113	0.911	T	0.82446	-0.0453	10	0.87932	D	0	.	14.8099	0.69985	0.0:0.0:0.0:1.0	.	958	O94887	FARP2_HUMAN	S	958	ENSP00000264042:L958S	ENSP00000264042:L958S	L	+	2	0	FARP2	242081102	1.000000	0.71417	0.552000	0.28243	0.957000	0.61999	7.770000	0.85390	1.962000	0.57031	0.533000	0.62120	TTG	.		0.448	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
FAT3	120114	hgsc.bcm.edu;bcgsc.ca	37	11	92087868	92087868	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:92087868G>T	ENST00000298047.6	+	1	2607	c.2590G>T	c.(2590-2592)Ggt>Tgt	p.G864C	FAT3_ENST00000409404.2_Missense_Mutation_p.G864C|FAT3_ENST00000541502.1_Missense_Mutation_p.G864C|FAT3_ENST00000525166.1_Missense_Mutation_p.G714C			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	864	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGGTTCTAATGGTGAAGTGAC	0.408										TCGA Ovarian(4;0.039)																											p.G864C		.											.	FAT3	73	0			c.G2590T						.						94.0	91.0	92.0					11																	92087868		1948	4145	6093	SO:0001583	missense	120114	exon1			TCTAATGGTGAAG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2590G>T	11.37:g.92087868G>T	ENSP00000298047:p.Gly864Cys	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	17.59	3.426755	0.62733	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.54675	4.62;4.62;0.56;4.62	5.71	5.71	0.89125	.	.	.	.	.	D	0.82825	0.5121	H	0.96805	3.885	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.88238	0.2908	9	0.87932	D	0	.	18.8459	0.92205	0.0:0.0:1.0:0.0	.	864	Q8TDW7-3	.	C	864;864;864;714	ENSP00000298047:G864C;ENSP00000387040:G864C;ENSP00000443786:G864C;ENSP00000432586:G714C	ENSP00000298047:G864C	G	+	1	0	FAT3	91727516	1.000000	0.71417	0.843000	0.33291	0.978000	0.69477	9.787000	0.99055	2.700000	0.92200	0.467000	0.42956	GGT	.		0.408	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FBF1	85302	hgsc.bcm.edu;bcgsc.ca	37	17	73916127	73916127	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:73916127T>C	ENST00000586717.1	-	18	2123	c.1850A>G	c.(1849-1851)cAg>cGg	p.Q617R	FBF1_ENST00000389570.4_Missense_Mutation_p.Q617R|FBF1_ENST00000319129.5_Missense_Mutation_p.Q616R			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	617					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						TGCCTGGTGCTGCTGCTGCAG	0.652																																					p.Q616R		.											.	FBF1	205	0			c.A1847G						.						23.0	27.0	25.0					17																	73916127		1982	4165	6147	SO:0001583	missense	85302	exon18			TGGTGCTGCTGCT	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.1850A>G	17.37:g.73916127T>C	ENSP00000465132:p.Gln617Arg	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	5.0	NM_001080542	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000586717.1	37		.	.	.	.	.	.	.	.	.	.	T	0.008	-1.929620	0.00488	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.15487	2.42;2.43	5.15	0.435	0.16544	.	.	.	.	.	T	0.04770	0.0129	N	0.01454	-0.855	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.0;0.001;0.002	T	0.41251	-0.9519	9	0.02654	T	1	-5.5969	9.2857	0.37755	0.0:0.6645:0.0:0.3355	.	631;617;616	Q8TES7-6;Q8TES7;A6NLR5	.;FBF1_HUMAN;.	R	617;617;616;630	ENSP00000374221:Q617R;ENSP00000324292:Q616R	ENSP00000324292:Q616R	Q	-	2	0	FBF1	71427722	0.033000	0.19621	0.393000	0.26258	0.099000	0.18886	0.456000	0.21859	0.104000	0.17725	-0.408000	0.06270	CAG	.		0.652	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	
FBLN1	2192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	45943008	45943008	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:45943008C>T	ENST00000327858.6	+	12	1460	c.1365C>T	c.(1363-1365)gcC>gcT	p.A455A	FBLN1_ENST00000402984.3_Silent_p.A493A|FBLN1_ENST00000476366.1_3'UTR|FBLN1_ENST00000262722.7_Silent_p.A455A|FBLN1_ENST00000340923.5_Silent_p.A455A|FBLN1_ENST00000442170.2_Silent_p.A455A|FBLN1_ENST00000348697.2_Silent_p.A455A	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	455	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		AGGAGTGTGCCAACGTCTACG	0.587																																					p.A455A		.											.	FBLN1	515	0			c.C1365T						.						102.0	82.0	89.0					22																	45943008		2203	4300	6503	SO:0001819	synonymous_variant	2192	exon12			GTGTGCCAACGTC		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1365C>T	22.37:g.45943008C>T		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	33.0	NM_006487	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Silent	SNP	ENST00000327858.6	37	CCDS14067.1																																																																																			.		0.587	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	127704892	127704892	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:127704892C>T	ENST00000508053.1	-	22	3205	c.2231G>A	c.(2230-2232)tGc>tAc	p.C744Y	FBN2_ENST00000262464.4_Missense_Mutation_p.C744Y|Y_RNA_ENST00000384560.1_RNA|FBN2_ENST00000508989.1_Missense_Mutation_p.C711Y|FBN2_ENST00000511489.1_5'UTR			P35556	FBN2_HUMAN	fibrillin 2	744	TB 3.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TTTTGCAGGGCATGGCTGGCA	0.463																																					p.C744Y		.											.	FBN2	146	0			c.G2231A						.						108.0	101.0	103.0					5																	127704892		2203	4300	6503	SO:0001583	missense	2201	exon16			GCAGGGCATGGCT	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2231G>A	5.37:g.127704892C>T	ENSP00000424571:p.Cys744Tyr	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	15.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466836	0.84425	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.99875	-7.4;-7.4;-7.4	4.57	4.57	0.56435	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.64402	D	0.000001	D	0.99880	0.9943	M	0.90252	3.1	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.996	D	0.96462	0.9342	10	0.72032	D	0.01	.	18.667	0.91493	0.0:1.0:0.0:0.0	.	711;744	D6RJI3;P35556	.;FBN2_HUMAN	Y	744;744;711	ENSP00000262464:C744Y;ENSP00000424571:C744Y;ENSP00000425596:C711Y	ENSP00000262464:C744Y	C	-	2	0	FBN2	127732791	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.609000	0.82925	2.824000	0.97209	0.655000	0.94253	TGC	.		0.463	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FCGBP	8857	hgsc.bcm.edu;bcgsc.ca	37	19	40440523	40440523	+	Start_Codon_SNP	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:40440523C>A	ENST00000221347.6	-	1	10	c.3G>T	c.(1-3)atG>atT	p.M1I		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			ATAGGGCACCCATGGCTGCAG	0.567																																					p.M1I		.											.	FCGBP	98	0			c.G3T						.						67.0	53.0	58.0					19																	40440523		2201	4299	6500	SO:0001582	initiator_codon_variant	8857	exon1			GGCACCCATGGCT	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.3G>T	19.37:g.40440523C>A	ENSP00000221347:p.Met1Ile	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710422	0.30322	.	.	ENSG00000090920	ENST00000221347	T	0.17370	2.28	4.86	4.86	0.63082	.	0.414207	0.19677	U	0.108616	T	0.38214	0.1032	.	.	.	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.08207	-1.0733	9	0.87932	D	0	.	13.7062	0.62641	0.0:1.0:0.0:0.0	.	1	Q9Y6R7	FCGBP_HUMAN	I	1	ENSP00000221347:M1I	ENSP00000221347:M1I	M	-	3	0	FCGBP	45132363	1.000000	0.71417	1.000000	0.80357	0.213000	0.24496	2.029000	0.41098	2.684000	0.91462	0.650000	0.86243	ATG	.		0.567	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	Missense_Mutation
FETUB	26998	hgsc.bcm.edu;bcgsc.ca	37	3	186358341	186358341	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:186358341T>C	ENST00000265029.3	+	1	193	c.92T>C	c.(91-93)cTg>cCg	p.L31P	FETUB_ENST00000450521.1_Missense_Mutation_p.L31P|RP11-134F2.2_ENST00000428501.1_RNA|RP11-134F2.2_ENST00000455926.1_RNA|FETUB_ENST00000488561.1_3'UTR|FETUB_ENST00000539949.1_Intron|FETUB_ENST00000382136.3_Missense_Mutation_p.L31P|FETUB_ENST00000382134.3_Missense_Mutation_p.L31P	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	31	Cystatin fetuin-B-type 1. {ECO:0000255|PROSITE-ProRule:PRU00862}.				binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		CCCTCGGCTCTGCTCTCCCGG	0.582																																					p.L31P		.											.	FETUB	92	0			c.T92C						.						159.0	165.0	163.0					3																	186358341		2203	4300	6503	SO:0001583	missense	26998	exon1			CGGCTCTGCTCTC	AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.92T>C	3.37:g.186358341T>C	ENSP00000265029:p.Leu31Pro	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	6.0	NM_014375	B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Missense_Mutation	SNP	ENST00000265029.3	37	CCDS3279.1	.	.	.	.	.	.	.	.	.	.	T	11.07	1.531121	0.27387	.	.	ENSG00000090512	ENST00000450521;ENST00000265029;ENST00000382134;ENST00000382136	T;T;T;T	0.17213	2.69;2.69;2.9;2.29	4.17	0.513	0.17000	Proteinase inhibitor I25, cystatin (1);	1.282600	0.05444	N	0.548118	T	0.24661	0.0598	M	0.75447	2.3	0.09310	N	1	B;B;B	0.29481	0.105;0.005;0.245	B;B;B	0.35039	0.042;0.008;0.194	T	0.40739	-0.9547	10	0.87932	D	0	-0.575	6.0607	0.19837	0.0:0.3217:0.0:0.6783	.	31;31;31	E9PG06;E9PG08;Q9UGM5	.;.;FETUB_HUMAN	P	31	ENSP00000404288:L31P;ENSP00000265029:L31P;ENSP00000371569:L31P;ENSP00000371571:L31P	ENSP00000265029:L31P	L	+	2	0	FETUB	187841035	0.004000	0.15560	0.000000	0.03702	0.011000	0.07611	1.566000	0.36396	0.087000	0.17167	0.533000	0.62120	CTG	.		0.582	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1	NM_014375	
FRAS1	80144	hgsc.bcm.edu;bcgsc.ca	37	4	79455681	79455681	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:79455681C>A	ENST00000264895.6	+	71	11444	c.11004C>A	c.(11002-11004)ctC>ctA	p.L3668L		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3664					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AATTTCAGCTCTGCAATAATG	0.418																																					p.L3668L		.											.	FRAS1	68	0			c.C11004A						.						169.0	153.0	158.0					4																	79455681		1907	4119	6026	SO:0001819	synonymous_variant	80144	exon71			TCAGCTCTGCAAT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11004C>A	4.37:g.79455681C>A		Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000264895.6	37	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	C	8.382	0.837726	0.16891	.	.	ENSG00000138759	ENST00000512123	T	0.66995	-0.24	5.29	1.07	0.20283	.	0.000000	0.64402	D	0.000003	T	0.69744	0.3145	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69339	-0.5171	7	0.87932	D	0	.	7.3831	0.26868	0.1098:0.4326:0.3864:0.0711	.	.	.	.	M	1897	ENSP00000422834:L1897M	ENSP00000422834:L1897M	L	+	1	2	FRAS1	79674705	0.945000	0.32115	1.000000	0.80357	0.995000	0.86356	0.050000	0.14120	0.542000	0.28846	0.591000	0.81541	CTG	.		0.418	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
FXYD6	53826	hgsc.bcm.edu;bcgsc.ca	37	11	117712509	117712509	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:117712509G>T	ENST00000526014.1	-	4	764	c.169C>A	c.(169-171)Cta>Ata	p.L57I	FXYD6_ENST00000583233.1_5'UTR|FXYD6_ENST00000584230.1_Missense_Mutation_p.L57I|FXYD6_ENST00000527717.1_Missense_Mutation_p.L57I|FXYD6_ENST00000524656.1_Missense_Mutation_p.L57I|FXYD6_ENST00000529335.2_Missense_Mutation_p.L56I|FXYD6_ENST00000584394.1_Missense_Mutation_p.L57I|FXYD6_ENST00000540359.1_Missense_Mutation_p.L57I|FXYD6_ENST00000527429.1_Missense_Mutation_p.L57I|FXYD6_ENST00000260282.4_Missense_Mutation_p.L57I|FXYD6_ENST00000530956.1_Missense_Mutation_p.L57I|RP11-728F11.4_ENST00000581173.2_RNA|FXYD6-FXYD2_ENST00000532984.1_Missense_Mutation_p.L57I|FXYD6_ENST00000539526.1_Missense_Mutation_p.L57I	NM_022003.3	NP_071286.1	Q9H0Q3	FXYD6_HUMAN	FXYD domain containing ion transport regulator 6	57					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)			central_nervous_system(1)|large_intestine(5)|lung(1)|skin(1)	8	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.89e-05)|Epithelial(105;0.00122)		AACTTACTTAGGATAAGGAGG	0.527																																					p.L57I		.											.	.	.	0			c.C169A						.						106.0	100.0	102.0					11																	117712509		2201	4296	6497	SO:0001583	missense	100533181	exon4			TACTTAGGATAAG	BC093040	CCDS8387.1	11q23.3	2010-04-14	2002-01-14		ENSG00000137726	ENSG00000137726			4030	protein-coding gene	gene with protein product	"""phosphohippolin"""	606683	"""FXYD domain-containing ion transport regulator 6"""			10950925	Standard	NM_022003		Approved			Q9H0Q3		ENST00000526014.1:c.169C>A	11.37:g.117712509G>T	ENSP00000433312:p.Leu57Ile	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	5.0	NM_001243598	A8K0R4|J3QLD2|Q6FIG9|Q6UW52	Missense_Mutation	SNP	ENST00000526014.1	37	CCDS8387.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.253512	0.59212	.	.	ENSG00000137726	ENST00000540359;ENST00000539526;ENST00000260282;ENST00000527717;ENST00000526014;ENST00000524656;ENST00000529335	T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.42	4.51	0.55191	.	.	.	.	.	D	0.82360	0.5020	.	.	.	0.51767	D	0.999933	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.83361	0.0002	8	0.62326	D	0.03	.	10.4055	0.44254	0.0904:0.0:0.9096:0.0	.	57;57	E9PJ02;Q9H0Q3	.;FXYD6_HUMAN	I	57;57;57;57;57;57;56	ENSP00000444243:L57I;ENSP00000442756:L57I;ENSP00000260282:L57I;ENSP00000431446:L57I;ENSP00000433312:L57I;ENSP00000431427:L57I;ENSP00000436629:L56I	ENSP00000260282:L57I	L	-	1	2	FXYD6	117217719	1.000000	0.71417	0.933000	0.37362	0.483000	0.33249	4.120000	0.57897	1.282000	0.44496	-0.126000	0.14955	CTA	.		0.527	FXYD6-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392307.1	NM_022003	
FYN	2534	hgsc.bcm.edu;bcgsc.ca	37	6	112021440	112021440	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:112021440T>C	ENST00000354650.3	-	9	1335	c.729A>G	c.(727-729)gtA>gtG	p.V243V	FYN_ENST00000368682.3_Intron|FYN_ENST00000356013.2_Intron|FYN_ENST00000229471.4_Intron|FYN_ENST00000538466.1_Intron|FYN_ENST00000368667.2_Silent_p.V243V|FYN_ENST00000368678.4_Intron|FYN_ENST00000476769.2_5'UTR|FYN_ENST00000229470.5_Intron	NM_002037.5	NP_002028.1	P06241	FYN_HUMAN	FYN proto-oncogene, Src family tyrosine kinase	243	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.		V -> L (in a lung squamous cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		activated T cell proliferation (GO:0050798)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular response to peptide hormone stimulus (GO:0071375)|dendrite morphogenesis (GO:0048813)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|feeding behavior (GO:0007631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|leukocyte migration (GO:0050900)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein localization to nucleus (GO:1900182)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|glycoprotein binding (GO:0001948)|growth factor receptor binding (GO:0070851)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(17)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	30		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	GACAGGGAACTACTAGGCGGC	0.517																																					p.V243V		.											FYN,NS,carcinoma,-2	FYN	1000	0			c.A729G						.						101.0	94.0	96.0					6																	112021440		2203	4300	6503	SO:0001819	synonymous_variant	2534	exon9			GGGAACTACTAGG	AK056699	CCDS5094.1, CCDS5095.1, CCDS5096.1	6q21	2014-06-25	2014-06-25		ENSG00000010810	ENSG00000010810		"""SH2 domain containing"""	4037	protein-coding gene	gene with protein product		137025	"""FYN oncogene related to SRC, FGR, YES"""			3526330	Standard	NM_002037		Approved	SYN, SLK, MGC45350	uc003pvh.3	P06241	OTTHUMG00000016305	ENST00000354650.3:c.729A>G	6.37:g.112021440T>C		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	4.0	NM_002037	B5BU57|E1P557|H0UI48|Q16248|Q5R3A6|Q5R3A7|Q8N5D7	Silent	SNP	ENST00000354650.3	37	CCDS5094.1																																																																																			.		0.517	FYN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043655.1		
GALNT13	114805	hgsc.bcm.edu;bcgsc.ca	37	2	155295139	155295139	+	Silent	SNP	C	C	A	rs182009673		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:155295139C>A	ENST00000392825.3	+	12	1998	c.1431C>A	c.(1429-1431)acC>acA	p.T477T	AC009227.2_ENST00000434635.1_RNA|GALNT13_ENST00000487047.1_3'UTR|GALNT13_ENST00000409237.1_Silent_p.T477T	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	477	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						AAATCCGAACCGATGACTTGT	0.343																																					p.T477T		.											.	GALNT13	95	0			c.C1431A						.						124.0	123.0	124.0					2																	155295139		2203	4300	6503	SO:0001819	synonymous_variant	114805	exon12			CCGAACCGATGAC	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1431C>A	2.37:g.155295139C>A		Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	5.0	NM_052917	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Silent	SNP	ENST00000392825.3	37	CCDS2199.1																																																																																			C|0.999;T|0.001		0.343	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917	
GAS2L2	246176	hgsc.bcm.edu;bcgsc.ca	37	17	34074044	34074044	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:34074044G>T	ENST00000254466.6	-	5	1103	c.1076C>A	c.(1075-1077)cCa>cAa	p.P359Q	GAS2L2_ENST00000587565.1_Missense_Mutation_p.P343Q	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	359					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCTCAGGAATGGTGCCATCTC	0.587																																					p.P359Q		.											.	GAS2L2	227	0			c.C1076A						.						46.0	50.0	49.0					17																	34074044		2203	4300	6503	SO:0001583	missense	246176	exon5			AGGAATGGTGCCA	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1076C>A	17.37:g.34074044G>T	ENSP00000254466:p.Pro359Gln	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	5.0	NM_139285	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098403	0.37048	.	.	ENSG00000132139	ENST00000254466	T	0.19938	2.11	4.54	3.57	0.40892	.	0.492528	0.18269	N	0.146396	T	0.22704	0.0548	L	0.56769	1.78	0.09310	N	1	P	0.44578	0.838	B	0.42422	0.387	T	0.11397	-1.0589	10	0.66056	D	0.02	-0.9574	8.404	0.32603	0.1065:0.0:0.8935:0.0	.	359	Q8NHY3	GA2L2_HUMAN	Q	359	ENSP00000254466:P359Q	ENSP00000254466:P359Q	P	-	2	0	GAS2L2	31098157	0.031000	0.19500	0.001000	0.08648	0.259000	0.26198	2.704000	0.47118	1.264000	0.44198	0.313000	0.20887	CCA	.		0.587	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
GBP6	163351	hgsc.bcm.edu;bcgsc.ca	37	1	89843997	89843997	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:89843997A>G	ENST00000370456.4	+	5	543	c.450A>G	c.(448-450)gaA>gaG	p.E150E	GBP6_ENST00000535065.1_Silent_p.E20E	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	150	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		AGCTCACAGAACTAATTAAGG	0.403																																					p.E150E		.											.	GBP6	92	0			c.A450G						.						111.0	119.0	117.0					1																	89843997		2203	4300	6503	SO:0001819	synonymous_variant	163351	exon5			CACAGAACTAATT	BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.450A>G	1.37:g.89843997A>G		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_198460	A2RRM3|Q6ZN86|Q7Z3F0	Silent	SNP	ENST00000370456.4	37	CCDS723.1																																																																																			.		0.403	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028001.1	NM_198460	
GFM1	85476	hgsc.bcm.edu;bcgsc.ca	37	3	158364696	158364696	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:158364696C>A	ENST00000486715.1	+	4	889	c.532C>A	c.(532-534)Cga>Aga	p.R178R	GFM1_ENST00000264263.5_Silent_p.R178R|GFM1_ENST00000478576.1_Silent_p.R178R	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CAAATTGGACCGAATGGGCTC	0.463																																					p.R178R		.											.	GFM1	93	0			c.C532A						.						83.0	80.0	81.0					3																	158364696		2203	4300	6503	SO:0001819	synonymous_variant	85476	exon4			TTGGACCGAATGG	AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.532C>A	3.37:g.158364696C>A		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	4.0	NM_024996		Silent	SNP	ENST00000486715.1	37	CCDS33885.1																																																																																			.		0.463	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996	
GFRA1	2674	hgsc.bcm.edu;bcgsc.ca	37	10	117853332	117853332	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr10:117853332G>T	ENST00000355422.6	-	8	1446	c.896C>A	c.(895-897)cCc>cAc	p.P299H	GFRA1_ENST00000369236.1_Missense_Mutation_p.P294H|GFRA1_ENST00000544592.1_Missense_Mutation_p.P178H|GFRA1_ENST00000439649.3_Missense_Mutation_p.P294H	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	299					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		TATGTAGTTGGGGGTCATGAC	0.423																																					p.P299H	Ovarian(128;329 1725 45498 46808 50759)	.											.	GFRA1	93	0			c.C896A						.						80.0	77.0	78.0					10																	117853332		2203	4300	6503	SO:0001583	missense	2674	exon8			TAGTTGGGGGTCA	AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.896C>A	10.37:g.117853332G>T	ENSP00000347591:p.Pro299His	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	5.0	NM_005264	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719313	0.89205	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.65916	-0.18;-0.18	5.98	5.98	0.97165	GDNF/GAS1 (2);	0.000000	0.85682	D	0.000000	D	0.83344	0.5234	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84862	0.0820	10	0.87932	D	0	-27.5613	20.4366	0.99092	0.0:0.0:1.0:0.0	.	299;294	P56159;P56159-2	GFRA1_HUMAN;.	H	299;294;294;178;294	ENSP00000358239:P294H;ENSP00000442179:P178H	ENSP00000347591:P294H	P	-	2	0	GFRA1	117843322	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	9.033000	0.93741	2.837000	0.97791	0.591000	0.81541	CCC	.		0.423	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
GIT2	9815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	110390999	110390999	+	Silent	SNP	G	G	A	rs369471977		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:110390999G>A	ENST00000355312.3	-	13	1139	c.1140C>T	c.(1138-1140)caC>caT	p.H380H	GIT2_ENST00000547815.1_Silent_p.H380H|GIT2_ENST00000553118.1_Silent_p.H380H|GIT2_ENST00000360185.4_Silent_p.H380H|GIT2_ENST00000356259.4_Silent_p.H380H|GIT2_ENST00000457474.2_Silent_p.H382H|GIT2_ENST00000338373.5_Silent_p.H380H|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000343646.5_Intron|GIT2_ENST00000551209.1_Silent_p.H379H|GIT2_ENST00000361006.5_Silent_p.H380H|GIT2_ENST00000354574.4_Silent_p.H382H|GIT2_ENST00000320063.9_Silent_p.H380H	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	380					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						TCTCAACGCTGTGCTGGTTAT	0.418																																					p.H382H		.											.	GIT2	226	0			c.C1146T						.	G	,,,,,	0,4406		0,0,2203	244.0	207.0	220.0		1146,1140,1140,1140,1140,1140	5.2	1.0	12		220	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	GIT2	NM_001135213.1,NM_001135214.1,NM_014776.3,NM_057169.3,NM_057170.3,NM_139201.2	,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,	382/682,380/730,380/680,380/760,380/632,380/472	110390999	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9815	exon14			AACGCTGTGCTGG	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.1140C>T	12.37:g.110390999G>A		Somatic	448.0	0.0		WXS	Illumina HiSeq	Phase_I	467.0	195.0	NM_001135213	Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Silent	SNP	ENST00000355312.3	37	CCDS9138.1																																																																																			.		0.418	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	NM_057169	
GLE1	2733	hgsc.bcm.edu;bcgsc.ca	37	9	131277857	131277857	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:131277857G>T	ENST00000309971.4	+	3	477	c.371G>T	c.(370-372)cGg>cTg	p.R124L	GLE1_ENST00000539582.1_5'UTR|GLE1_ENST00000372770.4_Missense_Mutation_p.R124L	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	124					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						CAGTCCTCACGGGGGATCAAA	0.428																																					p.R124L		.											.	GLE1	22	0			c.G371T						.						68.0	58.0	61.0					9																	131277857		2203	4300	6503	SO:0001583	missense	2733	exon3			CCTCACGGGGGAT	AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.371G>T	9.37:g.131277857G>T	ENSP00000308622:p.Arg124Leu	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	4.0	NM_001499	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Missense_Mutation	SNP	ENST00000309971.4	37	CCDS35154.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.524413	0.64747	.	.	ENSG00000119392	ENST00000309971;ENST00000372770	T;T	0.68903	-0.36;0.05	5.16	4.26	0.50523	.	0.178384	0.47455	D	0.000240	T	0.62853	0.2462	L	0.58101	1.795	0.58432	D	0.999999	P;P	0.44627	0.752;0.839	B;P	0.45276	0.283;0.475	T	0.59500	-0.7443	10	0.29301	T	0.29	-10.662	8.2898	0.31950	0.1817:0.0:0.8183:0.0	.	124;124	Q53GS7;Q53GS7-2	GLE1_HUMAN;.	L	124	ENSP00000308622:R124L;ENSP00000361856:R124L	ENSP00000308622:R124L	R	+	2	0	GLE1	130317678	1.000000	0.71417	0.904000	0.35570	0.879000	0.50718	2.922000	0.48860	1.185000	0.42971	0.313000	0.20887	CGG	.		0.428	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054456.1	NM_001003722	
GPIHBP1	338328	hgsc.bcm.edu;bcgsc.ca	37	8	144296897	144296897	+	Missense_Mutation	SNP	G	G	T	rs578073937		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr8:144296897G>T	ENST00000330824.2	+	3	266	c.191G>T	c.(190-192)cGg>cTg	p.R64L		NM_178172.3	NP_835466.1	Q8IV16	HDBP1_HUMAN	glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1	64	UPAR/Ly6.				cholesterol homeostasis (GO:0042632)|intracellular protein transport (GO:0006886)|positive regulation of chylomicron remnant clearance (GO:0090321)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein import (GO:0017038)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|protein transmembrane transport (GO:0071806)|response to heparin (GO:0071503)|transcytosis (GO:0045056)|triglyceride homeostasis (GO:0070328)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|external side of plasma membrane (GO:0009897)|high-density lipoprotein particle (GO:0034364)	chylomicron binding (GO:0035478)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|protein transmembrane transporter activity (GO:0008320)			lung(2)	2	all_cancers(97;6.49e-11)|all_epithelial(106;2.77e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GTGCTGCTGCGGTGCTACACC	0.672																																					p.R64L		.											.	GPIHBP1	68	0			c.G191T						.						42.0	31.0	35.0					8																	144296897		2183	4269	6452	SO:0001583	missense	338328	exon3			TGCTGCGGTGCTA	AF088057	CCDS34954.1	8q24.3	2014-07-14	2008-02-07						24945	protein-coding gene	gene with protein product	"""endothelial cell LPL transporter"""	612757	"""GPI anchored high density lipoprotein binding protein 1"""			12496272, 17883852, 17620854, 17403372	Standard	NM_178172		Approved	LOC338328, GPI-HBP1	uc003yxu.2	Q8IV16		ENST00000330824.2:c.191G>T	8.37:g.144296897G>T	ENSP00000329266:p.Arg64Leu	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	6.0	NM_178172	Q6P3T2|Q86W15	Missense_Mutation	SNP	ENST00000330824.2	37	CCDS34954.1	.	.	.	.	.	.	.	.	.	.	g	11.57	1.679548	0.29783	.	.	ENSG00000182851	ENST00000330824	T	0.77098	-1.07	3.95	-6.09	0.02145	Ly-6 antigen / uPA receptor -like (1);	1.872550	0.03244	N	0.180936	T	0.67173	0.2865	L	0.51422	1.61	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.51309	-0.8722	10	0.59425	D	0.04	-16.5311	3.1887	0.06609	0.5921:0.1332:0.141:0.1337	.	64	Q8IV16	HDBP1_HUMAN	L	64	ENSP00000329266:R64L	ENSP00000329266:R64L	R	+	2	0	GPIHBP1	144368272	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.697000	0.01910	-1.253000	0.02488	0.450000	0.29827	CGG	.		0.672	GPIHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381113.1	NM_178172	
GRIA4	2893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	105781253	105781253	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:105781253G>T	ENST00000530497.1	+	9	1251	c.1251G>T	c.(1249-1251)gtG>gtT	p.V417V	GRIA4_ENST00000525187.1_Silent_p.V417V|GRIA4_ENST00000393127.2_Silent_p.V417V|GRIA4_ENST00000282499.5_Silent_p.V417V|GRIA4_ENST00000393125.2_Silent_p.V417V|GRIA4_ENST00000428631.2_Silent_p.V417V			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	417					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ACAGAACAGTGGTTGTAACCA	0.438																																					p.V417V		.											.	GRIA4	230	0			c.G1251T						.						260.0	201.0	221.0					11																	105781253		2202	4299	6501	SO:0001819	synonymous_variant	2893	exon10			AACAGTGGTTGTA	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1251G>T	11.37:g.105781253G>T		Somatic	209.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	49.0	NM_001077244	Q86XE8	Silent	SNP	ENST00000530497.1	37	CCDS8333.1																																																																																			.		0.438	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
GRIN2A	2903	hgsc.bcm.edu;bcgsc.ca	37	16	9857312	9857312	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:9857312G>T	ENST00000396573.2	-	14	4398	c.4089C>A	c.(4087-4089)tcC>tcA	p.S1363S	GRIN2A_ENST00000535259.1_Intron|GRIN2A_ENST00000396575.2_Silent_p.S1363S|GRIN2A_ENST00000404927.2_Intron|GRIN2A_ENST00000330684.3_Silent_p.S1363S|GRIN2A_ENST00000562109.1_Intron	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1363					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.S1363S(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AAGGGTTATCGGAGGTGTGGT	0.557																																					p.S1363S		.											.	GRIN2A	349	1	Substitution - coding silent(1)	lung(1)	c.C4089A						.						72.0	68.0	69.0					16																	9857312		2197	4300	6497	SO:0001819	synonymous_variant	2903	exon14			GTTATCGGAGGTG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.4089C>A	16.37:g.9857312G>T		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_000833	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																			.		0.557	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
GRIN2A	2903	hgsc.bcm.edu;bcgsc.ca	37	16	9862782	9862782	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:9862782A>G	ENST00000396573.2	-	13	2830	c.2521T>C	c.(2521-2523)Ttc>Ctc	p.F841L	GRIN2A_ENST00000535259.1_Missense_Mutation_p.F684L|GRIN2A_ENST00000396575.2_Missense_Mutation_p.F841L|GRIN2A_ENST00000404927.2_Missense_Mutation_p.F841L|GRIN2A_ENST00000330684.3_Missense_Mutation_p.F841L|GRIN2A_ENST00000562109.1_Missense_Mutation_p.F841L	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	841					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTCCAGTAGAAGAGGTGCTCC	0.582																																					p.F841L		.											.	GRIN2A	349	0			c.T2521C						.						93.0	81.0	85.0					16																	9862782		2197	4300	6497	SO:0001583	missense	2903	exon13			AGTAGAAGAGGTG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2521T>C	16.37:g.9862782A>G	ENSP00000379818:p.Phe841Leu	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_000833	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.862599	0.91511	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	4.3	4.3	0.51218	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64170	0.2574	M	0.80746	2.51	0.80722	D	1	D;D;D	0.64830	0.992;0.994;0.979	D;D;D	0.73708	0.968;0.981;0.973	T	0.67971	-0.5532	9	.	.	.	.	12.9416	0.58348	1.0:0.0:0.0:0.0	.	684;841;841	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	L	841;841;684;841;841	ENSP00000379818:F841L;ENSP00000385872:F841L;ENSP00000441572:F684L;ENSP00000332549:F841L;ENSP00000379820:F841L	.	F	-	1	0	GRIN2A	9770283	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.176000	0.94839	1.692000	0.51112	0.460000	0.39030	TTC	.		0.582	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
GRIN2A	2903	hgsc.bcm.edu;bcgsc.ca	37	16	9943750	9943750	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:9943750G>T	ENST00000396573.2	-	6	1500	c.1191C>A	c.(1189-1191)tcC>tcA	p.S397S	GRIN2A_ENST00000535259.1_Silent_p.S240S|GRIN2A_ENST00000396575.2_Silent_p.S397S|GRIN2A_ENST00000404927.2_Silent_p.S397S|GRIN2A_ENST00000330684.3_Silent_p.S397S|GRIN2A_ENST00000562109.1_Silent_p.S397S	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	397					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTCACAGTCGGAGAAGGACT	0.582																																					p.S397S		.											.	GRIN2A	349	0			c.C1191A						.						135.0	111.0	119.0					16																	9943750		2197	4300	6497	SO:0001819	synonymous_variant	2903	exon6			ACAGTCGGAGAAG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1191C>A	16.37:g.9943750G>T		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_000833	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																			.		0.582	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
GRM3	2913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	86415661	86415661	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:86415661G>C	ENST00000361669.2	+	3	1652	c.553G>C	c.(553-555)Gat>Cat	p.D185H	AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000439827.1_Missense_Mutation_p.D185H|GRM3_ENST00000546348.1_Intron|GRM3_ENST00000394720.2_Missense_Mutation_p.D183H|GRM3_ENST00000536043.1_Missense_Mutation_p.D57H|AC005009.2_ENST00000418031.1_RNA	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	185					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					GTCGCGCTATGATTACTTTGC	0.567																																					p.D185H	GBM(52;969 1098 3139 52280)	.											.	GRM3	528	0			c.G553C						.						132.0	126.0	128.0					7																	86415661		2203	4300	6503	SO:0001583	missense	2913	exon3			CGCTATGATTACT		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.553G>C	7.37:g.86415661G>C	ENSP00000355316:p.Asp185His	Somatic	294.0	0.0		WXS	Illumina HiSeq	Phase_I	224.0	89.0	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.565840	0.86439	.	.	ENSG00000198822	ENST00000361669;ENST00000454217;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17	5.83	5.83	0.93111	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.93993	0.8076	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	D	0.94127	0.7385	10	0.87932	D	0	.	19.122	0.93367	0.0:0.0:1.0:0.0	.	57;185;185	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	H	185;57;57;185;183	ENSP00000355316:D185H;ENSP00000405427:D57H;ENSP00000441407:D57H;ENSP00000398767:D185H;ENSP00000378209:D183H	ENSP00000355316:D185H	D	+	1	0	GRM3	86253597	1.000000	0.71417	0.994000	0.49952	0.968000	0.65278	9.756000	0.98918	2.770000	0.95276	0.655000	0.94253	GAT	.		0.567	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
GTF3C2	2976	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	27550059	27550059	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:27550059C>A	ENST00000359541.2	-	18	2931	c.2502G>T	c.(2500-2502)ctG>ctT	p.L834L	GTF3C2_ENST00000264720.3_Silent_p.L834L|MPV17_ENST00000357186.6_5'Flank			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	834					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAATAGCCTCCAGCTGCAGCC	0.537																																					p.N834N		.											.	GTF3C2	92	0			c.C2502T						.						73.0	61.0	65.0					2																	27550059		2203	4300	6503	SO:0001819	synonymous_variant	2976	exon19			AGCCTCCAGCTGC	D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.2502G>T	2.37:g.27550059C>A		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	4.0	NM_001521	D6W557|Q16632|Q9BWI7	Silent	SNP	ENST00000359541.2	37	CCDS1749.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	8.056|8.056	0.767092|0.767092	0.15983|0.15983	.|.	.|.	ENSG00000115207|ENSG00000115207	ENST00000457098|ENST00000431028;ENST00000454704;ENST00000415683	.|.	.|.	.|.	4.95|4.95	-5.06|-5.06	0.02946|0.02946	.|.	.|.	.|.	.|.	.|.	.|T	.|0.35941	.|0.0949	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.36040	.|-0.9764	.|4	.|.	.|.	.|.	-11.0966|-11.0966	1.2024|1.2024	0.01887|0.01887	0.3202:0.2795:0.2405:0.1597|0.3202:0.2795:0.2405:0.1597	.|.	.|.	.|.	.|.	X|L	128|49;343;257	.|.	.|.	G|W	-|-	1|2	0|0	GTF3C2|GTF3C2	27403563|27403563	0.946000|0.946000	0.32159|0.32159	0.897000|0.897000	0.35233|0.35233	0.975000|0.975000	0.68041|0.68041	-0.216000|-0.216000	0.09266|0.09266	-1.068000|-1.068000	0.03156|0.03156	-0.881000|-0.881000	0.02953|0.02953	GGA|TGG	.		0.537	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2		
GYG2	8908	hgsc.bcm.edu;bcgsc.ca	37	X	2774545	2774545	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:2774545A>G	ENST00000381163.3	+	7	869	c.587A>G	c.(586-588)gAc>gGc	p.D196G	GYG2_ENST00000398806.3_Missense_Mutation_p.D165G|GYG2_ENST00000381161.1_3'UTR|GYG2_ENST00000542787.1_Missense_Mutation_p.D196G|GYG2_ENST00000338623.5_Missense_Mutation_p.D196G|GYG2-AS1_ENST00000445107.1_RNA	NM_001079855.1|NM_001184702.1|NM_003918.2	NP_001073324.1|NP_001171631.1|NP_003909.2	O15488	GLYG2_HUMAN	glycogenin 2	196					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	glycogenin glucosyltransferase activity (GO:0008466)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GTAGGGGCAGACCAAGGCTTA	0.448																																					p.D196G		.											.	GYG2	132	0			c.A587G						.						114.0	93.0	100.0					X																	2774545		2203	4299	6502	SO:0001583	missense	8908	exon7			GGGCAGACCAAGG	U94361	CCDS14121.1, CCDS48074.1	Xp22.3	2013-02-22			ENSG00000056998	ENSG00000056998	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4700	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	300198				9857012	Standard	NM_001079855		Approved	GN-2	uc004cqs.1	O15488	OTTHUMG00000021079	ENST00000381163.3:c.587A>G	X.37:g.2774545A>G	ENSP00000370555:p.Asp196Gly	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_003918	B7WNN6|O15485|O15486|O15487|O15489|O15490	Missense_Mutation	SNP	ENST00000381163.3	37	CCDS14121.1	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204566	0.38905	.	.	ENSG00000056998	ENST00000398806;ENST00000381163;ENST00000338623;ENST00000542787	T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48	3.34	3.34	0.38264	.	0.000000	0.64402	D	0.000020	D	0.92974	0.7764	H	0.98629	4.285	0.51482	D	0.999926	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.94089	0.7351	10	0.87932	D	0	.	11.4252	0.50007	1.0:0.0:0.0:0.0	.	196;196;156;165;165;196	O15488-6;O15488-4;O15488-3;A8K8Y1;O15488-2;O15488	.;.;.;.;.;GLYG2_HUMAN	G	165;196;196;196	ENSP00000381786:D165G;ENSP00000370555:D196G;ENSP00000341273:D196G;ENSP00000446092:D196G	ENSP00000341273:D196G	D	+	2	0	GYG2	2784545	1.000000	0.71417	0.145000	0.22337	0.006000	0.05464	7.242000	0.78210	1.191000	0.43056	0.425000	0.28330	GAC	.		0.448	GYG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055645.1	NM_003918	
HCRTR1	3061	hgsc.bcm.edu;bcgsc.ca	37	1	32087137	32087137	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:32087137C>T	ENST00000373706.5	+	4	835	c.682C>T	c.(682-684)Ctg>Ttg	p.L228L	HCRTR1_ENST00000403528.2_Silent_p.L228L|HCRTR1_ENST00000468521.1_3'UTR|HCRTR1_ENST00000373705.1_Silent_p.L228L			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	228					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CCTGGCCCCACTGGGCCTCAT	0.582																																					p.L228L		.											.	HCRTR1	523	0			c.C682T						.						166.0	164.0	165.0					1																	32087137		2203	4300	6503	SO:0001819	synonymous_variant	3061	exon6			GCCCCACTGGGCC	AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.682C>T	1.37:g.32087137C>T		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_001525	A8K3A6|Q9HBV6	Silent	SNP	ENST00000373706.5	37	CCDS344.1																																																																																			.		0.582	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	NM_001525	
HERC1	8925	hgsc.bcm.edu;bcgsc.ca	37	15	63916007	63916007	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:63916007G>T	ENST00000443617.2	-	73	13615	c.13528C>A	c.(13528-13530)Cga>Aga	p.R4510R		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4510	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TTCCACGCTCGGGAAGGCAGG	0.483																																					p.R4510R		.											.	HERC1	666	0			c.C13528A						.						95.0	96.0	96.0					15																	63916007		2024	4174	6198	SO:0001819	synonymous_variant	8925	exon73			ACGCTCGGGAAGG	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.13528C>A	15.37:g.63916007G>T		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	4.0	NM_003922	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1																																																																																			.		0.483	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
HNF1B	6928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	36091619	36091619	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:36091619G>A	ENST00000225893.4	-	4	1373	c.1012C>T	c.(1012-1014)Cag>Tag	p.Q338*	HNF1B_ENST00000561193.1_Nonsense_Mutation_p.Q312*|HNF1B_ENST00000427275.2_Nonsense_Mutation_p.Q312*|HNF1B_ENST00000560016.1_Nonsense_Mutation_p.Q338*	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	338					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			GAGCTGGGCTGGTGGTGGGGG	0.592																																					p.Q338X	Colon(71;102 1179 9001 27917 43397)	.											.	HNF1B	71	0			c.C1012T						.						78.0	60.0	66.0					17																	36091619		2203	4300	6503	SO:0001587	stop_gained	6928	exon4			TGGGCTGGTGGTG	BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.1012C>T	17.37:g.36091619G>A	ENSP00000225893:p.Gln338*	Somatic	421.0	0.0		WXS	Illumina HiSeq	Phase_I	431.0	174.0	NM_000458	B4DKM3|E0YMJ9	Nonsense_Mutation	SNP	ENST00000225893.4	37	CCDS11324.1	.	.	.	.	.	.	.	.	.	.	G	38	7.176410	0.98114	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	.	.	.	5.2	5.2	0.72013	.	0.163295	0.56097	D	0.000039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-1.8848	17.4606	0.87619	0.0:0.0:1.0:0.0	.	.	.	.	X	338;312;338;226	.	ENSP00000225893:Q338X	Q	-	1	0	HNF1B	33165732	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.155000	0.94700	2.713000	0.92767	0.650000	0.86243	CAG	.		0.592	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3	NM_000458	
HOXA11	3207	hgsc.bcm.edu;bcgsc.ca	37	7	27222608	27222608	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:27222608T>C	ENST00000006015.3	-	2	820	c.749A>G	c.(748-750)aAg>aGg	p.K250R	RP1-170O19.20_ENST00000470747.4_5'Flank|HOXA11-AS_ENST00000520395.1_RNA|HOXA10_ENST00000396344.4_5'Flank|HOXA11-AS_ENST00000522863.1_RNA|HOXA11-AS_ENST00000520360.1_RNA|HOXA11-AS_ENST00000522674.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11	250					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						GATCTGGTACTTGGTATAGGG	0.572			T	NUP98	CML																																p.K250R		.		Dom	yes		7	7p15-p14.2	3207	homeo box A11		L	.	HOXA11	1082	0			c.A749G						.						89.0	86.0	87.0					7																	27222608		2203	4300	6503	SO:0001583	missense	3207	exon2			TGGTACTTGGTAT		CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437	ENST00000006015.3:c.749A>G	7.37:g.27222608T>C	ENSP00000006015:p.Lys250Arg	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_005523	A4D190	Missense_Mutation	SNP	ENST00000006015.3	37	CCDS5411.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.7|28.7	4.946108|4.946108	0.92593|0.92593	.|.	.|.	ENSG00000005073|ENSG00000005073	ENST00000006015|ENST00000517402	D|.	0.96334|.	-3.98|.	5.91|5.91	5.91|5.91	0.95273|0.95273	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60779|0.60779	0.2295|0.2295	L|L	0.39245|0.39245	1.2|1.2	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	T|T	0.56739|0.56739	-0.7929|-0.7929	10|5	0.87932|.	D|.	0|.	.|.	16.3512|16.3512	0.83208|0.83208	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	250|.	P31270|.	HXA11_HUMAN|.	R|G	250|220	ENSP00000006015:K250R|.	ENSP00000006015:K250R|.	K|S	-|-	2|1	0|0	HOXA11|HOXA11	27189133|27189133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	8.040000|8.040000	0.89188|0.89188	2.266000|2.266000	0.75297|0.75297	0.533000|0.533000	0.62120|0.62120	AAG|AGT	.		0.572	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358754.1		
HPGD	3248	hgsc.bcm.edu;bcgsc.ca	37	4	175443106	175443106	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:175443106T>C	ENST00000296522.6	-	2	652	c.206A>G	c.(205-207)cAa>cGa	p.Q69R	HPGD_ENST00000296521.7_Missense_Mutation_p.Q69R|RP11-440I14.2_ENST00000515178.1_lincRNA|HPGD_ENST00000504433.1_Missense_Mutation_p.Q69R|HPGD_ENST00000542498.1_Missense_Mutation_p.Q69R|HPGD_ENST00000422112.2_Missense_Mutation_p.Q69R|HPGD_ENST00000510901.1_5'UTR|HPGD_ENST00000541923.1_5'UTR	NM_000860.5|NM_001145816.2|NM_001256301.1|NM_001256307.1	NP_000851.2|NP_001139288.1|NP_001243230.1|NP_001243236.1	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	69					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|ductus arteriosus closure (GO:0097070)|female pregnancy (GO:0007565)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|ovulation (GO:0030728)|parturition (GO:0007567)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|thrombin receptor signaling pathway (GO:0070493)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|catalytic activity (GO:0003824)|NAD binding (GO:0051287)|NAD+ binding (GO:0070403)|prostaglandin E receptor activity (GO:0004957)|protein homodimerization activity (GO:0042803)			kidney(1)|lung(3)|prostate(3)	7		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)		TCTCAGTTGTTGCTGGTCAGC	0.537																																					p.Q69R		.											.	HPGD	90	0			c.A206G						.						175.0	175.0	175.0					4																	175443106		2203	4300	6503	SO:0001583	missense	3248	exon2			AGTTGTTGCTGGT		CCDS3821.1, CCDS54821.1, CCDS58933.1, CCDS58934.1, CCDS58935.1	4q34-q35	2011-09-14			ENSG00000164120	ENSG00000164120	1.1.1.141	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	5154	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 36C, member 1"""	601688				19027726	Standard	NM_000860		Approved	SDR36C1	uc003itu.3	P15428	OTTHUMG00000160772	ENST00000296522.6:c.206A>G	4.37:g.175443106T>C	ENSP00000296522:p.Gln69Arg	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_000860	B4DTA4|B4DU74|B4DV57|D3DP43|E7EV11|O00749|Q06F08|Q12998	Missense_Mutation	SNP	ENST00000296522.6	37	CCDS3821.1	.	.	.	.	.	.	.	.	.	.	T	12.99	2.103285	0.37145	.	.	ENSG00000164120	ENST00000296522;ENST00000296521;ENST00000422112;ENST00000542498;ENST00000504433	T;D;T;D;D	0.87729	-1.35;-1.76;-1.35;-2.29;-2.29	5.39	2.86	0.33363	NAD(P)-binding domain (1);	0.454373	0.27744	N	0.018032	T	0.74619	0.3740	N	0.16233	0.39	0.26141	N	0.980274	B;B;B;B;B;B	0.13145	0.001;0.0;0.007;0.0;0.0;0.0	B;B;B;B;B;B	0.11329	0.006;0.0;0.005;0.0;0.0;0.001	T	0.62163	-0.6912	10	0.40728	T	0.16	.	7.3943	0.26927	0.0:0.077:0.144:0.779	.	69;69;69;69;69;69	E7EV11;O00749;E9PBZ2;Q12998;B4DV57;P15428	.;.;.;.;.;PGDH_HUMAN	R	69	ENSP00000296522:Q69R;ENSP00000296521:Q69R;ENSP00000398720:Q69R;ENSP00000443644:Q69R;ENSP00000420892:Q69R	ENSP00000296521:Q69R	Q	-	2	0	HPGD	175679681	0.997000	0.39634	0.811000	0.32455	0.891000	0.51852	3.014000	0.49590	0.326000	0.23384	0.379000	0.24179	CAA	.		0.537	HPGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362228.3		
HSD17B1	3292	hgsc.bcm.edu;bcgsc.ca	37	17	40706435	40706435	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:40706435C>T	ENST00000585807.1	+	5	4272	c.552C>T	c.(550-552)atC>atT	p.I184I	RP11-400F19.8_ENST00000585572.1_RNA|RP11-400F19.6_ENST00000590513.1_RNA|HSD17B1_ENST00000225929.5_Silent_p.I185I	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	184					bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	TGAGCCTGATCGAGTGCGGCC	0.677																																					p.I184I		.											.	HSD17B1	90	0			c.C552T						.						29.0	26.0	27.0					17																	40706435		2203	4299	6502	SO:0001819	synonymous_variant	3292	exon5			CCTGATCGAGTGC		CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.552C>T	17.37:g.40706435C>T		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_000413	B3KXS1|Q2M2L8	Silent	SNP	ENST00000585807.1	37	CCDS11428.1																																																																																			.		0.677	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450392.1	NM_000413	
HSPG2	3339	hgsc.bcm.edu;bcgsc.ca	37	1	22180694	22180694	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:22180694T>C	ENST00000374695.3	-	50	6510	c.6431A>G	c.(6430-6432)tAc>tGc	p.Y2144C	HSPG2_ENST00000430507.1_Intron	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2144	Ig-like C2-type 6.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ACCTGGGGTGTAGCTGGGGCC	0.622																																					p.Y2144C		.											.	HSPG2	141	0			c.A6431G						.						12.0	14.0	14.0					1																	22180694		2196	4293	6489	SO:0001583	missense	3339	exon50			GGGGTGTAGCTGG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.6431A>G	1.37:g.22180694T>C	ENSP00000363827:p.Tyr2144Cys	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	4.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	T	12.66	2.005774	0.35415	.	.	ENSG00000142798	ENST00000374695	T	0.76186	-1.0	5.34	1.34	0.21922	Immunoglobulin-like (1);	1.023810	0.07853	N	0.964982	T	0.74222	0.3688	M	0.68952	2.095	0.09310	N	1	P;P	0.47106	0.86;0.89	P;B	0.44359	0.447;0.41	T	0.60954	-0.7160	10	0.40728	T	0.16	.	10.314	0.43725	0.0:0.0:0.5136:0.4864	.	84;2144	Q59EG0;P98160	.;PGBM_HUMAN	C	2144	ENSP00000363827:Y2144C	ENSP00000363827:Y2144C	Y	-	2	0	HSPG2	22053281	0.000000	0.05858	0.028000	0.17463	0.294000	0.27393	-0.282000	0.08445	0.302000	0.22762	-0.313000	0.08912	TAC	.		0.622	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
IFI27L1	122509	hgsc.bcm.edu;bcgsc.ca	37	14	94568841	94568841	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:94568841T>C	ENST00000555523.1	+	5	461	c.242T>C	c.(241-243)gTg>gCg	p.V81A	IFI27L1_ENST00000557218.1_Missense_Mutation_p.V27A|IFI27L1_ENST00000556381.1_3'UTR|IFI27L1_ENST00000554544.1_Missense_Mutation_p.V16A|IFI27L1_ENST00000554562.1_3'UTR|IFI27L1_ENST00000393115.3_Missense_Mutation_p.V81A|IFI27L1_ENST00000553664.1_Silent_p.C103C|IFI27L1_ENST00000557066.1_Missense_Mutation_p.V27A|IFI27L1_ENST00000553350.1_Intron	NM_206949.2	NP_996832.1	Q96BM0	I27L1_HUMAN	interferon, alpha-inducible protein 27-like 1	81						integral component of membrane (GO:0016021)				lung(2)	2						GGACTCTCTGTGACATCTAAA	0.612																																					p.V81A		.											.	IFI27L1	90	0			c.T242C						.						62.0	58.0	60.0					14																	94568841		2203	4300	6503	SO:0001583	missense	122509	exon5			TCTCTGTGACATC	BC015423	CCDS9919.1	14q32.13	2008-10-08	2008-10-08	2008-10-08		ENSG00000165948			19754	protein-coding gene	gene with protein product		611320	"""family with sequence similarity 14, member B"""	FAM14B			Standard	NM_145249		Approved		uc001yck.3	Q96BM0		ENST00000555523.1:c.242T>C	14.37:g.94568841T>C	ENSP00000451851:p.Val81Ala	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_145249		Missense_Mutation	SNP	ENST00000555523.1	37	CCDS9919.1	.	.	.	.	.	.	.	.	.	.	t	8.223	0.802934	0.16397	.	.	ENSG00000165948	ENST00000555523;ENST00000393115;ENST00000554166;ENST00000555341;ENST00000557218;ENST00000554544;ENST00000557066	T;T;T;T	0.28454	1.61;1.61;1.61;1.61	3.27	-3.93	0.04143	.	1.300780	0.06118	U	0.668363	T	0.18341	0.0440	N	0.17474	0.49	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.29336	-1.0015	10	0.32370	T	0.25	.	10.7815	0.46379	0.0:0.6969:0.0:0.3031	.	81	Q96BM0	I27L1_HUMAN	A	81;81;80;80;27;16;27	ENSP00000451851:V81A;ENSP00000376824:V81A;ENSP00000452226:V80A;ENSP00000451608:V80A	ENSP00000376824:V81A	V	+	2	0	IFI27L1	93638594	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.504000	0.00449	-0.877000	0.04012	-0.332000	0.08345	GTG	.		0.612	IFI27L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412868.1	NM_206949	
IFNG	3458	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	68551870	68551870	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:68551870A>T	ENST00000229135.3	-	3	320	c.189T>A	c.(187-189)agT>agA	p.S63R	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	63					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	TTTTTCTGTCACTCTCCTTGG	0.373																																					p.S63R		.											.	IFNG	90	0			c.T189A						.						87.0	87.0	87.0					12																	68551870		2203	4300	6503	SO:0001583	missense	3458	exon3			TCTGTCACTCTCC		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.189T>A	12.37:g.68551870A>T	ENSP00000229135:p.Ser63Arg	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	37.0	NM_000619	B5BU88|Q53ZV4	Missense_Mutation	SNP	ENST00000229135.3	37	CCDS8980.1	.	.	.	.	.	.	.	.	.	.	A	15.10	2.733736	0.48939	.	.	ENSG00000111537	ENST00000229135	T	0.53423	0.62	5.38	3.05	0.35203	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.570944	0.19887	N	0.103839	T	0.57975	0.2090	M	0.71581	2.175	0.29060	N	0.883959	P	0.51240	0.943	P	0.57846	0.828	T	0.54180	-0.8332	9	.	.	.	-1.2533	6.9182	0.24371	0.8183:0.0:0.1817:0.0	.	63	P01579	IFNG_HUMAN	R	63	ENSP00000229135:S63R	.	S	-	3	2	IFNG	66838137	0.985000	0.35326	0.986000	0.45419	0.551000	0.35334	1.381000	0.34362	0.458000	0.26988	-0.250000	0.11733	AGT	.		0.373	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402301.1		
IRF2BPL	64207	hgsc.bcm.edu;bcgsc.ca	37	14	77491917	77491917	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:77491917A>G	ENST00000238647.3	-	1	3117	c.2219T>C	c.(2218-2220)tTc>tCc	p.F740S		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	740					development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						AGAGCAAGGGAAGCAAAATTT	0.577																																					p.F740S		.											.	IRF2BPL	90	0			c.T2219C						.						62.0	57.0	59.0					14																	77491917		2203	4300	6503	SO:0001583	missense	64207	exon1			CAAGGGAAGCAAA	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.2219T>C	14.37:g.77491917A>G	ENSP00000238647:p.Phe740Ser	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	Missense_Mutation	SNP	ENST00000238647.3	37	CCDS9854.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.823779	0.71143	.	.	ENSG00000119669	ENST00000238647	T	0.77877	-1.13	4.64	4.64	0.57946	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	U	0.000000	D	0.86653	0.5984	M	0.84326	2.69	0.80722	D	1	D	0.60160	0.987	P	0.60682	0.878	D	0.88885	0.3342	10	0.87932	D	0	.	13.3656	0.60682	1.0:0.0:0.0:0.0	.	740	Q9H1B7	I2BPL_HUMAN	S	740	ENSP00000238647:F740S	ENSP00000238647:F740S	F	-	2	0	IRF2BPL	76561670	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.097000	0.94193	1.948000	0.56530	0.379000	0.24179	TTC	.		0.577	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
ITFG3	83986	hgsc.bcm.edu;bcgsc.ca	37	16	312091	312091	+	Splice_Site	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:312091G>T	ENST00000399932.3	+	7	1159		c.e7-1		ITFG3_ENST00000442458.2_Splice_Site|ITFG3_ENST00000301679.2_Splice_Site|ITFG3_ENST00000301678.3_Splice_Site|ITFG3_ENST00000450082.2_Splice_Site|ITFG3_ENST00000600536.1_Splice_Site	NM_001284497.1	NP_001271426.1	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3							cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(3)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				TGTCATTGCAGGTTAGTGGCC	0.607																																					.		.											.	ITFG3	90	0			c.709-1G>T						.						55.0	59.0	58.0					16																	312091		2171	4282	6453	SO:0001630	splice_region_variant	83986	exon7			ATTGCAGGTTAGT	AL136542	CCDS10402.1	16p13.3	2006-03-31	2006-03-31	2006-03-31	ENSG00000167930	ENSG00000167930			14163	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 9"""	C16orf9			Standard	XM_005255622		Approved	DKFZP761D0211, FLJ32603	uc002cgf.3	Q9H0X4	OTTHUMG00000060728	ENST00000399932.3:c.709-1G>T	16.37:g.312091G>T		Somatic	243.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	5.0	NM_032039	D3DU45|Q7L416|Q96FR1|Q96MC7|Q96S30	Splice_Site	SNP	ENST00000399932.3	37	CCDS10402.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.020735	0.35606	.	.	ENSG00000167930	ENST00000399932;ENST00000301679;ENST00000442458;ENST00000449945;ENST00000301678;ENST00000450082	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8952	0.63766	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITFG3	252092	1.000000	0.71417	0.964000	0.40570	0.085000	0.17905	4.929000	0.63455	2.434000	0.82447	0.462000	0.41574	.	.		0.607	ITFG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134227.2	NM_032039	Intron
IRF8	3394	hgsc.bcm.edu;bcgsc.ca	37	16	85946744	85946744	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:85946744T>C	ENST00000268638.5	+	5	877	c.455T>C	c.(454-456)gTg>gCg	p.V152A	IRF8_ENST00000562492.1_5'Flank	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	152					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				CAGCCTTCTGTGGACGATTAC	0.577																																					p.V152A		.											.	IRF8	154	0			c.T455C						.						111.0	117.0	115.0					16																	85946744		2198	4300	6498	SO:0001583	missense	3394	exon5			CTTCTGTGGACGA	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.455T>C	16.37:g.85946744T>C	ENSP00000268638:p.Val152Ala	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_002163	A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	CCDS10956.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.818382	0.32145	.	.	ENSG00000140968	ENST00000268638	D	0.96967	-4.19	4.86	3.75	0.43078	.	0.655707	0.15813	N	0.243361	D	0.91945	0.7449	L	0.48642	1.525	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.83257	-0.0050	10	0.08179	T	0.78	-21.0783	6.6795	0.23113	0.0:0.0779:0.1554:0.7667	.	152	Q02556	IRF8_HUMAN	A	152	ENSP00000268638:V152A	ENSP00000268638:V152A	V	+	2	0	IRF8	84504245	0.998000	0.40836	0.901000	0.35422	0.968000	0.65278	1.156000	0.31712	0.798000	0.33994	0.459000	0.35465	GTG	.		0.577	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163	
ITGA11	22801	hgsc.bcm.edu;bcgsc.ca	37	15	68631922	68631922	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:68631922T>C	ENST00000315757.7	-	11	1278	c.1192A>G	c.(1192-1194)Acg>Gcg	p.T398A	ITGA11_ENST00000423218.2_Missense_Mutation_p.T398A	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	398					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						CCGGCACTCGTCTCCTTTAGC	0.582																																					p.T398A		.											.	ITGA11	538	0			c.A1192G						.						70.0	76.0	74.0					15																	68631922		2022	4175	6197	SO:0001583	missense	22801	exon11			CACTCGTCTCCTT	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1192A>G	15.37:g.68631922T>C	ENSP00000327290:p.Thr398Ala	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	5.0	NM_001004439	J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	ENST00000315757.7	37	CCDS45291.1	.	.	.	.	.	.	.	.	.	.	T	12.01	1.810639	0.32053	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491;ENST00000537153	T;T	0.71817	-0.6;-0.6	5.09	5.09	0.68999	.	0.094573	0.64402	D	0.000001	T	0.65821	0.2728	L	0.55481	1.735	0.43039	D	0.994626	B;P	0.38767	0.068;0.646	B;B	0.40825	0.097;0.341	T	0.62987	-0.6737	10	0.10377	T	0.69	.	14.1169	0.65159	0.0:0.0:0.0:1.0	.	398;398	A8K8T0;Q9UKX5	.;ITA11_HUMAN	A	398;398;33;398	ENSP00000327290:T398A;ENSP00000403392:T398A	ENSP00000327290:T398A	T	-	1	0	ITGA11	66418976	1.000000	0.71417	0.743000	0.31040	0.163000	0.22366	6.289000	0.72696	1.938000	0.56188	0.454000	0.30748	ACG	.		0.582	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_012211	
ITGB2	3689	hgsc.bcm.edu;bcgsc.ca	37	21	46330223	46330223	+	Silent	SNP	G	G	T	rs375907746		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr21:46330223G>T	ENST00000397850.2	-	4	575	c.123C>A	c.(121-123)ccC>ccA	p.P41P	ITGB2_ENST00000302347.5_Silent_p.P41P|ITGB2_ENST00000397857.1_Silent_p.P41P|ITGB2_ENST00000397846.3_Silent_p.P41P|ITGB2_ENST00000397854.3_Silent_p.P41P|ITGB2_ENST00000523126.1_5'UTR|ITGB2_ENST00000355153.4_Silent_p.P41P|ITGB2_ENST00000397852.1_Silent_p.P41P			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	41					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	AGGTGCAGCCGGGCCCCGACT	0.662																																					p.P41P		.											.	ITGB2	717	0			c.C123A						.						47.0	44.0	45.0					21																	46330223		2203	4300	6503	SO:0001819	synonymous_variant	3689	exon3			GCAGCCGGGCCCC	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.123C>A	21.37:g.46330223G>T		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	6.0	NM_000211	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	ENST00000397850.2	37	CCDS13716.1																																																																																			.		0.662	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
JAKMIP1	152789	hgsc.bcm.edu;bcgsc.ca	37	4	6087187	6087187	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:6087187G>T	ENST00000282924.5	-	4	1279	c.794C>A	c.(793-795)cCg>cAg	p.P265Q	JAKMIP1_ENST00000409021.3_Missense_Mutation_p.P265Q|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.P100Q|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.P100Q|JAKMIP1_ENST00000457227.2_5'UTR|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.P265Q	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	265	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GATCCCGGGCGGGAGCTCTCT	0.612																																					p.P265Q		.											.	JAKMIP1	292	0			c.C794A						.						50.0	52.0	52.0					4																	6087187		2203	4300	6503	SO:0001583	missense	152789	exon4			CCGGGCGGGAGCT	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.794C>A	4.37:g.6087187G>T	ENSP00000282924:p.Pro265Gln	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_001099433	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.672284	0.47781	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	4.29	4.29	0.51040	.	0.000000	0.64402	D	0.000007	T	0.51449	0.1675	M	0.73217	2.22	0.39418	D	0.966877	D;D;D;D;D	0.63880	0.993;0.983;0.98;0.98;0.983	P;P;P;P;P	0.61132	0.774;0.884;0.838;0.838;0.884	T	0.60193	-0.7311	10	0.72032	D	0.01	.	15.9279	0.79635	0.0:0.0:1.0:0.0	.	100;265;100;265;265	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	Q	265;100;265;265;157;265;265;100	ENSP00000386711:P265Q;ENSP00000387042:P100Q;ENSP00000282924:P265Q;ENSP00000386925:P265Q;ENSP00000386745:P100Q	ENSP00000282924:P265Q	P	-	2	0	JAKMIP1	6138088	1.000000	0.71417	0.902000	0.35471	0.201000	0.24016	5.460000	0.66691	2.239000	0.73571	0.655000	0.94253	CCG	.		0.612	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
JARID2	3720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	15497298	15497298	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:15497298C>T	ENST00000341776.2	+	7	2086	c.1842C>T	c.(1840-1842)atC>atT	p.I614I	JARID2_ENST00000397311.3_Silent_p.I442I|JARID2_ENST00000541660.1_Silent_p.I576I	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	614					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				TTCAGCACATCCACAAGCTGG	0.622																																					p.I614I		.											.	JARID2	228	0			c.C1842T						.						29.0	24.0	25.0					6																	15497298		2203	4298	6501	SO:0001819	synonymous_variant	3720	exon7			GCACATCCACAAG	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1842C>T	6.37:g.15497298C>T		Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	65.0	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Silent	SNP	ENST00000341776.2	37	CCDS4533.1																																																																																			.		0.622	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
KCNH8	131096	hgsc.bcm.edu;bcgsc.ca	37	3	19575099	19575099	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:19575099T>C	ENST00000328405.2	+	16	3098	c.2832T>C	c.(2830-2832)taT>taC	p.Y944Y		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	944					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						GGGCTGCTTATACCCAAGCAC	0.552																																					p.Y944Y	NSCLC(124;1625 1765 8018 24930 42026)	.											.	KCNH8	524	0			c.T2832C						.						82.0	80.0	81.0					3																	19575099		2203	4300	6503	SO:0001819	synonymous_variant	131096	exon16			TGCTTATACCCAA	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2832T>C	3.37:g.19575099T>C		Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	5.0	NM_144633	B7Z2I7|Q59GQ6	Silent	SNP	ENST00000328405.2	37	CCDS2632.1																																																																																			.		0.552	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
KIAA0020	9933	hgsc.bcm.edu;bcgsc.ca	37	9	2807906	2807906	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:2807906T>C	ENST00000397885.2	-	17	1930		c.e17-2			NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020							endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CAAAACAACCTGTAAAATATA	0.353																																					.		.											.	KIAA0020	91	0			c.1724-2A>G						.						74.0	70.0	71.0					9																	2807906		2203	4300	6503	SO:0001630	splice_region_variant	9933	exon18			ACAACCTGTAAAA	AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1724-2A>G	9.37:g.2807906T>C		Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_014878	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Splice_Site	SNP	ENST00000397885.2	37	CCDS6448.2	.	.	.	.	.	.	.	.	.	.	T	17.26	3.345515	0.61073	.	.	ENSG00000080608	ENST00000397885	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9	0.70672	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0020	2797906	1.000000	0.71417	0.994000	0.49952	0.835000	0.47333	6.124000	0.71620	2.258000	0.74832	0.529000	0.55759	.	.		0.353	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3	NM_014878	Intron
KIAA0319L	79932	hgsc.bcm.edu;bcgsc.ca	37	1	35928256	35928256	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:35928256A>G	ENST00000325722.3	-	8	1494	c.1260T>C	c.(1258-1260)tcT>tcC	p.S420S	KIAA0319L_ENST00000485551.1_5'UTR	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	420	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TGGTTGGCAAAGAGATCTCCT	0.443																																					p.S420S		.											.	KIAA0319L	92	0			c.T1260C						.						89.0	82.0	85.0					1																	35928256		2203	4300	6503	SO:0001819	synonymous_variant	79932	exon8			TGGCAAAGAGATC	AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.1260T>C	1.37:g.35928256A>G		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	4.0	NM_024874	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Silent	SNP	ENST00000325722.3	37	CCDS390.1	.	.	.	.	.	.	.	.	.	.	A	10.43	1.348828	0.24426	.	.	ENSG00000142687	ENST00000431916	.	.	.	5.54	4.4	0.53042	.	.	.	.	.	T	0.44350	0.1289	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42172	-0.9467	4	.	.	.	-6.7581	1.2872	0.02053	0.5356:0.1665:0.1489:0.149	.	.	.	.	L	250	.	.	F	-	1	0	KIAA0319L	35700843	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.630000	0.24553	0.923000	0.37045	0.533000	0.62120	TTT	.		0.443	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012684.2	NM_024874	
KIAA0922	23240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	154524546	154524546	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:154524546A>G	ENST00000409663.3	+	24	2780	c.2728A>G	c.(2728-2730)Agc>Ggc	p.S910G	KIAA0922_ENST00000409959.3_Missense_Mutation_p.S911G|KIAA0922_ENST00000440693.1_Missense_Mutation_p.S827G	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	910	Poly-Ser.					integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				GCAAAATGCTAGCTCCTCTTC	0.438																																					p.S911G		.											.	KIAA0922	92	0			c.A2731G						.						168.0	154.0	159.0					4																	154524546		2203	4300	6503	SO:0001583	missense	23240	exon24			AATGCTAGCTCCT	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.2728A>G	4.37:g.154524546A>G	ENSP00000386574:p.Ser910Gly	Somatic	247.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	147.0	NM_001131007	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	A	10.73	1.433805	0.25813	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.19250	2.42;2.16;2.42;2.16	6.17	0.976	0.19727	.	0.397804	0.34853	N	0.003640	T	0.13072	0.0317	L	0.36672	1.1	0.09310	N	1	B;B;B	0.15719	0.014;0.002;0.001	B;B;B	0.12837	0.008;0.006;0.002	T	0.24012	-1.0172	10	0.26408	T	0.33	-3.2992	5.69	0.17825	0.6965:0.0:0.1887:0.1148	.	827;911;910	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	G	910;827;911;688	ENSP00000386574:S910G;ENSP00000409663:S827G;ENSP00000386787:S911G;ENSP00000240487:S688G	ENSP00000240487:S688G	S	+	1	0	KIAA0922	154743996	0.986000	0.35501	0.018000	0.16275	0.871000	0.50021	2.084000	0.41625	-0.033000	0.13736	0.533000	0.62120	AGC	.		0.438	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	
ICE1	23379	hgsc.bcm.edu;bcgsc.ca	37	5	5489287	5489287	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:5489287A>G	ENST00000296564.7	+	19	6867	c.6645A>G	c.(6643-6645)gcA>gcG	p.A2215A		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		2215					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TACAGTTAGCAGCCGTGTATG	0.413																																					p.A2215A		.											.	KIAA0947	48	0			c.A6645G						.						53.0	53.0	53.0					5																	5489287		1857	4108	5965	SO:0001819	synonymous_variant	23379	exon19			GTTAGCAGCCGTG																												ENST00000296564.7:c.6645A>G	5.37:g.5489287A>G		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	ENST00000296564.7	37	CCDS47187.1																																																																																			.		0.413	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
KIAA1549L	25758	hgsc.bcm.edu;bcgsc.ca	37	11	33573676	33573676	+	Silent	SNP	G	G	T	rs372452571		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:33573676G>T	ENST00000321505.4	+	5	3033	c.2853G>T	c.(2851-2853)gcG>gcT	p.A951A	KIAA1549L_ENST00000265654.5_Silent_p.A957A|KIAA1549L_ENST00000389726.3_Silent_p.A957A			Q6ZVL6	K154L_HUMAN	KIAA1549-like	951						integral component of membrane (GO:0016021)											TGAGCCAAGCGGACAACATAC	0.453																																					p.A951A		.											.	.	.	0			c.G2853T						.						69.0	68.0	68.0					11																	33573676		1929	4140	6069	SO:0001819	synonymous_variant	25758	exon5			CCAAGCGGACAAC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2853G>T	11.37:g.33573676G>T		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_012194	B0QYU0	Silent	SNP	ENST00000321505.4	37	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	G	5.776	0.327476	0.10956	.	.	ENSG00000110427	ENST00000526400	.	.	.	6.08	-12.2	0.00006	.	.	.	.	.	T	0.31295	0.0792	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.47586	-0.9106	4	.	.	.	-5.2645	1.6363	0.02743	0.1523:0.2863:0.297:0.2645	.	.	.	.	L	349	.	.	R	+	2	0	C11orf41	33530252	0.000000	0.05858	0.000000	0.03702	0.659000	0.38960	-4.800000	0.00184	-3.665000	0.00124	-2.047000	0.00414	CGG	.		0.453	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
KIF16B	55614	hgsc.bcm.edu;bcgsc.ca	37	20	16492142	16492142	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr20:16492142T>C	ENST00000354981.2	-	6	634	c.477A>G	c.(475-477)agA>agG	p.R159R	KIF16B_ENST00000355755.3_Silent_p.R159R|KIF16B_ENST00000378003.2_5'UTR|KIF16B_ENST00000408042.1_Silent_p.R159R	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	159	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GAAGTAGATCTCTCACACGTT	0.338																																					p.R159R		.											.	KIF16B	291	0			c.A477G						.						70.0	69.0	69.0					20																	16492142		2203	4300	6503	SO:0001819	synonymous_variant	55614	exon6			TAGATCTCTCACA	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.477A>G	20.37:g.16492142T>C		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	4.0	NM_001199865	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	CCDS13122.1																																																																																			.		0.338	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
KIF17	57576	hgsc.bcm.edu;bcgsc.ca	37	1	21014288	21014288	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:21014288C>A	ENST00000247986.2	-	8	1841	c.1531G>T	c.(1531-1533)Gat>Tat	p.D511Y	KIF17_ENST00000490034.1_Intron|KIF17_ENST00000375044.1_Missense_Mutation_p.D411Y|KIF17_ENST00000400463.3_Missense_Mutation_p.D511Y			Q9P2E2	KIF17_HUMAN	kinesin family member 17	511					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TTGGAGACATCGTCACTGGGC	0.552																																					p.D511Y		.											.	KIF17	94	0			c.G1531T						.						88.0	83.0	84.0					1																	21014288		2203	4300	6503	SO:0001583	missense	57576	exon8			AGACATCGTCACT	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1531G>T	1.37:g.21014288C>A	ENSP00000247986:p.Asp511Tyr	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_020816	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	CCDS213.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.608443	0.28623	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.72394	-0.65;-0.53;-0.53	5.04	-0.415	0.12355	.	1.268100	0.06187	U	0.680688	T	0.58395	0.2119	L	0.39898	1.24	0.09310	N	1	P;P	0.51240	0.943;0.935	B;B	0.42851	0.4;0.3	T	0.51220	-0.8733	10	0.62326	D	0.03	.	1.369	0.02207	0.2948:0.3934:0.1435:0.1684	.	511;511	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	Y	411;511;511	ENSP00000364184:D411Y;ENSP00000383311:D511Y;ENSP00000247986:D511Y	ENSP00000247986:D511Y	D	-	1	0	KIF17	20886875	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.066000	0.14489	-0.227000	0.09884	-0.229000	0.12294	GAT	.		0.552	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
KL	9365	hgsc.bcm.edu;bcgsc.ca	37	13	33635814	33635814	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr13:33635814C>T	ENST00000380099.3	+	4	2606	c.2598C>T	c.(2596-2598)ctC>ctT	p.L866L	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	866	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		ACGGAGACCTCCCCATGTACA	0.522																																					p.L866L		.											.	KL	155	0			c.C2598T						.						116.0	114.0	115.0					13																	33635814		2203	4300	6503	SO:0001819	synonymous_variant	9365	exon4			AGACCTCCCCATG	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2598C>T	13.37:g.33635814C>T		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_004795	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Silent	SNP	ENST00000380099.3	37	CCDS9347.1																																																																																			.		0.522	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
KLF17	128209	hgsc.bcm.edu;bcgsc.ca	37	1	44595054	44595054	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:44595054C>T	ENST00000372299.3	+	2	169	c.111C>T	c.(109-111)aaC>aaT	p.N37N	KLF17_ENST00000476802.1_3'UTR	NM_173484.3	NP_775755.3	Q5JT82	KLF17_HUMAN	Kruppel-like factor 17	37					gamete generation (GO:0007276)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(1)|lung(6)|ovary(3)|prostate(1)|skin(2)|stomach(1)	18	Acute lymphoblastic leukemia(166;0.155)					CCATCTTGAACATGTCTTCAT	0.502																																					p.N37N		.											.	KLF17	92	0			c.C111T						.						124.0	115.0	118.0					1																	44595054		2203	4300	6503	SO:0001819	synonymous_variant	128209	exon2			CTTGAACATGTCT	BC049844	CCDS508.1	1p34.1	2011-11-15	2006-02-17	2006-02-17	ENSG00000171872	ENSG00000171872		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	18830	protein-coding gene	gene with protein product		609602	"""zinc finger protein 393"""	ZNF393		16460907	Standard	NM_173484		Approved	Zfp393, FLJ40160	uc001clp.3	Q5JT82	OTTHUMG00000009664	ENST00000372299.3:c.111C>T	1.37:g.44595054C>T		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_173484	Q86VQ7|Q8N805	Silent	SNP	ENST00000372299.3	37	CCDS508.1																																																																																			.		0.502	KLF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026646.1	NM_173484	
KLHL8	57563	hgsc.bcm.edu;bcgsc.ca	37	4	88098001	88098001	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:88098001A>G	ENST00000273963.5	-	6	1457	c.1116T>C	c.(1114-1116)ggT>ggC	p.G372G	KLHL8_ENST00000545252.1_Silent_p.G21G|KLHL8_ENST00000498875.2_Silent_p.G296G|KLHL8_ENST00000512111.1_Silent_p.G372G|KLHL8_ENST00000425278.2_Silent_p.G189G	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	372					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CATCATGTCCACCTACTGCAT	0.313																																					p.G372G		.											.	KLHL8	90	0			c.T1116C						.						203.0	183.0	190.0					4																	88098001		2203	4300	6503	SO:0001819	synonymous_variant	57563	exon6			ATGTCCACCTACT	AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1116T>C	4.37:g.88098001A>G		Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	4.0	NM_020803	Q53XA3|Q6N018	Silent	SNP	ENST00000273963.5	37	CCDS3617.1																																																																																			.		0.313	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253040.1		
KNTC1	9735	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	123055607	123055607	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:123055607G>C	ENST00000333479.7	+	24	2130	c.1953G>C	c.(1951-1953)gaG>gaC	p.E651D	KNTC1_ENST00000450485.2_Missense_Mutation_p.E614D	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	651					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.E651D(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AATTGGCAGAGATATTTTTTA	0.363																																					p.E651D		.											.	KNTC1	543	1	Substitution - Missense(1)	endometrium(1)	c.G1953C						.						91.0	88.0	89.0					12																	123055607		1815	4076	5891	SO:0001583	missense	9735	exon24			GGCAGAGATATTT		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.1953G>C	12.37:g.123055607G>C	ENSP00000328236:p.Glu651Asp	Somatic	254.0	0.0		WXS	Illumina HiSeq	Phase_I	232.0	15.0	NM_014708	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692717	0.30052	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.24350	1.86;2.4	5.49	2.17	0.27698	.	0.157403	0.44483	D	0.000453	T	0.18718	0.0449	L	0.51422	1.61	0.80722	D	1	P;B	0.36282	0.546;0.361	B;B	0.29353	0.101;0.075	T	0.04454	-1.0950	10	0.51188	T	0.08	-16.2422	8.0109	0.30353	0.4138:0.0:0.5862:0.0	.	614;651	E7ES84;P50748	.;KNTC1_HUMAN	D	614;651	ENSP00000397992:E614D;ENSP00000328236:E651D	ENSP00000328236:E651D	E	+	3	2	KNTC1	121621560	0.998000	0.40836	0.936000	0.37596	0.798000	0.45092	1.472000	0.35376	0.800000	0.34041	0.643000	0.83706	GAG	.		0.363	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
KPNA7	402569	hgsc.bcm.edu;bcgsc.ca	37	7	98792707	98792707	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:98792707A>G	ENST00000327442.6	-	4	578	c.539T>C	c.(538-540)cTt>cCt	p.L180P		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	180					cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						TATATTACCAAGAGCCCACAC	0.552																																					p.L180P		.											.	KPNA7	158	0			c.T539C						.						38.0	35.0	36.0					7																	98792707		692	1591	2283	SO:0001583	missense	402569	exon4			TTACCAAGAGCCC		CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.539T>C	7.37:g.98792707A>G	ENSP00000330878:p.Leu180Pro	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_001145715	A4D277	Missense_Mutation	SNP	ENST00000327442.6	37	CCDS47651.1	.	.	.	.	.	.	.	.	.	.	A	19.69	3.874312	0.72180	.	.	ENSG00000185467	ENST00000327442	D	0.85955	-2.05	5.58	4.38	0.52667	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.93838	0.8029	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94927	0.8079	10	0.87932	D	0	-18.4739	12.113	0.53850	0.8572:0.1428:0.0:0.0	.	180	A9QM74	IMA8_HUMAN	P	180	ENSP00000330878:L180P	ENSP00000330878:L180P	L	-	2	0	KPNA7	98630643	1.000000	0.71417	0.524000	0.27887	0.951000	0.60555	7.387000	0.79785	2.134000	0.65973	0.459000	0.35465	CTT	.		0.552	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335118.1	NM_001145715	
KRT1	3848	hgsc.bcm.edu;bcgsc.ca	37	12	53069530	53069530	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:53069530T>C	ENST00000252244.3	-	8	1534		c.e8-2			NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1						complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						CCAGACATCCTGTAGGAGAAA	0.517																																					.		.											.	KRT1	92	0			c.1476-2A>G						.						87.0	81.0	83.0					12																	53069530		2203	4300	6503	SO:0001630	splice_region_variant	3848	exon9			ACATCCTGTAGGA	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1476-2A>G	12.37:g.53069530T>C		Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	6.0	NM_006121	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Splice_Site	SNP	ENST00000252244.3	37	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	T	11.10	1.540002	0.27563	.	.	ENSG00000167768	ENST00000252244	.	.	.	4.55	4.55	0.56014	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.244	0.37513	0.0:0.0951:0.0:0.9049	.	.	.	.	.	-1	.	.	.	-	.	.	KRT1	51355797	0.997000	0.39634	0.953000	0.39169	0.419000	0.31324	2.849000	0.48286	1.812000	0.52913	0.379000	0.24179	.	.		0.517	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	Intron
KRT77	374454	hgsc.bcm.edu;bcgsc.ca	37	12	53086273	53086273	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:53086273C>T	ENST00000341809.3	-	7	1387	c.1359G>A	c.(1357-1359)ctG>ctA	p.L453L	KRT77_ENST00000537195.1_Silent_p.L220L|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	453	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GCTTGACCCCCAGCATGGCCT	0.657																																					p.L453L		.											.	KRT77	187	0			c.G1359A						.						54.0	49.0	51.0					12																	53086273		2203	4300	6503	SO:0001819	synonymous_variant	374454	exon7			GACCCCCAGCATG	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1359G>A	12.37:g.53086273C>T		Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	5.0	NM_175078	Q7RTS8	Silent	SNP	ENST00000341809.3	37	CCDS8837.1																																																																																			.		0.657	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078	
LAMA3	3909	hgsc.bcm.edu;bcgsc.ca	37	18	21355846	21355846	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr18:21355846A>G	ENST00000313654.9	+	10	1605	c.1364A>G	c.(1363-1365)gAg>gGg	p.E455G	LAMA3_ENST00000399516.3_Missense_Mutation_p.E455G	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	455	Domain V.|Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GACAACTGTGAGAAGTGTGCA	0.498																																					p.E455G		.											.	LAMA3	100	0			c.A1364G						.						83.0	79.0	81.0					18																	21355846		1963	4157	6120	SO:0001583	missense	3909	exon10			ACTGTGAGAAGTG	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.1364A>G	18.37:g.21355846A>G	ENSP00000324532:p.Glu455Gly	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	5.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117370	0.77323	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669;ENST00000538801	T;T	0.64618	-0.11;-0.11	4.92	4.92	0.64577	EGF-like, laminin (4);	.	.	.	.	T	0.78464	0.4287	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	0.99;1.0;0.999	P;D;D	0.77557	0.894;0.986;0.99	T	0.81695	-0.0816	9	0.87932	D	0	.	13.6779	0.62465	1.0:0.0:0.0:0.0	.	455;455;455	F5H8G3;Q6VU67;Q16787	.;.;LAMA3_HUMAN	G	455;455;453;455	ENSP00000324532:E455G;ENSP00000382432:E455G	ENSP00000324532:E455G	E	+	2	0	LAMA3	19609844	1.000000	0.71417	0.999000	0.59377	0.756000	0.42949	7.578000	0.82498	2.072000	0.62099	0.482000	0.46254	GAG	.		0.498	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
LANCL1	10314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	211341073	211341073	+	Silent	SNP	G	G	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:211341073G>C	ENST00000443314.1	-	1	390	c.48C>G	c.(46-48)tcC>tcG	p.S16S	LANCL1_ENST00000450366.2_Silent_p.S16S|LANCL1_ENST00000431941.2_Silent_p.S16S|LANCL1_ENST00000441020.3_Silent_p.S16S|CPS1_ENST00000430249.2_5'Flank|LANCL1_ENST00000233714.4_Silent_p.S16S			O43813	LANC1_HUMAN	LanC lantibiotic synthetase component C-like 1 (bacterial)	16					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|G-protein coupled receptor activity (GO:0004930)|glutathione binding (GO:0043295)|low-density lipoprotein particle receptor binding (GO:0050750)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)		CTTCGGCCAGGGATTTGTTAT	0.517																																					p.S16S		.											.	LANCL1	90	0			c.C48G						.						53.0	51.0	52.0					2																	211341073		2203	4300	6503	SO:0001819	synonymous_variant	10314	exon2			GGCCAGGGATTTG	Y11395	CCDS2392.1	2q33-q35	2008-05-23	2001-12-04		ENSG00000115365	ENSG00000115365			6508	protein-coding gene	gene with protein product		604155	"""LanC (bacterial lantibiotic synthetase component C)-like 1"""	GPR69A		9512664	Standard	NM_001136574		Approved	p40	uc010zjh.2	O43813	OTTHUMG00000132991	ENST00000443314.1:c.48C>G	2.37:g.211341073G>C		Somatic	374.0	0.0		WXS	Illumina HiSeq	Phase_I	322.0	163.0	NM_001136574		Silent	SNP	ENST00000443314.1	37	CCDS2392.1																																																																																			.		0.517	LANCL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336817.1	NM_006055	
LDOC1L	84247	hgsc.bcm.edu;bcgsc.ca	37	22	44893427	44893427	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:44893427G>A	ENST00000341255.3	-	2	519	c.10C>T	c.(10-12)Ccg>Tcg	p.P4S		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	4										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		GACGTCTGCGGCTGCACCATG	0.617																																					p.P4S		.											.	LDOC1L	69	0			c.C10T						.						37.0	26.0	30.0					22																	44893427		2202	4296	6498	SO:0001583	missense	84247	exon2			TCTGCGGCTGCAC	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.10C>T	22.37:g.44893427G>A	ENSP00000340434:p.Pro4Ser	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	4.0	NM_032287	Q6ZTR1	Missense_Mutation	SNP	ENST00000341255.3	37	CCDS33662.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429699	0.83776	.	.	ENSG00000188636	ENST00000341255	T	0.28666	1.6	2.95	2.95	0.34219	.	.	.	.	.	T	0.30262	0.0759	N	0.08118	0	0.33260	D	0.559666	D	0.60575	0.988	D	0.65140	0.932	T	0.43458	-0.9390	9	0.87932	D	0	-17.9232	9.6217	0.39725	0.0:0.0:1.0:0.0	.	4	Q6ICC9	LDOCL_HUMAN	S	4	ENSP00000340434:P4S	ENSP00000340434:P4S	P	-	1	0	LDOC1L	43272091	1.000000	0.71417	0.991000	0.47740	0.987000	0.75469	4.044000	0.57361	1.969000	0.57287	0.467000	0.42956	CCG	.		0.617	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	
LEPR	3953	hgsc.bcm.edu;bcgsc.ca	37	1	66067256	66067256	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:66067256T>C	ENST00000349533.6	+	9	1361	c.1176T>C	c.(1174-1176)acT>acC	p.T392T	LEPR_ENST00000371058.1_Silent_p.T392T|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371059.3_Silent_p.T392T|LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000371060.3_Silent_p.T392T|LEPR_ENST00000344610.8_Silent_p.T392T	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		GCAAAGTTACTTTTTTCAATC	0.373																																					p.T392T		.											.	LEPR	91	0			c.T1176C						.						112.0	109.0	110.0					1																	66067256		2203	4300	6503	SO:0001819	synonymous_variant	3953	exon9			AGTTACTTTTTTC	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.1176T>C	1.37:g.66067256T>C		Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	4.0	NM_001003680	Q6FHL5	Silent	SNP	ENST00000349533.6	37	CCDS631.1																																																																																			.		0.373	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
LIN7C	55327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	27523454	27523454	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:27523454T>C	ENST00000278193.2	-	2	71	c.51A>G	c.(49-51)gcA>gcG	p.A17A	LIN7C_ENST00000524596.1_Silent_p.A17A	NM_018362.3	NP_060832.1	Q9NUP9	LIN7C_HUMAN	lin-7 homolog C (C. elegans)	17	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				exocytosis (GO:0006887)|morphogenesis of an epithelial sheet (GO:0002011)|neurotransmitter secretion (GO:0007269)|protein transport (GO:0015031)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|MPP7-DLG1-LIN7 complex (GO:0097025)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|L27 domain binding (GO:0097016)|protein domain specific binding (GO:0019904)			endometrium(2)|lung(2)|upper_aerodigestive_tract(1)	5						ATAATTCAATTGCTCTACAAA	0.388																																					p.A17A		.											.	LIN7C	90	0			c.A51G						.						81.0	79.0	79.0					11																	27523454		2201	4298	6499	SO:0001819	synonymous_variant	55327	exon2			TTCAATTGCTCTA	AK002077	CCDS7864.1	11p14	2008-07-18				ENSG00000148943			17789	protein-coding gene	gene with protein product	"""LIN-7 protein 3"""	612332				10341223	Standard	NM_018362		Approved	MALS-3, Lin7c, LIN-7C, LIN-7-C, VELI3, FLJ11215	uc001mrl.3	Q9NUP9		ENST00000278193.2:c.51A>G	11.37:g.27523454T>C		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	28.0	NM_018362		Silent	SNP	ENST00000278193.2	37	CCDS7864.1																																																																																			.		0.388	LIN7C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388311.2	NM_018362	
LMO2	4005	hgsc.bcm.edu;bcgsc.ca	37	11	33890910	33890910	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:33890910T>C	ENST00000395833.3	-	1	452	c.23A>G	c.(22-24)aAg>aGg	p.K8R	LMO2_ENST00000493667.1_5'Flank|LMO2_ENST00000257818.2_Missense_Mutation_p.K77R	NM_001142315.1|NM_001142316.1	NP_001135787.1|NP_001135788.1	P25791	RBTN2_HUMAN	LIM domain only 2 (rhombotin-like 1)	8					cellular response to thyroid hormone stimulus (GO:0097067)|embryonic hemopoiesis (GO:0035162)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|cofactor binding (GO:0048037)|E-box binding (GO:0070888)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)|urinary_tract(1)	14						GTCCAGGCTCTTCCTTTCGAT	0.771			T	TRD@	T-ALL																																p.K77R		.		Dom	yes		11	11p13	4005	LIM domain only 2 (rhombotin-like 1) (RBTN2)		L	.	LMO2	658	0			c.A230G						.						6.0	5.0	5.0					11																	33890910		1480	2776	4256	SO:0001583	missense	4005	exon4			AGGCTCTTCCTTT	X61118	CCDS7888.2, CCDS44567.1	11p13	2008-07-18			ENSG00000135363	ENSG00000135363			6642	protein-coding gene	gene with protein product	"""T-cell translocation gene 2"", ""rhombotin-like 1"""	180385		RBTNL1		2034676	Standard	NM_005574		Approved	TTG2, RHOM2, RBTN2	uc010rem.2	P25791	OTTHUMG00000157176	ENST00000395833.3:c.23A>G	11.37:g.33890910T>C	ENSP00000379175:p.Lys8Arg	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	4.0	NM_005574	Q9HD58	Missense_Mutation	SNP	ENST00000395833.3	37	CCDS44567.1	.	.	.	.	.	.	.	.	.	.	T	15.47	2.844132	0.51164	.	.	ENSG00000135363	ENST00000395833;ENST00000257818	T;T	0.60672	0.17;0.56	4.38	4.38	0.52667	.	0.125963	0.49916	U	0.000126	T	0.44008	0.1273	L	0.46157	1.445	0.45580	D	0.998524	P;B	0.40144	0.704;0.011	B;B	0.29716	0.106;0.003	T	0.38499	-0.9658	10	0.20046	T	0.44	.	13.2524	0.60060	0.0:0.0:0.0:1.0	.	77;8	P25791-3;P25791	.;RBTN2_HUMAN	R	8;77	ENSP00000379175:K8R;ENSP00000257818:K77R	ENSP00000257818:K77R	K	-	2	0	LMO2	33847486	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.515000	0.67049	1.609000	0.50190	0.377000	0.23210	AAG	.		0.771	LMO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347777.1	NM_005574	
LPHN1	22859	hgsc.bcm.edu;bcgsc.ca	37	19	14273762	14273762	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:14273762C>A	ENST00000340736.6	-	6	1163	c.866G>T	c.(865-867)cGg>cTg	p.R289L	CTB-55O6.12_ENST00000592086.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000591528.1_5'UTR|LPHN1_ENST00000361434.3_Missense_Mutation_p.R284L	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	289	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CACCACCAGCCGCCCGTTGTT	0.632																																					p.R289L		.											.	LPHN1	523	0			c.G866T						.						88.0	63.0	71.0					19																	14273762		2203	4300	6503	SO:0001583	missense	22859	exon6			ACCAGCCGCCCGT	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.866G>T	19.37:g.14273762C>A	ENSP00000340688:p.Arg289Leu	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	C	33	5.194948	0.94960	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	D;D	0.89050	-2.46;-2.46	5.27	5.27	0.74061	Olfactomedin-like (3);	0.000000	0.64402	D	0.000001	D	0.92067	0.7486	M	0.62016	1.91	0.80722	D	1	P;D	0.57571	0.888;0.98	P;P	0.56823	0.614;0.807	D	0.92831	0.6280	10	0.72032	D	0.01	.	16.3786	0.83431	0.0:1.0:0.0:0.0	.	284;289	O94910-2;O94910	.;LPHN1_HUMAN	L	289;284	ENSP00000340688:R289L;ENSP00000355328:R284L	ENSP00000340688:R289L	R	-	2	0	LPHN1	14134762	0.902000	0.30710	1.000000	0.80357	0.996000	0.88848	2.133000	0.42093	2.450000	0.82876	0.655000	0.94253	CGG	.		0.632	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
LRRC17	10234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	102584705	102584705	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:102584705A>G	ENST00000339431.4	+	4	1272	c.977A>G	c.(976-978)aAc>aGc	p.N326S	LRRC17_ENST00000249377.4_3'UTR|FBXL13_ENST00000393772.2_Intron|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000436908.1_Intron|FBXL13_ENST00000379308.3_Intron|FBXL13_ENST00000379306.3_Intron|LRRC17_ENST00000485478.1_3'UTR|FBXL13_ENST00000379305.3_Intron|FBXL13_ENST00000313221.4_Intron|FBXL13_ENST00000455112.2_Intron	NM_001031692.2	NP_001026862.1	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17	326					bone marrow development (GO:0048539)|negative regulation of osteoclast differentiation (GO:0045671)|ossification (GO:0001503)	extracellular space (GO:0005615)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	17						TTATCAAACAACAGTCTGCAA	0.353																																					p.N326S		.											.	LRRC17	91	0			c.A977G						.						98.0	105.0	103.0					7																	102584705		2203	4299	6502	SO:0001583	missense	10234	exon4			CAAACAACAGTCT	U32907	CCDS5727.1, CCDS34721.1	7q22.1	2009-05-26			ENSG00000128606	ENSG00000128606			16895	protein-coding gene	gene with protein product						8982252, 19336404	Standard	NM_005824		Approved	P37NB, H_RG318M05.3	uc003vau.3	Q8N6Y2	OTTHUMG00000157210	ENST00000339431.4:c.977A>G	7.37:g.102584705A>G	ENSP00000344242:p.Asn326Ser	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	33.0	NM_001031692	Q13288|Q6UWA7|Q75MG5	Missense_Mutation	SNP	ENST00000339431.4	37	CCDS34721.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.800116	0.90538	.	.	ENSG00000128606	ENST00000339431	T	0.68025	-0.3	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000004	D	0.87018	0.6073	H	0.94385	3.53	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90545	0.4505	10	0.87932	D	0	-37.8037	16.3943	0.83563	1.0:0.0:0.0:0.0	.	326	Q8N6Y2	LRC17_HUMAN	S	326	ENSP00000344242:N326S	ENSP00000344242:N326S	N	+	2	0	LRRC17	102371941	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.281000	0.76405	0.533000	0.62120	AAC	.		0.353	LRRC17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347930.1	NM_005824	
LRGUK	136332	hgsc.bcm.edu;bcgsc.ca	37	7	133876488	133876488	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:133876488T>C	ENST00000285928.2	+	12	1485	c.1416T>C	c.(1414-1416)gaT>gaC	p.D472D		NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	472	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)			breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						ACGTTTTTGATGAAATGGTGA	0.338																																					p.D472D		.											.	LRGUK	227	0			c.T1416C						.						130.0	121.0	124.0					7																	133876488		2203	4300	6503	SO:0001819	synonymous_variant	136332	exon12			TTTTGATGAAATG	AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.1416T>C	7.37:g.133876488T>C		Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_144648	Q2M3I1	Silent	SNP	ENST00000285928.2	37	CCDS5830.1																																																																																			.		0.338	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339442.1	NM_144648	
LRRC56	115399	hgsc.bcm.edu;bcgsc.ca	37	11	540775	540775	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:540775C>T	ENST00000270115.7	+	4	591	c.91C>T	c.(91-93)Ccc>Tcc	p.P31S		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	31										kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCTGCACAACCCCTGCCCACA	0.662																																					p.P31S		.											.	LRRC56	91	0			c.C91T						.						50.0	46.0	47.0					11																	540775		2200	4299	6499	SO:0001583	missense	115399	exon4			CACAACCCCTGCC		CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.91C>T	11.37:g.540775C>T	ENSP00000270115:p.Pro31Ser	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_198075	Q8N3Q4	Missense_Mutation	SNP	ENST00000270115.7	37	CCDS7700.1	.	.	.	.	.	.	.	.	.	.	c	23.1	4.372993	0.82573	.	.	ENSG00000161328	ENST00000270115	T	0.41065	1.01	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000001	T	0.63768	0.2539	M	0.70275	2.135	0.38924	D	0.957805	D	0.89917	1.0	D	0.91635	0.999	T	0.69075	-0.5241	10	0.59425	D	0.04	-11.9051	15.5375	0.76016	0.0:1.0:0.0:0.0	.	31	Q8IYG6	LRC56_HUMAN	S	31	ENSP00000270115:P31S	ENSP00000270115:P31S	P	+	1	0	LRRC56	530775	0.697000	0.27767	1.000000	0.80357	0.940000	0.58332	1.652000	0.37313	2.287000	0.76781	0.556000	0.70494	CCC	.		0.662	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254969.1	NM_198075	
MARS	4141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57910119	57910119	+	Splice_Site	SNP	A	A	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:57910119A>C	ENST00000262027.5	+	20	2689	c.2555A>C	c.(2554-2556)cAa>cCa	p.Q852P	RN7SL312P_ENST00000582079.1_RNA|MIR616_ENST00000385293.1_RNA	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	852	WHEP-TRS.				gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	GTGACAAAACAAGTATGAAGC	0.483																																					p.Q852P		.											.	MARS	654	0			c.A2555C						.						75.0	65.0	69.0					12																	57910119		2203	4300	6503	SO:0001630	splice_region_variant	4141	exon20			CAAAACAAGTATG	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.2556+1A>C	12.37:g.57910119A>C		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	69.0	NM_004990	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	ENST00000262027.5	37	CCDS8942.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.230007	0.79688	.	.	ENSG00000166986	ENST00000262027;ENST00000552914	T;T	0.67865	-0.29;-0.29	5.47	5.47	0.80525	WHEP-TRS (3);S15/NS1, RNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.85159	0.5633	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87925	0.2706	10	0.54805	T	0.06	-16.7991	13.806	0.63233	1.0:0.0:0.0:0.0	.	852	P56192	SYMC_HUMAN	P	852;171	ENSP00000262027:Q852P;ENSP00000449787:Q171P	ENSP00000262027:Q852P	Q	+	2	0	MARS	56196386	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.696000	0.68287	2.216000	0.71823	0.459000	0.35465	CAA	.		0.483	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	Missense_Mutation
MDFIC	29969	hgsc.bcm.edu;bcgsc.ca	37	7	114619590	114619590	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:114619590A>G	ENST00000393486.1	+	4	837	c.247A>G	c.(247-249)Act>Gct	p.T83A	MDFIC_ENST00000257724.3_Missense_Mutation_p.T192A	NM_001166345.1|NM_199072.4	NP_001159817.1|NP_951038.1			MyoD family inhibitor domain containing											breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	8						TCAGCTTCAGACTTCAGCCCA	0.423																																					p.T192A		.											.	MDFIC	91	0			c.A574G						.						65.0	64.0	64.0					7																	114619590		2203	4300	6503	SO:0001583	missense	29969	exon4			CTTCAGACTTCAG	AF054589	CCDS34737.1, CCDS55155.1	7q31.1-q31.2	2006-01-11			ENSG00000135272	ENSG00000135272			28870	protein-coding gene	gene with protein product		614511				10671520	Standard	NM_199072		Approved	HIC	uc003vhf.3	Q9P1T7	OTTHUMG00000023647	ENST00000393486.1:c.247A>G	7.37:g.114619590A>G	ENSP00000377126:p.Thr83Ala	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_199072		Missense_Mutation	SNP	ENST00000393486.1	37	CCDS55155.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.338646	0.41398	.	.	ENSG00000135272	ENST00000257724;ENST00000393486;ENST00000427207;ENST00000498196	.	.	.	5.98	0.822	0.18806	.	0.572336	0.18522	N	0.138727	T	0.42810	0.1219	M	0.66506	2.035	0.33700	D	0.61444	B	0.10296	0.003	B	0.08055	0.003	T	0.39981	-0.9587	9	0.17832	T	0.49	0.0133	5.9591	0.19289	0.5295:0.2302:0.2403:0.0	.	83	Q9P1T7	MDFIC_HUMAN	A	192;83;69;28	.	ENSP00000257724:T192A	T	+	1	0	MDFIC	114406826	0.937000	0.31787	0.005000	0.12908	0.893000	0.52053	0.472000	0.22116	-0.078000	0.12730	0.482000	0.46254	ACT	.		0.423	MDFIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059968.4	NM_199072	
MDN1	23195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	90368429	90368429	+	Missense_Mutation	SNP	T	T	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:90368429T>G	ENST00000369393.3	-	89	15036	c.14921A>C	c.(14920-14922)gAa>gCa	p.E4974A	MDN1_ENST00000428876.1_Missense_Mutation_p.E4974A			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4974					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTCAGAGTGTTCTTCAGGATG	0.542																																					p.E4974A		.											.	MDN1	100	0			c.A14921C						.						294.0	256.0	269.0					6																	90368429		2203	4300	6503	SO:0001583	missense	23195	exon89			GAGTGTTCTTCAG	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.14921A>C	6.37:g.90368429T>G	ENSP00000358400:p.Glu4974Ala	Somatic	319.0	1.0		WXS	Illumina HiSeq	Phase_I	314.0	149.0	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	10.95	1.495882	0.26774	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03889	3.77;3.77	5.09	3.93	0.45458	.	0.395777	0.24470	N	0.038257	T	0.01222	0.0040	N	0.16478	0.41	0.33461	D	0.584991	B	0.10296	0.003	B	0.11329	0.006	T	0.46748	-0.9169	10	0.35671	T	0.21	.	9.9126	0.41415	0.0:0.0818:0.0:0.9182	.	4974	Q9NU22	MDN1_HUMAN	A	4974	ENSP00000358400:E4974A;ENSP00000413970:E4974A	ENSP00000358400:E4974A	E	-	2	0	MDN1	90425150	1.000000	0.71417	0.514000	0.27761	0.007000	0.05969	4.247000	0.58750	0.897000	0.36392	0.454000	0.30748	GAA	.		0.542	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
MED12L	116931	hgsc.bcm.edu;bcgsc.ca	37	3	151107911	151107911	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:151107911T>C	ENST00000474524.1	+	36	5529	c.5491T>C	c.(5491-5493)Tct>Cct	p.S1831P	MED12L_ENST00000273432.4_Missense_Mutation_p.S1691P	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1831						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCAGAACCAATCTCTTACTCC	0.493																																					p.S1831P		.											.	MED12L	576	0			c.T5491C						.						131.0	144.0	140.0					3																	151107911		2203	4300	6503	SO:0001583	missense	116931	exon36			AACCAATCTCTTA	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5491T>C	3.37:g.151107911T>C	ENSP00000417235:p.Ser1831Pro	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	4.0	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	T	2.556	-0.302968	0.05495	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.58797	0.56;0.31	5.75	0.525	0.17072	Mediator complex, subunit Med12, catenin-binding (1);	0.195620	0.46145	D	0.000309	T	0.25568	0.0622	N	0.08118	0	0.22562	N	0.998985	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.25779	-1.0122	10	0.05351	T	0.99	-7.3491	5.8181	0.18512	0.0:0.1291:0.5249:0.346	.	1691;1831	F8WAE6;Q86YW9	.;MD12L_HUMAN	P	1831;1691	ENSP00000417235:S1831P;ENSP00000273432:S1691P	ENSP00000273432:S1691P	S	+	1	0	MED12L	152590601	0.210000	0.23517	0.245000	0.24217	0.971000	0.66376	0.439000	0.21575	0.074000	0.16767	0.533000	0.62120	TCT	.		0.493	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
MGRN1	23295	hgsc.bcm.edu;bcgsc.ca	37	16	4715144	4715144	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:4715144T>C	ENST00000399577.5	+	7	763	c.670T>C	c.(670-672)Ttt>Ctt	p.F224L	MGRN1_ENST00000586183.1_Missense_Mutation_p.F224L|MGRN1_ENST00000262370.7_Missense_Mutation_p.F224L|MGRN1_ENST00000415496.1_Missense_Mutation_p.F225L|MGRN1_ENST00000588994.1_Missense_Mutation_p.F224L	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	224					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						CTTGGCTGCCTTTGAAAAGGT	0.642																																					p.F224L		.											.	MGRN1	92	0			c.T670C						.						54.0	60.0	58.0					16																	4715144		2056	4193	6249	SO:0001583	missense	23295	exon7			GCTGCCTTTGAAA	AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.670T>C	16.37:g.4715144T>C	ENSP00000382487:p.Phe224Leu	Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_001142291	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	ENST00000399577.5	37	CCDS45402.1	.	.	.	.	.	.	.	.	.	.	t	19.62	3.862379	0.71949	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	4.99	3.9	0.45041	.	0.047367	0.85682	N	0.000000	T	0.36413	0.0966	L	0.41356	1.27	0.58432	D	0.999994	D;D;D;D;P;D	0.76494	0.998;0.999;0.999;0.999;0.815;0.997	D;D;D;D;P;D	0.87578	0.998;0.99;0.97;0.978;0.646;0.995	T	0.04870	-1.0921	10	0.29301	T	0.29	-6.8499	8.5715	0.33572	0.0:0.088:0.0:0.912	.	224;224;224;225;224;224	O60291-4;O60291-3;B4DR12;E9PB19;O60291-2;O60291	.;.;.;.;.;MGRN1_HUMAN	L	224;224;225;224	ENSP00000262370:F224L;ENSP00000382487:F224L;ENSP00000393311:F225L;ENSP00000443810:F224L	ENSP00000262370:F224L	F	+	1	0	MGRN1	4655145	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	5.766000	0.68843	0.941000	0.37499	-0.259000	0.10710	TTT	.		0.642	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2		
MMAA	166785	hgsc.bcm.edu;bcgsc.ca	37	4	146575291	146575291	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:146575291C>A	ENST00000281317.5	+	6	2175	c.965C>A	c.(964-966)cCa>cAa	p.P322Q	MMAA_ENST00000541599.1_Missense_Mutation_p.P41Q	NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type	322					cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTCTGGAAACCAAAGGTAAGC	0.398																																					p.P322Q		.											.	MMAA	91	0			c.C965A						.						125.0	116.0	119.0					4																	146575291		2203	4300	6503	SO:0001583	missense	166785	exon6			GGAAACCAAAGGT	AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.965C>A	4.37:g.146575291C>A	ENSP00000281317:p.Pro322Gln	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_172250	B3KX40|Q495G7	Missense_Mutation	SNP	ENST00000281317.5	37	CCDS3766.1	.	.	.	.	.	.	.	.	.	.	C	32	5.176237	0.94846	.	.	ENSG00000151611	ENST00000281317;ENST00000537246;ENST00000541599	D;D	0.92805	-3.11;-3.11	5.49	5.49	0.81192	.	0.050420	0.85682	D	0.000000	D	0.97195	0.9083	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97864	1.0282	10	0.87932	D	0	-14.0752	19.3608	0.94436	0.0:1.0:0.0:0.0	.	322	Q8IVH4	MMAA_HUMAN	Q	322;322;41	ENSP00000281317:P322Q;ENSP00000442284:P41Q	ENSP00000281317:P322Q	P	+	2	0	MMAA	146794741	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.456000	0.80751	2.572000	0.86782	0.650000	0.86243	CCA	.		0.398	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364668.2		
MMGT1	93380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	135053250	135053250	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:135053250T>A	ENST00000305963.2	-	2	486	c.99A>T	c.(97-99)ttA>ttT	p.L33F	MMGT1_ENST00000433339.2_Missense_Mutation_p.L98F	NM_173470.1	NP_775741.1	Q8N4V1	MMGT1_HUMAN	membrane magnesium transporter 1	33					magnesium ion transport (GO:0015693)	early endosome (GO:0005769)|ER membrane protein complex (GO:0072546)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(1)|endometrium(1)|kidney(1)	3						CTTTTTCTGTTAATCGCATAT	0.294																																					p.L33F		.											.	MMGT1	130	0			c.A99T						.						161.0	153.0	156.0					X																	135053250		2203	4300	6503	SO:0001583	missense	93380	exon2			TTCTGTTAATCGC	AL157477	CCDS14653.1	Xq26.3	2012-05-23	2008-11-21	2008-11-21	ENSG00000169446	ENSG00000169446			28100	protein-coding gene	gene with protein product	"""ER membrane protein complex subunit 5"""		"""transmembrane protein 32"""	TMEM32		18057121, 22119785	Standard	NM_173470		Approved	EMC5	uc004ezi.1	Q8N4V1	OTTHUMG00000022499	ENST00000305963.2:c.99A>T	X.37:g.135053250T>A	ENSP00000306220:p.Leu33Phe	Somatic	578.0	0.0		WXS	Illumina HiSeq	Phase_I	484.0	245.0	NM_173470	B2R625|B4DIY3|D3DWG7|Q5JPP7	Missense_Mutation	SNP	ENST00000305963.2	37	CCDS14653.1	.	.	.	.	.	.	.	.	.	.	T	17.61	3.431485	0.62844	.	.	ENSG00000169446	ENST00000305963;ENST00000433339	.	.	.	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000001	T	0.69878	0.3160	M	0.62266	1.93	0.58432	D	0.999997	D;D	0.89917	1.0;0.958	D;P	0.91635	0.999;0.815	T	0.71276	-0.4641	9	0.52906	T	0.07	.	8.5328	0.33344	0.0:0.0932:0.0:0.9068	.	98;33	Q8N4V1-2;Q8N4V1	.;MMGT1_HUMAN	F	33;98	.	ENSP00000306220:L33F	L	-	3	2	MMGT1	134880916	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.536000	0.36072	1.832000	0.53329	0.481000	0.45027	TTA	.		0.294	MMGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058453.3	NM_173470	
MPO	4353	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	56355209	56355209	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:56355209G>A	ENST00000225275.3	-	7	1359	c.1183C>T	c.(1183-1185)Cgc>Tgc	p.R395C	MPO_ENST00000578493.1_5'UTR|MPO_ENST00000340482.3_Missense_Mutation_p.R427C	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	395					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	CAGGGGATGCGCGCTGAGCGG	0.622																																					p.R395C		.											.	MPO	156	0			c.C1183T						.						58.0	60.0	59.0					17																	56355209		2203	4300	6503	SO:0001583	missense	4353	exon7			GGATGCGCGCTGA		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1183C>T	17.37:g.56355209G>A	ENSP00000225275:p.Arg395Cys	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	15.0	NM_000250	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	G	4.434	0.080249	0.08533	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.73363	-0.74;-0.74	4.8	-0.804	0.10882	.	1.422290	0.03913	N	0.282206	T	0.71082	0.3298	L	0.56340	1.77	0.09310	N	1	B	0.16396	0.017	B	0.13407	0.009	T	0.59118	-0.7514	10	0.66056	D	0.02	-2.9074	10.6686	0.45745	0.0:0.3017:0.3917:0.3066	.	395	P05164	PERM_HUMAN	C	427;395	ENSP00000344419:R427C;ENSP00000225275:R395C	ENSP00000225275:R395C	R	-	1	0	MPO	53710208	0.000000	0.05858	0.037000	0.18230	0.157000	0.22087	-0.360000	0.07622	-0.244000	0.09639	-3.360000	0.00041	CGC	.		0.622	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1		
MSANTD3	91283	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	103212870	103212870	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:103212870C>T	ENST00000395067.2	+	3	721	c.450C>T	c.(448-450)tgC>tgT	p.C150C	MSANTD3-TMEFF1_ENST00000502978.1_Intron|TMEFF1_ENST00000334943.6_Intron|MSANTD3_ENST00000489377.1_3'UTR|MSANTD3_ENST00000374885.1_3'UTR	NM_001198805.1|NM_001198806.1|NM_080655.2	NP_001185734.1|NP_001185735.1|NP_542386.1	Q96H12	MSD3_HUMAN	Myb/SANT-like DNA-binding domain containing 3	150										endometrium(2)|lung(2)	4						GAGAACTGTGCGATGATGAGA	0.368																																					p.C150C		.											.	.	.	0			c.C450T						.						55.0	55.0	55.0					9																	103212870		2203	4300	6503	SO:0001819	synonymous_variant	91283	exon3			ACTGTGCGATGAT	BC008993	CCDS6749.1, CCDS56579.1	9q31.1	2012-03-13	2012-03-13	2012-03-13	ENSG00000066697	ENSG00000066697			23370	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 30"""	C9orf30			Standard	NM_080655		Approved	MGC17337		Q96H12	OTTHUMG00000020365	ENST00000395067.2:c.450C>T	9.37:g.103212870C>T		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	86.0	NM_001198805	B2RC35|Q5T726|Q5T727|Q5T728	Silent	SNP	ENST00000395067.2	37	CCDS6749.1																																																																																			.		0.368	MSANTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053410.1	NM_080655	
TMEFF1	8577	hgsc.bcm.edu;bcgsc.ca	37	9	103312401	103312401	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:103312401G>A	ENST00000374879.4	+	7	1166	c.734G>A	c.(733-735)gGa>gAa	p.G245E	MSANTD3-TMEFF1_ENST00000502978.1_Silent_p.G208G|TMEFF1_ENST00000334943.6_Missense_Mutation_p.G206E	NM_003692.4	NP_003683.2	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 1	245					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(7)|lung(9)|stomach(1)	19		Acute lymphoblastic leukemia(62;0.0452)				AGTTTGTTGGGAAAGAAAGAT	0.363																																					p.G319E		.											.	.	.	0			c.G956A						.						127.0	119.0	122.0					9																	103312401		2203	4300	6503	SO:0001583	missense	100526694	exon7			TGTTGGGAAAGAA	U19878	CCDS6750.1	9q31	2010-05-04			ENSG00000241697	ENSG00000241697			11866	protein-coding gene	gene with protein product	"""tomoregulin-1"", ""cancer/testis antigen family 120, member 1"""	603421		C9orf2		9730596	Standard	NM_003692		Approved	H7365, CT120.1		Q8IYR6	OTTHUMG00000020367	ENST00000374879.4:c.734G>A	9.37:g.103312401G>A	ENSP00000364013:p.Gly245Glu	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_001198812	Q13086|Q8N3T8	Missense_Mutation	SNP	ENST00000374879.4	37	CCDS6750.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099068	0.76983	.	.	ENSG00000241697	ENST00000334943;ENST00000374879	T;T	0.57273	0.44;0.41	5.74	5.74	0.90152	.	0.109197	0.64402	D	0.000006	T	0.53867	0.1823	N	0.14661	0.345	0.80722	D	1	P;D	0.76494	0.893;0.999	P;D	0.71656	0.706;0.974	T	0.45906	-0.9229	10	0.11182	T	0.66	-35.667	17.4089	0.87480	0.0:0.0:1.0:0.0	.	245;206	Q8IYR6;Q8IYR6-2	TEFF1_HUMAN;.	E	206;245	ENSP00000334447:G206E;ENSP00000364013:G245E	ENSP00000334447:G206E	G	+	2	0	TMEFF1	102352222	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.774000	0.75012	2.702000	0.92279	0.585000	0.79938	GGA	.		0.363	TMEFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053418.1	NM_003692	
MUC4	4585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	195517320	195517320	+	Silent	SNP	G	G	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:195517320G>C	ENST00000463781.3	-	2	1590	c.1131C>G	c.(1129-1131)acC>acG	p.T377T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T377T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	382					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGGGGATGAGGTGGTTGTTT	0.458																																					p.T377T		.											.	MUC4	90	0			c.C1131G						.						225.0	207.0	213.0					3																	195517320		1956	4143	6099	SO:0001819	synonymous_variant	4585	exon2			GGATGAGGTGGTT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.1131C>G	3.37:g.195517320G>C		Somatic	394.0	0.0		WXS	Illumina HiSeq	Phase_I	377.0	117.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.458	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MYLK2	85366	hgsc.bcm.edu;bcgsc.ca	37	20	30419870	30419870	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr20:30419870C>A	ENST00000375994.2	+	11	1914	c.1641C>A	c.(1639-1641)gcC>gcA	p.A547A	MYLK2_ENST00000375985.4_Silent_p.A547A|MYLK2_ENST00000468730.1_3'UTR			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	547					cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CGGAGAAAGCCAAACGCTGTA	0.602																																					p.A547A		.											.	MYLK2	760	0			c.C1641A						.						46.0	36.0	40.0					20																	30419870		2203	4300	6503	SO:0001819	synonymous_variant	85366	exon12			GAAAGCCAAACGC	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1641C>A	20.37:g.30419870C>A		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	6.0	NM_033118	Q569L1|Q96I84	Silent	SNP	ENST00000375994.2	37	CCDS13191.1																																																																																			.		0.602	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	NM_033118	
MYO9A	4649	hgsc.bcm.edu;bcgsc.ca	37	15	72196317	72196317	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:72196317T>C	ENST00000356056.5	-	21	3302	c.2830A>G	c.(2830-2832)Aca>Gca	p.T944A	MYO9A_ENST00000444904.1_Missense_Mutation_p.T925A|MYO9A_ENST00000424560.1_Missense_Mutation_p.T944A|MYO9A_ENST00000564571.1_Missense_Mutation_p.T944A|MYO9A_ENST00000566885.1_Missense_Mutation_p.T564A|MYO9A_ENST00000563542.1_5'UTR	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	944	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATTCGAACTGTTTCCAGCATC	0.378																																					p.T944A		.											.	MYO9A	93	0			c.A2830G						.						94.0	86.0	88.0					15																	72196317		2199	4297	6496	SO:0001583	missense	4649	exon21			GAACTGTTTCCAG	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.2830A>G	15.37:g.72196317T>C	ENSP00000348349:p.Thr944Ala	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	4.0	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	T	29.5	5.013916	0.93404	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864	D;D;D	0.87491	-2.26;-2.26;-2.26	5.24	5.24	0.73138	Myosin head, motor domain (2);	.	.	.	.	D	0.90978	0.7163	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.87578	0.998;0.978;0.992	D	0.89742	0.3934	9	0.33141	T	0.24	.	15.3061	0.73992	0.0:0.0:0.0:1.0	.	925;925;944	B2RTY4-2;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	A	944;944;925;925	ENSP00000348349:T944A;ENSP00000399162:T944A;ENSP00000398250:T925A	ENSP00000261864:T925A	T	-	1	0	MYO9A	69983371	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.499000	0.81566	2.203000	0.70933	0.533000	0.62120	ACA	.		0.378	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
MYOM1	8736	hgsc.bcm.edu;bcgsc.ca	37	18	3187546	3187546	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr18:3187546C>A	ENST00000356443.4	-	5	1194	c.861G>T	c.(859-861)acG>acT	p.T287T	MYOM1_ENST00000400569.3_Silent_p.T287T|RP13-270P17.2_ENST00000580139.1_RNA|MYOM1_ENST00000261606.7_Silent_p.T287T	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	287	Ig-like C2-type 1.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TCTCCCAAACCGTGTGGGAGC	0.428																																					p.T287T		.											.	MYOM1	94	0			c.G861T						.						138.0	132.0	134.0					18																	3187546		1972	4149	6121	SO:0001819	synonymous_variant	8736	exon5			CCAAACCGTGTGG	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.861G>T	18.37:g.3187546C>A		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Silent	SNP	ENST00000356443.4	37	CCDS45824.1																																																																																			.		0.428	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
MYOZ2	51778	hgsc.bcm.edu;bcgsc.ca	37	4	120079175	120079175	+	Splice_Site	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:120079175A>G	ENST00000307128.5	+	4	459		c.e4-1			NM_016599.4	NP_057683.1			myozenin 2											endometrium(1)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						GATTAAATACAGCACAGTATT	0.378																																					.		.											.	MYOZ2	90	0			c.247-2A>G						.						101.0	102.0	102.0					4																	120079175		2203	4300	6503	SO:0001630	splice_region_variant	51778	exon4			AAATACAGCACAG	AF249873	CCDS3711.1	4q26-q27	2014-09-17	2002-01-07	2002-01-11	ENSG00000172399	ENSG00000172399			1330	protein-coding gene	gene with protein product		605602	"""chromosome 4 open reading frame 5"""	C4orf5		8619474, 9110174	Standard	NM_016599		Approved	CS-1	uc003icp.4	Q9NPC6	OTTHUMG00000132968	ENST00000307128.5:c.247-1A>G	4.37:g.120079175A>G		Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_016599		Splice_Site	SNP	ENST00000307128.5	37	CCDS3711.1	.	.	.	.	.	.	.	.	.	.	A	18.29	3.592099	0.66219	.	.	ENSG00000172399	ENST00000307128	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9541	0.79871	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYOZ2	120298623	1.000000	0.71417	0.997000	0.53966	0.806000	0.45545	5.215000	0.65241	2.163000	0.67991	0.533000	0.62120	.	.		0.378	MYOZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256526.2		Intron
NAA16	79612	hgsc.bcm.edu;bcgsc.ca	37	13	41892974	41892974	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr13:41892974T>C	ENST00000379406.3	+	3	496	c.172T>C	c.(172-174)Tgt>Cgt	p.C58R	NAA16_ENST00000403412.3_Missense_Mutation_p.C58R|NAA16_ENST00000379367.3_Missense_Mutation_p.C58R	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	58					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						AACACTGAACTGTTTAGGAAA	0.294																																					p.C58R		.											.	NAA16	90	0			c.T172C						.						88.0	89.0	89.0					13																	41892974		2202	4294	6496	SO:0001583	missense	79612	exon3			CTGAACTGTTTAG	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.172T>C	13.37:g.41892974T>C	ENSP00000368716:p.Cys58Arg	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_001110798	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	37	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	T	19.92	3.916345	0.73098	.	.	ENSG00000172766	ENST00000379367;ENST00000379406;ENST00000403412	T;T;T	0.72394	0.74;0.74;-0.65	4.23	4.23	0.50019	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000002	D	0.84437	0.5472	M	0.88570	2.965	0.80722	D	1	D;D;P	0.89917	0.97;1.0;0.906	P;D;P	0.97110	0.665;1.0;0.57	D	0.84033	0.0360	10	0.21014	T	0.42	-10.8295	13.7888	0.63126	0.0:0.0:0.0:1.0	.	58;58;58	Q6N069;Q6N069-4;Q6N069-5	NAA16_HUMAN;.;.	R	58	ENSP00000368674:C58R;ENSP00000368716:C58R;ENSP00000386103:C58R	ENSP00000368674:C58R	C	+	1	0	NAA16	40790974	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.355000	0.79434	1.897000	0.54924	0.533000	0.62120	TGT	.		0.294	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
NAB1	4664	hgsc.bcm.edu;bcgsc.ca	37	2	191548468	191548468	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:191548468G>T	ENST00000337386.5	+	7	1471	c.1010G>T	c.(1009-1011)gGg>gTg	p.G337V	AC006460.2_ENST00000428032.1_RNA|NAB1_ENST00000409641.1_Missense_Mutation_p.G337V|AC006460.2_ENST00000411949.1_RNA|NAB1_ENST00000357215.5_Intron|NAB1_ENST00000545490.1_Intron|NAB1_ENST00000484774.1_3'UTR|NAB1_ENST00000409581.1_Missense_Mutation_p.G337V|AC006460.2_ENST00000421437.1_RNA	NM_005966.3	NP_005957.2	Q13506	NAB1_HUMAN	NGFI-A binding protein 1 (EGR1 binding protein 1)	337	Necessary for nuclear localization. {ECO:0000250}.				endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			CCACAGGATGGGTTTCCAGAT	0.358																																					p.G337V		.											.	NAB1	226	0			c.G1010T						.						70.0	72.0	71.0					2																	191548468		2203	4300	6503	SO:0001583	missense	4664	exon7			AGGATGGGTTTCC		CCDS2307.1	2q32.3-q33	2008-05-23			ENSG00000138386	ENSG00000138386			7626	protein-coding gene	gene with protein product	"""EGR1 binding protein 1"""	600800				7624335, 8668170, 9418898	Standard	XM_005246579		Approved		uc002usb.3	Q13506	OTTHUMG00000132689	ENST00000337386.5:c.1010G>T	2.37:g.191548468G>T	ENSP00000336894:p.Gly337Val	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	5.0	NM_005966	O75383|O75384|Q6GTU1|Q9UEV1	Missense_Mutation	SNP	ENST00000337386.5	37	CCDS2307.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.991187	0.54041	.	.	ENSG00000138386	ENST00000409581;ENST00000337386;ENST00000409641	.	.	.	5.14	5.14	0.70334	Nab1, C-terminal (1);	0.221327	0.47852	D	0.000218	T	0.56426	0.1984	L	0.27053	0.805	0.80722	D	1	P;P	0.37101	0.582;0.582	P;P	0.47299	0.543;0.543	T	0.59118	-0.7514	9	0.54805	T	0.06	-14.4149	15.9119	0.79479	0.0:0.0:1.0:0.0	.	337;337	B8ZZS2;Q13506	.;NAB1_HUMAN	V	337	.	ENSP00000336894:G337V	G	+	2	0	NAB1	191256713	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.179000	0.71974	2.675000	0.91044	0.650000	0.86243	GGG	.		0.358	NAB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255986.1	NM_005966	
NBEA	26960	hgsc.bcm.edu;bcgsc.ca	37	13	35517180	35517180	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr13:35517180G>T	ENST00000400445.3	+	1	757	c.223G>T	c.(223-225)Gca>Tca	p.A75S	NBEA_ENST00000540320.1_Missense_Mutation_p.A75S|NBEA_ENST00000310336.4_Missense_Mutation_p.A75S|NBEA_ENST00000379939.2_Missense_Mutation_p.A75S	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	75					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GATGAAATTCGCAGTGTTGAT	0.587																																					p.A75S		.											.	NBEA	144	0			c.G223T						.						118.0	130.0	126.0					13																	35517180		2088	4211	6299	SO:0001583	missense	26960	exon1			AAATTCGCAGTGT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.223G>T	13.37:g.35517180G>T	ENSP00000383295:p.Ala75Ser	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	5.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592953	0.86953	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	4.49	4.49	0.54785	.	0.186397	0.31542	N	0.007462	T	0.66607	0.2806	M	0.64567	1.98	0.80722	D	1	D	0.69078	0.997	D	0.74023	0.982	T	0.62676	-0.6804	10	0.13853	T	0.58	.	16.1514	0.81624	0.0:0.0:1.0:0.0	.	75	Q5T321	.	S	75	ENSP00000440951:A75S;ENSP00000383295:A75S;ENSP00000369271:A75S;ENSP00000308534:A75S	ENSP00000308534:A75S	A	+	1	0	NBEA	34415180	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.950000	0.93019	2.068000	0.61886	0.561000	0.74099	GCA	.		0.587	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NCAN	1463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	19359573	19359573	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:19359573C>A	ENST00000252575.6	+	14	3801	c.3702C>A	c.(3700-3702)taC>taA	p.Y1234*	NCAN_ENST00000538881.1_Nonsense_Mutation_p.Y685*	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1234	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.			Y -> N (in Ref. 1; AAC80576). {ECO:0000305}.	axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	AGGCCAAGTACAATGTCCATG	0.577																																					p.Y1234X		.											.	NCAN	94	0			c.C3702A						.						130.0	90.0	104.0					19																	19359573		2203	4300	6503	SO:0001587	stop_gained	1463	exon14			CAAGTACAATGTC	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3702C>A	19.37:g.19359573C>A	ENSP00000252575:p.Tyr1234*	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	60.0	NM_004386	Q9UPK6	Nonsense_Mutation	SNP	ENST00000252575.6	37	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	C	36	5.830964	0.97003	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	.	.	.	4.54	0.94	0.19513	.	0.273768	0.19634	N	0.109617	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.0681	0.25164	0.0:0.6342:0.0:0.3658	.	.	.	.	X	1248;1234;685	.	ENSP00000252575:Y1234X	Y	+	3	2	NCAN	19220573	0.974000	0.33945	0.989000	0.46669	0.867000	0.49689	0.350000	0.20079	0.056000	0.16144	-0.293000	0.09583	TAC	.		0.577	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386	
NKD1	85407	hgsc.bcm.edu;bcgsc.ca	37	16	50667325	50667325	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:50667325C>T	ENST00000268459.3	+	10	1270	c.1046C>T	c.(1045-1047)cCc>cTc	p.P349L		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	349					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		GTGAGGTCCCCCAAGGCCCAG	0.667																																					p.P349L		.											.	NKD1	226	0			c.C1046T						.						47.0	55.0	52.0					16																	50667325		2198	4300	6498	SO:0001583	missense	85407	exon10			GGTCCCCCAAGGC	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.1046C>T	16.37:g.50667325C>T	ENSP00000268459:p.Pro349Leu	Somatic	275.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	7.0	NM_033119	B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	37	CCDS10743.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.364808	0.82463	.	.	ENSG00000140807	ENST00000268459	T	0.80994	-1.44	4.18	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.81283	0.4790	M	0.65975	2.015	0.80722	D	1	P	0.39250	0.665	B	0.43728	0.429	T	0.80781	-0.1229	10	0.33141	T	0.24	-24.5648	14.8623	0.70389	0.0:1.0:0.0:0.0	.	349	Q969G9	NKD1_HUMAN	L	349	ENSP00000268459:P349L	ENSP00000268459:P349L	P	+	2	0	NKD1	49224826	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.057000	0.76669	2.162000	0.67917	0.460000	0.39030	CCC	.		0.667	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1		
NKX6-3	157848	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	41503971	41503971	+	Silent	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr8:41503971G>A	ENST00000524115.2	-	2	408	c.405C>T	c.(403-405)gtC>gtT	p.V135V		NM_152568.2	NP_689781.1	A6NJ46	NKX63_HUMAN	NK6 homeobox 3	265					cell fate determination (GO:0001709)|glandular epithelial cell differentiation (GO:0002067)|negative regulation of epithelial cell differentiation (GO:0030857)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(1)	1	Ovarian(28;0.00541)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Esophageal squamous(32;0.0844)|Hepatocellular(245;0.154)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GCGGGCGTCAGACGCTGTGCG	0.726																																					p.V135V		.											.	NKX6-3	90	0			c.C405T						.						20.0	19.0	20.0					8																	41503971		2195	4296	6491	SO:0001819	synonymous_variant	157848	exon2			GCGTCAGACGCTG	AK057898	CCDS6118.1	8p11.21	2014-08-12	2007-07-09		ENSG00000165066	ENSG00000165066		"""Homeoboxes / ANTP class : NKL subclass"""	26328	protein-coding gene	gene with protein product		610772	"""NK6 transcription factor related, locus 3 (Drosophila)"""			16326147	Standard	XM_005273422		Approved	FLJ25169	uc003xoa.2	A6NJ46	OTTHUMG00000164083	ENST00000524115.2:c.405C>T	8.37:g.41503971G>A		Somatic	97.0	1.0		WXS	Illumina HiSeq	Phase_I	97.0	43.0	NM_152568	Q96LR0	Silent	SNP	ENST00000524115.2	37	CCDS6118.1																																																																																			.		0.726	NKX6-3-002	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000377166.2	NM_152568	
NPPC	4880	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	232790144	232790144	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:232790144C>T	ENST00000409852.1	-	2	525	c.372G>A	c.(370-372)ctG>ctA	p.L124L	NPPC_ENST00000295440.2_Silent_p.L124L	NM_024409.2	NP_077720.1	P23582	ANFC_HUMAN	natriuretic peptide C	124					cGMP biosynthetic process (GO:0006182)|growth plate cartilage chondrocyte differentiation (GO:0003418)|growth plate cartilage chondrocyte proliferation (GO:0003419)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA metabolic process (GO:0051053)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of vasodilation (GO:0045909)|post-embryonic development (GO:0009791)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood vessel size (GO:0050880)|regulation of cAMP metabolic process (GO:0030814)|regulation of cGMP metabolic process (GO:0030823)|regulation of multicellular organism growth (GO:0040014)|regulation of smooth muscle cell proliferation (GO:0048660)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|single organism reproductive process (GO:0044702)	extracellular space (GO:0005615)|secretory granule (GO:0030141)	receptor binding (GO:0005102)						all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;9.35e-14)|BRCA - Breast invasive adenocarcinoma(100;0.00119)|LUSC - Lung squamous cell carcinoma(224;0.00746)|Lung(119;0.00834)		ACTAACATCCCAGGCCGCTCA	0.701																																					p.L124L		.											.	NPPC	90	0			c.G372A						.						30.0	37.0	34.0					2																	232790144		2192	4298	6490	SO:0001819	synonymous_variant	4880	exon2			ACATCCCAGGCCG		CCDS2489.1	2q37.1	2014-01-30	2010-11-09		ENSG00000163273	ENSG00000163273		"""Endogenous ligands"""	7941	protein-coding gene	gene with protein product		600296	"""natriuretic peptide precursor C"""			7698765, 8330189	Standard	NM_024409		Approved	CNP	uc002vsl.2	P23582	OTTHUMG00000133232	ENST00000409852.1:c.372G>A	2.37:g.232790144C>T		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	22.0	NM_024409	Q4ZG41	Silent	SNP	ENST00000409852.1	37	CCDS2489.1																																																																																			.		0.701	NPPC-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331011.1	NM_024409	
NPTX1	4884	hgsc.bcm.edu;bcgsc.ca	37	17	78445639	78445639	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:78445639C>A	ENST00000306773.4	-	4	1127	c.970G>T	c.(970-972)Ggg>Tgg	p.G324W	NPTX1_ENST00000575212.1_5'Flank	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	324	Pentaxin.				axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			TCCCAGACCCCGTCCCGGGTG	0.622																																					p.G324W		.											.	NPTX1	90	0			c.G970T						.						56.0	45.0	49.0					17																	78445639		2203	4300	6503	SO:0001583	missense	4884	exon4			AGACCCCGTCCCG	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.970G>T	17.37:g.78445639C>A	ENSP00000307549:p.Gly324Trp	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_002522	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.889179	0.91889	.	.	ENSG00000171246	ENST00000306773;ENST00000535681	T	0.23348	1.91	5.02	5.02	0.67125	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.68412	0.2998	H	0.97940	4.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81699	-0.0814	10	0.87932	D	0	-31.6303	18.1318	0.89604	0.0:1.0:0.0:0.0	.	324	Q15818	NPTX1_HUMAN	W	324;86	ENSP00000307549:G324W	ENSP00000307549:G324W	G	-	1	0	NPTX1	76060234	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	7.582000	0.82546	2.607000	0.88179	0.561000	0.74099	GGG	.		0.622	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
NRG2	9542	broad.mit.edu;bcgsc.ca	37	5	139232521	139232521	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:139232521G>T	ENST00000361474.1	-	7	1608	c.1384C>A	c.(1384-1386)Cgg>Agg	p.R462R	CTB-35F21.4_ENST00000504413.1_RNA|NRG2_ENST00000289422.7_Silent_p.R470R|NRG2_ENST00000394770.1_3'UTR|NRG2_ENST00000289409.4_Silent_p.R456R|NRG2_ENST00000541337.1_Silent_p.R396R|NRG2_ENST00000340391.3_Silent_p.R259R|NRG2_ENST00000358522.3_Silent_p.R464R|NRG2_ENST00000545385.1_Silent_p.R464R	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	462					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTCCAGCCGGGGGTGGCTG	0.627																																					p.R470R		.											.	NRG2	526	0			c.C1408A						.						50.0	55.0	53.0					5																	139232521		2203	4300	6503	SO:0001819	synonymous_variant	9542	exon8			CCAGCCGGGGGTG		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.1384C>A	5.37:g.139232521G>T		Somatic	164.0	1.0		WXS	Illumina HiSeq	Phase_I	163.0	8.0	NM_013982		Silent	SNP	ENST00000361474.1	37	CCDS4217.1																																																																																			.		0.627	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	
NUDT15	55270	hgsc.bcm.edu;bcgsc.ca	37	13	48611895	48611895	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr13:48611895G>A	ENST00000258662.2	+	1	193	c.13G>A	c.(13-15)Gca>Aca	p.A5T	SUCLA2_ENST00000543413.1_5'UTR	NM_018283.1	NP_060753.1	Q9NV35	NUD15_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 15	5					dGTP catabolic process (GO:0006203)|GTP catabolic process (GO:0006184)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity (GO:0035539)|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity (GO:0008413)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(1)	7		all_cancers(8;3.75e-25)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|all_hematologic(8;0.000219)|Lung NSC(96;0.000226)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;4.83e-07)		GACGGCCAGCGCACAGCCGCG	0.716											OREG0022405	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A5T		.											.	NUDT15	90	0			c.G13A						.																																			SO:0001583	missense	55270	exon1			GCCAGCGCACAGC		CCDS9407.1	13q14.12	2006-04-12			ENSG00000136159	ENSG00000136159		"""Nudix motif containing"""	23063	protein-coding gene	gene with protein product		615792				12767940	Standard	NM_018283		Approved	MTH2, FLJ10956	uc001vbw.1	Q9NV35	OTTHUMG00000016890	ENST00000258662.2:c.13G>A	13.37:g.48611895G>A	ENSP00000258662:p.Ala5Thr	Somatic	74.0	0.0	955	WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_018283	A2RUR6|Q32Q27|Q6P2C9	Missense_Mutation	SNP	ENST00000258662.2	37	CCDS9407.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846455	0.32606	.	.	ENSG00000136159	ENST00000258662	T	0.34859	1.34	4.72	2.97	0.34412	NUDIX hydrolase domain-like (1);	0.727696	0.13528	N	0.381185	T	0.26304	0.0642	L	0.40543	1.245	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.19321	-1.0309	10	0.26408	T	0.33	-5.0166	6.6964	0.23201	0.0964:0.1793:0.7243:0.0	.	5	Q9NV35	NUD15_HUMAN	T	5	ENSP00000258662:A5T	ENSP00000258662:A5T	A	+	1	0	NUDT15	47509896	0.009000	0.17119	0.001000	0.08648	0.000000	0.00434	1.572000	0.36461	0.718000	0.32166	-0.140000	0.14226	GCA	.		0.716	NUDT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044862.3	NM_018283	
NUP98	4928	hgsc.bcm.edu;bcgsc.ca	37	11	3716712	3716712	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:3716712T>C	ENST00000324932.7	-	26	4554	c.4134A>G	c.(4132-4134)agA>agG	p.R1378R	NUP98_ENST00000359171.4_Silent_p.R1378R|NUP98_ENST00000488828.1_5'UTR|NUP98_ENST00000355260.3_Silent_p.R1378R	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1395					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AGATGCGCAGTCTCTCATCCT	0.468			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.R1378R		.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98	703	0			c.A4134G						.						199.0	202.0	201.0					11																	3716712		2201	4298	6499	SO:0001819	synonymous_variant	4928	exon26			GCGCAGTCTCTCA	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4134A>G	11.37:g.3716712T>C		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_016320	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Silent	SNP	ENST00000324932.7	37	CCDS7746.1	.	.	.	.	.	.	.	.	.	.	T	7.320	0.616757	0.14129	.	.	ENSG00000110713	ENST00000429801	.	.	.	5.05	2.63	0.31362	.	.	.	.	.	T	0.53367	0.1792	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42172	-0.9467	4	.	.	.	-8.7075	5.0929	0.14718	0.0:0.314:0.1488:0.5372	.	.	.	.	A	331	.	.	T	-	1	0	NUP98	3673288	0.833000	0.29383	0.992000	0.48379	0.590000	0.36582	-0.014000	0.12656	0.319000	0.23209	0.456000	0.33151	ACT	.		0.468	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
OAS2	4939	hgsc.bcm.edu;bcgsc.ca	37	12	113444238	113444238	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:113444238A>G	ENST00000342315.4	+	8	1703	c.1489A>G	c.(1489-1491)Aca>Gca	p.T497A	RP1-71H24.1_ENST00000552784.1_RNA|OAS2_ENST00000392583.2_Missense_Mutation_p.T497A	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	497	OAS domain 2.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						TTCTGGCTCCACACCCAGCCC	0.463																																					p.T497A	Pancreas(199;709 2232 18410 33584 35052)	.											.	OAS2	91	0			c.A1489G						.						66.0	65.0	65.0					12																	113444238		2203	4300	6503	SO:0001583	missense	4939	exon8			GGCTCCACACCCA	M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.1489A>G	12.37:g.113444238A>G	ENSP00000342278:p.Thr497Ala	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_002535	A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	ENST00000342315.4	37	CCDS31906.1	.	.	.	.	.	.	.	.	.	.	.	10.07	1.249420	0.22880	.	.	ENSG00000111335	ENST00000342315;ENST00000392583	T;T	0.08546	3.08;3.08	4.51	-4.63	0.03359	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	1.183370	0.06544	N	0.743700	T	0.04003	0.0112	N	0.13043	0.29	0.09310	N	1	B;B	0.14805	0.011;0.005	B;B	0.18561	0.022;0.022	T	0.42275	-0.9461	10	0.44086	T	0.13	-18.8292	1.0937	0.01668	0.3049:0.2906:0.2632:0.1412	.	497;497	P29728;P29728-2	OAS2_HUMAN;.	A	497	ENSP00000342278:T497A;ENSP00000376362:T497A	ENSP00000342278:T497A	T	+	1	0	OAS2	111928621	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.022000	0.13511	-1.146000	0.02854	-0.290000	0.09829	ACA	.		0.463	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1		
OR2B3	442184	hgsc.bcm.edu;bcgsc.ca	37	6	29054566	29054566	+	Missense_Mutation	SNP	C	C	A	rs369975513		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:29054566C>A	ENST00000377173.2	-	1	524	c.460G>T	c.(460-462)Ggc>Tgc	p.G154C		NM_001005226.2	NP_001005226.1	O76000	OR2B3_HUMAN	olfactory receptor, family 2, subfamily B, member 3	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|lung(17)|prostate(1)|skin(2)	24						ACTGAGTTGCCGAAACCAATG	0.488																																					p.G154C		.											.	OR2B3	1	0			c.G460T						.						63.0	58.0	60.0					6																	29054566		2203	4300	6503	SO:0001583	missense	442184	exon1			AGTTGCCGAAACC		CCDS34358.1	6p22.2-p21.31	2012-08-09	2008-10-22	2008-10-22	ENSG00000204703	ENSG00000204703		"""GPCR / Class A : Olfactory receptors"""	8238	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 3 pseudogene"""	OR2B3P			Standard	NM_001005226		Approved	OR6-4	uc003nlx.3	O76000	OTTHUMG00000031226	ENST00000377173.2:c.460G>T	6.37:g.29054566C>A	ENSP00000366378:p.Gly154Cys	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	5.0	NM_001005226	B0UYQ1|Q5ST41|Q96R13	Missense_Mutation	SNP	ENST00000377173.2	37	CCDS34358.1	.	.	.	.	.	.	.	.	.	.	C	6.722	0.501960	0.12822	.	.	ENSG00000204703	ENST00000377173	T	0.37411	1.2	3.83	-0.243	0.13035	GPCR, rhodopsin-like superfamily (1);	0.341386	0.21456	U	0.074252	T	0.18087	0.0434	N	0.16368	0.405	0.09310	N	1	D	0.57899	0.981	D	0.63877	0.919	T	0.09952	-1.0651	10	0.62326	D	0.03	.	5.5456	0.17061	0.0:0.39:0.2112:0.3988	.	154	O76000	OR2B3_HUMAN	C	154	ENSP00000366378:G154C	ENSP00000366378:G154C	G	-	1	0	OR2B3	29162545	0.000000	0.05858	0.001000	0.08648	0.118000	0.20060	-3.800000	0.00363	-0.342000	0.08363	-0.409000	0.06214	GGC	.		0.488	OR2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076469.2		
OR2T3	343173	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	248637025	248637025	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:248637025A>G	ENST00000359594.2	+	1	399	c.374A>G	c.(373-375)tAt>tGt	p.Y125C		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCCATGGCCTATGACCGATAT	0.552																																					p.Y125C		.											.	OR2T3	69	0			c.A374G						.						53.0	52.0	53.0					1																	248637025		2195	4295	6490	SO:0001583	missense	343173	exon1			TGGCCTATGACCG		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.374A>G	1.37:g.248637025A>G	ENSP00000352604:p.Tyr125Cys	Somatic	545.0	0.0		WXS	Illumina HiSeq	Phase_I	787.0	209.0	NM_001005495	B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	37	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	a	9.872	1.199201	0.22121	.	.	ENSG00000196539	ENST00000359594	T	0.01347	4.99	2.65	2.65	0.31530	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.05364	0.0142	M	0.90425	3.115	0.24293	N	0.995155	P	0.51653	0.947	P	0.47786	0.557	T	0.15578	-1.0432	9	0.62326	D	0.03	.	9.7894	0.40697	1.0:0.0:0.0:0.0	.	125	Q8NH03	OR2T3_HUMAN	C	125	ENSP00000352604:Y125C	ENSP00000352604:Y125C	Y	+	2	0	OR2T3	246703648	0.247000	0.23920	0.864000	0.33941	0.357000	0.29423	0.550000	0.23345	0.967000	0.38186	0.156000	0.16432	TAT	.		0.552	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495	
OR8A1	390275	hgsc.bcm.edu;bcgsc.ca	37	11	124440852	124440852	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:124440852G>T	ENST00000284287.3	+	1	960	c.888G>T	c.(886-888)acG>acT	p.T296T		NM_001005194.1	NP_001005194.1	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A, member 1	296					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			haematopoietic_and_lymphoid_tissue(1)|lung(16)|ovary(2)|prostate(1)|skin(2)	22		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		TCTACACCACGGTAATCCCCA	0.468																																					p.T296T		.											.	OR8A1	69	0			c.G888T						.						79.0	70.0	73.0					11																	124440852		2201	4299	6500	SO:0001819	synonymous_variant	390275	exon1			CACCACGGTAATC	BK004495	CCDS31712.1	11q24.2	2012-08-09			ENSG00000196119	ENSG00000196119		"""GPCR / Class A : Olfactory receptors"""	8469	protein-coding gene	gene with protein product							Standard	NM_001005194		Approved	OST025	uc010san.2	Q8NGG7	OTTHUMG00000165923	ENST00000284287.3:c.888G>T	11.37:g.124440852G>T		Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	8.0	NM_001005194	Q6IEW7|Q96RC6	Silent	SNP	ENST00000284287.3	37	CCDS31712.1																																																																																			.		0.468	OR8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387062.1	NM_001005194	
OSBPL6	114880	hgsc.bcm.edu;bcgsc.ca	37	2	179197627	179197627	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:179197627G>T	ENST00000190611.4	+	8	892	c.516G>T	c.(514-516)tgG>tgT	p.W172C	OSBPL6_ENST00000357080.4_Missense_Mutation_p.W172C|OSBPL6_ENST00000409045.3_Missense_Mutation_p.W172C|OSBPL6_ENST00000392505.2_Missense_Mutation_p.W172C|OSBPL6_ENST00000359685.3_Missense_Mutation_p.W172C|OSBPL6_ENST00000409631.1_Missense_Mutation_p.W172C|OSBPL6_ENST00000315022.2_Missense_Mutation_p.W151C	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	172	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TTGATGCATGGGTCTCCAAAC	0.428																																					p.W172C		.											.	OSBPL6	69	0			c.G516T						.						162.0	156.0	158.0					2																	179197627		2203	4300	6503	SO:0001583	missense	114880	exon8			TGCATGGGTCTCC	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.516G>T	2.37:g.179197627G>T	ENSP00000190611:p.Trp172Cys	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	5.0	NM_001201482	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.775178	0.90108	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.58210	0.35;0.45;0.61;0.4;0.4;0.45;0.43	5.57	5.57	0.84162	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.83078	0.5176	H	0.96604	3.85	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;0.996;0.999;0.997;0.998	D	0.88211	0.2890	10	0.87932	D	0	-9.033	19.9215	0.97087	0.0:0.0:1.0:0.0	.	172;151;172;172;172;172	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	C	172;172;172;172;172;172;151	ENSP00000376293:W172C;ENSP00000352713:W172C;ENSP00000349591:W172C;ENSP00000387248:W172C;ENSP00000190611:W172C;ENSP00000386885:W172C;ENSP00000318723:W151C	ENSP00000190611:W172C	W	+	3	0	OSBPL6	178905873	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.813000	0.99286	2.785000	0.95823	0.655000	0.94253	TGG	.		0.428	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
PAM	5066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	102237061	102237061	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:102237061C>A	ENST00000438793.3	+	3	682	c.212C>A	c.(211-213)tCc>tAc	p.S71Y	PAM_ENST00000379787.4_5'UTR|PAM_ENST00000455264.2_Splice_Site_p.S71Y|PAM_ENST00000346918.2_Splice_Site_p.S71Y|PAM_ENST00000274392.9_Intron|PAM_ENST00000304400.7_Splice_Site_p.S71Y|PAM_ENST00000348126.2_Splice_Site_p.S71Y	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	71	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TTTTAATAGTCCGATACATAC	0.353																																					p.S71Y		.											.	PAM	68	0			c.C212A						.						98.0	100.0	99.0					5																	102237061		2203	4300	6503	SO:0001630	splice_region_variant	5066	exon3			AATAGTCCGATAC	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.211-1C>A	5.37:g.102237061C>A		Somatic	380.0	1.0		WXS	Illumina HiSeq	Phase_I	382.0	137.0	NM_138822	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	C	18.29	3.592299	0.66219	.	.	ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000455264	T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26	5.39	5.39	0.77823	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.000000	0.85682	D	0.000000	T	0.61362	0.2341	M	0.65975	2.015	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.998	D;D;P;D;D	0.91635	0.999;0.998;0.892;0.998;0.943	T	0.63001	-0.6734	10	0.72032	D	0.01	.	19.5261	0.95208	0.0:1.0:0.0:0.0	.	71;71;71;71;71	P19021;P19021-4;P19021-3;P19021-5;P19021-2	AMD_HUMAN;.;.;.;.	Y	71	ENSP00000396493:S71Y;ENSP00000282992:S71Y;ENSP00000314638:S71Y;ENSP00000306100:S71Y;ENSP00000403461:S71Y	ENSP00000306100:S71Y	S	+	2	0	PAM	102264960	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	5.307000	0.65762	2.668000	0.90789	0.650000	0.86243	TCC	.		0.353	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	Missense_Mutation
PC	5091	hgsc.bcm.edu;bcgsc.ca	37	11	66639169	66639169	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:66639169T>C	ENST00000393958.2	-	4	403	c.310A>G	c.(310-312)Aag>Gag	p.K104E	PC_ENST00000393955.2_Missense_Mutation_p.K104E|PC_ENST00000393960.1_Missense_Mutation_p.K104E|PC_ENST00000524491.1_Missense_Mutation_p.K64E|PC_ENST00000355677.3_Missense_Mutation_p.K104E	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	104	Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	TTGGCCACCTTGATGATGTCT	0.657																																					p.K104E		.											.	PC	228	0			c.A310G						.						21.0	21.0	21.0					11																	66639169		2175	4281	6456	SO:0001583	missense	5091	exon4			CCACCTTGATGAT	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.310A>G	11.37:g.66639169T>C	ENSP00000377530:p.Lys104Glu	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	4.0	NM_000920	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	T	10.02	1.236804	0.22711	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960;ENST00000524491;ENST00000355677	D;D;D;D;D	0.97328	-4.34;-4.34;-4.34;-4.34;-4.34	4.45	4.45	0.53987	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Biotin carboxylation domain (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.062464	0.64402	D	0.000010	D	0.88247	0.6385	N	0.01515	-0.825	0.46849	D	0.999229	B	0.10296	0.003	B	0.19666	0.026	D	0.84399	0.0559	10	0.10902	T	0.67	-30.511	11.7276	0.51718	0.0:0.0:0.0:1.0	.	104	P11498	PYC_HUMAN	E	104;104;104;64;104	ENSP00000377527:K104E;ENSP00000377530:K104E;ENSP00000377532:K104E;ENSP00000434192:K64E;ENSP00000347900:K104E	ENSP00000347900:K104E	K	-	1	0	PC	66395745	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.069000	0.50026	1.874000	0.54306	0.533000	0.62120	AAG	.		0.657	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
PCDHB11	56125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	140579924	140579924	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:140579924G>T	ENST00000354757.3	+	1	577	c.577G>T	c.(577-579)Gag>Tag	p.E193*	PCDHB11_ENST00000536699.1_Intron	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	193	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E193Q(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAATACCCCGAGTTAGTTCT	0.463																																					p.E193X		.											.	PCDHB11	96	1	Substitution - Missense(1)	NS(1)	c.G577T						.						62.0	65.0	64.0					5																	140579924		2203	4300	6503	SO:0001587	stop_gained	56125	exon1			TACCCCGAGTTAG	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.577G>T	5.37:g.140579924G>T	ENSP00000346802:p.Glu193*	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	262.0	123.0	NM_018931	B4DSF7|Q2M223	Nonsense_Mutation	SNP	ENST00000354757.3	37	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	G	34	5.355734	0.95854	.	.	ENSG00000197479	ENST00000354757	.	.	.	2.7	2.7	0.31948	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.3974	0.60861	0.0:0.0:1.0:0.0	.	.	.	.	X	193	.	ENSP00000346802:E193X	E	+	1	0	PCDHB11	140560108	1.000000	0.71417	0.739000	0.30968	0.889000	0.51656	9.162000	0.94745	1.496000	0.48567	0.467000	0.42956	GAG	.		0.463	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
PCDHB15	56121	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140626597	140626597	+	Missense_Mutation	SNP	C	C	G	rs532029427		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:140626597C>G	ENST00000231173.3	+	1	1451	c.1451C>G	c.(1450-1452)gCc>gGc	p.A484G		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	484	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCACCAACGCCCAGGTCACC	0.647																																					p.A484G		.											.	PCDHB15	156	0			c.C1451G						.						61.0	73.0	68.0					5																	140626597		2203	4296	6499	SO:0001583	missense	56121	exon1			CCAACGCCCAGGT	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1451C>G	5.37:g.140626597C>G	ENSP00000231173:p.Ala484Gly	Somatic	240.0	0.0		WXS	Illumina HiSeq	Phase_I	277.0	125.0	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	37	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.304160	0.60305	.	.	ENSG00000113248	ENST00000231173	T	0.51574	0.7	4.52	4.52	0.55395	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.41903	0.1179	N	0.17800	0.525	0.38899	D	0.957276	P	0.36125	0.538	B	0.43838	0.433	T	0.52034	-0.8629	9	0.72032	D	0.01	.	14.1287	0.65238	0.0:0.8486:0.1514:0.0	.	484	Q9Y5E8	PCDBF_HUMAN	G	484	ENSP00000231173:A484G	ENSP00000231173:A484G	A	+	2	0	PCDHB15	140606781	0.398000	0.25279	1.000000	0.80357	0.980000	0.70556	0.978000	0.29488	2.251000	0.74343	0.485000	0.47835	GCC	.		0.647	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
PCDHGA4	56111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140735864	140735864	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:140735864T>C	ENST00000571252.1	+	1	1097	c.1097T>C	c.(1096-1098)aTt>aCt	p.I366T	PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	366	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTACAGTAATTGCACTTTTC	0.453																																					p.I366T		.											.	.	.	0			c.T1097C						.						30.0	29.0	30.0					5																	140735864		1968	4109	6077	SO:0001583	missense	56111	exon1			CAGTAATTGCACT	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1097T>C	5.37:g.140735864T>C	ENSP00000458570:p.Ile366Thr	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	45.0	NM_018917	Q9Y5D3	Missense_Mutation	SNP	ENST00000571252.1	37	CCDS58979.1																																																																																			.		0.453	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
PDCD6IP	10015	broad.mit.edu;bcgsc.ca	37	3	33870347	33870347	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:33870347G>T	ENST00000307296.3	+	7	1097	c.720G>T	c.(718-720)gaG>gaT	p.E240D	PDCD6IP_ENST00000457054.2_Missense_Mutation_p.E245D			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	240	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.|Interaction with CHMP4A, CHMP4B and CHMP4C.|Interaction with EIAV p9.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						ATTTCCAGGAGGTGTTCCCTG	0.443																																					p.E245D		.											.	PDCD6IP	228	0			c.G735T						.						105.0	103.0	104.0					3																	33870347		2203	4300	6503	SO:0001583	missense	10015	exon7			CCAGGAGGTGTTC	BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.720G>T	3.37:g.33870347G>T	ENSP00000307387:p.Glu240Asp	Somatic	1129.0	2.0		WXS	Illumina HiSeq	Phase_I	1058.0	49.0	NM_001162429	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Missense_Mutation	SNP	ENST00000307296.3	37	CCDS2660.1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660738	0.29515	.	.	ENSG00000170248	ENST00000307296;ENST00000457054	T;T	0.18810	2.19;2.19	5.2	5.2	0.72013	BRO1 domain (3);	0.093279	0.64402	D	0.000001	T	0.14917	0.0360	N	0.16478	0.41	0.80722	D	1	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.12837	0.008;0.002;0.002	T	0.10200	-1.0640	10	0.12766	T	0.61	-20.2609	19.0901	0.93224	0.0:0.0:1.0:0.0	.	21;245;240	B7Z5C1;E9PFU1;Q8WUM4	.;.;PDC6I_HUMAN	D	240;245	ENSP00000307387:E240D;ENSP00000411825:E245D	ENSP00000307387:E240D	E	+	3	2	PDCD6IP	33845351	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.233000	0.58651	2.586000	0.87340	0.655000	0.94253	GAG	.		0.443	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
PDS5A	23244	hgsc.bcm.edu;bcgsc.ca	37	4	39910134	39910134	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:39910134G>T	ENST00000303538.8	-	11	1653	c.1114C>A	c.(1114-1116)Cca>Aca	p.P372T	PDS5A_ENST00000503396.1_Missense_Mutation_p.P372T	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						GCTTCTTCTGGATCATGTGAT	0.358																																					p.P372T		.											.	.	.	0			c.C1114A						.						118.0	109.0	111.0					4																	39910134		1838	4087	5925	SO:0001583	missense	23244	exon11			CTTCTGGATCATG	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1114C>A	4.37:g.39910134G>T	ENSP00000303427:p.Pro372Thr	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_001100399		Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	G	10.80	1.451583	0.26074	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	T;T	0.68331	-0.13;-0.32	4.93	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77329	0.4114	L	0.46741	1.465	0.80722	D	1	B;D	0.89917	0.328;1.0	B;D	0.97110	0.155;1.0	T	0.76083	-0.3089	9	.	.	.	-8.9094	18.1354	0.89617	0.0:0.0:1.0:0.0	.	372;372	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	T	372	ENSP00000303427:P372T;ENSP00000426749:P372T	.	P	-	1	0	PDS5A	39586529	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.843000	0.99491	2.285000	0.76669	0.557000	0.71058	CCA	.		0.358	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1	NM_015200	
PHF21A	51317	hgsc.bcm.edu;bcgsc.ca	37	11	46098351	46098351	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:46098351T>C	ENST00000418153.2	-	5	306	c.107A>G	c.(106-108)cAg>cGg	p.Q36R	PHF21A_ENST00000323180.6_Missense_Mutation_p.Q36R|PHF21A_ENST00000257821.4_Missense_Mutation_p.Q36R			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	36	Gln-rich.				blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						TTCATGAAGCTGTTTCTTTAA	0.373																																					p.Q36R		.											.	PHF21A	92	0			c.A107G						.						132.0	123.0	126.0					11																	46098351		2202	4299	6501	SO:0001583	missense	51317	exon5			TGAAGCTGTTTCT	AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.107A>G	11.37:g.46098351T>C	ENSP00000398824:p.Gln36Arg	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_016621	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	ENST00000418153.2	37	CCDS44578.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.949696	0.73787	.	.	ENSG00000135365	ENST00000257821;ENST00000323180;ENST00000418153;ENST00000524497;ENST00000531959;ENST00000529734;ENST00000529782;ENST00000533757	T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.55273	0.1910	N	0.24115	0.695	0.46317	D	0.998986	D;D	0.60160	0.987;0.981	D;D	0.70487	0.953;0.969	T	0.56257	-0.8009	10	0.44086	T	0.13	-4.1686	16.3786	0.83431	0.0:0.0:0.0:1.0	.	36;36	Q96BD5;Q96BD5-2	PF21A_HUMAN;.	R	36;36;36;43;43;36;13;36	ENSP00000257821:Q36R;ENSP00000323152:Q36R;ENSP00000398824:Q36R;ENSP00000431273:Q43R;ENSP00000432916:Q43R;ENSP00000436157:Q36R;ENSP00000435121:Q13R;ENSP00000432406:Q36R	ENSP00000257821:Q36R	Q	-	2	0	PHF21A	46054927	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.676000	0.74498	2.323000	0.78572	0.528000	0.53228	CAG	.		0.373	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392583.1	NM_016621	
PHF21B	112885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	45291935	45291935	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:45291935A>G	ENST00000313237.5	-	6	1010	c.860T>C	c.(859-861)cTg>cCg	p.L287P	PHF21B_ENST00000403565.1_Missense_Mutation_p.L83P|PHF21B_ENST00000396103.3_Missense_Mutation_p.L245P|PHF21B_ENST00000447824.3_Missense_Mutation_p.L233P|PHF21B_ENST00000404079.2_Missense_Mutation_p.L233P	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	287							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		CGTGGTAACCAGGCCTAGCGC	0.522																																					p.L287P		.											.	PHF21B	93	0			c.T860C						.						215.0	186.0	196.0					22																	45291935		2203	4300	6503	SO:0001583	missense	112885	exon6			GTAACCAGGCCTA	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.860T>C	22.37:g.45291935A>G	ENSP00000324403:p.Leu287Pro	Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	67.0	NM_138415	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	ENST00000313237.5	37	CCDS14061.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.254463	0.80135	.	.	ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000414269	T;T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01;0.01	5.23	5.23	0.72850	.	0.000000	0.52532	D	0.000062	T	0.75466	0.3853	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.999;0.999;0.999	T	0.77846	-0.2436	10	0.66056	D	0.02	-21.6784	14.1049	0.65083	1.0:0.0:0.0:0.0	.	233;245;233;287;83	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2;B1AHC5	.;.;.;PF21B_HUMAN;.	P	83;287;245;233;233;83	ENSP00000385053:L83P;ENSP00000324403:L287P;ENSP00000379410:L245P;ENSP00000385105:L233P;ENSP00000388619:L233P;ENSP00000401091:L83P	ENSP00000324403:L287P	L	-	2	0	PHF21B	43670599	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.799000	0.85936	1.954000	0.56735	0.460000	0.39030	CTG	.		0.522	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415	
PHKB	5257	hgsc.bcm.edu;bcgsc.ca	37	16	47545621	47545621	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:47545621T>C	ENST00000323584.5	+	5	475	c.451T>C	c.(451-453)Tct>Cct	p.S151P	PHKB_ENST00000455779.1_Missense_Mutation_p.S144P|PHKB_ENST00000299167.8_Missense_Mutation_p.S151P|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000566044.1_Missense_Mutation_p.S144P	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	151					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				ATGTCTTCACTCTGTTTTCAA	0.333																																					p.S151P		.											.	PHKB	154	0			c.T451C						.						144.0	125.0	132.0					16																	47545621		2201	4300	6501	SO:0001583	missense	5257	exon5			CTTCACTCTGTTT		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.451T>C	16.37:g.47545621T>C	ENSP00000313504:p.Ser151Pro	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	4.0	NM_000293	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	T	33	5.237119	0.95240	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.91631	-2.88;-2.88	5.87	5.87	0.94306	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.96147	0.8744	M	0.81942	2.565	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.99;0.982	D	0.96562	0.9416	10	0.87932	D	0	-24.1279	16.5764	0.84681	0.0:0.0:0.0:1.0	.	144;151;144	B4DQ16;Q93100;Q93100-4	.;KPBB_HUMAN;.	P	144;144;151	ENSP00000414345:S144P;ENSP00000313504:S151P	ENSP00000299167:S144P	S	+	1	0	PHKB	46103122	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.795000	0.85887	2.371000	0.80710	0.533000	0.62120	TCT	.		0.333	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
PIK3CD	5293	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	9781914	9781914	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:9781914A>G	ENST00000377346.4	+	16	2246	c.2051A>G	c.(2050-2052)aAg>aGg	p.K684R	PIK3CD_ENST00000543390.1_3'UTR|PIK3CD_ENST00000361110.2_Missense_Mutation_p.K708R|PIK3CD_ENST00000536656.1_Missense_Mutation_p.K708R	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	684					adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	GTGCTGATGAAGCAGGTGAGG	0.711											OREG0013082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K684R		.											.	PIK3CD	1311	0			c.A2051G						.						33.0	38.0	36.0					1																	9781914		2195	4292	6487	SO:0001583	missense	5293	exon16			TGATGAAGCAGGT		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.2051A>G	1.37:g.9781914A>G	ENSP00000366563:p.Lys684Arg	Somatic	33.0	0.0	659	WXS	Illumina HiSeq	Phase_I	28.0	4.0	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.699697	0.30142	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	D;D;D	0.82255	-1.59;-1.59;-1.59	5.9	4.78	0.61160	Phosphoinositide 3-kinase, accessory (PIK) domain (1);Protein kinase-like domain (1);	0.046560	0.85682	N	0.000000	T	0.69931	0.3166	N	0.16066	0.365	0.80722	D	1	P;P;B	0.36990	0.476;0.577;0.432	B;B;B	0.41619	0.361;0.191;0.344	T	0.63607	-0.6599	10	0.17832	T	0.49	-36.5769	8.3882	0.32512	0.8498:0.0:0.1502:0.0	.	683;708;684	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	R	708;684;708;708	ENSP00000446444:K708R;ENSP00000366563:K684R;ENSP00000354410:K708R	ENSP00000353766:K708R	K	+	2	0	PIK3CD	9704501	1.000000	0.71417	0.997000	0.53966	0.082000	0.17680	3.749000	0.55150	1.050000	0.40346	0.533000	0.62120	AAG	.		0.711	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
PIK3CD	5293	hgsc.bcm.edu;bcgsc.ca	37	1	9782115	9782115	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:9782115A>G	ENST00000377346.4	+	17	2333	c.2138A>G	c.(2137-2139)gAg>gGg	p.E713G	PIK3CD_ENST00000543390.1_3'UTR|PIK3CD_ENST00000361110.2_Missense_Mutation_p.E737G|PIK3CD_ENST00000536656.1_Missense_Mutation_p.E737G	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	713					adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	CAGACCAAGGAGCTGATGCAC	0.612											OREG0013082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E713G		.											.	PIK3CD	1311	0			c.A2138G						.						66.0	74.0	71.0					1																	9782115		2203	4300	6503	SO:0001583	missense	5293	exon17			CCAAGGAGCTGAT		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.2138A>G	1.37:g.9782115A>G	ENSP00000366563:p.Glu713Gly	Somatic	147.0	0.0	659	WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.795517	0.90453	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	D;D;D	0.82433	-1.61;-1.61;-1.61	5.4	5.4	0.78164	Protein kinase-like domain (1);	0.107748	0.64402	D	0.000006	D	0.88016	0.6324	L	0.61218	1.895	0.80722	D	1	P;D;D	0.57571	0.57;0.98;0.975	B;P;P	0.59056	0.334;0.851;0.821	D	0.89223	0.3572	10	0.72032	D	0.01	-40.3082	14.6236	0.68605	1.0:0.0:0.0:0.0	.	712;737;713	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	G	737;713;737;737	ENSP00000446444:E737G;ENSP00000366563:E713G;ENSP00000354410:E737G	ENSP00000353766:E737G	E	+	2	0	PIK3CD	9704702	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.194000	0.94962	2.045000	0.60652	0.459000	0.35465	GAG	.		0.612	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
PKD1L2	114780	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	81185495	81185495	+	RNA	SNP	T	T	C	rs546322359		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:81185495T>C	ENST00000525539.1	-	0	4429				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CACCAGGTCATAGACCAGCAC	0.532													T|||	1	0.000199681	0.0008	0.0	5008	,	,		17982	0.0		0.0	False		,,,				2504	0.0				.		.											.	PKD1L2	92	0			.						.						56.0	53.0	54.0					16																	81185495		1951	4143	6094			114780	.			AGGTCATAGACCA	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81185495T>C		Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	72.0	.	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000525539.1	37																																																																																				.		0.532	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
PLAGL1	5325	hgsc.bcm.edu;bcgsc.ca	37	6	144263706	144263706	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:144263706T>C	ENST00000360537.2	-	5	2160	c.247A>G	c.(247-249)Acc>Gcc	p.T83A	PLAGL1_ENST00000437412.1_Missense_Mutation_p.T31A|PLAGL1_ENST00000416623.1_Missense_Mutation_p.T83A|PLAGL1_ENST00000367572.1_Missense_Mutation_p.T31A|PLAGL1_ENST00000444202.1_Missense_Mutation_p.T83A|PLAGL1_ENST00000392307.1_Missense_Mutation_p.T31A|PLAGL1_ENST00000392309.1_Missense_Mutation_p.T83A|PLAGL1_ENST00000429150.1_Missense_Mutation_p.T83A|PLAGL1_ENST00000354765.2_Missense_Mutation_p.T83A|PLAGL1_ENST00000367571.1_Missense_Mutation_p.T83A			Q9UM63	PLAL1_HUMAN	pleiomorphic adenoma gene-like 1	83					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(1)|large_intestine(4)|lung(2)|prostate(1)|skin(3)|stomach(2)	13				OV - Ovarian serous cystadenocarcinoma(155;5.74e-07)|GBM - Glioblastoma multiforme(68;0.0885)		GGGTCGTGGGTCTGGAGGTGG	0.542											OREG0017707	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T83A		.											.	PLAGL1	91	0			c.A247G						.						124.0	114.0	118.0					6																	144263706		2203	4300	6503	SO:0001583	missense	5325	exon7			CGTGGGTCTGGAG	U81992	CCDS5202.1, CCDS5203.1	6q24-q25	2013-01-08			ENSG00000118495	ENSG00000118495		"""Zinc fingers, C2H2-type"""	9046	protein-coding gene	gene with protein product		603044				9722527, 9671765	Standard	NM_006718		Approved	ZAC, LOT1	uc003qkf.3	Q9UM63	OTTHUMG00000015738	ENST00000360537.2:c.247A>G	6.37:g.144263706T>C	ENSP00000353734:p.Thr83Ala	Somatic	42.0	0.0	1685	WXS	Illumina HiSeq	Phase_I	55.0	4.0	NM_001080953	B2RBA4|B2RCM8|E1P595|E1P597|O76019|Q7Z3V8|Q92981|Q96JR9|Q9UIZ0	Missense_Mutation	SNP	ENST00000360537.2	37	CCDS5202.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.021705	0.75275	.	.	ENSG00000118495	ENST00000360537;ENST00000354765;ENST00000444202;ENST00000429150;ENST00000392309;ENST00000416623;ENST00000437412;ENST00000392307;ENST00000367572;ENST00000367571;ENST00000417959	T;T;T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;2.73;2.73;2.73;1.55;2.73	6.16	3.75	0.43078	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.082393	0.52532	N	0.000071	T	0.27454	0.0674	L	0.45285	1.41	0.40727	D	0.982711	D	0.65815	0.995	P	0.62184	0.899	T	0.08411	-1.0723	10	0.72032	D	0.01	-23.0055	7.8278	0.29326	0.1236:0.0665:0.0:0.8099	.	83	Q9UM63	PLAL1_HUMAN	A	83;83;83;83;83;83;31;31;31;83;31	ENSP00000353734:T83A;ENSP00000346810:T83A;ENSP00000400929:T83A;ENSP00000398409:T83A;ENSP00000376125:T83A;ENSP00000400060:T83A;ENSP00000392418:T31A;ENSP00000376124:T31A;ENSP00000356544:T31A;ENSP00000356543:T83A;ENSP00000395960:T31A	ENSP00000346810:T83A	T	-	1	0	PLAGL1	144305399	1.000000	0.71417	0.754000	0.31244	0.990000	0.78478	7.977000	0.88081	0.547000	0.28938	0.528000	0.53228	ACC	.		0.542	PLAGL1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042541.1		
PLCXD2	257068	hgsc.bcm.edu;bcgsc.ca	37	3	111427204	111427204	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:111427204C>A	ENST00000477665.1	+	2	919	c.595C>A	c.(595-597)Ctg>Atg	p.L199M	PLCXD2_ENST00000393934.3_Missense_Mutation_p.L199M	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2	199	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						AAGTTTGACGCTGCGAACTCT	0.512																																					p.L199M		.											.	PLCXD2	227	0			c.C595A						.						63.0	62.0	62.0					3																	111427204		2203	4300	6503	SO:0001583	missense	257068	exon2			TTGACGCTGCGAA	AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.595C>A	3.37:g.111427204C>A	ENSP00000420686:p.Leu199Met	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	5.0	NM_001185106	Q96N12	Missense_Mutation	SNP	ENST00000477665.1	37	CCDS54619.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.195817	0.38806	.	.	ENSG00000240891	ENST00000393934;ENST00000477665	.	.	.	5.73	2.93	0.34026	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	.	.	.	.	T	0.79845	0.4516	M	0.88450	2.955	0.49915	D	0.999838	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81673	-0.0826	8	0.87932	D	0	-9.2257	10.3159	0.43736	0.0:0.768:0.0:0.232	.	199;199	Q0VAA5;Q0VAA5-2	PLCX2_HUMAN;.	M	199	.	ENSP00000377511:L199M	L	+	1	2	PLCXD2	112909894	0.992000	0.36948	0.030000	0.17652	0.135000	0.20990	2.953000	0.49105	0.881000	0.35993	0.655000	0.94253	CTG	.		0.512	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354322.1	NM_153268	
POLG	5428	hgsc.bcm.edu;bcgsc.ca	37	15	89876764	89876764	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:89876764C>A	ENST00000268124.5	-	2	555	c.222G>T	c.(220-222)ttG>ttT	p.L74F	RP11-217B1.2_ENST00000562356.1_RNA|POLG_ENST00000525806.1_5'Flank|RP11-217B1.2_ENST00000569473.1_RNA|POLG_ENST00000442287.2_Missense_Mutation_p.L74F	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	74					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			TCTGGATGTCCAATGGGTTGT	0.672								DNA polymerases (catalytic subunits)																													p.L74F	Colon(73;648 1203 11348 18386 27782)	.											.	POLG	228	0			c.G222T						.						42.0	37.0	38.0					15																	89876764		2200	4299	6499	SO:0001583	missense	5428	exon2			GATGTCCAATGGG	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.222G>T	15.37:g.89876764C>A	ENSP00000268124:p.Leu74Phe	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	4.0	NM_002693	Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.324251	0.60634	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.96885	-4.16;-4.16	5.07	5.07	0.68467	.	0.066963	0.64402	D	0.000018	D	0.97148	0.9068	M	0.65975	2.015	0.48830	D	0.999712	D	0.76494	0.999	D	0.85130	0.997	D	0.96671	0.9496	10	0.56958	D	0.05	-13.0334	8.5579	0.33492	0.2756:0.583:0.1414:0.0	.	74	P54098	DPOG1_HUMAN	F	74	ENSP00000268124:L74F;ENSP00000399851:L74F	ENSP00000268124:L74F	L	-	3	2	POLG	87677768	1.000000	0.71417	0.968000	0.41197	0.801000	0.45260	1.317000	0.33631	2.359000	0.80004	0.561000	0.74099	TTG	.		0.672	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
POLR3B	55703	hgsc.bcm.edu;bcgsc.ca	37	12	106824192	106824192	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:106824192C>T	ENST00000228347.4	+	14	1627	c.1405C>T	c.(1405-1407)Cgc>Tgc	p.R469C	POLR3B_ENST00000539066.1_Missense_Mutation_p.R411C	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	469					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						GAGTGGTCCTCGCTCCCTCCA	0.493																																					p.R469C		.											.	POLR3B	91	0			c.C1405T						.						114.0	105.0	108.0					12																	106824192		2203	4300	6503	SO:0001583	missense	55703	exon14			GGTCCTCGCTCCC	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.1405C>T	12.37:g.106824192C>T	ENSP00000228347:p.Arg469Cys	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	4.0	NM_018082	A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737375	0.89482	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066	D;D	0.97553	-4.43;-4.43	5.56	4.66	0.58398	RNA polymerase Rpb2, domain 3 (1);	0.000000	0.85682	D	0.000000	D	0.99124	0.9698	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98855	1.0760	10	0.87932	D	0	-12.6298	15.7308	0.77804	0.1378:0.8622:0.0:0.0	.	469	Q9NW08	RPC2_HUMAN	C	469;469;411	ENSP00000228347:R469C;ENSP00000445721:R411C	ENSP00000228347:R469C	R	+	1	0	POLR3B	105348322	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.452000	0.80683	1.301000	0.44836	0.655000	0.94253	CGC	.		0.493	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082	
PROX1	5629	hgsc.bcm.edu;bcgsc.ca	37	1	214170676	214170676	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:214170676G>T	ENST00000366958.4	+	2	1406	c.798G>T	c.(796-798)tcG>tcT	p.S266S	PROX1_ENST00000435016.1_Silent_p.S266S|PROX1_ENST00000498508.2_Silent_p.S266S|PROX1_ENST00000261454.4_Silent_p.S266S	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	266					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		GCACTGATTCGGAAAATGATG	0.522																																					p.S266S		.											.	PROX1	654	0			c.G798T						.						58.0	57.0	57.0					1																	214170676		2203	4300	6503	SO:0001819	synonymous_variant	5629	exon2			TGATTCGGAAAAT	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.798G>T	1.37:g.214170676G>T		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	4.0	NM_001270616	A6NK29|A8K2B1|Q5SW76|Q8TB91	Silent	SNP	ENST00000366958.4	37	CCDS31021.1																																																																																			.		0.522	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
PRR23A	729627	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	138725110	138725110	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:138725110T>C	ENST00000383163.2	-	1	0	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	MRPS22_ENST00000495075.1_Intron	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	1										endometrium(3)|kidney(1)|lung(7)	11						CGGCTGCCCATAGCCTCGACG	0.697																																					p.M1V		.											.	.	.	0			c.A1G						.						1.0	2.0	2.0					3																	138725110		348	1024	1372	SO:0001630	splice_region_variant	729627	exon1			TGCCCATAGCCTC		CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.1-1A>G	3.37:g.138725110T>C		Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	12.0	8.0	NM_001134659		Missense_Mutation	SNP	ENST00000383163.2	37	CCDS46923.1	.	.	.	.	.	.	.	.	.	.	T	7.219	0.597077	0.13875	.	.	ENSG00000206260	ENST00000383163	.	.	.	2.52	1.36	0.22044	.	1.434950	0.04639	N	0.405053	T	0.28566	0.0707	.	.	.	0.09310	N	1	B	0.24618	0.107	B	0.23716	0.048	T	0.22382	-1.0218	8	0.36615	T	0.2	.	4.0819	0.09931	0.0:0.1761:0.0:0.8239	.	1	A6NEV1	PR23A_HUMAN	V	1	.	ENSP00000372649:M1V	M	-	1	0	PRR23A	140207800	0.000000	0.05858	0.003000	0.11579	0.209000	0.24338	-0.245000	0.08890	0.407000	0.25591	0.379000	0.24179	ATG	.		0.697	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361503.1	NM_001134659	Missense_Mutation
PRSS12	8492	hgsc.bcm.edu;bcgsc.ca	37	4	119203115	119203115	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:119203115C>A	ENST00000296498.3	-	13	2886	c.2604G>T	c.(2602-2604)tgG>tgT	p.W868C	SNHG8_ENST00000384096.1_lincRNA|PRSS12_ENST00000510903.1_5'Flank	NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	868	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						CACTTTTTATCCAAGGTACAA	0.448																																					p.W868C		.											.	PRSS12	91	0			c.G2604T						.						94.0	96.0	96.0					4																	119203115		2203	4300	6503	SO:0001583	missense	8492	exon13			TTTTATCCAAGGT	AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.2604G>T	4.37:g.119203115C>A	ENSP00000296498:p.Trp868Cys	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_003619	Q9UP16	Missense_Mutation	SNP	ENST00000296498.3	37	CCDS3709.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676123	0.88445	.	.	ENSG00000164099	ENST00000296498	D	0.99121	-5.45	6.17	6.17	0.99709	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.99616	0.9860	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97998	1.0358	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	868	P56730	NETR_HUMAN	C	868	ENSP00000296498:W868C	ENSP00000296498:W868C	W	-	3	0	PRSS12	119422563	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.941000	0.99782	0.655000	0.94253	TGG	.		0.448	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256516.2		
PTGR2	145482	hgsc.bcm.edu;bcgsc.ca	37	14	74350824	74350824	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:74350824A>G	ENST00000555661.1	+	10	1145	c.1000A>G	c.(1000-1002)Aca>Gca	p.T334A	PTGR2_ENST00000555228.1_Missense_Mutation_p.T334A|ZNF410_ENST00000540593.1_5'Flank|ZNF410_ENST00000555044.1_5'Flank|PTGR2_ENST00000553813.1_Missense_Mutation_p.T200A|ZNF410_ENST00000324593.6_5'Flank|ZNF410_ENST00000442160.3_5'Flank|PTGR2_ENST00000267568.4_Missense_Mutation_p.T334A|RP5-1021I20.4_ENST00000556551.2_Missense_Mutation_p.T264A			Q8N8N7	PTGR2_HUMAN	prostaglandin reductase 2	334					prostaglandin metabolic process (GO:0006693)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)			NS(1)|large_intestine(3)|lung(2)|prostate(1)|skin(2)	9					Indomethacin(DB00328)	GTCCATGATGACAGGAGGTAA	0.333																																					p.T334A	Esophageal Squamous(98;1155 1417 16452 47043 47872)	.											.	PTGR2	90	0			c.A1000G						.						122.0	106.0	111.0					14																	74350824		2203	4298	6501	SO:0001583	missense	145482	exon10			ATGATGACAGGAG	AK096410	CCDS9820.1	14q24.1-q24.2	2008-06-04	2008-06-02	2008-06-03		ENSG00000140043			20149	protein-coding gene	gene with protein product		608642	"""zinc binding alcohol dehydrogenase domain containing 1"""	ZADH1		17449869	Standard	NM_152444		Approved	FLJ39091	uc001xow.3	Q8N8N7		ENST00000555661.1:c.1000A>G	14.37:g.74350824A>G	ENSP00000452280:p.Thr334Ala	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	4.0	NM_152444	Q3L8A4|Q6MZH8	Missense_Mutation	SNP	ENST00000555661.1	37	CCDS9820.1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.919849	0.52653	.	.	ENSG00000140043;ENSG00000140043;ENSG00000140043;ENSG00000258653	ENST00000555228;ENST00000555661;ENST00000267568;ENST00000553813	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	5.7	5.7	0.88788	GroES-like (1);	0.249108	0.45606	D	0.000359	T	0.58075	0.2097	L	0.28054	0.825	0.39287	D	0.964665	B	0.06786	0.001	B	0.06405	0.002	T	0.56492	-0.7970	10	0.32370	T	0.25	-14.5219	6.2839	0.21023	0.7847:0.0:0.0735:0.1418	.	334	Q8N8N7	PTGR2_HUMAN	A	334;334;334;200	ENSP00000450975:T334A;ENSP00000452280:T334A;ENSP00000267568:T334A;ENSP00000450824:T200A	ENSP00000267568:T334A	T	+	1	0	RP5-1021I20.4;PTGR2	73420577	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.446000	0.44908	2.175000	0.68902	0.533000	0.62120	ACA	.		0.333	PTGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412575.1		
PTPN9	5780	hgsc.bcm.edu;bcgsc.ca	37	15	75761250	75761250	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:75761250A>G	ENST00000306726.2	-	13	2154	c.1642T>C	c.(1642-1644)Tca>Cca	p.S548P		NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	548	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTCATGCGTGACACCGTCTGG	0.542																																					p.S548P		.											.	PTPN9	226	0			c.T1642C						.						98.0	80.0	86.0					15																	75761250		2197	4294	6491	SO:0001583	missense	5780	exon13			TGCGTGACACCGT		CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.1642T>C	15.37:g.75761250A>G	ENSP00000303554:p.Ser548Pro	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	4.0	NM_002833	Q53XR9	Missense_Mutation	SNP	ENST00000306726.2	37	CCDS10280.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.492680	0.64074	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	D	0.84070	-1.8	6.17	4.99	0.66335	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.326738	0.32987	N	0.005418	T	0.75693	0.3884	M	0.66439	2.03	0.40294	D	0.978539	P	0.45240	0.854	B	0.36534	0.227	T	0.77680	-0.2497	10	0.51188	T	0.08	.	4.2373	0.10632	0.6653:0.1864:0.1483:0.0	.	548	P43378	PTN9_HUMAN	P	548;538	ENSP00000303554:S548P	ENSP00000303554:S548P	S	-	1	0	PTPN9	73548303	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.971000	0.49248	2.371000	0.80710	0.533000	0.62120	TCA	.		0.542	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1		
RASGRF1	5923	hgsc.bcm.edu;bcgsc.ca	37	15	79254552	79254552	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:79254552A>G	ENST00000419573.3	-	28	4030	c.3756T>C	c.(3754-3756)tcT>tcC	p.S1252S	RASGRF1_ENST00000394745.3_Silent_p.S468S|RASGRF1_ENST00000558480.2_Silent_p.S1236S	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	1252	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CCATTACAAAAGATTGGTCCA	0.478																																					p.S1252S		.											.	RASGRF1	662	0			c.T3756C						.						67.0	65.0	66.0					15																	79254552		2196	4292	6488	SO:0001819	synonymous_variant	5923	exon28			TACAAAAGATTGG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3756T>C	15.37:g.79254552A>G		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	37	CCDS10309.1																																																																																			.		0.478	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
RASSF9	9182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	86198974	86198974	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:86198974G>A	ENST00000361228.3	-	2	1182	c.814C>T	c.(814-816)Cga>Tga	p.R272*		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	272					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)	p.R272*(2)		endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TATTTCAGTCGTTCTTCCAGC	0.398																																					p.R272X		.											.	RASSF9	23	2	Substitution - Nonsense(2)	large_intestine(2)	c.C814T						.						113.0	108.0	110.0					12																	86198974		1886	4108	5994	SO:0001587	stop_gained	9182	exon2			TCAGTCGTTCTTC		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.814C>T	12.37:g.86198974G>A	ENSP00000354884:p.Arg272*	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	35.0	NM_005447	B3KMQ4|Q8N5U8	Nonsense_Mutation	SNP	ENST00000361228.3	37	CCDS44950.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.685307	0.68157	.	.	ENSG00000198774	ENST00000361228	.	.	.	4.9	1.88	0.25563	.	0.581472	0.16373	U	0.217227	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-15.3805	10.6117	0.45425	0.0:0.1108:0.2861:0.6031	.	.	.	.	X	272	.	ENSP00000354884:R272X	R	-	1	2	RASSF9	84723105	0.009000	0.17119	0.003000	0.11579	0.198000	0.23893	0.492000	0.22435	0.148000	0.19059	-0.188000	0.12872	CGA	.		0.398	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		
RBM47	54502	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	40434757	40434757	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:40434757C>G	ENST00000381793.2	-	5	1849	c.1453G>C	c.(1453-1455)Gac>Cac	p.D485H	RBM47_ENST00000515809.1_5'UTR|RBM47_ENST00000381795.6_Missense_Mutation_p.D416H|RBM47_ENST00000319592.4_Missense_Mutation_p.D416H|RBM47_ENST00000514014.1_Missense_Mutation_p.D447H|RBM47_ENST00000295971.7_Missense_Mutation_p.D485H			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	485					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						CTGGCTGGGTCTGGCTGCACA	0.587																																					p.D485H		.											.	RBM47	25	0			c.G1453C						.						47.0	46.0	46.0					4																	40434757		2203	4300	6503	SO:0001583	missense	54502	exon6			CTGGGTCTGGCTG	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.1453G>C	4.37:g.40434757C>G	ENSP00000371212:p.Asp485His	Somatic	247.0	1.0		WXS	Illumina HiSeq	Phase_I	168.0	129.0	NM_001098634	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Missense_Mutation	SNP	ENST00000381793.2	37	CCDS43223.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672416	0.88348	.	.	ENSG00000163694	ENST00000319592;ENST00000381793;ENST00000381795;ENST00000295971;ENST00000514014	T;T;T;T;T	0.19938	2.24;2.11;2.24;2.11;2.14	4.78	4.78	0.61160	.	1.073180	0.07514	U	0.909410	T	0.42966	0.1226	L	0.53249	1.67	0.27697	N	0.945912	D;P	0.59767	0.986;0.641	P;B	0.59288	0.855;0.275	T	0.45220	-0.9276	10	0.48119	T	0.1	-45.0832	18.0004	0.89196	0.0:1.0:0.0:0.0	.	416;485	A0AV96-2;A0AV96	.;RBM47_HUMAN	H	416;485;416;485;447	ENSP00000320108:D416H;ENSP00000371212:D485H;ENSP00000371214:D416H;ENSP00000295971:D485H;ENSP00000423243:D447H	ENSP00000295971:D485H	D	-	1	0	RBM47	40129514	0.997000	0.39634	1.000000	0.80357	0.992000	0.81027	3.784000	0.55416	2.491000	0.84063	0.491000	0.48974	GAC	.		0.587	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
RCN1	5954	hgsc.bcm.edu;bcgsc.ca	37	11	32125951	32125951	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:32125951A>G	ENST00000054950.3	+	6	1222	c.929A>G	c.(928-930)aAc>aGc	p.N310S	RCN1_ENST00000532942.1_Missense_Mutation_p.N259S|RP1-65P5.3_ENST00000533009.1_RNA	NM_002901.2	NP_002892.1	Q15293	RCN1_HUMAN	reticulocalbin 1, EF-hand calcium binding domain	310	EF-hand 6. {ECO:0000255|PROSITE- ProRule:PRU00448}.				camera-type eye development (GO:0043010)|in utero embryonic development (GO:0001701)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)	17	Lung SC(675;0.225)					GAGAACTGGAACATGTTTGTC	0.403																																					p.N310S		.											.	RCN1	153	0			c.A929G						.						97.0	82.0	87.0					11																	32125951		2202	4299	6501	SO:0001583	missense	5954	exon6			ACTGGAACATGTT	D42073	CCDS7876.1	11p13	2013-01-10			ENSG00000049449	ENSG00000049449		"""EF-hand domain containing"""	9934	protein-coding gene	gene with protein product	"""proliferation-inducing gene 20"""	602735		RCN		9192846, 8586628	Standard	NM_002901		Approved	Rcal, PIG20, FLJ37041	uc010reb.2	Q15293		ENST00000054950.3:c.929A>G	11.37:g.32125951A>G	ENSP00000054950:p.Asn310Ser	Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	5.0	NM_002901	B7Z1M1|D3DR00	Missense_Mutation	SNP	ENST00000054950.3	37	CCDS7876.1	.	.	.	.	.	.	.	.	.	.	a	13.79	2.340836	0.41498	.	.	ENSG00000049449	ENST00000532942;ENST00000054950;ENST00000528630	T;T	0.53423	0.62;0.84	5.82	4.7	0.59300	EF-hand-like domain (1);	0.077381	0.85682	N	0.000000	T	0.46405	0.1391	M	0.62154	1.92	0.80722	D	1	B;B	0.23854	0.024;0.092	B;B	0.25884	0.036;0.064	T	0.42783	-0.9431	10	0.59425	D	0.04	-30.5925	11.5839	0.50908	0.9307:0.0:0.0693:0.0	.	310;259	Q15293;B7Z1M1	RCN1_HUMAN;.	S	259;310;7	ENSP00000436422:N259S;ENSP00000054950:N310S	ENSP00000054950:N310S	N	+	2	0	RCN1	32082527	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.312000	0.72840	1.045000	0.40225	0.533000	0.62120	AAC	.		0.403	RCN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388510.1	NM_002901	
RDH8	50700	hgsc.bcm.edu;bcgsc.ca	37	19	10131464	10131464	+	Silent	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:10131464G>A	ENST00000171214.1	+	4	771	c.522G>A	c.(520-522)ctG>ctA	p.L174L	RDH8_ENST00000591589.1_Silent_p.L194L	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	174					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	TCCAGCTGCTGCAGTTCAACA	0.567																																					p.L194L		.											.	RDH8	94	0			c.G582A						.						67.0	54.0	58.0					19																	10131464		2203	4300	6503	SO:0001819	synonymous_variant	50700	exon4			GCTGCTGCAGTTC	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.522G>A	19.37:g.10131464G>A		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_015725	Q9H838	Silent	SNP	ENST00000171214.1	37																																																																																				.		0.567	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
RGPD4	285190	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	108487607	108487607	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:108487607A>G	ENST00000408999.3	+	20	3224	c.3147A>G	c.(3145-3147)gaA>gaG	p.E1049E	RGPD4_ENST00000354986.4_Silent_p.E1049E	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1049	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AAAAAGTAGAACTTGTAATAG	0.408																																					p.E1049E		.											.	RGPD4	2	0			c.A3147G						.						14.0	10.0	11.0					2																	108487607		691	1577	2268	SO:0001819	synonymous_variant	285190	exon20			AGTAGAACTTGTA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3147A>G	2.37:g.108487607A>G		Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	47.0	NM_182588	B9A029	Silent	SNP	ENST00000408999.3	37	CCDS46381.1																																																																																			.		0.408	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
RHPN2	85415	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	33498926	33498926	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:33498926C>A	ENST00000254260.3	-	7	789	c.754G>T	c.(754-756)Gcc>Tcc	p.A252S	RHPN2_ENST00000400226.4_Missense_Mutation_p.A101S	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	252	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					ATACCTGCGGCTCTCTGAAAG	0.622																																					p.A252S		.											.	RHPN2	516	0			c.G754T						.						30.0	26.0	27.0					19																	33498926		2203	4299	6502	SO:0001583	missense	85415	exon7			CTGCGGCTCTCTG	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.754G>T	19.37:g.33498926C>A	ENSP00000254260:p.Ala252Ser	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	60.0	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013648	0.35511	.	.	ENSG00000131941	ENST00000254260;ENST00000400226	T;T	0.32023	1.47;1.47	4.21	4.21	0.49690	BRO1 domain (3);	0.163049	0.53938	D	0.000056	T	0.29976	0.0750	L	0.48362	1.52	0.53688	D	0.99997	P	0.36577	0.558	B	0.37267	0.245	T	0.08269	-1.0730	10	0.28530	T	0.3	-15.1431	16.9558	0.86259	0.0:1.0:0.0:0.0	.	252	Q8IUC4	RHPN2_HUMAN	S	252;101	ENSP00000254260:A252S;ENSP00000402244:A101S	ENSP00000254260:A252S	A	-	1	0	RHPN2	38190766	1.000000	0.71417	1.000000	0.80357	0.337000	0.28794	4.743000	0.62110	2.079000	0.62486	0.455000	0.32223	GCC	.		0.622	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
RICTOR	253260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	38950476	38950476	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:38950476T>A	ENST00000357387.3	-	31	3504	c.3474A>T	c.(3472-3474)caA>caT	p.Q1158H	RICTOR_ENST00000296782.5_Missense_Mutation_p.Q1158H	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					AAGTCTCTAATTGTAATGTTT	0.373																																					p.Q1158H		.											.	RICTOR	849	0			c.A3474T						.						168.0	171.0	170.0					5																	38950476		2203	4300	6503	SO:0001583	missense	253260	exon31			CTCTAATTGTAAT		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.3474A>T	5.37:g.38950476T>A	ENSP00000349959:p.Gln1158His	Somatic	309.0	1.0		WXS	Illumina HiSeq	Phase_I	427.0	190.0	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	T	11.42	1.634307	0.29068	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.44881	0.91;0.91	5.86	-0.886	0.10590	.	0.193901	0.53938	D	0.000058	T	0.19725	0.0474	N	0.08118	0	0.22684	N	0.99886	B;B	0.28584	0.216;0.216	B;B	0.31337	0.128;0.128	T	0.17440	-1.0369	10	0.87932	D	0	-15.0279	6.2372	0.20770	0.0:0.3467:0.2363:0.417	.	1158;1158	Q6R327;Q6R327-3	RICTR_HUMAN;.	H	1158	ENSP00000349959:Q1158H;ENSP00000296782:Q1158H	ENSP00000296782:Q1158H	Q	-	3	2	RICTOR	38986233	0.995000	0.38212	0.994000	0.49952	0.994000	0.84299	0.143000	0.16115	-0.010000	0.14271	0.528000	0.53228	CAA	.		0.373	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
RNASE4	6038	hgsc.bcm.edu;bcgsc.ca	37	14	21167714	21167714	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:21167714A>G	ENST00000555835.1	+	2	860	c.184A>G	c.(184-186)Atg>Gtg	p.M62V	RNASE4_ENST00000304704.4_Missense_Mutation_p.M62V|AL163636.6_ENST00000553909.1_3'UTR|RNASE4_ENST00000397995.2_Missense_Mutation_p.M62V|RP11-903H12.3_ENST00000554286.1_RNA|RNASE4_ENST00000555597.1_Missense_Mutation_p.M62V	NM_002937.3	NP_002928.1	P34096	RNAS4_HUMAN	ribonuclease, RNase A family, 4	62					cellular response to starvation (GO:0009267)|mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_cancers(95;0.00304)		Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	GBM - Glioblastoma multiforme(265;0.0133)		AAGACGGAAGATGACTTTGTA	0.498																																					p.M62V	Esophageal Squamous(59;1059 1362 26290 51151)	.											.	RNASE4	514	0			c.A184G						.						154.0	125.0	135.0					14																	21167714		2203	4300	6503	SO:0001583	missense	6038	exon2			CGGAAGATGACTT	U36775	CCDS9555.1	14q11	2014-07-16			ENSG00000258818	ENSG00000258818		"""Ribonucleases, RNase A"""	10047	protein-coding gene	gene with protein product		601030				7501448	Standard	NM_002937		Approved		uc001vxy.4	P34096	OTTHUMG00000029575	ENST00000555835.1:c.184A>G	14.37:g.21167714A>G	ENSP00000452245:p.Met62Val	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	4.0	NM_002937		Missense_Mutation	SNP	ENST00000555835.1	37	CCDS9555.1	.	.	.	.	.	.	.	.	.	.	A	18.60	3.659341	0.67586	.	.	ENSG00000258818;ENSG00000258818;ENSG00000258818;ENSG00000181784;ENSG00000181784;ENSG00000181784	ENST00000555835;ENST00000397995;ENST00000555597;ENST00000398001;ENST00000304704;ENST00000397999	T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02	5.81	5.81	0.92471	Ribonuclease A, domain (4);	0.112323	0.64402	D	0.000004	T	0.67608	0.2911	M	0.89715	3.055	0.35604	D	0.808104	D	0.67145	0.996	D	0.63283	0.913	T	0.80627	-0.1298	10	0.72032	D	0.01	-32.3892	12.8374	0.57782	1.0:0.0:0.0:0.0	.	62	P34096	RNAS4_HUMAN	V	62	ENSP00000452245:M62V;ENSP00000381081:M62V;ENSP00000451624:M62V;ENSP00000381087:M62V;ENSP00000307096:M62V;ENSP00000381085:M62V	ENSP00000307096:M62V	M	+	1	0	AL163636.2;RNASE4	20237554	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	3.185000	0.50934	2.343000	0.79666	0.533000	0.62120	ATG	.		0.498	RNASE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073729.3		
RNF123	63891	hgsc.bcm.edu;bcgsc.ca	37	3	49735904	49735904	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:49735904C>T	ENST00000327697.6	+	8	659	c.515C>T	c.(514-516)gCc>gTc	p.A172V	RNF123_ENST00000432042.1_Missense_Mutation_p.A26V	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	172	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		AACTCCTATGCCTATGATGGC	0.572																																					p.A172V		.											.	RNF123	584	0			c.C515T						.						82.0	74.0	77.0					3																	49735904		2203	4300	6503	SO:0001583	missense	63891	exon8			CCTATGCCTATGA	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.515C>T	3.37:g.49735904C>T	ENSP00000328287:p.Ala172Val	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	5.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	C	36	5.628320	0.96671	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.71103	-0.54;-0.54	4.96	4.96	0.65561	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.117675	0.56097	D	0.000030	D	0.84871	0.5568	M	0.80616	2.505	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	D	0.86731	0.1948	10	0.87932	D	0	-25.1749	17.731	0.88377	0.0:1.0:0.0:0.0	.	172	Q5XPI4	RN123_HUMAN	V	172;172;26	ENSP00000328287:A172V;ENSP00000392443:A26V	ENSP00000328287:A172V	A	+	2	0	RNF123	49710908	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.960000	0.76036	2.735000	0.93741	0.561000	0.74099	GCC	.		0.572	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
RNF128	79589	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	X	105970375	105970375	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:105970375G>T	ENST00000255499.2	+	1	482	c.232G>T	c.(232-234)Gag>Tag	p.E78*	RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	78	PA.				negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						CTCGCCGCTGGAGCCTGTGGC	0.677																																					p.E78X		.											.	RNF128	227	0			c.G232T						.						15.0	13.0	14.0					X																	105970375		2146	4174	6320	SO:0001587	stop_gained	79589	exon1			CCGCTGGAGCCTG	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.232G>T	X.37:g.105970375G>T	ENSP00000255499:p.Glu78*	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	75.0	NM_194463	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Nonsense_Mutation	SNP	ENST00000255499.2	37	CCDS14521.1	.	.	.	.	.	.	.	.	.	.	g	40	8.078396	0.98643	.	.	ENSG00000133135	ENST00000255499	.	.	.	4.7	4.7	0.59300	.	0.763681	0.12066	N	0.502641	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	10.5584	0.45131	0.0:0.1912:0.8088:0.0	.	.	.	.	X	78	.	ENSP00000255499:E78X	E	+	1	0	RNF128	105857031	0.996000	0.38824	0.985000	0.45067	0.975000	0.68041	1.794000	0.38774	2.082000	0.62665	0.509000	0.49947	GAG	.		0.677	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	
ROR2	4920	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	94495611	94495611	+	Missense_Mutation	SNP	G	G	A	rs148340413	byFrequency	TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:94495611G>A	ENST00000375708.3	-	6	928	c.730C>T	c.(730-732)Cgg>Tgg	p.R244W	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Missense_Mutation_p.R104W	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	244	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.		R -> Q (in dbSNP:rs55737262). {ECO:0000269|PubMed:17344846}.		cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TTGGGTGTCCGGGAGCGCGCG	0.647													G|||	5	0.000998403	0.0008	0.0	5008	,	,		11558	0.0		0.0	False		,,,				2504	0.0041				p.R244W		.											.	ROR2	1471	0			c.C730T	GRCh37	CM074998	ROR2	M	rs148340413	.	G	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	41.0	39.0	40.0		730	2.4	1.0	9	dbSNP_134	40	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ROR2	NM_004560.3	101	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	probably-damaging	244/944	94495611	3,13003	2203	4300	6503	SO:0001583	missense	4920	exon6			GTGTCCGGGAGCG	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.730C>T	9.37:g.94495611G>A	ENSP00000364860:p.Arg244Trp	Somatic	159.0	1.0		WXS	Illumina HiSeq	Phase_I	227.0	107.0	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	37	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570989	0.65765	4.54E-4	1.16E-4	ENSG00000169071	ENST00000375715;ENST00000375708	T;T	0.77098	0.52;-1.07	4.44	2.38	0.29361	Frizzled domain (2);Kringle (1);	0.000000	0.38164	N	0.001794	T	0.81545	0.4845	L	0.46157	1.445	0.52501	D	0.999954	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.61658	0.849;0.88;0.892	D	0.83454	0.0050	10	0.66056	D	0.02	.	14.0428	0.64687	0.0:0.0:0.7148:0.2852	.	244;244;104	A1L4F5;Q01974;B1APY4	.;ROR2_HUMAN;.	W	104;244	ENSP00000364867:R104W;ENSP00000364860:R244W	ENSP00000364860:R244W	R	-	1	2	ROR2	93535432	0.070000	0.21116	1.000000	0.80357	0.926000	0.56050	0.687000	0.25407	1.067000	0.40740	0.561000	0.74099	CGG	G|1.000;A|0.000		0.647	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
RPS6KA3	6197	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	20181109	20181109	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:20181109C>T	ENST00000379565.3	-	19	2021	c.1814G>A	c.(1813-1815)gGt>gAt	p.G605D	RPS6KA3_ENST00000544447.1_Missense_Mutation_p.G577D|RPS6KA3_ENST00000479809.1_5'UTR|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.G576D|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.G575D	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	605	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	GAGTAGGACACCAAGACTCCA	0.333																																					p.G605D		.											.	RPS6KA3	1504	0			c.G1814A						.						173.0	147.0	156.0					X																	20181109		2203	4300	6503	SO:0001583	missense	6197	exon19			AGGACACCAAGAC	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1814G>A	X.37:g.20181109C>T	ENSP00000368884:p.Gly605Asp	Somatic	411.0	1.0		WXS	Illumina HiSeq	Phase_I	366.0	24.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	37	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672227	0.88348	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.04	5.04	0.67666	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95655	0.8587	H	0.99726	4.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98350	1.0543	10	0.87932	D	0	.	17.5875	0.87986	0.0:1.0:0.0:0.0	.	576;575;577;605	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	D	605;577;575;576	ENSP00000368884:G605D;ENSP00000440220:G577D;ENSP00000368865:G575D;ENSP00000444837:G576D	ENSP00000368865:G575D	G	-	2	0	RPS6KA3	20091030	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.818000	0.86416	2.080000	0.62538	0.415000	0.27848	GGT	.		0.333	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
RPGR	6103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	38145015	38145015	+	Intron	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:38145015C>A	ENST00000339363.3	-	14	2688				RPGR_ENST00000378505.2_Missense_Mutation_p.R1079S|RPGR_ENST00000309513.3_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000318842.7_Intron|RPGR_ENST00000338898.3_Intron|RPGR_ENST00000342811.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CTCCATCCTGCCTTTCATTCT	0.423																																					p.R1079S		.											.	RPGR	131	0			c.G3237T						.						408.0	328.0	355.0					X																	38145015		2202	4300	6502	SO:0001627	intron_variant	6103	exon15			ATCCTGCCTTTCA	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+1331G>T	X.37:g.38145015C>A		Somatic	834.0	1.0		WXS	Illumina HiSeq	Phase_I	745.0	365.0	NM_001034853	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	37		.	.	.	.	.	.	.	.	.	.	c	9.446	1.089200	0.20390	.	.	ENSG00000156313	ENST00000378505	T	0.02197	4.4	2.56	1.49	0.22878	.	1.292120	0.05640	U	0.583284	T	0.02304	0.0071	L	0.48642	1.525	0.40039	D	0.975626	P	0.37233	0.588	B	0.20955	0.032	T	0.50939	-0.8768	10	0.87932	D	0	.	5.1985	0.15250	0.3421:0.6579:0.0:0.0	.	1079	E9PE28	.	S	1079	ENSP00000367766:R1079S	ENSP00000367766:R1079S	R	-	3	2	RPGR	38029959	0.000000	0.05858	0.035000	0.18076	0.523000	0.34469	-0.557000	0.05985	1.252000	0.44001	0.339000	0.21740	AGG	.		0.423	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328	
RSL1D1	26156	hgsc.bcm.edu;bcgsc.ca	37	16	11935611	11935611	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:11935611A>G	ENST00000571133.1	-	7	868	c.796T>C	c.(796-798)Tcg>Ccg	p.S266P	RSL1D1_ENST00000542106.1_Missense_Mutation_p.S46P	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	266					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						CTGACAAACGAGGAAAAGATG	0.363																																					p.S266P		.											.	RSL1D1	90	0			c.T796C						.						73.0	74.0	73.0					16																	11935611		2197	4300	6497	SO:0001583	missense	26156	exon7			CAAACGAGGAAAA	AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.796T>C	16.37:g.11935611A>G	ENSP00000460871:p.Ser266Pro	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	5.0	NM_015659	B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Missense_Mutation	SNP	ENST00000571133.1	37	CCDS10551.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.393795	0.42410	.	.	ENSG00000171490	ENST00000355674;ENST00000396503;ENST00000542106	T	0.51817	0.69	4.91	4.91	0.64330	.	0.072138	0.56097	D	0.000021	T	0.65407	0.2688	M	0.78456	2.415	0.46927	D	0.999259	D;D	0.76494	0.999;0.999	D;D	0.70227	0.949;0.968	T	0.68938	-0.5277	10	0.66056	D	0.02	-7.6655	9.1436	0.36919	0.8164:0.1836:0.0:0.0	.	266;266	Q32Q62;O76021	.;RL1D1_HUMAN	P	265;266;46	ENSP00000347897:S265P	ENSP00000347897:S265P	S	-	1	0	RSL1D1	11843112	1.000000	0.71417	0.876000	0.34364	0.081000	0.17604	4.390000	0.59646	1.975000	0.57531	0.397000	0.26171	TCG	.		0.363	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252059.2	NM_015659	
SBNO1	55206	hgsc.bcm.edu;bcgsc.ca	37	12	123798234	123798234	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:123798234T>C	ENST00000602398.1	-	24	3280	c.3153A>G	c.(3151-3153)aaA>aaG	p.K1051K	SBNO1_ENST00000420886.2_Silent_p.K1051K|SBNO1_ENST00000602750.1_Silent_p.K1050K|SBNO1_ENST00000267176.4_Silent_p.K1050K			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1051					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TTACAATGGATTTCATGACAA	0.333																																					p.K1051K		.											.	SBNO1	292	0			c.A3153G						.						73.0	74.0	73.0					12																	123798234		2203	4300	6503	SO:0001819	synonymous_variant	55206	exon23			AATGGATTTCATG	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.3153A>G	12.37:g.123798234T>C		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Silent	SNP	ENST00000602398.1	37	CCDS53844.1																																																																																			.		0.333	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
SCEL	8796	hgsc.bcm.edu;bcgsc.ca	37	13	78130761	78130761	+	Missense_Mutation	SNP	G	G	T	rs200836262		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr13:78130761G>T	ENST00000349847.3	+	3	158	c.74G>T	c.(73-75)cGg>cTg	p.R25L	SCEL_ENST00000377246.3_Missense_Mutation_p.R25L|SCEL_ENST00000535157.1_Missense_Mutation_p.R25L	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	25					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)	p.R25L(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		GGAACCACACGGAAGCAGCAG	0.433																																					p.R25L		.											.	SCEL	95	1	Substitution - Missense(1)	lung(1)	c.G74T						.						182.0	187.0	186.0					13																	78130761		2203	4300	6503	SO:0001583	missense	8796	exon3			CCACACGGAAGCA	AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.74G>T	13.37:g.78130761G>T	ENSP00000302579:p.Arg25Leu	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	4.0	NM_003843	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	ENST00000349847.3	37	CCDS9459.1	.	.	.	.	.	.	.	.	.	.	g	0.005	-2.196575	0.00299	.	.	ENSG00000136155	ENST00000348770;ENST00000535157;ENST00000377246;ENST00000349847	T;T;T	0.21734	1.99;1.99;1.99	5.16	-2.02	0.07388	.	0.552403	0.15231	N	0.273429	T	0.04048	0.0113	N	0.00583	-1.355	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31475	-0.9942	10	0.30854	T	0.27	1.2565	2.1981	0.03916	0.3887:0.0711:0.2974:0.2428	.	25;25;25	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	L	25	ENSP00000437895:R25L;ENSP00000366454:R25L;ENSP00000302579:R25L	ENSP00000315127:R25L	R	+	2	0	SCEL	77028762	0.020000	0.18652	0.001000	0.08648	0.000000	0.00434	-0.378000	0.07446	-0.882000	0.03987	-3.487000	0.00034	CGG	.		0.433	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045339.2	NM_144777	
SCP2D1	140856	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	18794517	18794517	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr20:18794517G>T	ENST00000377428.2	+	1	148	c.58G>T	c.(58-60)Ggc>Tgc	p.G20C	C20orf78_ENST00000278779.4_Intron|C20orf78_ENST00000463425.1_5'Flank	NM_178483.2	NP_848578.1	Q9UJQ7	SCP2D_HUMAN	SCP2 sterol-binding domain containing 1	20																	ACCTCTGGTGGGCCAGTTCGA	0.517																																					p.G20C		.											.	.	.	0			c.G58T						.						105.0	100.0	101.0					20																	18794517		2203	4300	6503	SO:0001583	missense	140856	exon1			CTGGTGGGCCAGT	AL035563	CCDS13139.1	20p11.23	2012-10-29	2012-10-29	2012-10-29	ENSG00000132631	ENSG00000132631			16211	protein-coding gene	gene with protein product	"""sterol carrier protein 2-like protein"""		"""chromosome 20 open reading frame 79"""	C20orf79		16501878	Standard	NM_178483		Approved	dJ1068E13.2, HSD22	uc002wrk.3	Q9UJQ7	OTTHUMG00000031983	ENST00000377428.2:c.58G>T	20.37:g.18794517G>T	ENSP00000366645:p.Gly20Cys	Somatic	166.0	1.0		WXS	Illumina HiSeq	Phase_I	196.0	90.0	NM_178483	Q548A4	Missense_Mutation	SNP	ENST00000377428.2	37	CCDS13139.1	.	.	.	.	.	.	.	.	.	.	G	1.556	-0.538031	0.04082	.	.	ENSG00000132631	ENST00000377428	T	0.25579	1.79	5.74	1.54	0.23209	.	0.532673	0.18500	N	0.139383	T	0.15739	0.0379	N	0.17082	0.46	0.09310	N	1	B	0.33238	0.403	B	0.39419	0.299	T	0.16453	-1.0402	10	0.49607	T	0.09	-1.8299	4.4944	0.11830	0.2505:0.0:0.5906:0.1589	.	20	Q9UJQ7	CT079_HUMAN	C	20	ENSP00000366645:G20C	ENSP00000366645:G20C	G	+	1	0	C20orf79	18742517	0.001000	0.12720	0.002000	0.10522	0.003000	0.03518	0.280000	0.18790	0.061000	0.16311	0.467000	0.42956	GGC	.		0.517	SCP2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078193.1	NM_178483	
SEC24B	10427	hgsc.bcm.edu;bcgsc.ca	37	4	110453794	110453794	+	Splice_Site	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:110453794G>T	ENST00000265175.5	+	21	3445		c.e21-1		SEC24B_ENST00000399100.2_Splice_Site|SEC24B_ENST00000504968.2_Splice_Site	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TTTCTTTTCAGGGTGCAGTAC	0.398																																					.		.											.	SEC24B	137	0			c.3391-1G>T						.						111.0	102.0	105.0					4																	110453794		1892	4113	6005	SO:0001630	splice_region_variant	10427	exon21			TTTTCAGGGTGCA	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.3391-1G>T	4.37:g.110453794G>T		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	4.0	NM_006323	B7ZKM8|B7ZKN4|Q0VG08	Splice_Site	SNP	ENST00000265175.5	37	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323452	0.81580	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6544	0.95831	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC24B	110673243	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	9.244000	0.95423	2.647000	0.89833	0.467000	0.42956	.	.		0.398	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2		Intron
SEL1L3	23231	hgsc.bcm.edu;bcgsc.ca	37	4	25849271	25849271	+	Silent	SNP	G	G	T	rs200467510	byFrequency	TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:25849271G>T	ENST00000399878.3	-	2	500	c.378C>A	c.(376-378)ccC>ccA	p.P126P	SEL1L3_ENST00000513364.1_Intron|SEL1L3_ENST00000502949.1_5'UTR|SEL1L3_ENST00000264868.5_Silent_p.P91P	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	126						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						TTTTGTACACGGGAATGCTAC	0.393																																					p.P126P		.											.	.	.	0			c.C378A						.						109.0	100.0	103.0					4																	25849271		1878	4117	5995	SO:0001819	synonymous_variant	23231	exon2			GTACACGGGAATG	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.378C>A	4.37:g.25849271G>T		Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	4.0	NM_015187	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Silent	SNP	ENST00000399878.3	37	CCDS47037.1																																																																																			G|0.996;A|0.004		0.393	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187	
SEC24D	9871	hgsc.bcm.edu;bcgsc.ca	37	4	119666159	119666159	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:119666159T>C	ENST00000280551.6	-	14	2002	c.1764A>G	c.(1762-1764)gaA>gaG	p.E588E	SEC24D_ENST00000511481.1_Silent_p.E219E|SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000379735.5_Silent_p.E589E|SEC24D_ENST00000419654.2_Silent_p.E144E|SEC24D_ENST00000429811.2_Silent_p.E144E			O94855	SC24D_HUMAN	SEC24 family member D	588					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						TCCCTGGTGCTTCAGCAGTTG	0.388																																					p.E588E		.											.	SEC24D	90	0			c.A1764G						.						124.0	130.0	128.0					4																	119666159		2203	4300	6503	SO:0001819	synonymous_variant	9871	exon14			TGGTGCTTCAGCA	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1764A>G	4.37:g.119666159T>C		Somatic	252.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	7.0	NM_014822	Q8IYI7	Silent	SNP	ENST00000280551.6	37	CCDS3710.1																																																																																			.		0.388	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4		
SEMA6A	57556	hgsc.bcm.edu;bcgsc.ca	37	5	115823894	115823894	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:115823894T>C	ENST00000343348.6	-	9	1443		c.e9-2		SEMA6A_ENST00000510263.1_Splice_Site|CTB-118N6.3_ENST00000514214.1_RNA|SEMA6A_ENST00000503962.1_5'Flank|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000257414.8_Splice_Site|CTB-118N6.3_ENST00000508640.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A						apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		AGTATGGTTCTGTAGACAAAC	0.383																																					.		.											.	SEMA6A	92	0			c.656-2A>G						.						77.0	70.0	72.0					5																	115823894		1863	4111	5974	SO:0001630	splice_region_variant	57556	exon10			TGGTTCTGTAGAC	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.656-2A>G	5.37:g.115823894T>C		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	6.0	NM_020796	Q9P2H9	Splice_Site	SNP	ENST00000343348.6	37	CCDS47256.1	.	.	.	.	.	.	.	.	.	.	T	14.69	2.609553	0.46527	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000510263	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2215	0.82262	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEMA6A	115851793	1.000000	0.71417	0.999000	0.59377	0.446000	0.32137	7.997000	0.88414	2.367000	0.80283	0.528000	0.53228	.	.		0.383	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796	Intron
SEPT3	55964	hgsc.bcm.edu;bcgsc.ca	37	22	42377812	42377812	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:42377812C>A	ENST00000396426.3	+	2	429	c.174C>A	c.(172-174)acC>acA	p.T58T	SEPT3_ENST00000396425.3_Silent_p.T58T|SEPT3_ENST00000406029.1_Intron|SEPT3_ENST00000291236.11_Intron|CTA-250D10.19_ENST00000424613.1_RNA|SEPT3_ENST00000328414.8_Silent_p.T58T	NM_145733.2	NP_663786.2	Q9UH03	SEPT3_HUMAN	septin 3	58	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cell junction (GO:0030054)|septin complex (GO:0031105)|synapse (GO:0045202)	GTP binding (GO:0005525)			breast(1)|kidney(3)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	17						CCATGAAGACCGGTTTCGACT	0.572																																					p.T58T		.											.	SEPT3	68	0			c.C174A						.						126.0	99.0	109.0					22																	42377812		2203	4300	6503	SO:0001819	synonymous_variant	55964	exon2			GAAGACCGGTTTC	AF285107	CCDS14026.2, CCDS14027.2	22q13.2	2013-01-21			ENSG00000100167	ENSG00000100167		"""Septins"""	10750	protein-coding gene	gene with protein product		608314		SEP3			Standard	NM_019106		Approved		uc003bbr.4	Q9UH03	OTTHUMG00000030494	ENST00000396426.3:c.174C>A	22.37:g.42377812C>A		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	6.0	NM_019106	B1AHR0|Q2NKJ7|Q59GF7|Q6IBZ6|Q8N3P3|Q9HD35	Silent	SNP	ENST00000396426.3	37	CCDS14026.2																																																																																			.		0.572	SEPT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322051.1	NM_145734	
SERPINE2	5270	hgsc.bcm.edu;bcgsc.ca	37	2	224856708	224856708	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:224856708T>C	ENST00000258405.4	-	4	739	c.497A>G	c.(496-498)gAc>gGc	p.D166G	SERPINE2_ENST00000447280.2_Missense_Mutation_p.D178G|SERPINE2_ENST00000409840.3_Missense_Mutation_p.D166G|SERPINE2_ENST00000409304.1_Missense_Mutation_p.D166G	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	166					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CAGCAGATTGTCAATCATATC	0.488																																					p.D178G		.											.	SERPINE2	290	0			c.A533G						.						58.0	51.0	54.0					2																	224856708		2203	4300	6503	SO:0001583	missense	5270	exon4			AGATTGTCAATCA	M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.497A>G	2.37:g.224856708T>C	ENSP00000258405:p.Asp166Gly	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_001136530	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	ENST00000258405.4	37	CCDS2460.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.468784	0.43839	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738	D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81	5.8	5.8	0.92144	Serpin domain (3);	0.205916	0.52532	D	0.000077	T	0.81602	0.4857	L	0.44542	1.39	0.47862	D	0.999539	P;P	0.38395	0.629;0.488	B;B	0.37731	0.257;0.257	T	0.81141	-0.1068	10	0.38643	T	0.18	.	16.1506	0.81618	0.0:0.0:0.0:1.0	.	178;166	B4DIF2;P07093	.;GDN_HUMAN	G	166;166;166;178;166	ENSP00000386412:D166G;ENSP00000258405:D166G;ENSP00000386969:D166G;ENSP00000415786:D178G;ENSP00000408452:D166G	ENSP00000258405:D166G	D	-	2	0	SERPINE2	224564952	1.000000	0.71417	0.852000	0.33557	0.932000	0.56968	5.130000	0.64745	2.206000	0.71126	0.528000	0.53228	GAC	.		0.488	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	
SETD3	84193	hgsc.bcm.edu;bcgsc.ca	37	14	99927679	99927679	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:99927679T>C	ENST00000331768.5	-	4	356		c.e4-2		SETD3_ENST00000436070.2_Splice_Site|SETD3_ENST00000329331.3_Splice_Site|SETD3_ENST00000453938.1_Intron	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3						histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				CGGACAGACCTATATTAATCC	0.373																																					.		.											.	SETD3	514	0			c.197-2A>G						.						77.0	78.0	78.0					14																	99927679		2203	4299	6502	SO:0001630	splice_region_variant	84193	exon5			CAGACCTATATTA	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.197-2A>G	14.37:g.99927679T>C		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	4.0	NM_032233	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Splice_Site	SNP	ENST00000331768.5	37	CCDS9951.1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.451830	0.63290	.	.	ENSG00000183576	ENST00000331768;ENST00000329331;ENST00000436070	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8249	0.78690	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD3	98997432	1.000000	0.71417	0.945000	0.38365	0.664000	0.39144	7.965000	0.87945	2.194000	0.70268	0.533000	0.62120	.	.		0.373	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233	Intron
SEZ6L	23544	broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	26690288	26690288	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:26690288A>C	ENST00000248933.6	+	3	961	c.866A>C	c.(865-867)gAg>gCg	p.E289A	SEZ6L_ENST00000343706.4_Missense_Mutation_p.E289A|SEZ6L_ENST00000529632.2_Missense_Mutation_p.E289A|SEZ6L_ENST00000402979.1_Missense_Mutation_p.E62A|SEZ6L_ENST00000360929.3_Missense_Mutation_p.E289A|SEZ6L_ENST00000403121.1_Missense_Mutation_p.E62A|SEZ6L_ENST00000404234.3_Missense_Mutation_p.E289A			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	289	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						TCCAATCCTGAGGGGTACATT	0.517																																					p.E289A		.											.	SEZ6L	95	0			c.A866C						.						161.0	135.0	143.0					22																	26690288		2203	4300	6503	SO:0001583	missense	23544	exon3			ATCCTGAGGGGTA	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.866A>C	22.37:g.26690288A>C	ENSP00000248933:p.Glu289Ala	Somatic	168.0	1.0		WXS	Illumina HiSeq	Phase_I	105.0	8.0	NM_021115	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.465472	0.84425	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24;2.24;2.24	5.52	5.52	0.82312	CUB (5);	0.000000	0.53938	D	0.000044	T	0.44138	0.1279	M	0.77103	2.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.995;0.998;0.998;0.999;0.999;0.995	T	0.45205	-0.9277	10	0.87932	D	0	.	14.819	0.70055	1.0:0.0:0.0:0.0	.	289;289;62;289;289;289;289	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	A	289;289;289;289;289;62;62	ENSP00000384772:E289A;ENSP00000437037:E289A;ENSP00000354185:E289A;ENSP00000248933:E289A;ENSP00000342661:E289A;ENSP00000384838:E62A;ENSP00000384733:E62A	ENSP00000248933:E289A	E	+	2	0	SEZ6L	25020288	1.000000	0.71417	0.378000	0.26068	0.941000	0.58515	8.743000	0.91592	2.094000	0.63399	0.482000	0.46254	GAG	.		0.517	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
SFI1	9814	hgsc.bcm.edu;bcgsc.ca	37	22	31969140	31969140	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:31969140A>G	ENST00000400288.2	+	9	967	c.862A>G	c.(862-864)Aga>Gga	p.R288G	SFI1_ENST00000540643.1_Missense_Mutation_p.R264G|SFI1_ENST00000432498.1_Missense_Mutation_p.R288G|SFI1_ENST00000400289.1_Missense_Mutation_p.R206G|SFI1_ENST00000443011.1_Missense_Mutation_p.R135G|SFI1_ENST00000414585.1_Missense_Mutation_p.R135G|SFI1_ENST00000443326.1_Missense_Mutation_p.R206G	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	288					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GCAAAAACGGAGATTTCTAAA	0.502											OREG0003525	type=REGULATORY REGION|Gene=SFI1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.R288G		.											.	SFI1	90	0			c.A862G						.						81.0	81.0	81.0					22																	31969140		1903	4134	6037	SO:0001583	missense	9814	exon9			AAACGGAGATTTC	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.862A>G	22.37:g.31969140A>G	ENSP00000383145:p.Arg288Gly	Somatic	50.0	0.0	828	WXS	Illumina HiSeq	Phase_I	53.0	4.0	NM_001007467	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	A	11.18	1.562377	0.27915	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000421060;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288	T;T;T;T;T;T;T	0.37058	1.22;1.22;1.22;2.73;2.71;1.22;1.22	5.87	3.62	0.41486	.	0.712062	0.14740	N	0.301244	T	0.35451	0.0932	N	0.08118	0	0.09310	N	1	P;P;D;P;P;D	0.76494	0.835;0.835;0.999;0.95;0.897;0.967	B;B;D;P;P;P	0.71414	0.311;0.311;0.973;0.487;0.465;0.74	T	0.18840	-1.0324	10	0.31617	T	0.26	.	10.2417	0.43316	0.6827:0.3173:0.0:0.0	.	264;206;206;288;288;264	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3;A8K8P3-5	.;.;.;.;SFI1_HUMAN;.	G	288;264;206;264;135;135;206;288	ENSP00000402679:R288G;ENSP00000443025:R264G;ENSP00000416469:R206G;ENSP00000397148:R135G;ENSP00000401199:R135G;ENSP00000383146:R206G;ENSP00000383145:R288G	ENSP00000383145:R288G	R	+	1	2	SFI1	30299140	0.004000	0.15560	0.002000	0.10522	0.005000	0.04900	1.848000	0.39309	1.008000	0.39264	0.533000	0.62120	AGA	.		0.502	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
SHANK2	22941	hgsc.bcm.edu;bcgsc.ca	37	11	70336441	70336441	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:70336441T>C	ENST00000423696.2	-	13	1390	c.1354A>G	c.(1354-1356)Agc>Ggc	p.S452G	SHANK2_ENST00000409161.1_Missense_Mutation_p.S235G|SHANK2_ENST00000357171.3_Missense_Mutation_p.S243G|SHANK2_ENST00000409530.1_Missense_Mutation_p.S242G|SHANK2_ENST00000449116.2_Missense_Mutation_p.S233G|SHANK2_ENST00000338508.4_Missense_Mutation_p.S832G|SHANK2_ENST00000449833.2_Missense_Mutation_p.S236G			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	452					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GCTTTTGGGCTCCCAGGAACA	0.597																																					p.S243G		.											.	SHANK2	94	0			c.A727G						.						121.0	114.0	116.0					11																	70336441		2200	4294	6494	SO:0001583	missense	22941	exon8			TTGGGCTCCCAGG	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.1354A>G	11.37:g.70336441T>C	ENSP00000394536:p.Ser452Gly	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	5.0	NM_133266	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.65|13.65	2.300054|2.300054	0.40694|0.40694	.|.	.|.	ENSG00000162105|ENSG00000162105	ENST00000412252|ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018;ENST00000409530;ENST00000449116;ENST00000357171	.|T;T;T;T;T;T;T;T;T	.|0.57752	.|2.25;2.25;3.02;0.98;2.4;2.39;0.78;0.38;0.79	4.63|4.63	4.63|4.63	0.57726|0.57726	.|.	.|0.068309	.|0.53938	.|D	.|0.000056	T|T	0.55847|0.55847	0.1946|0.1946	M|M	0.74881|0.74881	2.28|2.28	0.47476|0.47476	D|D	0.999434|0.999434	.|B;B;B;B	.|0.30179	.|0.002;0.271;0.198;0.132	.|B;B;B;B	.|0.35727	.|0.004;0.066;0.157;0.209	T|T	0.55153|0.55153	-0.8185|-0.8185	5|10	.|0.27785	.|T	.|0.31	.|.	14.06|14.06	0.64793|0.64793	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|233;452;831;236	.|B7ZKU9;Q9UPX8;Q9UPX8-3;Q9UPX8-4	.|.;SHAN2_HUMAN;.;.	G|G	241|236;235;110;832;452;470;455;242;233;243	.|ENSP00000399423:S236G;ENSP00000386491:S235G;ENSP00000402944:S110G;ENSP00000345193:S832G;ENSP00000394536:S452G;ENSP00000294018:S455G;ENSP00000387324:S242G;ENSP00000394939:S233G;ENSP00000349694:S243G	.|ENSP00000294018:S455G	E|S	-|-	2|1	0|0	SHANK2|SHANK2	70014089|70014089	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	4.315000|4.315000	0.59172|0.59172	1.715000|1.715000	0.51383|0.51383	0.379000|0.379000	0.24179|0.24179	GAG|AGC	.		0.597	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
SHROOM1	134549	bcgsc.ca;mdanderson.org	37	5	132161730	132161730	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:132161730A>G	ENST00000378679.3	-	4	907	c.103T>C	c.(103-105)Tct>Cct	p.S35P	SHROOM1_ENST00000378676.1_Missense_Mutation_p.S35P|SHROOM1_ENST00000488072.1_5'Flank|SHROOM1_ENST00000319854.3_Missense_Mutation_p.S35P	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	35					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCGGAGAAAGAGCTGTAGGCC	0.701																																					p.S35P		.											.	SHROOM1	91	0			c.T103C						.						6.0	8.0	7.0					5																	132161730		2099	4225	6324	SO:0001583	missense	134549	exon1			AGAAAGAGCTGTA	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.103T>C	5.37:g.132161730A>G	ENSP00000367950:p.Ser35Pro	Somatic	37.0	1.0		WXS	Illumina HiSeq	Phase_1	54.0	5.0	NM_133456	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Missense_Mutation	SNP	ENST00000378679.3	37	CCDS54902.1	.	.	.	.	.	.	.	.	.	.	A	19.30	3.801908	0.70682	.	.	ENSG00000164403	ENST00000378679;ENST00000319854;ENST00000378676;ENST00000440118	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	4.31	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.50667	0.1629	L	0.32530	0.975	0.35319	D	0.784582	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.63171	-0.6697	10	0.87932	D	0	-12.6602	10.4128	0.44303	1.0:0.0:0.0:0.0	.	35;35	Q2M3G4-2;Q2M3G4	.;SHRM1_HUMAN	P	35	ENSP00000367950:S35P;ENSP00000324245:S35P;ENSP00000367947:S35P;ENSP00000388049:S35P	ENSP00000324245:S35P	S	-	1	0	SHROOM1	132189629	1.000000	0.71417	0.999000	0.59377	0.543000	0.35085	5.362000	0.66098	1.886000	0.54624	0.459000	0.35465	TCT	.		0.701	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
SHROOM3	57619	hgsc.bcm.edu;bcgsc.ca	37	4	77660862	77660862	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:77660862T>C	ENST00000296043.6	+	5	2489	c.1536T>C	c.(1534-1536)gcT>gcC	p.A512A		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	512					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			ACAAGATGGCTACCATTGATG	0.537																																					p.A512A		.											.	SHROOM3	93	0			c.T1536C						.						119.0	120.0	119.0					4																	77660862		2203	4300	6503	SO:0001819	synonymous_variant	57619	exon5			GATGGCTACCATT	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.1536T>C	4.37:g.77660862T>C		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			.		0.537	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
SIGIRR	59307	hgsc.bcm.edu;bcgsc.ca	37	11	407512	407512	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:407512A>G	ENST00000431843.2	-	6	844	c.538T>C	c.(538-540)Ttc>Ctc	p.F180L	SIGIRR_ENST00000382520.2_Missense_Mutation_p.F180L|SIGIRR_ENST00000531205.1_Missense_Mutation_p.F180L|SIGIRR_ENST00000397632.3_Missense_Mutation_p.F180L|SIGIRR_ENST00000529486.1_5'UTR|SIGIRR_ENST00000332725.3_Missense_Mutation_p.F180L	NM_001135054.1	NP_001128526.1	Q6IA17	SIGIR_HUMAN	single immunoglobulin and toll-interleukin 1 receptor (TIR) domain	180	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				acute-phase response (GO:0006953)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(2)|endometrium(1)|liver(1)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	13		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGTTCACGAACTTGCGGTCC	0.677																																					p.F180L		.											.	SIGIRR	90	0			c.T538C						.						26.0	26.0	26.0					11																	407512		2188	4289	6477	SO:0001583	missense	59307	exon6			TCACGAACTTGCG		CCDS31325.1	11p15.5	2013-01-11	2005-10-10					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30575	protein-coding gene	gene with protein product	"""single immunoglobulin domain IL1R1 related"""	605478				10346978	Standard	NM_021805		Approved	TIR8	uc001lpe.1	Q6IA17		ENST00000431843.2:c.538T>C	11.37:g.407512A>G	ENSP00000403104:p.Phe180Leu	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	7.0	NM_021805	Q3KQY2|Q6UXI3|Q9H733	Missense_Mutation	SNP	ENST00000431843.2	37	CCDS31325.1	.	.	.	.	.	.	.	.	.	.	a	16.69	3.193513	0.58017	.	.	ENSG00000185187	ENST00000431843;ENST00000397632;ENST00000332725;ENST00000531205;ENST00000382520;ENST00000528209;ENST00000530494	T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92	2.75	2.75	0.32379	Toll/interleukin-1 receptor homology (TIR) domain (3);	0.063235	0.64402	D	0.000004	T	0.28928	0.0718	M	0.78344	2.41	0.80722	D	1	P;B	0.42296	0.775;0.362	B;B	0.39660	0.306;0.166	T	0.15178	-1.0446	10	0.40728	T	0.16	.	10.2759	0.43510	1.0:0.0:0.0:0.0	.	180;180	C9JFX4;Q6IA17	.;SIGIR_HUMAN	L	180;180;180;180;180;76;124	ENSP00000403104:F180L;ENSP00000380756:F180L;ENSP00000333656:F180L;ENSP00000433022:F180L;ENSP00000371960:F180L;ENSP00000435135:F76L	ENSP00000333656:F180L	F	-	1	0	SIGIRR	397512	1.000000	0.71417	1.000000	0.80357	0.226000	0.24999	5.558000	0.67319	1.525000	0.49052	0.240000	0.17902	TTC	.		0.677	SIGIRR-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383884.3	NM_021805	
SIRT6	51548	hgsc.bcm.edu;bcgsc.ca	37	19	4179153	4179153	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:4179153A>G	ENST00000337491.2	-	3	389	c.325T>C	c.(325-327)Ttc>Ctc	p.F109L	SIRT6_ENST00000601488.1_Intron|SIRT6_ENST00000594279.1_Missense_Mutation_p.F37L|SIRT6_ENST00000305232.6_Missense_Mutation_p.F109L|SIRT6_ENST00000381935.3_Missense_Mutation_p.F37L	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	109	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGACCAGGAAGCGGAGGAGG	0.677																																					p.F109L		.											.	SIRT6	227	0			c.T325C						.						25.0	23.0	23.0					19																	4179153		2203	4300	6503	SO:0001583	missense	51548	exon3			CCAGGAAGCGGAG	AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.325T>C	19.37:g.4179153A>G	ENSP00000337332:p.Phe109Leu	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	5.0	NM_016539	B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Missense_Mutation	SNP	ENST00000337491.2	37	CCDS12122.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.587910	0.86851	.	.	ENSG00000077463	ENST00000337491;ENST00000305232;ENST00000381935	T;T;T	0.17370	2.28;2.28;2.28	4.97	4.97	0.65823	.	0.170832	0.53938	D	0.000060	T	0.27349	0.0671	L	0.41824	1.3	0.51767	D	0.999936	P;D;D	0.71674	0.882;0.991;0.998	P;P;D	0.65443	0.722;0.848;0.935	T	0.03443	-1.1036	10	0.11485	T	0.65	-27.9351	13.4809	0.61334	1.0:0.0:0.0:0.0	.	109;109;37	Q8N6T7-2;Q8N6T7;B7Z5U1	.;SIRT6_HUMAN;.	L	109;109;37	ENSP00000337332:F109L;ENSP00000305310:F109L;ENSP00000371360:F37L	ENSP00000305310:F109L	F	-	1	0	SIRT6	4130153	1.000000	0.71417	0.961000	0.40146	0.724000	0.41520	6.898000	0.75676	1.877000	0.54381	0.454000	0.30748	TTC	.		0.677	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457931.2		
SLC12A6	9990	hgsc.bcm.edu;bcgsc.ca	37	15	34547524	34547524	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:34547524A>G	ENST00000354181.3	-	8	1307	c.815T>C	c.(814-816)tTt>tCt	p.F272S	SLC12A6_ENST00000560164.1_Missense_Mutation_p.F84S|SLC12A6_ENST00000451844.2_Missense_Mutation_p.F84S|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000397702.2_Missense_Mutation_p.F213S|SLC12A6_ENST00000558667.1_Missense_Mutation_p.F272S|SLC12A6_ENST00000560611.1_Missense_Mutation_p.F272S|SLC12A6_ENST00000290209.5_Missense_Mutation_p.F221S|SLC12A6_ENST00000558589.1_Missense_Mutation_p.F263S|SLC12A6_ENST00000458406.2_Missense_Mutation_p.F213S|SLC12A6_ENST00000397707.2_Missense_Mutation_p.F257S			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	272					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	ACCAAGATAAAAGCAGAGGCC	0.438																																					p.F272S		.											.	SLC12A6	517	0			c.T815C						.						90.0	93.0	92.0					15																	34547524		2201	4298	6499	SO:0001583	missense	9990	exon7			AGATAAAAGCAGA	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.815T>C	15.37:g.34547524A>G	ENSP00000346112:p.Phe272Ser	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	5.0	NM_133647	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.822965	0.90873	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D	0.88975	-2.42;-2.45;-2.44;-2.44;-1.98	5.43	5.43	0.79202	Amino acid permease domain (1);	0.114524	0.64402	D	0.000015	D	0.96750	0.8939	H	0.98333	4.205	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;1.0;1.0	D;D;D;D	0.87578	0.928;0.998;0.973;0.995	D	0.98152	1.0442	10	0.87932	D	0	.	14.5986	0.68424	1.0:0.0:0.0:0.0	.	257;272;221;84	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	S	221;257;263;213;213;84	ENSP00000290209:F221S;ENSP00000380819:F257S;ENSP00000380814:F213S;ENSP00000387725:F213S;ENSP00000390199:F84S	ENSP00000290209:F221S	F	-	2	0	SLC12A6	32334816	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.139000	0.94554	2.279000	0.76181	0.533000	0.62120	TTT	.		0.438	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135	
SLC14A1	6563	hgsc.bcm.edu;bcgsc.ca	37	18	43310402	43310402	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr18:43310402C>A	ENST00000321925.4	+	3	349	c.117C>A	c.(115-117)acC>acA	p.T39T	SLC14A1_ENST00000436407.3_Silent_p.T95T|SLC14A1_ENST00000502059.2_Intron|SLC14A1_ENST00000591943.1_3'UTR|SLC14A1_ENST00000535474.1_Intron|SLC14A1_ENST00000589700.1_Silent_p.T39T|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A1_ENST00000402943.2_Intron|SLC14A1_ENST00000415427.3_Silent_p.T95T|RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000586142.1_Silent_p.T39T	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	39					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						GCTATGTCACCGGTGACATGA	0.478																																					p.T95T		.											.	SLC14A1	515	0			c.C285A						.						117.0	105.0	109.0					18																	43310402		2203	4300	6503	SO:0001819	synonymous_variant	6563	exon2			TGTCACCGGTGAC	BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.117C>A	18.37:g.43310402C>A		Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	5.0	NM_001146037	A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Silent	SNP	ENST00000321925.4	37	CCDS11925.1																																																																																			.		0.478	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865	
SLC15A2	6565	hgsc.bcm.edu;bcgsc.ca	37	3	121647383	121647383	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:121647383A>G	ENST00000489711.1	+	15	1710	c.1322A>G	c.(1321-1323)gAg>gGg	p.E441G	SLC15A2_ENST00000465060.1_3'UTR|SLC15A2_ENST00000295605.2_Missense_Mutation_p.E410G	NM_021082.3	NP_066568.3	Q16348	S15A2_HUMAN	solute carrier family 15 (oligopeptide transporter), member 2	441					drug transport (GO:0015893)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|dipeptide transporter activity (GO:0042936)|high-affinity oligopeptide transporter activity (GO:0015334)|peptide:proton symporter activity (GO:0015333)			NS(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(17)|skin(6)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(114;0.0967)	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Fosinopril(DB00492)|Glyburide(DB01016)|Moexipril(DB00691)|Nateglinide(DB00731)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Tranexamic Acid(DB00302)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CTGTTGATAGAGTCCATCAAA	0.393																																					p.E441G		.											.	SLC15A2	91	0			c.A1322G						.						168.0	176.0	173.0					3																	121647383		2203	4300	6503	SO:0001583	missense	6565	exon15			TGATAGAGTCCAT	BC044572	CCDS3007.1, CCDS54631.1	3q21.1	2013-07-18	2013-07-18		ENSG00000163406	ENSG00000163406		"""Solute carriers"""	10921	protein-coding gene	gene with protein product		602339	"""solute carrier family 15 (H+/peptide transporter), member 2"""			7756356	Standard	NM_021082		Approved	PEPT2	uc003eep.2	Q16348	OTTHUMG00000159423	ENST00000489711.1:c.1322A>G	3.37:g.121647383A>G	ENSP00000417085:p.Glu441Gly	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	6.0	NM_021082	A8K1A5|B4E2A7	Missense_Mutation	SNP	ENST00000489711.1	37	CCDS3007.1	.	.	.	.	.	.	.	.	.	.	A	8.753	0.921676	0.17982	.	.	ENSG00000163406	ENST00000489711;ENST00000542599;ENST00000295605	T;T	0.04454	3.62;3.62	5.65	4.48	0.54585	.	0.424514	0.28996	N	0.013477	T	0.05868	0.0153	L	0.50333	1.59	0.39041	D	0.960127	B;B	0.11235	0.004;0.0	B;B	0.16722	0.016;0.005	T	0.27020	-1.0086	10	0.30078	T	0.28	-3.7873	8.9241	0.35630	0.8349:0.0:0.0:0.165	.	410;441	B4E2A7;Q16348	.;S15A2_HUMAN	G	441;403;410	ENSP00000417085:E441G;ENSP00000295605:E410G	ENSP00000295605:E410G	E	+	2	0	SLC15A2	123130073	0.994000	0.37717	0.977000	0.42913	0.285000	0.27093	2.545000	0.45769	1.124000	0.41980	0.533000	0.62120	GAG	.		0.393	SLC15A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355239.1	NM_021082	
SLC16A4	9122	hgsc.bcm.edu;bcgsc.ca	37	1	110918150	110918150	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:110918150T>C	ENST00000369779.4	-	8	1515	c.1266A>G	c.(1264-1266)acA>acG	p.T422T	SLC16A4_ENST00000472422.2_Silent_p.T374T|SLC16A4_ENST00000437429.2_Silent_p.T312T|RP5-1074L1.4_ENST00000609909.1_RNA|SLC16A4_ENST00000541986.1_Silent_p.T360T|SLC16A4_ENST00000369781.4_Silent_p.T254T	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	422					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	ACCTGTTTACTGTAGAATTCC	0.403																																					p.T422T		.											.	SLC16A4	93	0			c.A1266G						.						81.0	83.0	82.0					1																	110918150		2203	4300	6503	SO:0001819	synonymous_variant	9122	exon8			GTTTACTGTAGAA	U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.1266A>G	1.37:g.110918150T>C		Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	5.0	NM_004696	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Silent	SNP	ENST00000369779.4	37	CCDS823.1																																																																																			.		0.403	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3	NM_004696	
SLC2A4RG	56731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	62373570	62373570	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr20:62373570C>T	ENST00000266077.2	+	5	719	c.667C>T	c.(667-669)Ctg>Ttg	p.L223L	SLC2A4RG_ENST00000493772.1_3'UTR|RP4-583P15.10_ENST00000447343.2_RNA	NM_020062.3	NP_064446.2	Q9NR83	S2A4R_HUMAN	SLC2A4 regulator	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|lung(2)|prostate(2)|skin(1)	7	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					ACACATCCGCCTGGTGCACCT	0.706																																					p.L223L		.											.	SLC2A4RG	90	0			c.C667T						.						16.0	20.0	18.0					20																	62373570		2171	4269	6440	SO:0001819	synonymous_variant	56731	exon5			ATCCGCCTGGTGC	AF249267	CCDS13537.1	20q13.33	2010-03-11			ENSG00000125520	ENSG00000125520			15930	protein-coding gene	gene with protein product	"""GLUT4 enhancer factor"", ""Huntington's disease gene regulatory region-binding protein 1"""	609493				10825161	Standard	NM_020062		Approved	GEF, HDBP1, Si-1-2, Si-1-2-19	uc002ygq.3	Q9NR83	OTTHUMG00000032997	ENST00000266077.2:c.667C>T	20.37:g.62373570C>T		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	62.0	NM_020062	Q2PHL5|Q6F6I6|Q6F6I7|Q6GTK5|Q8TAH5|Q8WVW7|Q96QD3|Q9BV85	Silent	SNP	ENST00000266077.2	37	CCDS13537.1																																																																																			.		0.706	SLC2A4RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080202.1	NM_020062	
SLC34A2	10568	hgsc.bcm.edu;bcgsc.ca	37	4	25664190	25664190	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:25664190G>A	ENST00000382051.3	+	2	118	c.68G>A	c.(67-69)gGt>gAt	p.G23D	SLC34A2_ENST00000503434.1_Missense_Mutation_p.G23D|SLC34A2_ENST00000504570.1_Missense_Mutation_p.G23D	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	23					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GGGGCCGCAGGTCAGCAGCCC	0.547			T	ROS1	NSCLC																																p.G23D		.		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	SLC34A2	95	0			c.G68A						.						69.0	70.0	70.0					4																	25664190		2203	4300	6503	SO:0001583	missense	10568	exon2			CCGCAGGTCAGCA	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.68G>A	4.37:g.25664190G>A	ENSP00000371483:p.Gly23Asp	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	4.0	NM_001177998	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	G	6.559	0.471493	0.12461	.	.	ENSG00000157765	ENST00000513204;ENST00000504570;ENST00000382051;ENST00000503434;ENST00000507530	T;T;T;T;T	0.54071	0.59;2.0;2.0;2.0;0.59	5.25	-2.44	0.06502	.	2.205720	0.01628	N	0.023400	T	0.43919	0.1269	L	0.44542	1.39	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.22836	-1.0205	10	0.35671	T	0.21	1.0696	7.1731	0.25728	0.3183:0.3219:0.3598:0.0	.	23;23	O95436-2;O95436	.;NPT2B_HUMAN	D	23	ENSP00000423038:G23D;ENSP00000425501:G23D;ENSP00000371483:G23D;ENSP00000423021:G23D;ENSP00000424266:G23D	ENSP00000371483:G23D	G	+	2	0	SLC34A2	25273288	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.130000	0.10498	-0.372000	0.07992	-0.165000	0.13383	GGT	.		0.547	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
SLC37A1	54020	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43979198	43979198	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr21:43979198C>A	ENST00000352133.2	+	11	1962	c.980C>A	c.(979-981)cCa>cAa	p.P327Q	AP001625.6_ENST00000442605.1_RNA|SLC37A1_ENST00000398341.3_Splice_Site_p.P327Q			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	327					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						TTGAAAATTCCAGTAAGTAAA	0.557																																					p.P327Q		.											.	SLC37A1	90	0			c.C980A						.						38.0	40.0	39.0					21																	43979198		2203	4300	6503	SO:0001630	splice_region_variant	54020	exon12			AAATTCCAGTAAG	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.981+1C>A	21.37:g.43979198C>A		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	5.0	NM_018964	D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	ENST00000352133.2	37	CCDS13689.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365300	0.61513	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.63096	-0.02;-0.02	5.7	5.7	0.88788	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.80618	0.4657	M	0.82193	2.58	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.82659	-0.0348	10	0.66056	D	0.02	-17.2009	16.7639	0.85519	0.0:1.0:0.0:0.0	.	327	P57057	GLPT_HUMAN	Q	327	ENSP00000381383:P327Q;ENSP00000344648:P327Q	ENSP00000344648:P327Q	P	+	2	0	SLC37A1	42852267	0.997000	0.39634	0.652000	0.29579	0.003000	0.03518	5.609000	0.67661	2.688000	0.91661	0.655000	0.94253	CCA	.		0.557	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195377.1		Missense_Mutation
SLC37A3	84255	hgsc.bcm.edu;bcgsc.ca	37	7	140069457	140069457	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:140069457G>T	ENST00000326232.9	-	4	427	c.224C>A	c.(223-225)cCc>cAc	p.P75H	SLC37A3_ENST00000340308.3_Missense_Mutation_p.P75H|SLC37A3_ENST00000429996.2_Missense_Mutation_p.P75H|RNA5SP247_ENST00000411181.1_RNA|SLC37A3_ENST00000461089.1_5'UTR|SLC37A3_ENST00000447932.2_Missense_Mutation_p.P75H	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	75					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					CTCTGCACTGGGGAACAAATG	0.483																																					p.P75H	Esophageal Squamous(133;211 1716 4665 11387 37873)	.											.	SLC37A3	93	0			c.C224A						.						99.0	87.0	91.0					7																	140069457		2203	4300	6503	SO:0001583	missense	84255	exon4			GCACTGGGGAACA	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.224C>A	7.37:g.140069457G>T	ENSP00000321498:p.Pro75His	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	4.0	NM_207113	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	ENST00000326232.9	37	CCDS5859.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.798989	0.50208	.	.	ENSG00000157800	ENST00000340308;ENST00000447932;ENST00000326232;ENST00000429996;ENST00000539816;ENST00000469193	T;T;T;T;T	0.47869	2.15;2.45;2.45;0.83;0.85	5.2	5.2	0.72013	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.335918	0.31199	N	0.008065	T	0.60599	0.2281	M	0.63843	1.955	0.46416	D	0.999031	P;P;P;P;P	0.43578	0.743;0.708;0.565;0.811;0.619	P;P;B;P;P	0.53401	0.683;0.554;0.43;0.725;0.566	T	0.61048	-0.7141	10	0.49607	T	0.09	-24.2852	16.5098	0.84281	0.0:0.0:1.0:0.0	.	75;75;75;75;75	B4DKF5;F5H743;Q8NCC5-2;Q8NCC5-3;Q8NCC5	.;.;.;.;SPX3_HUMAN	H	75	ENSP00000343358:P75H;ENSP00000397481:P75H;ENSP00000321498:P75H;ENSP00000412208:P75H;ENSP00000419024:P75H	ENSP00000321498:P75H	P	-	2	0	SLC37A3	139715926	1.000000	0.71417	0.643000	0.29450	0.204000	0.24138	3.508000	0.53378	2.435000	0.82474	0.591000	0.81541	CCC	.		0.483	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348492.1	NM_032295	
SLC45A4	57210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142228278	142228278	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr8:142228278C>A	ENST00000024061.3	-	4	1615	c.1308G>T	c.(1306-1308)gaG>gaT	p.E436D	SLC45A4_ENST00000519067.1_Missense_Mutation_p.E436D|SLC45A4_ENST00000517878.1_Missense_Mutation_p.E487D|SLC45A4_ENST00000433583.2_Missense_Mutation_p.E429D	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CGCCCTCCCCCTCCTCACTCT	0.672																																					p.E436D		.											.	SLC45A4	70	0			c.G1308T						.						63.0	55.0	58.0					8																	142228278		2203	4300	6503	SO:0001583	missense	57210	exon4			CTCCCCCTCCTCA	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.1308G>T	8.37:g.142228278C>A	ENSP00000024061:p.Glu436Asp	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	33.0	NM_001080431	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	37	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	C	11.22	1.575869	0.28092	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061	D;D;D;D	0.95482	-3.72;-3.72;-3.72;-3.72	5.07	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.90321	0.6972	N	0.25647	0.755	0.45194	D	0.998207	B;B;B	0.21452	0.034;0.056;0.056	B;B;B	0.21360	0.012;0.034;0.027	D	0.86630	0.1885	10	0.38643	T	0.18	-35.5141	10.8078	0.46529	0.0:0.8493:0.0:0.1507	.	487;436;436	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	D	436;487;429;436	ENSP00000429059:E436D;ENSP00000428137:E487D;ENSP00000400799:E429D;ENSP00000024061:E436D	ENSP00000024061:E436D	E	-	3	2	SLC45A4	142297460	0.986000	0.35501	1.000000	0.80357	0.169000	0.22640	0.211000	0.17474	2.535000	0.85469	0.561000	0.74099	GAG	.		0.672	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
SLC5A2	6524	hgsc.bcm.edu;bcgsc.ca	37	16	31499986	31499986	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:31499986G>T	ENST00000330498.3	+	10	1192	c.1173G>T	c.(1171-1173)atG>atT	p.M391I	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	391					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)			endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	CCGCGCTCATGTCCTCGCTGG	0.706																																					p.M391I		.											.	SLC5A2	91	0			c.G1173T						.						28.0	25.0	26.0					16																	31499986		2196	4299	6495	SO:0001583	missense	6524	exon10			GCTCATGTCCTCG		CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.1173G>T	16.37:g.31499986G>T	ENSP00000327943:p.Met391Ile	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	4.0	NM_003041	A2RRD2	Missense_Mutation	SNP	ENST00000330498.3	37	CCDS10714.1	.	.	.	.	.	.	.	.	.	.	G	32	5.107688	0.94292	.	.	ENSG00000140675	ENST00000330498	D	0.90955	-2.76	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.93350	0.7880	L	0.49455	1.56	0.80722	D	1	D	0.59357	0.985	D	0.72338	0.977	D	0.93607	0.6935	10	0.59425	D	0.04	.	15.2095	0.73209	0.0:0.0:1.0:0.0	.	391	P31639	SC5A2_HUMAN	I	391	ENSP00000327943:M391I	ENSP00000327943:M391I	M	+	3	0	SLC5A2	31407487	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.651000	0.98493	2.453000	0.82957	0.561000	0.74099	ATG	.		0.706	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255627.2		
SLITRK1	114798	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	84453981	84453981	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr13:84453981G>C	ENST00000377084.2	-	1	2547	c.1662C>G	c.(1660-1662)agC>agG	p.S554R		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	554	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		ACTTGAGGTCGCTCATCAGCA	0.537																																					p.S554R		.											.	SLITRK1	94	0			c.C1662G						.						59.0	54.0	56.0					13																	84453981		2203	4300	6503	SO:0001583	missense	114798	exon1			GAGGTCGCTCATC	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1662C>G	13.37:g.84453981G>C	ENSP00000366288:p.Ser554Arg	Somatic	107.0	1.0		WXS	Illumina HiSeq	Phase_I	108.0	66.0	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701742	0.48307	.	.	ENSG00000178235	ENST00000377084	T	0.52754	0.65	5.22	5.22	0.72569	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.35653	0.0939	L	0.31065	0.9	0.58432	D	0.999995	P	0.47962	0.903	B	0.42593	0.392	T	0.18681	-1.0329	10	0.56958	D	0.05	-17.8047	8.4475	0.32852	0.1665:0.0:0.8335:0.0	.	554	Q96PX8	SLIK1_HUMAN	R	554	ENSP00000366288:S554R	ENSP00000366288:S554R	S	-	3	2	SLITRK1	83351982	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.430000	0.44766	2.603000	0.88011	0.655000	0.94253	AGC	.		0.537	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
SMEK1	55671	hgsc.bcm.edu;bcgsc.ca	37	14	91937188	91937188	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:91937188C>A	ENST00000554943.1	-	10	1768	c.1653G>T	c.(1651-1653)ttG>ttT	p.L551F	SMEK1_ENST00000554684.1_Missense_Mutation_p.L538F|SMEK1_ENST00000428424.2_Missense_Mutation_p.L312F|SMEK1_ENST00000555462.1_Missense_Mutation_p.L312F|SMEK1_ENST00000337238.4_Missense_Mutation_p.L538F			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	551					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		TACATAATGCCAAGAAAGCAT	0.353																																					p.L538F		.											.	SMEK1	226	0			c.G1614T						.						110.0	112.0	111.0					14																	91937188		2203	4300	6503	SO:0001583	missense	55671	exon11			TAATGCCAAGAAA	AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.1653G>T	14.37:g.91937188C>A	ENSP00000450883:p.Leu551Phe	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	4.0	NM_032560	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	ENST00000554943.1	37		.	.	.	.	.	.	.	.	.	.	C	17.44	3.389892	0.61956	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462;ENST00000554390	T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34	5.8	3.92	0.45320	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72342	0.3448	M	0.89601	3.045	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.87578	0.986;0.99;0.998	T	0.71948	-0.4438	10	0.72032	D	0.01	-9.0136	4.8908	0.13726	0.1475:0.6134:0.0:0.2391	.	312;551;538	Q6IN85-4;Q6IN85;Q6IN85-2	.;P4R3A_HUMAN;.	F	538;538;312;551;312;538	ENSP00000450864:L538F;ENSP00000337125:L538F;ENSP00000392704:L312F;ENSP00000450883:L551F;ENSP00000450891:L312F;ENSP00000452596:L538F	ENSP00000337125:L538F	L	-	3	2	SMEK1	91006941	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	0.843000	0.27640	0.729000	0.32403	0.650000	0.86243	TTG	.		0.353	SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1	NM_032560	
SMPD2	6610	hgsc.bcm.edu;bcgsc.ca	37	6	109764241	109764241	+	Missense_Mutation	SNP	A	A	G	rs145532915	byFrequency	TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:109764241A>G	ENST00000258052.3	+	8	1045	c.686A>G	c.(685-687)aAg>aGg	p.K229R	PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000424445.2_5'Flank|PPIL6_ENST00000440797.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	229					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		CAGGAGCTGAAGCCATTTCCC	0.502																																					p.K229R		.											.	SMPD2	90	0			c.A686G						.						96.0	88.0	91.0					6																	109764241		2203	4300	6503	SO:0001583	missense	6610	exon8			AGCTGAAGCCATT	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.686A>G	6.37:g.109764241A>G	ENSP00000258052:p.Lys229Arg	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	6.0	NM_003080	Q5TED1|Q9BWR3	Missense_Mutation	SNP	ENST00000258052.3	37	CCDS5075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.731|1.731	-0.494046|-0.494046	0.04322|0.04322	.|.	.|.	ENSG00000135587|ENSG00000135587	ENST00000258052|ENST00000458487	T|.	0.32272|.	1.46|.	5.95|5.95	0.512|0.512	0.16994|0.16994	Endonuclease/exonuclease/phosphatase (2);|.	1.230960|.	0.05155|.	N|.	0.496721|.	T|T	0.12263|0.12263	0.0298|0.0298	N|N	0.21282|0.21282	0.65|0.65	0.09310|0.09310	N|N	1|1	B|.	0.21821|.	0.061|.	B|.	0.22152|.	0.038|.	T|T	0.33240|0.33240	-0.9876|-0.9876	10|5	0.13470|.	T|.	0.59|.	-0.2032|-0.2032	8.7389|8.7389	0.34545|0.34545	0.5746:0.0:0.4254:0.0|0.5746:0.0:0.4254:0.0	.|.	229|.	O60906|.	NSMA_HUMAN|.	R|G	229|126	ENSP00000258052:K229R|.	ENSP00000258052:K229R|.	K|S	+|+	2|1	0|0	SMPD2|SMPD2	109870934|109870934	0.030000|0.030000	0.19436|0.19436	0.001000|0.001000	0.08648|0.08648	0.147000|0.147000	0.21601|0.21601	0.364000|0.364000	0.20325|0.20325	0.077000|0.077000	0.16863|0.16863	0.533000|0.533000	0.62120|0.62120	AAG|AGC	A|0.999;T|0.001		0.502	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1		
SNAI1	6615	hgsc.bcm.edu;bcgsc.ca	37	20	48600493	48600493	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr20:48600493T>C	ENST00000244050.2	+	2	276	c.215T>C	c.(214-216)aTt>aCt	p.I72T		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	72					cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			GCCCAGCCAATTGCCTGGGCC	0.662																																					p.I72T		.											.	SNAI1	227	0			c.T215C						.						44.0	50.0	48.0					20																	48600493		2203	4300	6503	SO:0001583	missense	6615	exon2			AGCCAATTGCCTG	AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.215T>C	20.37:g.48600493T>C	ENSP00000244050:p.Ile72Thr	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	5.0	NM_005985	B2R842|Q9P113|Q9UBP7|Q9UHH7	Missense_Mutation	SNP	ENST00000244050.2	37	CCDS13423.1	.	.	.	.	.	.	.	.	.	.	T	1.677	-0.507608	0.04231	.	.	ENSG00000124216	ENST00000244050	T	0.21734	1.99	4.09	1.77	0.24775	.	1.733090	0.02986	N	0.146262	T	0.13243	0.0321	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24728	-1.0152	10	0.15066	T	0.55	1.2354	5.9026	0.18976	0.0:0.16:0.1486:0.6914	.	72	O95863	SNAI1_HUMAN	T	72	ENSP00000244050:I72T	ENSP00000244050:I72T	I	+	2	0	SNAI1	48033900	0.000000	0.05858	0.000000	0.03702	0.651000	0.38670	0.378000	0.20569	0.234000	0.21139	-0.410000	0.06199	ATT	.		0.662	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080350.1		
SNAP29	9342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	21235375	21235375	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr22:21235375C>T	ENST00000215730.7	+	3	601	c.473C>T	c.(472-474)gCa>gTa	p.A158V		NM_004782.3	NP_004773.1	O95721	SNP29_HUMAN	synaptosomal-associated protein, 29kDa	158					autophagic vacuole fusion (GO:0000046)|exocytosis (GO:0006887)|membrane fusion (GO:0061025)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|upper_aerodigestive_tract(1)	9	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			GAACAGGAAGCAAAGTACCAG	0.403																																					p.A158V		.											.	SNAP29	278	0			c.C473T						.						84.0	73.0	76.0					22																	21235375		2203	4300	6503	SO:0001583	missense	9342	exon3			AGGAAGCAAAGTA	AF115436	CCDS13784.1	22q11.21	2008-06-10	2002-08-29		ENSG00000099940	ENSG00000099940			11133	protein-coding gene	gene with protein product	"""soluble 29 kDa NSF attachment protein"""	604202	"""synaptosomal-associated protein, 29kD"""			9852078, 10591208	Standard	NM_004782		Approved	SNAP-29, CEDNIK	uc011ahw.2	O95721	OTTHUMG00000150765	ENST00000215730.7:c.473C>T	22.37:g.21235375C>T	ENSP00000215730:p.Ala158Val	Somatic	209.0	1.0		WXS	Illumina HiSeq	Phase_I	153.0	107.0	NM_004782		Missense_Mutation	SNP	ENST00000215730.7	37	CCDS13784.1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.748021	0.30955	.	.	ENSG00000099940	ENST00000215730;ENST00000439214	.	.	.	4.79	-0.269	0.12930	SNAP-25 (1);	0.768768	0.12064	N	0.502901	T	0.26593	0.0650	N	0.22421	0.69	0.09310	N	1	B	0.30068	0.267	B	0.29942	0.109	T	0.19386	-1.0307	9	0.30078	T	0.28	-0.6118	10.2209	0.43196	0.4547:0.4386:0.1067:0.0	.	158	O95721	SNP29_HUMAN	V	158;65	.	ENSP00000215730:A158V	A	+	2	0	SNAP29	19565375	0.156000	0.22821	0.309000	0.25155	0.988000	0.76386	0.979000	0.29500	0.201000	0.20466	0.491000	0.48974	GCA	.		0.403	SNAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320000.4	NM_004782	
SNX15	29907	hgsc.bcm.edu;bcgsc.ca	37	11	64802421	64802421	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:64802421A>G	ENST00000377244.3	+	4	489	c.359A>G	c.(358-360)aAg>aGg	p.K120R	RP11-399J13.3_ENST00000301886.3_3'UTR|SNX15_ENST00000352068.5_Missense_Mutation_p.K120R	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	120	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						CCCCAGCTCAAGGAGTTCTTC	0.572																																					p.K120R	Esophageal Squamous(56;269 1304 3324 8253)	.											.	SNX15	227	0			c.A359G						.						64.0	58.0	60.0					11																	64802421		2201	4297	6498	SO:0001583	missense	29907	exon4			AGCTCAAGGAGTT	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.359A>G	11.37:g.64802421A>G	ENSP00000366452:p.Lys120Arg	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	5.0	NM_147777	E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	37	CCDS8089.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.245899	0.80024	.	.	ENSG00000110025	ENST00000377244;ENST00000534637;ENST00000524831;ENST00000352068	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	5.38	5.38	0.77491	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.46870	0.1415	N	0.25245	0.725	0.80722	D	1	D;P;D	0.89917	1.0;0.92;1.0	D;P;D	0.87578	0.998;0.491;0.998	T	0.31806	-0.9930	10	0.13470	T	0.59	-6.2292	13.33	0.60480	1.0:0.0:0.0:0.0	.	120;120;120	E5KQS5;E5KQS6;Q9NRS6	.;.;SNX15_HUMAN	R	120;116;108;120	ENSP00000366452:K120R;ENSP00000437277:K116R;ENSP00000431690:K108R;ENSP00000316410:K120R	ENSP00000316410:K120R	K	+	2	0	SNX15	64558997	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	8.529000	0.90602	2.046000	0.60703	0.455000	0.32223	AAG	.		0.572	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
SOX3	6658	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	139587141	139587141	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:139587141G>T	ENST00000370536.2	-	1	84	c.85C>A	c.(85-87)Ccc>Acc	p.P29T		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	29					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					GGCGGGAAGGGTAGGCTTATC	0.652																																					p.P29T		.											.	SOX3	1083	0			c.C85A						.						10.0	10.0	10.0					X																	139587141		2193	4281	6474	SO:0001583	missense	6658	exon1			GGAAGGGTAGGCT		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.85C>A	X.37:g.139587141G>T	ENSP00000359567:p.Pro29Thr	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	31.0	NM_005634	P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	ENST00000370536.2	37	CCDS14669.1	.	.	.	.	.	.	.	.	.	.	g	11.55	1.672375	0.29693	.	.	ENSG00000134595	ENST00000370536	D	0.98493	-4.96	3.67	1.8	0.24995	.	.	.	.	.	D	0.93455	0.7912	N	0.19112	0.55	0.23879	N	0.996589	B	0.24186	0.099	B	0.22753	0.041	D	0.86525	0.1818	8	.	.	.	.	5.0479	0.14494	0.1311:0.2109:0.658:0.0	.	29	P41225	SOX3_HUMAN	T	29	ENSP00000359567:P29T	.	P	-	1	0	SOX3	139414807	0.050000	0.20438	0.229000	0.23960	0.689000	0.40095	0.143000	0.16115	0.179000	0.19938	0.525000	0.51046	CCC	.		0.652	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058577.1		
SPACA1	81833	hgsc.bcm.edu;bcgsc.ca	37	6	88768538	88768538	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:88768538C>A	ENST00000237201.1	+	4	589	c.472C>A	c.(472-474)Caa>Aaa	p.Q158K		NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	158					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		AAGACAAGACCAAGTGAGTAA	0.333																																					p.Q158K		.											.	SPACA1	90	0			c.C472A						.						69.0	69.0	69.0					6																	88768538		2203	4300	6503	SO:0001583	missense	81833	exon4			CAAGACCAAGTGA	AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.472C>A	6.37:g.88768538C>A	ENSP00000237201:p.Gln158Lys	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	5.0	NM_030960		Missense_Mutation	SNP	ENST00000237201.1	37	CCDS5014.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146618	0.57044	.	.	ENSG00000118434	ENST00000237201	T	0.23147	1.92	5.77	5.77	0.91146	.	0.088226	0.49916	D	0.000136	T	0.21921	0.0528	L	0.55103	1.725	0.33206	D	0.552773	P	0.40970	0.734	P	0.46510	0.519	T	0.04579	-1.0941	10	0.44086	T	0.13	-16.1234	13.8419	0.63444	0.1525:0.8475:0.0:0.0	.	158	Q9HBV2	SACA1_HUMAN	K	158	ENSP00000237201:Q158K	ENSP00000237201:Q158K	Q	+	1	0	SPACA1	88825257	0.996000	0.38824	0.991000	0.47740	0.643000	0.38383	2.284000	0.43478	2.733000	0.93635	0.585000	0.79938	CAA	.		0.333	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041459.1		
SPAG17	200162	hgsc.bcm.edu;bcgsc.ca	37	1	118550817	118550817	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:118550817C>A	ENST00000336338.5	-	31	4502	c.4437G>T	c.(4435-4437)gaG>gaT	p.E1479D		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1479						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TCCGAGGACCCTCGGCTACAA	0.507																																					p.E1479D		.											.	SPAG17	158	0			c.G4437T						.						82.0	71.0	75.0					1																	118550817		2203	4300	6503	SO:0001583	missense	200162	exon31			AGGACCCTCGGCT		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.4437G>T	1.37:g.118550817C>A	ENSP00000337804:p.Glu1479Asp	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.810801	0.50421	.	.	ENSG00000155761	ENST00000336338	T	0.19806	2.12	5.53	0.226	0.15353	.	0.547480	0.20513	N	0.090843	T	0.06690	0.0171	L	0.54323	1.7	0.09310	N	1	B	0.17268	0.021	B	0.18263	0.021	T	0.29941	-0.9995	10	0.54805	T	0.06	.	5.3301	0.15928	0.0:0.1566:0.2802:0.5631	.	1479	Q6Q759	SPG17_HUMAN	D	1479	ENSP00000337804:E1479D	ENSP00000337804:E1479D	E	-	3	2	SPAG17	118352340	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	0.045000	0.14013	0.137000	0.18759	-0.339000	0.08088	GAG	.		0.507	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
SPATA19	219938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	133714476	133714476	+	Missense_Mutation	SNP	C	C	G	rs138068697		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:133714476C>G	ENST00000299140.3	-	3	249	c.195G>C	c.(193-195)caG>caC	p.Q65H	SPATA19_ENST00000532889.1_Missense_Mutation_p.Q65H	NM_174927.1	NP_777587.1	Q7Z5L4	SPT19_HUMAN	spermatogenesis associated 19	65					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	mitochondrial outer membrane (GO:0005741)				cervix(1)|endometrium(2)|large_intestine(2)|lung(5)|prostate(1)	11	all_hematologic(175;0.127)	all_cancers(12;5.59e-17)|all_epithelial(12;2.65e-12)|all_lung(97;0.00045)|Lung NSC(97;0.000861)|Breast(109;0.000873)|Medulloblastoma(222;0.0425)|Esophageal squamous(93;0.0844)|all_neural(223;0.117)		Epithelial(10;4.36e-10)|all cancers(11;7.1e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00286)|Lung(977;0.207)		CCCTTACACCCTGGGAAGGGT	0.512																																					p.Q65H		.											.	SPATA19	90	0			c.G195C						.						136.0	131.0	132.0					11																	133714476		2201	4297	6498	SO:0001583	missense	219938	exon3			TACACCCTGGGAA	AK098717	CCDS8493.1	11q25	2010-04-23				ENSG00000166118			30614	protein-coding gene	gene with protein product	"""spergen 1"", ""cancer/testis antigen 132"""	609805				12477932	Standard	XM_005271448		Approved	FLJ25851, spergen1, SPAS1, CT132	uc001qgv.1	Q7Z5L4		ENST00000299140.3:c.195G>C	11.37:g.133714476C>G	ENSP00000299140:p.Gln65His	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	110.0	NM_174927	Q8N7A9	Missense_Mutation	SNP	ENST00000299140.3	37	CCDS8493.1	.	.	.	.	.	.	.	.	.	.	C	8.443	0.851238	0.17034	.	.	ENSG00000166118	ENST00000299140;ENST00000532889	T;T	0.46451	0.87;0.87	1.33	1.33	0.21861	.	.	.	.	.	T	0.36193	0.0958	N	0.08118	0	0.09310	N	1	D	0.54397	0.966	P	0.61592	0.891	T	0.16070	-1.0415	9	0.87932	D	0	.	6.4121	0.21696	0.0:1.0:0.0:0.0	.	65	Q7Z5L4	SPT19_HUMAN	H	65	ENSP00000299140:Q65H;ENSP00000435248:Q65H	ENSP00000299140:Q65H	Q	-	3	2	SPATA19	133219686	0.038000	0.19896	0.010000	0.14722	0.010000	0.07245	0.441000	0.21611	0.585000	0.29608	0.591000	0.81541	CAG	C|1.000;T|0.000		0.512	SPATA19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393281.1	NM_174927	
SPATA7	55812	hgsc.bcm.edu;bcgsc.ca	37	14	88892683	88892683	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:88892683T>C	ENST00000393545.4	+	6	769	c.480T>C	c.(478-480)agT>agC	p.S160S	SPATA7_ENST00000045347.7_Silent_p.S160S|SPATA7_ENST00000356583.5_Silent_p.S128S|SPATA7_ENST00000556553.1_Silent_p.S128S	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	160					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						TACACCTAAGTCTACATAAAT	0.458																																					p.S160S		.											.	SPATA7	91	0			c.T480C						.						80.0	71.0	74.0					14																	88892683		2203	4300	6503	SO:0001819	synonymous_variant	55812	exon6			CCTAAGTCTACAT	AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.480T>C	14.37:g.88892683T>C		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_018418	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Silent	SNP	ENST00000393545.4	37	CCDS9883.1																																																																																			.		0.458	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1		
SPECC1	92521	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	20163561	20163561	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:20163561G>A	ENST00000261503.5	+	12	2945	c.2894G>A	c.(2893-2895)cGc>cAc	p.R965H	SPECC1_ENST00000395530.2_Missense_Mutation_p.R884H|SPECC1_ENST00000536879.1_Missense_Mutation_p.R305H|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395527.4_Missense_Mutation_p.R965H	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	965	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		GGTTCCAAGCGCAATGCTCTA	0.507																																					p.R965H		.											.	SPECC1	639	0			c.G2894A						.						125.0	116.0	119.0					17																	20163561		2203	4300	6503	SO:0001583	missense	92521	exon12			CCAAGCGCAATGC	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.2894G>A	17.37:g.20163561G>A	ENSP00000261503:p.Arg965His	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	60.0	NM_001033553	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829930	0.91036	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000536879;ENST00000395527	D;D;T	0.95377	-3.69;-3.69;0.58	4.31	4.31	0.51392	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98166	0.9394	M	0.93283	3.4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	D	0.98968	1.0800	10	0.87932	D	0	-14.961	14.6715	0.68948	0.0:0.0:1.0:0.0	.	965;884;965	A8MV89;Q5M775-4;Q5M775	.;.;CYTSB_HUMAN	H	965;965;305;884	ENSP00000261503:R965H;ENSP00000438294:R305H;ENSP00000378898:R884H	ENSP00000261503:R965H	R	+	2	0	SPECC1	20104153	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.598000	0.90852	2.399000	0.81585	0.655000	0.94253	CGC	.		0.507	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
SPESP1	246777	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	69238897	69238897	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:69238897A>G	ENST00000310673.3	+	2	1178	c.1024A>G	c.(1024-1026)Aga>Gga	p.R342G	NOX5_ENST00000448182.3_Intron|NOX5_ENST00000260364.5_Intron|RP11-809H16.2_ENST00000557966.1_RNA|NOX5_ENST00000455873.3_Intron	NM_145658.3	NP_663633.1	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1	342					acrosome reaction (GO:0007340)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	19						TAGATCAAGGAGAGTCACAGC	0.264																																					p.R342G		.											.	SPESP1	90	0			c.A1024G						.						31.0	33.0	32.0					15																	69238897		1940	4083	6023	SO:0001583	missense	246777	exon2			TCAAGGAGAGTCA	AF275321	CCDS10230.1	15q22.31	2011-04-15				ENSG00000258484			15570	protein-coding gene	gene with protein product		609399				12773409	Standard	NM_145658		Approved	SP-ESP	uc002arn.2	Q6UW49		ENST00000310673.3:c.1024A>G	15.37:g.69238897A>G	ENSP00000312284:p.Arg342Gly	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	4.0	NM_145658	Q8NG22|Q8WVH8	Missense_Mutation	SNP	ENST00000310673.3	37	CCDS10230.1	.	.	.	.	.	.	.	.	.	.	A	3.487	-0.104586	0.06967	.	.	ENSG00000258484	ENST00000310673	T	0.27720	1.65	5.19	1.62	0.23740	.	0.617328	0.14594	N	0.310099	T	0.14442	0.0349	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31668	-0.9935	10	0.13853	T	0.58	-0.7094	6.5665	0.22515	0.716:0.0:0.284:0.0	.	342	Q6UW49	SPESP_HUMAN	G	342	ENSP00000312284:R342G	ENSP00000312284:R342G	R	+	1	2	SPESP1	67025951	0.004000	0.15560	0.023000	0.16930	0.022000	0.10575	-0.118000	0.10692	0.386000	0.24997	-0.274000	0.10170	AGA	.		0.264	SPESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257125.1	NM_145658	
SPG7	6687	hgsc.bcm.edu;bcgsc.ca	37	16	89616941	89616941	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:89616941A>G	ENST00000268704.2	+	13	1718	c.1703A>G	c.(1702-1704)cAg>cGg	p.Q568R		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	568					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		AAGGAAGAACAGAAAGTGGTT	0.592																																					p.Q568R		.											.	SPG7	226	0			c.A1703G						.						116.0	107.0	110.0					16																	89616941		2198	4300	6498	SO:0001583	missense	6687	exon13			AAGAACAGAAAGT	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1703A>G	16.37:g.89616941A>G	ENSP00000268704:p.Gln568Arg	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	4.0	NM_003119	O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	ENST00000268704.2	37	CCDS10977.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.222|1.222	-0.626757|-0.626757	0.03610|0.03610	.|.	.|.	ENSG00000197912|ENSG00000197912	ENST00000268704|ENST00000312613	T|.	0.80909|.	-1.43|.	5.84|5.84	3.53|3.53	0.40419|0.40419	Peptidase M41 (1);Peptidase M41, FtsH (2);|.	0.160396|.	0.56097|.	N|.	0.000027|.	T|T	0.07279|0.07279	0.0184|0.0184	N|N	0.00034|0.00034	-2.565|-2.565	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|T	0.10706|0.10706	-1.0618|-1.0618	10|6	0.06757|0.87932	T|D	0.87|0	.|.	3.2925|3.2925	0.06954|0.06954	0.5682:0.0:0.2664:0.1654|0.5682:0.0:0.2664:0.1654	.|.	568|.	Q9UQ90|.	SPG7_HUMAN|.	R|G	568|160	ENSP00000268704:Q568R|.	ENSP00000268704:Q568R|ENSP00000310320:R160G	Q|R	+|+	2|1	0|2	SPG7|SPG7	88144442|88144442	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.310000|0.310000	0.27922|0.27922	3.457000|3.457000	0.53007|0.53007	1.052000|1.052000	0.40392|0.40392	0.459000|0.459000	0.35465|0.35465	CAG|AGA	.		0.592	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119	
SPTB	6710	hgsc.bcm.edu;bcgsc.ca	37	14	65252316	65252316	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr14:65252316T>C	ENST00000389721.5	-	17	3826	c.3794A>G	c.(3793-3795)gAg>gGg	p.E1265G	SPTB_ENST00000556626.1_Missense_Mutation_p.E1265G|SPTB_ENST00000542895.1_Missense_Mutation_p.E1265G|SPTB_ENST00000389720.3_Missense_Mutation_p.E1265G|SPTB_ENST00000389722.3_Missense_Mutation_p.E1265G	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1265					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GACAGAGGCCTCCTGGGCCTT	0.557																																					p.E1265G		.											.	SPTB	100	0			c.A3794G						.						71.0	62.0	65.0					14																	65252316		2203	4300	6503	SO:0001583	missense	6710	exon17			GAGGCCTCCTGGG		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3794A>G	14.37:g.65252316T>C	ENSP00000374371:p.Glu1265Gly	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	T	14.28	2.487581	0.44249	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	5.18	5.18	0.71444	.	0.054164	0.64402	D	0.000001	T	0.50990	0.1648	M	0.78637	2.42	0.80722	D	1	B;P	0.43314	0.085;0.803	B;P	0.48795	0.126;0.59	T	0.57219	-0.7849	10	0.66056	D	0.02	.	14.2976	0.66325	0.0:0.0:0.0:1.0	.	1265;1269	P11277;Q59FP5	SPTB1_HUMAN;.	G	1269;1265;49;1265;1265;1265;1265	ENSP00000374372:E1265G;ENSP00000451752:E1265G;ENSP00000374371:E1265G;ENSP00000443882:E1265G;ENSP00000374370:E1265G	ENSP00000334218:E49G	E	-	2	0	SPTB	64322069	1.000000	0.71417	0.999000	0.59377	0.104000	0.19210	7.981000	0.88123	2.080000	0.62538	0.443000	0.29094	GAG	.		0.557	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
SPTBN2	6712	hgsc.bcm.edu;bcgsc.ca	37	11	66468660	66468660	+	Silent	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:66468660G>T	ENST00000533211.1	-	17	3241	c.2910C>A	c.(2908-2910)acC>acA	p.T970T	SPTBN2_ENST00000529997.1_Silent_p.T970T|SPTBN2_ENST00000309996.2_Silent_p.T970T			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	970					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TCCAGGCCTGGGTCTCCGTGC	0.617																																					p.T970T		.											.	SPTBN2	155	0			c.C2910A						.						51.0	48.0	49.0					11																	66468660		2199	4295	6494	SO:0001819	synonymous_variant	6712	exon16			GGCCTGGGTCTCC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.2910C>A	11.37:g.66468660G>T		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	6.0	NM_006946	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																			.		0.617	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
SRFBP1	153443	hgsc.bcm.edu;bcgsc.ca	37	5	121309963	121309963	+	Silent	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:121309963C>A	ENST00000339397.4	+	2	181	c.109C>A	c.(109-111)Cga>Aga	p.R37R		NM_152546.2	NP_689759.2			serum response factor binding protein 1											central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		GAGTGTTGGCCGACTGAAGTC	0.313																																					p.R37R		.											.	SRFBP1	90	0			c.C109A						.						70.0	65.0	67.0					5																	121309963		1816	4073	5889	SO:0001819	synonymous_variant	153443	exon2			GTTGGCCGACTGA	AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.109C>A	5.37:g.121309963C>A		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	5.0	NM_152546		Silent	SNP	ENST00000339397.4	37	CCDS43354.1																																																																																			.		0.313	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371200.1	NM_152546	
STAT5A	6776	hgsc.bcm.edu;bcgsc.ca	37	17	40460208	40460208	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:40460208T>C	ENST00000345506.4	+	17	2561	c.1919T>C	c.(1918-1920)cTg>cCg	p.L640P	STAT5A_ENST00000590949.1_Missense_Mutation_p.L640P|STAT5A_ENST00000452307.2_Missense_Mutation_p.L637P|STAT5A_ENST00000588868.1_Missense_Mutation_p.L609P|STAT5A_ENST00000587646.1_Missense_Mutation_p.L128P|STAT5A_ENST00000546010.2_Missense_Mutation_p.L610P	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	640	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		GAACGCAACCTGTGGAACCTG	0.547																																					p.L640P		.											.	STAT5A	846	0			c.T1919C						.						79.0	71.0	74.0					17																	40460208		2203	4300	6503	SO:0001583	missense	6776	exon17			GCAACCTGTGGAA	U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1919T>C	17.37:g.40460208T>C	ENSP00000341208:p.Leu640Pro	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	6.0	NM_003152	Q1KLZ6	Missense_Mutation	SNP	ENST00000345506.4	37	CCDS11424.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.710982	0.68730	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	D;D;D	0.88664	-2.41;-2.41;-2.41	5.06	5.06	0.68205	SH2 motif (4);	0.147903	0.46145	D	0.000306	D	0.88108	0.6348	N	0.11064	0.09	0.80722	D	1	D;D;D;P;D	0.69078	0.997;0.997;0.997;0.529;0.997	D;D;D;P;D	0.69142	0.938;0.958;0.938;0.489;0.962	D	0.90804	0.4696	10	0.87932	D	0	-19.3234	14.4833	0.67597	0.0:0.0:0.0:1.0	.	640;637;610;611;640	A8K6I5;Q8WWS9;Q1KLZ6;Q59GY7;P42229	.;.;.;.;STA5A_HUMAN	P	640;610;611;637	ENSP00000341208:L640P;ENSP00000443107:L610P;ENSP00000400320:L637P	ENSP00000341208:L640P	L	+	2	0	STAT5A	37713734	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	6.927000	0.75840	1.919000	0.55581	0.459000	0.35465	CTG	.		0.547	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152	
SSTR2	6752	hgsc.bcm.edu;bcgsc.ca	37	17	71166524	71166524	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:71166524A>G	ENST00000357585.2	+	2	1435	c.1066A>G	c.(1066-1068)Acc>Gcc	p.T356A	SSTR2_ENST00000315332.2_Intron|RP11-143K11.5_ENST00000580671.1_RNA	NM_001050.2	NP_001041.1	P30874	SSR2_HUMAN	somatostatin receptor 2	356				T -> A (in Ref. 5; BAG36594). {ECO:0000305}.	adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|peristalsis (GO:0030432)|regulation of muscle contraction (GO:0006937)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|somatostatin receptor activity (GO:0004994)			endometrium(2)|large_intestine(5)|lung(2)|prostate(2)	11			LUSC - Lung squamous cell carcinoma(166;0.197)		Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	GACCACGGAGACCCAGAGGAC	0.557																																					p.T356A		.											.	SSTR2	522	0			c.A1066G						.						55.0	51.0	52.0					17																	71166524		2203	4300	6503	SO:0001583	missense	6752	exon2			ACGGAGACCCAGA		CCDS11691.1	17q24	2012-08-08				ENSG00000180616		"""GPCR / Class A : Somatostatin receptors"""	11331	protein-coding gene	gene with protein product		182452				8449518	Standard	NM_001050		Approved		uc002jje.3	P30874		ENST00000357585.2:c.1066A>G	17.37:g.71166524A>G	ENSP00000350198:p.Thr356Ala	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	5.0	NM_001050	A8K3Y0|B2R9P7|Q4VBP0|Q96GE0|Q96TF2|Q9BWH1	Missense_Mutation	SNP	ENST00000357585.2	37	CCDS11691.1	.	.	.	.	.	.	.	.	.	.	A	11.41	1.630056	0.28978	.	.	ENSG00000180616	ENST00000357585	T	0.72394	-0.65	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.62429	0.2427	L	0.43152	1.355	0.80722	D	1	B	0.14805	0.011	B	0.16289	0.015	T	0.57705	-0.7765	10	0.18710	T	0.47	.	15.0092	0.71536	1.0:0.0:0.0:0.0	.	356	P30874	SSR2_HUMAN	A	356	ENSP00000350198:T356A	ENSP00000350198:T356A	T	+	1	0	SSTR2	68678119	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.905000	0.92613	2.084000	0.62774	0.533000	0.62120	ACC	.		0.557	SSTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441633.1		
SRSF2	6427	hgsc.bcm.edu;bcgsc.ca	37	17	74732955	74732955	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:74732955C>T	ENST00000392485.2	-	1	460	c.288G>A	c.(286-288)ccG>ccA	p.P96P	MFSD11_ENST00000591864.1_5'UTR|MFSD11_ENST00000590514.1_5'Flank|MFSD11_ENST00000593181.1_5'Flank|MFSD11_ENST00000355954.3_5'Flank|RP11-318A15.7_ENST00000587459.1_Intron|MFSD11_ENST00000586622.1_5'UTR|MIR636_ENST00000384825.1_RNA|MFSD11_ENST00000336509.4_5'Flank|SRSF2_ENST00000359995.5_Silent_p.P96P|SRSF2_ENST00000508921.3_Silent_p.P96P|MFSD11_ENST00000590393.1_5'Flank|MFSD11_ENST00000588460.1_5'UTR	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	96					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA biosynthetic process (GO:2001141)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)	p.P95_R102del(21)|p.P95_D97del(2)		haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329						GGTGTGAGTCCGGGGGGCGGC	0.741			Mis		"""MDS, CLL"""																																p.P96P		.		Dom	yes		17	17q25	6427	serine/arginine-rich splicing factor 2		L	.	SRSF2	226	23	Deletion - In frame(23)	haematopoietic_and_lymphoid_tissue(23)	c.G288A						.						14.0	17.0	16.0					17																	74732955		2126	4192	6318	SO:0001819	synonymous_variant	6427	exon1			TGAGTCCGGGGGG	M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2		8530103, 20516191	Standard	NM_003016		Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.288G>A	17.37:g.74732955C>T		Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	4.0	NM_001195427	B3KWD5|B4DN89|H0YG49	Silent	SNP	ENST00000392485.2	37	CCDS11749.1																																																																																			.		0.741	SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437489.1	NM_003016	
SUMF1	285362	hgsc.bcm.edu;bcgsc.ca	37	3	4458810	4458810	+	Splice_Site	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:4458810A>G	ENST00000272902.5	-	6	876		c.e6+1		SUMF1_ENST00000458465.2_Intron|SUMF1_ENST00000405420.2_Splice_Site|SUMF1_ENST00000383843.5_Splice_Site|SUMF1_ENST00000534863.1_Splice_Site	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1						cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		CTCATTACTCACAGGCGCAGT	0.547																																					.		.											.	SUMF1	91	0			c.765+2T>C						.						167.0	148.0	155.0					3																	4458810		2203	4300	6503	SO:0001630	splice_region_variant	285362	exon6			TTACTCACAGGCG	BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.840+1T>C	3.37:g.4458810A>G		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_001164674	B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Splice_Site	SNP	ENST00000272902.5	37	CCDS2564.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.400217	0.83120	.	.	ENSG00000144455	ENST00000534982;ENST00000534863;ENST00000272902;ENST00000383843;ENST00000405420	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1525	0.72713	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SUMF1	4433810	1.000000	0.71417	0.999000	0.59377	0.853000	0.48598	8.263000	0.89864	2.217000	0.71921	0.533000	0.62120	.	.		0.547	SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206591.2	NM_182760	Intron
SVEP1	79987	hgsc.bcm.edu;bcgsc.ca	37	9	113169106	113169106	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:113169106C>T	ENST00000401783.2	-	38	9110	c.8774G>A	c.(8773-8775)gGt>gAt	p.G2925D	SVEP1_ENST00000297826.5_Missense_Mutation_p.G851D|SVEP1_ENST00000374469.1_Missense_Mutation_p.G2902D	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2925	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TTTTGGAGCACCGTGCAAGAT	0.537																																					p.G2925D		.											.	SVEP1	75	0			c.G8774A						.						148.0	149.0	149.0					9																	113169106		2064	4209	6273	SO:0001583	missense	79987	exon38			GGAGCACCGTGCA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.8774G>A	9.37:g.113169106C>T	ENSP00000384917:p.Gly2925Asp	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195395	0.58126	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.72725	-0.68;-0.68;-0.68	5.41	5.41	0.78517	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.89037	0.6601	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91255	0.5032	10	0.56958	D	0.05	.	19.1906	0.93664	0.0:1.0:0.0:0.0	.	2925	Q4LDE5	SVEP1_HUMAN	D	2925;2902;851	ENSP00000384917:G2925D;ENSP00000363593:G2902D;ENSP00000297826:G851D	ENSP00000297826:G851D	G	-	2	0	SVEP1	112208927	1.000000	0.71417	0.197000	0.23402	0.142000	0.21351	7.582000	0.82546	2.548000	0.85928	0.591000	0.81541	GGT	.		0.537	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SYT10	341359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	33579155	33579155	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:33579155C>T	ENST00000228567.3	-	2	723	c.427G>A	c.(427-429)Gaa>Aaa	p.E143K	SYT10_ENST00000567656.1_5'Flank|SYT10_ENST00000535526.1_5'UTR	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	143					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					GTTTGGACTTCTGCTGGGATG	0.383																																					p.E143K		.											.	SYT10	92	0			c.G427A						.						186.0	193.0	191.0					12																	33579155		2203	4300	6503	SO:0001583	missense	341359	exon2			GGACTTCTGCTGG	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.427G>A	12.37:g.33579155C>T	ENSP00000228567:p.Glu143Lys	Somatic	675.0	2.0		WXS	Illumina HiSeq	Phase_I	621.0	234.0	NM_198992	Q495U2	Missense_Mutation	SNP	ENST00000228567.3	37	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782972	0.90282	.	.	ENSG00000110975	ENST00000228567	T	0.56103	0.48	3.78	3.78	0.43462	.	0.000000	0.41938	U	0.000791	T	0.53449	0.1797	M	0.71036	2.16	0.80722	D	1	P	0.38711	0.643	B	0.38327	0.271	T	0.60352	-0.7280	10	0.40728	T	0.16	.	15.8987	0.79356	0.0:1.0:0.0:0.0	.	143	Q6XYQ8	SYT10_HUMAN	K	143	ENSP00000228567:E143K	ENSP00000228567:E143K	E	-	1	0	SYT10	33470422	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.798000	0.75155	2.390000	0.81377	0.655000	0.94253	GAA	.		0.383	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992	
TACC2	10579	hgsc.bcm.edu;bcgsc.ca	37	10	123848021	123848021	+	Silent	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr10:123848021T>C	ENST00000369005.1	+	5	5828	c.5488T>C	c.(5488-5490)Tta>Cta	p.L1830L	TACC2_ENST00000513429.1_Intron|TACC2_ENST00000334433.3_Silent_p.L1830L|TACC2_ENST00000515603.1_Silent_p.L1830L|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Silent_p.L1830L|TACC2_ENST00000453444.2_Silent_p.L1830L	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1830					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCCATCCATGTTACCTTCGGT	0.438																																					p.L1830L		.											.	TACC2	296	0			c.T5488C						.						59.0	52.0	54.0					10																	123848021		2203	4300	6503	SO:0001819	synonymous_variant	10579	exon5			TCCATGTTACCTT	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.5488T>C	10.37:g.123848021T>C		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	6.0	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	37	CCDS7626.1																																																																																			.		0.438	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
NPFF	8620	hgsc.bcm.edu;bcgsc.ca	37	12	53899518	53899518	+	IGR	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:53899518T>C	ENST00000267017.3	-	0	592				TARBP2_ENST00000456234.2_Missense_Mutation_p.I255T|TARBP2_ENST00000552857.1_Silent_p.D142D|TARBP2_ENST00000266987.2_Missense_Mutation_p.I276T|TARBP2_ENST00000394357.2_Missense_Mutation_p.I255T	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						GGAGAGAAGATCCTGTCCCTC	0.617																																					p.I276T		.											.	TARBP2	226	0			c.T827C						.						104.0	107.0	106.0					12																	53899518		2203	4300	6503	SO:0001628	intergenic_variant	6895	exon8			AGAAGATCCTGTC	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		12.37:g.53899518T>C		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_134323	Q3SXL4	Missense_Mutation	SNP	ENST00000267017.3	37	CCDS8862.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.701358	0.88924	.	.	ENSG00000139546	ENST00000266987;ENST00000456234;ENST00000394357	T;T;T	0.65364	-0.15;-0.14;-0.14	4.98	4.98	0.66077	.	0.050187	0.85682	D	0.000000	T	0.59569	0.2203	L	0.59436	1.845	0.80722	D	1	P	0.34522	0.455	B	0.34991	0.193	T	0.63888	-0.6535	10	0.54805	T	0.06	-8.0569	14.0884	0.64973	0.0:0.0:0.0:1.0	.	276	Q15633	TRBP2_HUMAN	T	276;255;255	ENSP00000266987:I276T;ENSP00000416077:I255T;ENSP00000377885:I255T	ENSP00000266987:I276T	I	+	2	0	TARBP2	52185785	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.690000	0.61731	2.227000	0.72691	0.459000	0.35465	ATC	.		0.617	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717	
TBCK	93627	hgsc.bcm.edu;bcgsc.ca	37	4	107154107	107154107	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:107154107C>T	ENST00000273980.5	-	18	2074	c.1627G>A	c.(1627-1629)Gtg>Atg	p.V543M	TBCK_ENST00000432496.2_Missense_Mutation_p.V543M|TBCK_ENST00000394708.2_Missense_Mutation_p.V543M|TBCK_ENST00000361687.4_Missense_Mutation_p.V480M|TBCK_ENST00000394706.3_Missense_Mutation_p.V504M					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						TGCCAATACACAAGATCAGGA	0.353																																					p.V543M		.											.	TBCK	336	0			c.G1627A						.						117.0	113.0	115.0					4																	107154107		2203	4300	6503	SO:0001583	missense	93627	exon17			AATACACAAGATC		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1627G>A	4.37:g.107154107C>T	ENSP00000273980:p.Val543Met	Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_001163436		Missense_Mutation	SNP	ENST00000273980.5	37	CCDS54788.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953603	0.92660	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.04156	3.69;3.69;3.69;3.69;3.69	5.46	5.46	0.80206	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.29321	0.0730	M	0.88241	2.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.986;0.998	T	0.10245	-1.0638	10	0.87932	D	0	.	19.3032	0.94151	0.0:1.0:0.0:0.0	.	543;504;480	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	M	543;543;480;504;543	ENSP00000273980:V543M;ENSP00000405847:V543M;ENSP00000355338:V480M;ENSP00000378196:V504M;ENSP00000378198:V543M	ENSP00000273980:V543M	V	-	1	0	TBCK	107373556	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.656000	0.83736	2.563000	0.86464	0.655000	0.94253	GTG	.		0.353	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
TCP11L2	255394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	106740125	106740125	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:106740125G>A	ENST00000299045.3	+	10	1551	c.1377G>A	c.(1375-1377)atG>atA	p.M459I		NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	459										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						AAAAATGCATGCCTCCTATGC	0.413																																					p.M459I		.											.	TCP11L2	93	0			c.G1377A						.						64.0	58.0	60.0					12																	106740125		2203	4300	6503	SO:0001583	missense	255394	exon10			ATGCATGCCTCCT	BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.1377G>A	12.37:g.106740125G>A	ENSP00000299045:p.Met459Ile	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	42.0	NM_152772	B2RA65|G3V1Y9	Missense_Mutation	SNP	ENST00000299045.3	37	CCDS9104.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.625977	0.46840	.	.	ENSG00000166046	ENST00000299045	T	0.10960	2.82	5.69	5.69	0.88448	.	0.588706	0.19966	N	0.102109	T	0.08980	0.0222	N	0.21142	0.635	0.80722	D	1	B	0.11235	0.004	B	0.16722	0.016	T	0.21895	-1.0232	10	0.34782	T	0.22	-3.3243	13.0662	0.59034	0.0733:0.0:0.9267:0.0	.	459	Q8N4U5	T11L2_HUMAN	I	459	ENSP00000299045:M459I	ENSP00000299045:M459I	M	+	3	0	TCP11L2	105264255	1.000000	0.71417	0.988000	0.46212	0.984000	0.73092	3.394000	0.52551	2.685000	0.91497	0.655000	0.94253	ATG	.		0.413	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407206.1	NM_152772	
TENM4	26011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	78437179	78437179	+	Silent	SNP	C	C	A	rs369844183		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:78437179C>A	ENST00000278550.7	-	23	3957	c.3495G>T	c.(3493-3495)gcG>gcT	p.A1165A		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1165					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CAAGCTTGGACGCGTCAATTT	0.458																																					p.A1165A		.											.	.	.	0			c.G3495T						.						320.0	310.0	313.0					11																	78437179		1943	4136	6079	SO:0001819	synonymous_variant	26011	exon23			CTTGGACGCGTCA	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.3495G>T	11.37:g.78437179C>A		Somatic	431.0	0.0		WXS	Illumina HiSeq	Phase_I	372.0	138.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	CCDS44688.1																																																																																			.		0.458	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
TFAP2D	83741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	50740456	50740456	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:50740456C>T	ENST00000008391.3	+	8	1466	c.1238C>T	c.(1237-1239)aCt>aTt	p.T413I		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					GAAAAACACACTACTCACAAG	0.512																																					p.T413I		.											.	TFAP2D	159	0			c.C1238T						.						66.0	65.0	65.0					6																	50740456		2203	4300	6503	SO:0001583	missense	83741	exon8			AACACACTACTCA	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1238C>T	6.37:g.50740456C>T	ENSP00000008391:p.Thr413Ile	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	43.0	NM_172238		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.688160	0.29962	.	.	ENSG00000008197	ENST00000008391	D	0.96885	-4.16	5.31	4.45	0.53987	Transcription factor AP-2, C-terminal (1);	0.155858	0.43579	D	0.000551	D	0.89132	0.6628	N	0.08118	0	0.44149	D	0.996941	B	0.19583	0.037	B	0.34346	0.18	D	0.85696	0.1310	10	0.66056	D	0.02	-8.3512	16.1801	0.81892	0.0:0.8665:0.1335:0.0	.	413	Q7Z6R9	AP2D_HUMAN	I	413	ENSP00000008391:T413I	ENSP00000008391:T413I	T	+	2	0	TFAP2D	50848415	1.000000	0.71417	0.987000	0.45799	0.690000	0.40134	7.487000	0.81328	1.258000	0.44101	-0.355000	0.07637	ACT	.		0.512	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
TFR2	7036	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	100226878	100226878	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:100226878T>C	ENST00000462107.1	-	11	1675	c.1388A>G	c.(1387-1389)aAc>aGc	p.N463S	TFR2_ENST00000544242.1_Missense_Mutation_p.N4S|TFR2_ENST00000431692.1_3'UTR|TFR2_ENST00000223051.3_Missense_Mutation_p.N463S			Q9UP52	TFR2_HUMAN	transferrin receptor 2	463					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	GACCTTACCGTTGCTCACCAT	0.662																																					p.N463S		.											.	TFR2	92	0			c.A1388G						.						95.0	89.0	91.0					7																	100226878		2203	4300	6503	SO:0001583	missense	7036	exon10			TTACCGTTGCTCA	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.1388A>G	7.37:g.100226878T>C	ENSP00000420525:p.Asn463Ser	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	4.0	NM_003227	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	ENST00000462107.1	37	CCDS34707.1	.	.	.	.	.	.	.	.	.	.	T	14.76	2.631235	0.46944	.	.	ENSG00000106327	ENST00000223051;ENST00000462107;ENST00000544242	T;T;T	0.46819	0.86;0.86;0.86	4.54	3.35	0.38373	Peptidase M28 (1);	0.273448	0.38837	N	0.001546	T	0.28466	0.0704	N	0.17922	0.545	0.80722	D	1	B	0.22800	0.075	B	0.23018	0.043	T	0.05131	-1.0904	10	0.25751	T	0.34	-26.323	6.9773	0.24683	0.0:0.1054:0.0:0.8946	.	463	Q9UP52	TFR2_HUMAN	S	463;463;4	ENSP00000223051:N463S;ENSP00000420525:N463S;ENSP00000443656:N4S	ENSP00000223051:N463S	N	-	2	0	TFR2	100064814	0.999000	0.42202	0.994000	0.49952	0.916000	0.54674	3.319000	0.51983	0.736000	0.32559	0.459000	0.35465	AAC	.		0.662	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
TH	7054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	2190970	2190970	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:2190970C>T	ENST00000381178.1	-	3	333	c.315G>A	c.(313-315)gaG>gaA	p.E105E	TH_ENST00000381175.1_Silent_p.E101E|TH_ENST00000333684.5_Silent_p.E78E|TH_ENST00000352909.3_Silent_p.E74E	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	105					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	CCTCCTTCTCCTCAAAGGCCA	0.687																																					p.E105E		.											.	TH	90	0			c.G315A						.						41.0	42.0	42.0					11																	2190970		2202	4299	6501	SO:0001819	synonymous_variant	7054	exon3			CTTCTCCTCAAAG	X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.315G>A	11.37:g.2190970C>T		Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	86.0	NM_199292	B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Silent	SNP	ENST00000381178.1	37	CCDS7731.1																																																																																			.		0.687	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026597.1	NM_000360	
THBS1	7057	hgsc.bcm.edu;bcgsc.ca	37	15	39886569	39886569	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:39886569G>T	ENST00000260356.5	+	21	3598	c.3433G>T	c.(3433-3435)Ggt>Tgt	p.G1145C	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	1145	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		AACCTATGCTGGTGGTAGACT	0.403																																					p.G1145C		.											.	THBS1	653	0			c.G3433T						.						154.0	145.0	148.0					15																	39886569		2200	4297	6497	SO:0001583	missense	7057	exon21			TATGCTGGTGGTA		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.3433G>T	15.37:g.39886569G>T	ENSP00000260356:p.Gly1145Cys	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986764	0.93106	.	.	ENSG00000137801	ENST00000260356	D	0.98060	-4.69	5.44	5.44	0.79542	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.35320	N	0.003294	D	0.98953	0.9644	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99659	1.0993	10	0.87932	D	0	-23.7926	19.6125	0.95613	0.0:0.0:1.0:0.0	.	1060;1145	B4E3J7;P07996	.;TSP1_HUMAN	C	1145	ENSP00000260356:G1145C	ENSP00000260356:G1145C	G	+	1	0	THBS1	37673861	1.000000	0.71417	0.989000	0.46669	0.985000	0.73830	9.813000	0.99286	2.698000	0.92095	0.591000	0.81541	GGT	.		0.403	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
TK2	7084	hgsc.bcm.edu;bcgsc.ca	37	16	66575828	66575828	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:66575828C>A	ENST00000451102.2	-	3	535	c.185G>T	c.(184-186)gGg>gTg	p.G62V	TK2_ENST00000299697.7_Missense_Mutation_p.G104V|TK2_ENST00000544898.1_Missense_Mutation_p.G13V|TK2_ENST00000525974.1_5'UTR|TK2_ENST00000545043.2_Intron|TK2_ENST00000527284.1_Missense_Mutation_p.G31V|TK2_ENST00000564917.1_Missense_Mutation_p.G62V|TK2_ENST00000527800.1_5'UTR|TK2_ENST00000563369.2_5'UTR|TK2_ENST00000417693.3_Missense_Mutation_p.G62V			O00142	KITM_HUMAN	thymidine kinase 2, mitochondrial	62					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|DNA replication (GO:0006260)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|thymidine kinase activity (GO:0004797)			large_intestine(1)|lung(2)|urinary_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0736)|Epithelial(162;0.237)		TGTCGTCTTCCCACTTGCAAT	0.488																																					p.G62V		.											.	TK2	115	0			c.G185T						.						137.0	109.0	118.0					16																	66575828		2201	4300	6501	SO:0001583	missense	7084	exon3			GTCTTCCCACTTG		CCDS10805.1, CCDS10805.2, CCDS54016.1, CCDS54017.1, CCDS54018.1, CCDS61955.1	16q22-q23.1	2012-10-02			ENSG00000166548	ENSG00000166548	2.7.1.21		11831	protein-coding gene	gene with protein product		188250					Standard	NM_004614		Approved		uc002eos.3	O00142	OTTHUMG00000137499	ENST00000451102.2:c.185G>T	16.37:g.66575828C>A	ENSP00000414334:p.Gly62Val	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	4.0	NM_001172645	B4DGJ7|B4DZK7|B7ZAB1|E9PH08|O15238	Missense_Mutation	SNP	ENST00000451102.2	37	CCDS10805.2	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661623	0.88154	.	.	ENSG00000166548	ENST00000299697;ENST00000417693;ENST00000451102;ENST00000527284;ENST00000544898	D;D;D;D;D	0.99931	-8.18;-8.18;-8.18;-8.18;-8.18	6.06	6.06	0.98353	.	0.097274	0.64402	D	0.000001	D	0.99941	0.9974	H	0.96175	3.78	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.998;1.0;1.0	D	0.96319	0.9235	10	0.87932	D	0	-40.5018	16.1399	0.81515	0.0:1.0:0.0:0.0	.	62;13;26;104;31	O00142;F5GYK4;A4IF54;E5KNQ5;O00142-2	KITM_HUMAN;.;.;.;.	V	104;62;62;31;13	ENSP00000299697:G104V;ENSP00000407469:G62V;ENSP00000414334:G62V;ENSP00000435312:G31V;ENSP00000440898:G13V	ENSP00000299697:G104V	G	-	2	0	TK2	65133329	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.121000	0.64691	2.880000	0.98712	0.650000	0.86243	GGG	.		0.488	TK2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268806.4		
TOP2A	7153	hgsc.bcm.edu;bcgsc.ca	37	17	38561112	38561112	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:38561112A>G	ENST00000423485.1	-	17	2135	c.1977T>C	c.(1975-1977)gaT>gaC	p.D659D		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	659					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	CCTTTCGATCATCTATCTGTT	0.343																																					p.D659D		.											.	TOP2A	655	0			c.T1977C						.						82.0	73.0	76.0					17																	38561112		1811	4077	5888	SO:0001819	synonymous_variant	7153	exon17			TCGATCATCTATC		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.1977T>C	17.37:g.38561112A>G		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_001067	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Silent	SNP	ENST00000423485.1	37	CCDS45672.1																																																																																			.		0.343	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
TPO	7173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1440156	1440156	+	Splice_Site	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr2:1440156G>T	ENST00000345913.4	+	5	573	c.482G>T	c.(481-483)aGa>aTa	p.R161I	TPO_ENST00000539820.1_Splice_Site_p.R161I|TPO_ENST00000382269.3_Splice_Site_p.R161I|TPO_ENST00000349624.3_Splice_Site_p.R161I|TPO_ENST00000346956.3_Splice_Site_p.R161I|TPO_ENST00000497517.2_Intron|TPO_ENST00000329066.4_Splice_Site_p.R161I|TPO_ENST00000382198.1_Splice_Site_p.R161I|TPO_ENST00000382201.3_Splice_Site_p.R161I|TPO_ENST00000337415.3_Splice_Site_p.R161I	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	161					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TGCAACAACAGGTATTGTTTG	0.458																																					p.R161I		.											.	TPO	332	0			c.G482T						.						115.0	113.0	114.0					2																	1440156		2203	4300	6503	SO:0001630	splice_region_variant	7173	exon5			ACAACAGGTATTG		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.482+1G>T	2.37:g.1440156G>T		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	58.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464356	0.63513	.	.	ENSG00000115705	ENST00000382269;ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000539820;ENST00000329066;ENST00000382201;ENST00000423320;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T;T;T;T	0.58797	0.45;0.31;0.31;0.31;0.31;0.45;0.31;0.31;0.31;0.31;0.31	5.07	5.07	0.68467	.	0.050880	0.85682	D	0.000000	T	0.71745	0.3376	L	0.53729	1.69	0.52099	D	0.999946	D;D;D;D;D	0.89917	0.995;0.999;1.0;0.997;0.996	D;D;D;D;D	0.91635	0.953;0.994;0.999;0.953;0.972	T	0.74444	-0.3663	10	0.72032	D	0.01	-16.0578	15.3642	0.74507	0.0:0.0:1.0:0.0	.	161;161;161;161;161	P07202-4;P07202-5;E9PFM6;P07202-2;P07202	.;.;.;.;PERT_HUMAN	I	161;161;161;161;161;161;161;161;161;161;90	ENSP00000371704:R161I;ENSP00000337263:R161I;ENSP00000318820:R161I;ENSP00000263886:R161I;ENSP00000332044:R161I;ENSP00000444840:R161I;ENSP00000329869:R161I;ENSP00000371636:R161I;ENSP00000390994:R161I;ENSP00000371633:R161I;ENSP00000405788:R90I	ENSP00000329869:R161I	R	+	2	0	TPO	1419163	1.000000	0.71417	1.000000	0.80357	0.378000	0.30076	3.983000	0.56916	2.353000	0.79882	0.313000	0.20887	AGA	.		0.458	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	Missense_Mutation
TROAP	10024	hgsc.bcm.edu;bcgsc.ca	37	12	49725141	49725141	+	Missense_Mutation	SNP	G	G	T	rs200487146	byFrequency	TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:49725141G>T	ENST00000257909.3	+	14	2319	c.2243G>T	c.(2242-2244)cGg>cTg	p.R748L	TROAP_ENST00000551245.1_Missense_Mutation_p.R838L|TROAP_ENST00000547923.1_Missense_Mutation_p.R427L	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	748					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						GGCCCCACCCGGGTCTGCACC	0.602											OREG0021792	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R748L		.											.	TROAP	91	0			c.G2243T						.						52.0	50.0	51.0					12																	49725141		2203	4300	6503	SO:0001583	missense	10024	exon14			CCACCCGGGTCTG	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.2243G>T	12.37:g.49725141G>T	ENSP00000257909:p.Arg748Leu	Somatic	97.0	0.0	964	WXS	Illumina HiSeq	Phase_I	123.0	5.0	NM_005480	F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	ENST00000257909.3	37	CCDS8784.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612630	0.87258	.	.	ENSG00000135451	ENST00000551245;ENST00000257909;ENST00000547923	.	.	.	5.93	5.93	0.95920	.	0.000000	0.53938	D	0.000058	T	0.70806	0.3266	L	0.47190	1.495	0.34673	D	0.72388	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.78033	-0.2362	9	0.87932	D	0	-20.8276	15.8438	0.78871	0.0:0.0:1.0:0.0	.	838;427;748	F8W130;F8W1U0;Q12815	.;.;TROAP_HUMAN	L	838;748;427	.	ENSP00000257909:R748L	R	+	2	0	TROAP	48011408	0.985000	0.35326	0.892000	0.35008	0.967000	0.64934	3.669000	0.54561	2.815000	0.96918	0.561000	0.74099	CGG	G|0.999;A|0.001		0.602	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480	
TRPM3	80036	hgsc.bcm.edu;bcgsc.ca	37	9	73235023	73235023	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr9:73235023C>A	ENST00000377111.2	-	15	2305	c.2062G>T	c.(2062-2064)Gac>Tac	p.D688Y	TRPM3_ENST00000357533.2_Missense_Mutation_p.D692Y|TRPM3_ENST00000396285.1_Missense_Mutation_p.D535Y|TRPM3_ENST00000408909.2_Missense_Mutation_p.D547Y|TRPM3_ENST00000396280.5_Missense_Mutation_p.D537Y|TRPM3_ENST00000358082.3_Missense_Mutation_p.D550Y|TRPM3_ENST00000377106.1_Missense_Mutation_p.D560Y|TRPM3_ENST00000377110.3_Missense_Mutation_p.D688Y|TRPM3_ENST00000396292.4_Missense_Mutation_p.D560Y|TRPM3_ENST00000377105.1_Missense_Mutation_p.D547Y|TRPM3_ENST00000423814.3_Missense_Mutation_p.D715Y|TRPM3_ENST00000360823.2_Missense_Mutation_p.D550Y	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	713					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.D560N(1)|p.D692N(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TGGGAAATGTCGTCAACCATG	0.602																																					p.D688Y		.											.	TRPM3	521	2	Substitution - Missense(2)	lung(2)	c.G2062T						.						73.0	69.0	71.0					9																	73235023		2203	4300	6503	SO:0001583	missense	80036	exon15			AAATGTCGTCAAC	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2062G>T	9.37:g.73235023C>A	ENSP00000366315:p.Asp688Tyr	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.620384|4.620384	0.87460|0.87460	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814|ENST00000396280	T;T;T;T;T;T;T;T;T;T;T|.	0.63580|.	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82637|0.82637	0.5080|0.5080	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D|.	0.89917|.	1.0;0.998;1.0;0.995;1.0;1.0;0.999;0.999|.	D;D;D;D;D;D;D;D|.	0.97110|.	0.992;0.97;1.0;0.981;0.987;0.997;0.986;0.971|.	T|T	0.81455|0.81455	-0.0925|-0.0925	10|5	0.87932|.	D|.	0|.	-30.4518|-30.4518	20.6439|20.6439	0.99570|0.99570	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	688;688;678;692;550;547;660;535|.	Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3|.	.;.;.;.;.;.;.;.|.	Y|L	688;688;560;550;547;692;547;535;560;550;715|536	ENSP00000366315:D688Y;ENSP00000366314:D688Y;ENSP00000366310:D560Y;ENSP00000354066:D550Y;ENSP00000366309:D547Y;ENSP00000350140:D692Y;ENSP00000386127:D547Y;ENSP00000379581:D535Y;ENSP00000379587:D560Y;ENSP00000350791:D550Y;ENSP00000389542:D715Y|.	ENSP00000350140:D692Y|.	D|R	-|-	1|2	0|0	TRPM3|TRPM3	72424843|72424843	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.800000|0.800000	0.45204|0.45204	7.818000|7.818000	0.86416|0.86416	2.890000|2.890000	0.99128|0.99128	0.650000|0.650000	0.86243|0.86243	GAC|CGA	.		0.602	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
TRRAP	8295	hgsc.bcm.edu;bcgsc.ca	37	7	98545947	98545947	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:98545947G>T	ENST00000359863.4	+	33	4840	c.4631G>T	c.(4630-4632)cGg>cTg	p.R1544L	TRRAP_ENST00000446306.3_Missense_Mutation_p.R1525L|TRRAP_ENST00000355540.3_Missense_Mutation_p.R1526L	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1544					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AAAACGGAGCGGGCGATGCTG	0.498																																					p.R1544L		.											.	TRRAP	923	0			c.G4631T						.						85.0	77.0	80.0					7																	98545947		2203	4300	6503	SO:0001583	missense	8295	exon33			CGGAGCGGGCGAT	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.4631G>T	7.37:g.98545947G>T	ENSP00000352925:p.Arg1544Leu	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	4.0	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.108936|4.108936	0.77096|0.77096	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.66995	.|-0.24;-0.24	5.74|5.74	5.74|5.74	0.90152|0.90152	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.65123|0.65123	0.2661|0.2661	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.48911	.|0.917;0.65;0.79	.|P;B;B	.|0.45406	.|0.479;0.147;0.306	T|T	0.65557|0.65557	-0.6139|-0.6139	5|10	.|0.48119	.|T	.|0.1	.|.	20.2825|20.2825	0.98528|0.98528	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1526;1265;1544	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	W|L	1266|1544;1526;1524	.|ENSP00000352925:R1544L;ENSP00000347733:R1526L	.|ENSP00000347733:R1526L	G|R	+|+	1|2	0|0	TRRAP|TRRAP	98383883|98383883	1.000000|1.000000	0.71417|0.71417	0.727000|0.727000	0.30756|0.30756	0.205000|0.205000	0.24178|0.24178	9.420000|9.420000	0.97426|0.97426	2.873000|2.873000	0.98535|0.98535	0.561000|0.561000	0.74099|0.74099	GGG|CGG	.		0.498	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
TSPEAR	54084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45953608	45953608	+	Missense_Mutation	SNP	C	C	T	rs370848096	byFrequency	TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr21:45953608C>T	ENST00000323084.4	-	3	567	c.502G>A	c.(502-504)Gtc>Atc	p.V168I	TSPEAR_ENST00000397916.1_Missense_Mutation_p.V100I	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	168	Laminin G-like.				sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						AGGGAGAAGACGCCTGCGGAC	0.697													C|||	2	0.000399361	0.0	0.0	5008	,	,		12838	0.0		0.0	False		,,,				2504	0.002				p.V168I		.											.	TSPEAR	244	0			c.G502A						.						25.0	25.0	25.0					21																	45953608		2192	4291	6483	SO:0001583	missense	54084	exon3			AGAAGACGCCTGC	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.502G>A	21.37:g.45953608C>T	ENSP00000321987:p.Val168Ile	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	74.0	NM_144991		Missense_Mutation	SNP	ENST00000323084.4	37	CCDS13712.1	.	.	.	.	.	.	.	.	.	.	c	1.389	-0.581309	0.03854	.	.	ENSG00000175894	ENST00000323084;ENST00000397916;ENST00000341581	T;T	0.43688	0.94;0.94	4.99	-0.667	0.11395	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);	0.779066	0.12485	N	0.464779	T	0.15912	0.0383	N	0.03608	-0.345	0.09310	N	1	B	0.18741	0.03	B	0.09377	0.004	T	0.26155	-1.0111	10	0.16896	T	0.51	3.2862	6.7678	0.23576	0.4228:0.2357:0.0:0.3415	.	168	Q8WU66	TSEAR_HUMAN	I	168;100;168	ENSP00000321987:V168I;ENSP00000381012:V100I	ENSP00000321987:V168I	V	-	1	0	TSPEAR	44778036	0.995000	0.38212	0.012000	0.15200	0.000000	0.00434	3.040000	0.49799	-0.754000	0.04715	-2.269000	0.00276	GTC	.		0.697	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098761.1	NM_144991	
TTC39A	22996	hgsc.bcm.edu;bcgsc.ca	37	1	51767296	51767296	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:51767296T>C	ENST00000447632.2	-	12	1157	c.1109A>G	c.(1108-1110)aAg>aGg	p.K370R	TTC39A_ENST00000262676.5_3'UTR|TTC39A_ENST00000262675.7_Missense_Mutation_p.K307R|TTC39A_ENST00000371747.3_Missense_Mutation_p.K369R|TTC39A_ENST00000413473.2_Missense_Mutation_p.K338R|TTC39A_ENST00000371750.5_Missense_Mutation_p.K335R|TTC39A_ENST00000451380.1_Missense_Mutation_p.K334R			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A	370								p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						GTAGGACATCTTCCACTGGCC	0.582																																					p.K338R		.											.	TTC39A	23	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)	c.A1013G						.						73.0	75.0	74.0					1																	51767296		2123	4237	6360	SO:0001583	missense	22996	exon12			GACATCTTCCACT	AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.1109A>G	1.37:g.51767296T>C	ENSP00000393952:p.Lys370Arg	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	4.0	NM_001144832	B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	ENST00000447632.2	37		.	.	.	.	.	.	.	.	.	.	T	16.02	3.005308	0.54254	.	.	ENSG00000085831	ENST00000447632;ENST00000413473;ENST00000262675;ENST00000451380;ENST00000371750;ENST00000371747	T;T;T;T;T;T	0.64260	0.88;0.88;0.88;0.88;0.88;-0.09	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.55465	0.1922	L	0.49571	1.57	0.49687	D	0.999812	B;B;B;B;B;B	0.17667	0.002;0.002;0.005;0.023;0.006;0.019	B;B;B;B;B;B	0.21546	0.012;0.021;0.013;0.035;0.034;0.021	T	0.51371	-0.8714	10	0.19147	T	0.46	-13.2017	13.8104	0.63260	0.0:0.0:0.0:1.0	.	338;334;307;334;370;335	Q5SRH9-4;E7EQY9;D3DQ30;B7Z782;Q5SRH9;G3XAF8	.;.;.;.;TT39A_HUMAN;.	R	370;338;307;334;335;369	ENSP00000393952:K370R;ENSP00000406144:K338R;ENSP00000262675:K307R;ENSP00000397207:K334R;ENSP00000360815:K335R;ENSP00000360812:K369R	ENSP00000262675:K307R	K	-	2	0	TTC39A	51539884	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.964000	0.70379	1.925000	0.55765	0.379000	0.24179	AAG	.		0.582	TTC39A-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000022434.2		
TWSG1	57045	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	18	9337333	9337333	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr18:9337333A>G	ENST00000262120.5	+	2	297	c.106A>G	c.(106-108)Agc>Ggc	p.S36G	TWSG1_ENST00000581641.1_Missense_Mutation_p.S36G|RP11-888D10.3_ENST00000584509.1_lincRNA	NM_020648.5	NP_065699.1	Q9GZX9	TWSG1_HUMAN	twisted gastrulation BMP signaling modulator 1	36	Cys-rich.				BMP signaling pathway (GO:0030509)|camera-type eye development (GO:0043010)|cell differentiation (GO:0030154)|forebrain development (GO:0030900)|hemopoiesis (GO:0030097)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of osteoblast differentiation (GO:0045668)|ossification (GO:0001503)|positive regulation of BMP signaling pathway (GO:0030513)|salivary gland morphogenesis (GO:0007435)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|pancreas(2)	10						TAGTGATGTGAGCAAATGCCT	0.373																																					p.S36G		.											.	TWSG1	92	0			c.A106G						.						141.0	124.0	129.0					18																	9337333		2203	4300	6503	SO:0001583	missense	57045	exon2			GATGTGAGCAAAT	AA486291	CCDS11844.1	18p11.3	2013-10-03	2013-10-03		ENSG00000128791	ENSG00000128791			12429	protein-coding gene	gene with protein product		605049	"""twisted gastrulation homolog 1 (Drosophila)"""			11260715	Standard	NM_020648		Approved	TSG	uc002knz.3	Q9GZX9	OTTHUMG00000131597	ENST00000262120.5:c.106A>G	18.37:g.9337333A>G	ENSP00000262120:p.Ser36Gly	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	4.0	NM_020648	B2RE08|D3DUH9|Q8NBI7|Q96K46	Missense_Mutation	SNP	ENST00000262120.5	37	CCDS11844.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.146938	0.77888	.	.	ENSG00000128791	ENST00000262120	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.67373	0.2886	M	0.74467	2.265	0.53688	D	0.99997	D	0.57899	0.981	P	0.51806	0.68	T	0.72600	-0.4244	9	0.87932	D	0	-27.5754	12.6797	0.56914	1.0:0.0:0.0:0.0	.	36	Q9GZX9	TWSG1_HUMAN	G	36	.	ENSP00000262120:S36G	S	+	1	0	TWSG1	9327333	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.345000	0.72995	2.242000	0.73789	0.533000	0.62120	AGC	.		0.373	TWSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254480.2		
TTC39C	125488	hgsc.bcm.edu;bcgsc.ca	37	18	21660556	21660556	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr18:21660556C>T	ENST00000317571.3	+	5	704	c.468C>T	c.(466-468)atC>atT	p.I156I	TTC39C_ENST00000578150.1_3'UTR|TTC39C_ENST00000304621.6_Silent_p.I95I|RP11-403A21.3_ENST00000578443.1_RNA	NM_001135993.1	NP_001129465.1	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C	156										breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	19						TAGCTTATATCAAAGGTGGGT	0.348																																					p.I156I		.											.	TTC39C	91	0			c.C468T						.						48.0	48.0	48.0					18																	21660556		2203	4300	6503	SO:0001819	synonymous_variant	125488	exon5			TTATATCAAAGGT	AK091080	CCDS32804.1, CCDS45839.1, CCDS58616.1	18q11.2	2014-02-07	2008-06-23	2008-06-23	ENSG00000168234	ENSG00000168234		"""Tetratricopeptide (TTC) repeat domain containing"""	26595	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 17"""	C18orf17		14702039	Standard	NM_153211		Approved	FLJ33761, HsT2697	uc002kuw.3	Q8N584	OTTHUMG00000179403	ENST00000317571.3:c.468C>T	18.37:g.21660556C>T		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_001135993	B7WP63|J3QRR1|Q0VAJ2|Q8N284	Silent	SNP	ENST00000317571.3	37	CCDS45839.1																																																																																			.		0.348	TTC39C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446107.1	NM_153211	
TYK2	7297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10476357	10476357	+	Silent	SNP	G	G	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:10476357G>A	ENST00000525621.1	-	7	1328	c.847C>T	c.(847-849)Ctg>Ttg	p.L283L	TYK2_ENST00000524462.1_Silent_p.L98L|TYK2_ENST00000529370.1_Silent_p.L283L|TYK2_ENST00000264818.6_Silent_p.L283L	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	283	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GCCTGGGCCAGCAGCCTCAGG	0.672																																					p.L283L		.											.	TYK2	1009	0			c.C847T						.						19.0	22.0	21.0					19																	10476357		2201	4296	6497	SO:0001819	synonymous_variant	7297	exon7			GGGCCAGCAGCCT		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.847C>T	19.37:g.10476357G>A		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	45.0	NM_003331	Q6QB10|Q96CH0	Silent	SNP	ENST00000525621.1	37	CCDS12236.1																																																																																			.		0.672	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1		
UBA6	55236	hgsc.bcm.edu;bcgsc.ca	37	4	68534270	68534270	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr4:68534270C>A	ENST00000322244.5	-	9	851	c.792G>T	c.(790-792)acG>acT	p.T264T	UBA6_ENST00000420827.2_Splice_Site_p.T264T	NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	264					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TTGACTTACCCGTTATTTGTT	0.338																																					p.T264T		.											.	UBA6	90	0			c.G792T						.						114.0	111.0	112.0					4																	68534270		2202	4300	6502	SO:0001630	splice_region_variant	55236	exon9			CTTACCCGTTATT	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.793+1G>T	4.37:g.68534270C>A		Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	5.0	NM_018227	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Silent	SNP	ENST00000322244.5	37	CCDS3516.1																																																																																			.		0.338	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227	Silent
UBP1	7342	hgsc.bcm.edu;bcgsc.ca	37	3	33444345	33444345	+	Missense_Mutation	SNP	G	G	T	rs373493970		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:33444345G>T	ENST00000283629.3	-	9	1508	c.979C>A	c.(979-981)Cca>Aca	p.P327T	UBP1_ENST00000447368.2_Missense_Mutation_p.P291T|UBP1_ENST00000486388.1_5'UTR|UBP1_ENST00000283628.5_Missense_Mutation_p.P327T	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	327					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						GTGGGCGCTGGGGAAGGGCTG	0.483																																					p.P327T		.											.	UBP1	537	0			c.C979A						.	G	THR/PRO,THR/PRO,THR/PRO	0,4406		0,0,2203	84.0	68.0	73.0		871,979,979	-0.7	1.0	3		73	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	UBP1	NM_001128160.1,NM_001128161.1,NM_014517.4	38,38,38	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign,benign,benign	291/505,327/541,327/541	33444345	1,13005	2203	4300	6503	SO:0001583	missense	7342	exon9			GCGCTGGGGAAGG	AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.979C>A	3.37:g.33444345G>T	ENSP00000283629:p.Pro327Thr	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	7.0	NM_014517	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386906	0.42308	0.0	1.16E-4	ENSG00000153560	ENST00000283629;ENST00000447368;ENST00000283628	T;T;T	0.21543	2.0;2.17;2.0	6.17	-0.703	0.11261	.	0.377335	0.33327	N	0.005031	T	0.12220	0.0297	L	0.40543	1.245	0.37362	D	0.911274	B;B	0.14805	0.001;0.011	B;B	0.23852	0.002;0.049	T	0.27331	-1.0077	10	0.08599	T	0.76	0.0141	5.6838	0.17790	0.0738:0.3079:0.4747:0.1436	.	291;327	Q9NZI7-4;Q9NZI7	.;UBIP1_HUMAN	T	327;291;327	ENSP00000283629:P327T;ENSP00000395558:P291T;ENSP00000283628:P327T	ENSP00000283628:P327T	P	-	1	0	UBP1	33419349	0.998000	0.40836	0.986000	0.45419	0.961000	0.63080	0.409000	0.21082	-0.124000	0.11724	0.655000	0.94253	CCA	.		0.483	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517	
ULK4	54986	hgsc.bcm.edu;bcgsc.ca	37	3	41860960	41860960	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:41860960A>G	ENST00000301831.4	-	19	2265	c.1803T>C	c.(1801-1803)gtT>gtC	p.V601V		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	601					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CAGCCAAGGGAACAGCCCAGC	0.443																																					p.V601V		.											.	ULK4	297	0			c.T1803C						.						109.0	109.0	109.0					3																	41860960		1893	4115	6008	SO:0001819	synonymous_variant	54986	exon19			CAAGGGAACAGCC	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.1803T>C	3.37:g.41860960A>G		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_017886	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Silent	SNP	ENST00000301831.4	37	CCDS43071.1																																																																																			.		0.443	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
UPF1	5976	hgsc.bcm.edu;bcgsc.ca	37	19	18963017	18963017	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:18963017G>T	ENST00000599848.1	+	6	1093	c.884G>T	c.(883-885)cGg>cTg	p.R295L	UPF1_ENST00000600310.1_3'UTR|UPF1_ENST00000262803.5_Missense_Mutation_p.R295L			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	295	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GTCCTCCTGCGGTACGAGGAC	0.607																																					p.R295L		.											.	UPF1	91	0			c.G884T						.						88.0	77.0	81.0					19																	18963017		2203	4300	6503	SO:0001583	missense	5976	exon6			TCCTGCGGTACGA	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.884G>T	19.37:g.18963017G>T	ENSP00000470142:p.Arg295Leu	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	5.0	NM_002911	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		.	.	.	.	.	.	.	.	.	.	G	23.6	4.432643	0.83776	.	.	ENSG00000005007	ENST00000262803	D	0.90324	-2.65	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.93400	0.7895	M	0.90425	3.115	0.80722	D	1	P;P	0.42871	0.689;0.792	B;B	0.43413	0.24;0.419	D	0.94873	0.8032	10	0.87932	D	0	-37.4037	17.4668	0.87634	0.0:0.0:1.0:0.0	.	295;295	Q92900;Q92900-2	RENT1_HUMAN;.	L	295	ENSP00000262803:R295L	ENSP00000262803:R295L	R	+	2	0	UPF1	18824017	1.000000	0.71417	0.822000	0.32727	0.390000	0.30446	9.429000	0.97481	2.362000	0.80069	0.561000	0.74099	CGG	.		0.607	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
USP36	57602	hgsc.bcm.edu;bcgsc.ca	37	17	76810529	76810529	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr17:76810529T>C	ENST00000542802.3	-	11	1572	c.1129A>G	c.(1129-1131)Agc>Ggc	p.S377G	USP36_ENST00000312010.6_Missense_Mutation_p.S377G|USP36_ENST00000449938.2_Missense_Mutation_p.S77G|USP36_ENST00000588467.1_5'UTR			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	377	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GCATGGCAGCTGTAGCCCGAG	0.527																																					p.S377G		.											.	USP36	659	0			c.A1129G						.						92.0	68.0	76.0					17																	76810529		2203	4300	6503	SO:0001583	missense	57602	exon11			GGCAGCTGTAGCC	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.1129A>G	17.37:g.76810529T>C	ENSP00000441214:p.Ser377Gly	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	4.0	NM_025090	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	ENST00000542802.3	37	CCDS32755.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411169	0.83340	.	.	ENSG00000055483	ENST00000312010;ENST00000449938;ENST00000542802;ENST00000432878	T;T;T	0.06687	3.27;3.27;3.27	5.16	5.16	0.70880	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.077885	0.85682	D	0.000000	T	0.24509	0.0594	L	0.53561	1.675	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.978	T	0.00565	-1.1668	10	0.87932	D	0	-32.9359	14.672	0.68951	0.0:0.0:0.0:1.0	.	377;377	Q9P275;Q9P275-2	UBP36_HUMAN;.	G	377;77;377;377	ENSP00000310590:S377G;ENSP00000401119:S77G;ENSP00000441214:S377G	ENSP00000310590:S377G	S	-	1	0	USP36	74322124	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.123000	0.57917	1.936000	0.56123	0.533000	0.62120	AGC	.		0.527	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090	
USP48	84196	hgsc.bcm.edu;bcgsc.ca	37	1	22084236	22084236	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:22084236C>A	ENST00000308271.9	-	2	823	c.175G>T	c.(175-177)Ggt>Tgt	p.G59C	USP48_ENST00000400301.1_Missense_Mutation_p.G59C|USP48_ENST00000529637.1_Missense_Mutation_p.G59C|USP48_ENST00000421625.2_Missense_Mutation_p.G59C	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	59					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ATATGCTCACCAATACCAACC	0.333																																					p.G59C		.											.	USP48	659	0			c.G175T						.						108.0	100.0	103.0					1																	22084236		2203	4300	6503	SO:0001583	missense	84196	exon2			GCTCACCAATACC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.175G>T	1.37:g.22084236C>A	ENSP00000309262:p.Gly59Cys	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	5.0	NM_001032730	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.906411	0.92107	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000529637;ENST00000421625	T;T;T;T	0.09538	3.0;2.97;2.97;3.24	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.36413	0.0966	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;1.0	T	0.04427	-1.0952	10	0.87932	D	0	.	18.8507	0.92227	0.0:1.0:0.0:0.0	.	59;59;59;59;59;59	B7ZKS7;B7ZKS3;Q86UV5-7;Q86UV5-3;Q86UV5-2;Q86UV5	.;.;.;.;.;UBP48_HUMAN	C	59	ENSP00000383157:G59C;ENSP00000309262:G59C;ENSP00000431949:G59C;ENSP00000406256:G59C	ENSP00000309262:G59C	G	-	1	0	USP48	21956823	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.343000	0.79319	2.689000	0.91719	0.655000	0.94253	GGT	.		0.333	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
VCAN	1462	hgsc.bcm.edu;bcgsc.ca	37	5	82849183	82849183	+	Splice_Site	SNP	A	A	G	rs13184139		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:82849183A>G	ENST00000265077.3	+	11	10059	c.9494A>G	c.(9493-9495)gAt>gGt	p.D3165G	VCAN_ENST00000512590.2_Splice_Site_p.D1363G|VCAN-AS1_ENST00000513899.1_RNA|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000502527.2_Splice_Site_p.D424G|VCAN_ENST00000342785.4_Splice_Site_p.D1411G|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000343200.5_Splice_Site_p.D2178G	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3165					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TTCTTCTCAGATACCGAGACA	0.493																																					p.D3165G		.											.	VCAN	238	0			c.A9494G						.						105.0	93.0	97.0					5																	82849183		2203	4300	6503	SO:0001630	splice_region_variant	1462	exon11			TCTCAGATACCGA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9494-1A>G	5.37:g.82849183A>G		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.018909	0.75275	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000502527	T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31	6.06	6.06	0.98353	C-type lectin-like (1);	0.000000	0.64402	D	0.000007	T	0.38241	0.1033	L	0.49256	1.55	0.58432	D	0.999998	D;D;B;D	0.89917	1.0;1.0;0.318;1.0	D;D;P;D	0.91635	0.999;0.998;0.64;0.999	T	0.05451	-1.0884	10	0.62326	D	0.03	.	16.6093	0.84858	1.0:0.0:0.0:0.0	.	1411;424;2178;3165	P13611-3;P13611-4;P13611-2;P13611	.;.;.;CSPG2_HUMAN	G	3165;2178;1411;1363;424	ENSP00000265077:D3165G;ENSP00000340062:D2178G;ENSP00000342768:D1411G;ENSP00000425959:D1363G;ENSP00000421362:D424G	ENSP00000265077:D3165G	D	+	2	0	VCAN	82884939	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	9.339000	0.96797	2.324000	0.78689	0.533000	0.62120	GAT	A|1.000;|0.000		0.493	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	Missense_Mutation
VPRBP	9730	hgsc.bcm.edu;bcgsc.ca	37	3	51456168	51456168	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr3:51456168A>G	ENST00000335891.5	-	8	2061	c.2052T>C	c.(2050-2052)tgT>tgC	p.C684C				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1133					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		CTGAGTTGTGACAGTTATAGC	0.493																																					p.C1080C		.											.	VPRBP	92	0			c.T3240C						.						137.0	139.0	138.0					3																	51456168		2034	4196	6230	SO:0001819	synonymous_variant	9730	exon15			GTTGTGACAGTTA	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2052T>C	3.37:g.51456168A>G		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	4.0	NM_014703	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Silent	SNP	ENST00000335891.5	37																																																																																				.		0.493	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
VPS13B	157680	hgsc.bcm.edu;bcgsc.ca	37	8	100654256	100654256	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr8:100654256A>G	ENST00000358544.2	+	34	5624	c.5513A>G	c.(5512-5514)gAc>gGc	p.D1838G	VPS13B_ENST00000357162.2_Missense_Mutation_p.D1813G|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1838					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATTCCCTTTGACATATTTATT	0.383																																					p.D1838G	Colon(161;2205 2542 7338 31318)	.											.	VPS13B	301	0			c.A5513G						.						74.0	75.0	74.0					8																	100654256		2203	4300	6503	SO:0001583	missense	157680	exon34			CCTTTGACATATT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.5513A>G	8.37:g.100654256A>G	ENSP00000351346:p.Asp1838Gly	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.737823	0.89573	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.74106	-0.81;-0.79	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.80904	0.4713	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.82991	-0.0182	10	0.87932	D	0	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	1813;1838	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	G	1813;1838	ENSP00000349685:D1813G;ENSP00000351346:D1838G	ENSP00000349685:D1813G	D	+	2	0	VPS13B	100723432	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.019000	0.93662	2.281000	0.76405	0.533000	0.62120	GAC	.		0.383	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
WEE2	494551	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	141414139	141414139	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:141414139T>C	ENST00000397541.2	+	2	879	c.473T>C	c.(472-474)tTc>tCc	p.F158S	WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000488785.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	158					female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					ATTAATCCCTTCACTCCAGAG	0.423																																					p.F158S		.											.	WEE2	305	0			c.T473C						.						80.0	75.0	76.0					7																	141414139		1839	4097	5936	SO:0001583	missense	494551	exon2			ATCCCTTCACTCC	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.473T>C	7.37:g.141414139T>C	ENSP00000380675:p.Phe158Ser	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	4.0	NM_001105558		Missense_Mutation	SNP	ENST00000397541.2	37	CCDS43660.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.179199	0.78564	.	.	ENSG00000214102	ENST00000397541	T	0.48201	0.82	5.03	3.87	0.44632	.	0.000000	0.64402	U	0.000001	T	0.67468	0.2896	M	0.82323	2.585	0.58432	D	0.999992	D	0.76494	0.999	D	0.69307	0.963	T	0.71059	-0.4702	10	0.87932	D	0	.	10.802	0.46493	0.0:0.0747:0.0:0.9252	.	158	P0C1S8	WEE2_HUMAN	S	158	ENSP00000380675:F158S	ENSP00000380675:F158S	F	+	2	0	WEE2	141060608	1.000000	0.71417	0.989000	0.46669	0.979000	0.70002	6.539000	0.73856	0.932000	0.37266	0.477000	0.44152	TTC	.		0.423	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349091.1	NM_001105558	
WLS	79971	hgsc.bcm.edu;bcgsc.ca	37	1	68610266	68610266	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr1:68610266A>G	ENST00000262348.4	-	10	1601	c.1348T>C	c.(1348-1350)Ttc>Ctc	p.F450L	GNG12-AS1_ENST00000413628.1_RNA|WLS_ENST00000370976.3_Missense_Mutation_p.F359L|WLS_ENST00000491811.1_5'UTR|WLS_ENST00000540432.1_Missense_Mutation_p.F450L|GNG12-AS1_ENST00000420587.1_RNA|GNG12-AS1_ENST00000434072.1_RNA|WLS_ENST00000354777.2_Missense_Mutation_p.F448L	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	450					anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						CTAACGATGAAGAAGATGACA	0.443																																					p.F450L		.											.	WLS	90	0			c.T1348C						.						125.0	129.0	128.0					1																	68610266		2203	4300	6503	SO:0001583	missense	79971	exon10			CGATGAAGAAGAT	BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.1348T>C	1.37:g.68610266A>G	ENSP00000262348:p.Phe450Leu	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_024911	B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Missense_Mutation	SNP	ENST00000262348.4	37	CCDS642.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.884942	0.91814	.	.	ENSG00000116729	ENST00000540432;ENST00000354777;ENST00000262348;ENST00000370976	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.49779	0.1577	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.993;0.996;0.998;0.993	T	0.46428	-0.9192	10	0.32370	T	0.25	-24.4284	15.7591	0.78063	1.0:0.0:0.0:0.0	.	450;359;450;448	F5H4K0;Q5JRS7;Q5T9L3;Q5T9L3-2	.;.;WLS_HUMAN;.	L	450;448;450;359	ENSP00000446112:F450L;ENSP00000346829:F448L;ENSP00000262348:F450L;ENSP00000360015:F359L	ENSP00000262348:F450L	F	-	1	0	WLS	68382854	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.915000	0.92740	2.123000	0.65237	0.528000	0.53228	TTC	.		0.443	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025368.1	NM_024911	
XAB2	56949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7691045	7691045	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:7691045T>C	ENST00000358368.4	-	5	671	c.634A>G	c.(634-636)Aag>Gag	p.K212E	XAB2_ENST00000534844.1_Missense_Mutation_p.K209E	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	212					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						TTGCCGGCCTTAGACACGAAA	0.642								Direct reversal of damage;Nucleotide excision repair (NER)																													p.K212E		.											.	XAB2	272	0			c.A634G						.						71.0	77.0	75.0					19																	7691045		2203	4299	6502	SO:0001583	missense	56949	exon5			CGGCCTTAGACAC	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.634A>G	19.37:g.7691045T>C	ENSP00000351137:p.Lys212Glu	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	41.0	NM_020196	Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	ENST00000358368.4	37	CCDS32892.1	.	.	.	.	.	.	.	.	.	.	T	8.852	0.944764	0.18356	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.62941	-0.01;-0.01	4.96	3.95	0.45737	.	0.000000	0.85682	D	0.000000	T	0.54565	0.1866	M	0.63169	1.94	0.49299	D	0.999776	B	0.20780	0.048	B	0.13407	0.009	T	0.47736	-0.9094	10	0.28530	T	0.3	-47.5253	8.3945	0.32548	0.0:0.0911:0.0:0.9089	.	212	Q9HCS7	SYF1_HUMAN	E	212;209	ENSP00000351137:K212E;ENSP00000438225:K209E	ENSP00000351137:K212E	K	-	1	0	XAB2	7597045	1.000000	0.71417	0.993000	0.49108	0.025000	0.11179	7.454000	0.80714	0.756000	0.33013	-0.388000	0.06559	AAG	.		0.642	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1	NM_020196	
XPO5	57510	hgsc.bcm.edu;bcgsc.ca	37	6	43515423	43515423	+	Silent	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:43515423A>G	ENST00000265351.7	-	19	2292	c.2082T>C	c.(2080-2082)gcT>gcC	p.A694A		NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	694					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			ACGCAATGAAAGCATCAACAT	0.478																																					p.A694A		.											.	XPO5	271	0			c.T2082C						.						100.0	96.0	97.0					6																	43515423		1969	4163	6132	SO:0001819	synonymous_variant	57510	exon19			AATGAAAGCATCA	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.2082T>C	6.37:g.43515423A>G		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	5.0	NM_020750	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Silent	SNP	ENST00000265351.7	37	CCDS47430.1																																																																																			.		0.478	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750	
YPEL4	219539	hgsc.bcm.edu;bcgsc.ca	37	11	57413467	57413467	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:57413467T>C	ENST00000524669.1	-	5	3093	c.371A>G	c.(370-372)aAc>aGc	p.N124S	YPEL4_ENST00000534711.1_Missense_Mutation_p.N124S|YPEL4_ENST00000531442.1_5'Flank|YPEL4_ENST00000300022.3_Missense_Mutation_p.N124S|YPEL4_ENST00000544993.1_Missense_Mutation_p.N124S|AP000662.4_ENST00000530595.1_RNA			Q96NS1	YPEL4_HUMAN	yippee-like 4 (Drosophila)	124						nucleus (GO:0005634)				lung(2)|skin(1)	3						GTCCCAGCCGTTGTCCTTCAC	0.552																																					p.N124S		.											.	YPEL4	90	0			c.A371G						.						173.0	130.0	145.0					11																	57413467		2201	4296	6497	SO:0001583	missense	219539	exon5			CAGCCGTTGTCCT	AK054775	CCDS7963.1	11q12	2008-02-05				ENSG00000166793			18328	protein-coding gene	gene with protein product		609725					Standard	NM_145008		Approved	FLJ30213	uc001nkv.4	Q96NS1		ENST00000524669.1:c.371A>G	11.37:g.57413467T>C	ENSP00000432648:p.Asn124Ser	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_145008	B3KW92|Q2M3U7|Q65Z98	Missense_Mutation	SNP	ENST00000524669.1	37	CCDS7963.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.309891	0.81247	.	.	ENSG00000166793	ENST00000524669;ENST00000300022;ENST00000544993;ENST00000534711	.	.	.	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000001	T	0.51415	0.1673	L	0.45285	1.41	0.80722	D	1	P	0.37612	0.602	B	0.38803	0.282	T	0.48127	-0.9062	9	0.24483	T	0.36	-7.3639	15.1263	0.72486	0.0:0.0:0.0:1.0	.	124	Q96NS1	YPEL4_HUMAN	S	124	.	ENSP00000300022:N124S	N	-	2	0	YPEL4	57170043	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.775000	0.85489	2.057000	0.61298	0.459000	0.35465	AAC	.		0.552	YPEL4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393370.1	NM_145008	
ZC3H12C	85463	hgsc.bcm.edu;bcgsc.ca	37	11	110035709	110035709	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr11:110035709C>T	ENST00000278590.3	+	6	1950	c.1899C>T	c.(1897-1899)agC>agT	p.S633S	ZC3H12C_ENST00000453089.2_Silent_p.S602S|ZC3H12C_ENST00000528673.1_Silent_p.S634S	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	633							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		GGAGCATGAGCTGTGGGAGCA	0.522																																					p.S633S		.											.	ZC3H12C	68	0			c.C1899T						.						57.0	60.0	59.0					11																	110035709		2053	4209	6262	SO:0001819	synonymous_variant	85463	exon6			CATGAGCTGTGGG		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1899C>T	11.37:g.110035709C>T		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	4.0	NM_033390	B4DI65|B4DR47	Silent	SNP	ENST00000278590.3	37	CCDS44727.1																																																																																			.		0.522	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390	
ZC3HAV1L	92092	hgsc.bcm.edu;bcgsc.ca	37	7	138719329	138719329	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:138719329C>A	ENST00000275766.1	-	2	472	c.461G>T	c.(460-462)cGg>cTg	p.R154L		NM_080660.3	NP_542391.2	Q96H79	ZCCHL_HUMAN	zinc finger CCCH-type, antiviral 1-like	154										NS(2)|endometrium(2)|large_intestine(1)|lung(4)|skin(1)	10						AAGCAGGATCCGAAGCTGGTT	0.453																																					p.R154L		.											.	ZC3HAV1L	90	0			c.G461T						.						112.0	109.0	110.0					7																	138719329		2203	4300	6503	SO:0001583	missense	92092	exon2			AGGATCCGAAGCT	BC008842	CCDS5850.1	7q34	2006-07-03	2006-07-03	2006-07-03	ENSG00000146858	ENSG00000146858			22423	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 39"""	C7orf39			Standard	NM_080660		Approved	MGC14289	uc003vum.1	Q96H79	OTTHUMG00000157229	ENST00000275766.1:c.461G>T	7.37:g.138719329C>A	ENSP00000275766:p.Arg154Leu	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_080660	Q8WUD9	Missense_Mutation	SNP	ENST00000275766.1	37	CCDS5850.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.862521	0.51482	.	.	ENSG00000146858	ENST00000275766	T	0.38560	1.13	5.86	1.96	0.26148	.	0.356873	0.20743	N	0.086485	T	0.30355	0.0762	L	0.52573	1.65	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.17137	-1.0379	10	0.33940	T	0.23	.	3.2547	0.06827	0.1435:0.56:0.1392:0.1573	.	154	Q96H79	ZCCHL_HUMAN	L	154	ENSP00000275766:R154L	ENSP00000275766:R154L	R	-	2	0	ZC3HAV1L	138369869	0.024000	0.19004	0.009000	0.14445	0.941000	0.58515	0.569000	0.23638	0.461000	0.27071	0.650000	0.86243	CGG	.		0.453	ZC3HAV1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348090.1	NM_080660	
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu	37	16	72992020	72992020	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:72992020C>T	ENST00000268489.5	-	2	2697	c.2025G>A	c.(2023-2025)aaG>aaA	p.K675K	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	675					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GCCAGTTGCACTTGGGGCACT	0.602																																					p.K675K		.											.	ZFHX3	72	0			c.G2025A						.						45.0	49.0	48.0					16																	72992020		2198	4300	6498	SO:0001819	synonymous_variant	463	exon2			GTTGCACTTGGGG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2025G>A	16.37:g.72992020C>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	4.0	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.602	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZMYM3	9203	hgsc.bcm.edu;bcgsc.ca	37	X	70465850	70465850	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chrX:70465850A>G	ENST00000353904.2	-	16	2858	c.2671T>C	c.(2671-2673)Tcg>Ccg	p.S891P	ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Missense_Mutation_p.S893P|ZMYM3_ENST00000314425.5_Missense_Mutation_p.S891P|ZMYM3_ENST00000373984.3_Missense_Mutation_p.S893P|ZMYM3_ENST00000373998.1_Missense_Mutation_p.S879P	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	891					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					ATAGGCATCGAGAAAGGCACC	0.572																																					p.S891P		.											.	ZMYM3	131	0			c.T2671C						.						122.0	99.0	107.0					X																	70465850		2203	4300	6503	SO:0001583	missense	9203	exon16			GCATCGAGAAAGG	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.2671T>C	X.37:g.70465850A>G	ENSP00000343909:p.Ser891Pro	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_005096	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	ENST00000353904.2	37	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	a	15.19	2.760658	0.49468	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988	T;T;T;T;T	0.41400	1.61;1.0;1.61;1.61;1.61	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000008	T	0.42449	0.1203	N	0.15975	0.35	0.41935	D	0.990581	D;D	0.67145	0.996;0.994	D;P	0.65010	0.931;0.854	T	0.27706	-1.0066	10	0.15952	T	0.53	-7.3014	14.089	0.64977	1.0:0.0:0.0:0.0	.	879;891	Q14202-2;Q14202	.;ZMYM3_HUMAN	P	891;879;891;893;893	ENSP00000322845:S891P;ENSP00000363110:S879P;ENSP00000343909:S891P;ENSP00000363096:S893P;ENSP00000363100:S893P	ENSP00000322845:S891P	S	-	1	0	ZMYM3	70382575	1.000000	0.71417	0.997000	0.53966	0.943000	0.58893	2.833000	0.48159	1.902000	0.55061	0.427000	0.28365	TCG	.		0.572	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599	
ZNF10	7556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	133727625	133727625	+	Silent	SNP	C	C	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr12:133727625C>G	ENST00000248211.6	+	3	267	c.45C>G	c.(43-45)acC>acG	p.T15T	ZNF10_ENST00000426665.2_Silent_p.T15T|ZNF268_ENST00000416488.1_Silent_p.T15T|ZNF10_ENST00000540927.1_Intron|CTD-2140B24.4_ENST00000540096.2_Silent_p.T15T|ZNF10_ENST00000402932.2_Silent_p.T15T	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	15	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CACTGGTGACCTTCAAGGATG	0.453																																					p.T15T		.											.	ZNF10	154	0			c.C45G						.						279.0	245.0	257.0					12																	133727625		2203	4300	6503	SO:0001819	synonymous_variant	7556	exon3			GGTGACCTTCAAG	X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.45C>G	12.37:g.133727625C>G		Somatic	206.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	84.0	NM_015394	B2RBS1|Q8TC91	Silent	SNP	ENST00000248211.6	37	CCDS9283.1																																																																																			.		0.453	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394	
ZNF20	7568	hgsc.bcm.edu;bcgsc.ca	37	19	12243683	12243683	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:12243683T>C	ENST00000334213.5	-	4	1542	c.1318A>G	c.(1318-1320)Ata>Gta	p.I440V	ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000485451.1_5'Flank|ZNF20_ENST00000600335.1_Intron	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	440					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						CTTTCATGTATATGCAAGGAA	0.418																																					p.I440V		.											.	ZNF20	22	0			c.A1318G						.						93.0	98.0	96.0					19																	12243683		2187	4295	6482	SO:0001583	missense	7568	exon4			CATGTATATGCAA	X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.1318A>G	19.37:g.12243683T>C	ENSP00000335437:p.Ile440Val	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	4.0	NM_021143	Q8N457|Q9UG41	Missense_Mutation	SNP	ENST00000334213.5	37	CCDS45986.1	.	.	.	.	.	.	.	.	.	.	T	4.502	0.093141	0.08632	.	.	ENSG00000132010	ENST00000334213;ENST00000292241	T	0.07327	3.2	0.94	-0.317	0.12736	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03136	0.0092	N	0.04320	-0.23	0.09310	N	1	B	0.18461	0.028	B	0.20767	0.031	T	0.47560	-0.9108	9	0.19147	T	0.46	.	4.1968	0.10447	0.3019:0.0:0.0:0.6981	.	440	P17024	ZNF20_HUMAN	V	440	ENSP00000335437:I440V	ENSP00000292241:I440V	I	-	1	0	ZNF20	12104683	0.000000	0.05858	0.001000	0.08648	0.918000	0.54935	-7.956000	0.00027	-0.189000	0.10482	0.260000	0.18958	ATA	.		0.418	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1	NM_021143	
ZNF223	7766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	44570978	44570978	+	Nonsense_Mutation	SNP	A	A	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:44570978A>T	ENST00000434772.3	+	5	1252	c.997A>T	c.(997-999)Aag>Tag	p.K333*	ZNF223_ENST00000591793.1_Nonsense_Mutation_p.K443*	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	333					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				GGATTTGTGTAAGCATCAGAC	0.443																																					p.K333X		.											.	ZNF223	91	0			c.A997T						.						109.0	107.0	108.0					19																	44570978		2203	4300	6503	SO:0001587	stop_gained	7766	exon5			TTGTGTAAGCATC	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.997A>T	19.37:g.44570978A>T	ENSP00000401947:p.Lys333*	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	52.0	NM_013361	Q15736|Q8TBJ3|Q9HCA9	Nonsense_Mutation	SNP	ENST00000434772.3	37	CCDS12635.1	.	.	.	.	.	.	.	.	.	.	A	37	6.246649	0.97408	.	.	ENSG00000178386	ENST00000434772	.	.	.	2.46	0.269	0.15631	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.6982	0.17867	0.5965:0.0:0.4035:0.0	.	.	.	.	X	333	.	ENSP00000401947:K333X	K	+	1	0	ZNF223	49262818	0.000000	0.05858	0.001000	0.08648	0.825000	0.46686	-1.667000	0.01961	0.188000	0.20168	0.260000	0.18958	AAG	.		0.443	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460469.2		
ZNF225	7768	hgsc.bcm.edu;bcgsc.ca	37	19	44635250	44635250	+	Silent	SNP	C	C	A	rs201221735		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:44635250C>A	ENST00000262894.6	+	5	763	c.483C>A	c.(481-483)tcC>tcA	p.S161S	ZNF225_ENST00000590612.1_Silent_p.S161S|ZNF225_ENST00000592780.1_3'UTR	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	161					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				GTGATGTCTCCGTCCTTGATC	0.413																																					p.S161S		.											.	.	.	0			c.C483A						.						110.0	110.0	110.0					19																	44635250		2032	4213	6245	SO:0001819	synonymous_variant	7768	exon5			TGTCTCCGTCCTT	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.483C>A	19.37:g.44635250C>A		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	5.0	NM_013362	A8K8S2|Q53F12|Q9NS46|Q9UID8	Silent	SNP	ENST00000262894.6	37	CCDS46100.1																																																																																			C|0.999;T|0.000		0.413	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
ZNF311	282890	hgsc.bcm.edu;bcgsc.ca	37	6	28967374	28967374	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr6:28967374T>C	ENST00000377179.3	-	5	712	c.200A>G	c.(199-201)gAg>gGg	p.E67G	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	67	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						AGCTACATCCTCAAATGTCAC	0.438																																					p.E67G		.											.	ZNF311	22	0			c.A200G						.						137.0	99.0	112.0					6																	28967374		1511	2709	4220	SO:0001583	missense	282890	exon5			ACATCCTCAAATG	AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.200A>G	6.37:g.28967374T>C	ENSP00000366384:p.Glu67Gly	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	4.0	NM_001010877	A2BFK5|B0S7Y4|Q92971	Missense_Mutation	SNP	ENST00000377179.3	37	CCDS34357.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.858953	0.51376	.	.	ENSG00000197935	ENST00000377179	T	0.02216	4.39	3.48	2.34	0.29019	Krueppel-associated box (4);	.	.	.	.	T	0.03434	0.0099	M	0.63169	1.94	0.25543	N	0.987162	D	0.69078	0.997	D	0.67900	0.954	T	0.41052	-0.9530	9	0.72032	D	0.01	-19.7298	6.3444	0.21341	0.0:0.125:0.0:0.875	.	67	Q5JNZ3	ZN311_HUMAN	G	67	ENSP00000366384:E67G	ENSP00000366384:E67G	E	-	2	0	ZNF311	29075353	0.874000	0.30092	0.995000	0.50966	0.597000	0.36814	1.099000	0.31013	1.532000	0.49169	0.477000	0.44152	GAG	.		0.438	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076631.3	XM_212581	
ZNF333	84449	hgsc.bcm.edu;bcgsc.ca	37	19	14815924	14815924	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:14815924C>T	ENST00000292530.6	+	6	456	c.365C>T	c.(364-366)cCa>cTa	p.P122L	ZNF333_ENST00000536363.1_Missense_Mutation_p.P13L|ZNF333_ENST00000601134.1_Silent_p.T62T|ZNF333_ENST00000540689.2_Missense_Mutation_p.P122L	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						AGGGAGACACCATTGACTCGA	0.607																																					p.P122L	NSCLC(60;75 1281 16985 25154 29885)	.											.	ZNF333	92	0			c.C365T						.						56.0	50.0	52.0					19																	14815924		2203	4300	6503	SO:0001583	missense	84449	exon6			AGACACCATTGAC		CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.365C>T	19.37:g.14815924C>T	ENSP00000292530:p.Pro122Leu	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_032433	Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	ENST00000292530.6	37	CCDS12316.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.108868	0.37242	.	.	ENSG00000160961	ENST00000392987;ENST00000536363;ENST00000540689;ENST00000292530	T;T;T	0.05855	3.38;5.9;3.42	1.94	-1.49	0.08718	.	.	.	.	.	T	0.03348	0.0097	N	0.24115	0.695	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.10450	0.003;0.005	T	0.48352	-0.9043	9	0.08179	T	0.78	.	5.0306	0.14407	0.0:0.4861:0.0:0.5139	.	122;122	Q96JL9;Q6P2E6	ZN333_HUMAN;.	L	122;13;122;122	ENSP00000439749:P13L;ENSP00000438130:P122L;ENSP00000292530:P122L	ENSP00000292530:P122L	P	+	2	0	ZNF333	14676924	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.162000	0.10012	-0.288000	0.09051	-0.929000	0.02709	CCA	.		0.607	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466496.1	NM_032433	
ZNF610	162963	hgsc.bcm.edu;bcgsc.ca	37	19	52856964	52856964	+	Silent	SNP	C	C	T	rs375754279		TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr19:52856964C>T	ENST00000403906.3	+	4	549	c.93C>T	c.(91-93)atC>atT	p.I31I	ZNF610_ENST00000321287.8_Silent_p.I31I|ZNF610_ENST00000327920.8_Silent_p.I31I|ZNF610_ENST00000601151.1_Silent_p.I31I	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	31	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I31I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		ACGTGGCCATCGAATTCTCTC	0.438																																					p.I31I		.											ZNF610,NS,carcinoma,0	ZNF610	93	1	Substitution - coding silent(1)	ovary(1)	c.C93T						.	C	,,,	1,4405	2.1+/-5.4	0,1,2202	98.0	98.0	98.0		93,93,93,93	-2.9	0.9	19		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZNF610	NM_001161425.1,NM_001161426.1,NM_001161427.1,NM_173530.2	,,,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,,,	31/463,31/463,31/420,31/463	52856964	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	162963	exon4			GGCCATCGAATTC	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.93C>T	19.37:g.52856964C>T		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_001161427	A8K4C3|Q86YH8|Q8NDS9	Silent	SNP	ENST00000403906.3	37	CCDS12851.1																																																																																			.		0.438	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530	
ZNF646	9726	hgsc.bcm.edu;bcgsc.ca	37	16	31088245	31088245	+	Silent	SNP	C	C	T			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr16:31088245C>T	ENST00000394979.2	+	1	1023	c.600C>T	c.(598-600)ccC>ccT	p.P200P	ZNF668_ENST00000564456.1_5'Flank|ZNF646_ENST00000300850.5_Silent_p.P200P|ZNF668_ENST00000300849.4_5'Flank			O15015	ZN646_HUMAN	zinc finger protein 646	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CTCCTCTCCCCATCCCAGCCA	0.602																																					p.P200P		.											.	ZNF646	153	0			c.C600T						.						45.0	50.0	48.0					16																	31088245		2196	4300	6496	SO:0001819	synonymous_variant	9726	exon2			TCTCCCCATCCCA	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.600C>T	16.37:g.31088245C>T		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	6.0	NM_014699	Q8IVD8	Silent	SNP	ENST00000394979.2	37																																																																																				.		0.602	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699	
ZNF655	79027	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99170201	99170201	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr7:99170201A>G	ENST00000394163.2	+	3	653	c.470A>G	c.(469-471)gAt>gGt	p.D157G	GS1-259H13.10_ENST00000455905.1_Intron|GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000424881.1_Missense_Mutation_p.D192G|ZNF655_ENST00000252713.4_Missense_Mutation_p.D157G|ZNF655_ENST00000419215.2_3'UTR|ZNF655_ENST00000493277.1_Missense_Mutation_p.D192G|ZNF655_ENST00000425063.1_3'UTR	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	157					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					CAGAATACCGATGACAATGAT	0.378																																					p.D192G		.											.	ZNF655	91	0			c.A575G						.						65.0	65.0	65.0					7																	99170201		2203	4300	6503	SO:0001583	missense	79027	exon4			ATACCGATGACAA	AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.470A>G	7.37:g.99170201A>G	ENSP00000377718:p.Asp157Gly	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	5.0	NM_001085368	A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Missense_Mutation	SNP	ENST00000394163.2	37	CCDS5669.1	.	.	.	.	.	.	.	.	.	.	A	4.079	0.012634	0.07912	.	.	ENSG00000197343	ENST00000252713;ENST00000493277;ENST00000424881;ENST00000394163	T;T;T;T	0.06294	3.39;3.32;3.32;3.39	4.56	4.56	0.56223	.	0.000000	0.46145	D	0.000320	T	0.17023	0.0409	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	T	0.00205	-1.1922	10	0.87932	D	0	-7.711	10.6033	0.45379	1.0:0.0:0.0:0.0	.	192;157	Q8N720-3;Q8N720	.;ZN655_HUMAN	G	157;192;192;157	ENSP00000252713:D157G;ENSP00000419135:D192G;ENSP00000393876:D192G;ENSP00000377718:D157G	ENSP00000252713:D157G	D	+	2	0	ZNF655	99008137	0.026000	0.19158	0.985000	0.45067	0.077000	0.17291	2.941000	0.49011	2.275000	0.75901	0.528000	0.53228	GAT	.		0.378	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000344929.1	NM_138494	
ZNF710	374655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	90610374	90610374	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr15:90610374A>G	ENST00000268154.4	+	2	256	c.5A>G	c.(4-6)gAg>gGg	p.E2G		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			CACGGGATGGAGGGCTTCATG	0.587																																					p.E2G		.											.	ZNF710	90	0			c.A5G						.						53.0	36.0	42.0					15																	90610374		2200	4298	6498	SO:0001583	missense	374655	exon2			GGATGGAGGGCTT	AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.5A>G	15.37:g.90610374A>G	ENSP00000268154:p.Glu2Gly	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	42.0	NM_198526	A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	ENST00000268154.4	37	CCDS10358.1	.	.	.	.	.	.	.	.	.	.	A	14.66	2.601097	0.46423	.	.	ENSG00000140548	ENST00000268154	T	0.12569	2.67	5.28	5.28	0.74379	.	0.000000	0.39274	N	0.001419	T	0.11281	0.0275	L	0.27053	0.805	0.49687	D	0.999815	P	0.46987	0.888	B	0.39465	0.3	T	0.03148	-1.1067	10	0.87932	D	0	-26.3241	14.2008	0.65703	1.0:0.0:0.0:0.0	.	2	Q8N1W2	ZN710_HUMAN	G	2	ENSP00000268154:E2G	ENSP00000268154:E2G	E	+	2	0	ZNF710	88411378	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.966000	0.63715	2.217000	0.71921	0.533000	0.62120	GAG	.		0.587	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313423.1	NM_198526	
ZSWIM6	57688	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	60628300	60628301	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-EP-A2KB-01A-11D-A183-10	TCGA-EP-A2KB-10A-01D-A183-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	305a5074-5384-45a0-985d-289b178d09f6	87df7481-7da6-412b-9452-d7ce62844ef4	g.chr5:60628300_60628301GC>TT	ENST00000252744.5	+	1	201_202	c.201_202GC>TT	c.(199-204)ccGCcg>ccTTcg	p.P68S		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	68	Gly-rich.				neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						GGTTGCTGCCGCCGGGCAAGAC	0.777																																					p.P68S		.											.	.	.	0			.						.																																			SO:0001583	missense	57688	.			GCTGCCGCCGGGC	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	Exception_encountered	5.37:g.60628300_60628301delinsTT	ENSP00000252744:p.Pro68Ser	Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	17.0	.		Missense_Mutation	DNP	ENST00000252744.5	37	CCDS47215.1																																																																																			.		0.777	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
