#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AANAT	15	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74465363	74465363	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr17:74465363T>A	ENST00000392492.3	+	3	506	c.272T>A	c.(271-273)gTg>gAg	p.V91E	AANAT_ENST00000250615.3_Missense_Mutation_p.V136E	NM_001088.2	NP_001079.1	Q16613	SNAT_HUMAN	aralkylamine N-acetyltransferase	91	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|N-terminal protein amino acid acetylation (GO:0006474)|response to calcium ion (GO:0051592)|response to copper ion (GO:0046688)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to insulin (GO:0032868)|response to light stimulus (GO:0009416)|response to prostaglandin E (GO:0034695)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	aralkylamine N-acetyltransferase activity (GO:0004059)|arylamine N-acetyltransferase activity (GO:0004060)			lung(1)	1						GGCTGCCTTGTGGCCTTCATC	0.627																																					p.V136E		.											.	AANAT	90	0			c.T407A						.						133.0	134.0	134.0					17																	74465363		2203	4300	6503	SO:0001583	missense	15	exon6			GCCTTGTGGCCTT	U40347	CCDS11745.1, CCDS54169.1	17q25.1	2013-10-15	2010-05-07		ENSG00000129673	ENSG00000129673	2.3.1.87		19	protein-coding gene	gene with protein product	"""serotonin N-acetyltransferase"""	600950	"""arylalkylamine N-acetyltransferase"""			8661026	Standard	NM_001088		Approved	SNAT	uc002jro.3	Q16613	OTTHUMG00000180179	ENST00000392492.3:c.272T>A	17.37:g.74465363T>A	ENSP00000376282:p.Val91Glu	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	19.0	NM_001166579	A0AVF2|J3KMZ5|Q562F4	Missense_Mutation	SNP	ENST00000392492.3	37	CCDS11745.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.293262	0.80914	.	.	ENSG00000129673	ENST00000250615;ENST00000392492	T;T	0.32023	1.47;1.47	4.98	3.9	0.45041	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.056648	0.64402	D	0.000001	T	0.58609	0.2134	M	0.88450	2.955	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.63395	-0.6647	10	0.87932	D	0	-13.3083	10.3711	0.44055	0.0:0.0777:0.0:0.9223	.	91	Q16613	SNAT_HUMAN	E	136;91	ENSP00000250615:V136E;ENSP00000376282:V91E	ENSP00000250615:V136E	V	+	2	0	AANAT	71976958	1.000000	0.71417	0.867000	0.34043	0.868000	0.49771	4.741000	0.62095	0.755000	0.32990	0.379000	0.24179	GTG	.		0.627	AANAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450130.1	NM_001088	
ACCSL	390110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	44072129	44072129	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr11:44072129G>T	ENST00000378832.1	+	3	648	c.592G>T	c.(592-594)Gag>Tag	p.E198*		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	198					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						GAACTGCATTGAGGACACCTT	0.468																																					p.E198X		.											.	ACCSL	95	0			c.G592T						.						205.0	205.0	205.0					11																	44072129		1989	4179	6168	SO:0001587	stop_gained	390110	exon3			TGCATTGAGGACA		CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.592G>T	11.37:g.44072129G>T	ENSP00000368109:p.Glu198*	Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	27.0	NM_001031854		Nonsense_Mutation	SNP	ENST00000378832.1	37	CCDS41636.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881766	0.91740	.	.	ENSG00000205126	ENST00000378832	.	.	.	5.08	5.08	0.68730	.	0.456429	0.26220	N	0.025640	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-3.6168	16.0109	0.80402	0.0:0.0:1.0:0.0	.	.	.	.	X	198	.	ENSP00000368109:E198X	E	+	1	0	ACCSL	44028705	1.000000	0.71417	0.067000	0.19924	0.003000	0.03518	5.434000	0.66526	2.642000	0.89623	0.655000	0.94253	GAG	.		0.468	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854	
ACAD8	27034	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134131672	134131672	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr11:134131672T>C	ENST00000281182.4	+	9	1086	c.980T>C	c.(979-981)gTg>gCg	p.V327A	ACAD8_ENST00000543332.1_3'UTR|ACAD8_ENST00000374752.4_Missense_Mutation_p.V200A|ACAD8_ENST00000524547.1_3'UTR|ACAD8_ENST00000537423.1_Missense_Mutation_p.V250A	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	327					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	ACAAGGCTGGTGGCCGCGCGG	0.577																																					p.V327A	GBM(65;238 1125 33403 41853 48889)	.											.	ACAD8	90	0			c.T980C						.						93.0	81.0	85.0					11																	134131672		2201	4297	6498	SO:0001583	missense	27034	exon9			GGCTGGTGGCCGC	AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	ENST00000281182.4:c.980T>C	11.37:g.134131672T>C	ENSP00000281182:p.Val327Ala	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	11.0	NM_014384	B7Z5W4|Q6ZWP6|Q9BUS8	Missense_Mutation	SNP	ENST00000281182.4	37	CCDS8498.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.151777	0.78001	.	.	ENSG00000151498	ENST00000281182;ENST00000537423;ENST00000374752	D;D;D	0.95554	-3.74;-3.74;-3.74	5.69	5.69	0.88448	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.94069	0.8099	N	0.24115	0.695	0.80722	D	1	P;P;P	0.44816	0.706;0.724;0.844	P;P;P	0.52454	0.606;0.699;0.699	D	0.93675	0.6993	10	0.34782	T	0.22	.	15.9508	0.79835	0.0:0.0:0.0:1.0	.	250;200;327	B7Z5W4;Q6ZWP6;Q9UKU7	.;.;ACAD8_HUMAN	A	327;250;200	ENSP00000281182:V327A;ENSP00000443763:V250A;ENSP00000363884:V200A	ENSP00000281182:V327A	V	+	2	0	ACAD8	133636882	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	6.183000	0.72002	2.170000	0.68504	0.459000	0.35465	GTG	.		0.577	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393607.1	NM_014384	
ALB	213	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74284003	74284003	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr4:74284003A>G	ENST00000503124.1	+	10	1384	c.1177A>G	c.(1177-1179)Aag>Gag	p.K393E	ALB_ENST00000415165.2_Missense_Mutation_p.K351E|ALB_ENST00000509063.1_Missense_Mutation_p.K543E|ALB_ENST00000295897.4_Missense_Mutation_p.K543E|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_Missense_Mutation_p.K428E			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ACTTTCTGAGAAGGAGAGACA	0.383																																					p.K543E		.											.	ALB	96	0			c.A1627G						.						106.0	103.0	104.0					4																	74284003		2203	4300	6503	SO:0001583	missense	213	exon12			TCTGAGAAGGAGA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1177A>G	4.37:g.74284003A>G	ENSP00000421027:p.Lys393Glu	Somatic	80.0	1.0		WXS	Illumina HiSeq	Phase_I	21.0	8.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.030|0.030	-1.341696|-1.341696	0.01277|0.01277	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000511370|ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	T|T;T;T;T;T	0.59502|0.53857	0.26|0.6;0.6;0.6;0.6;0.6	5.94|5.94	-1.23|-1.23	0.09465|0.09465	.|Serum albumin-like (1);Serum albumin, N-terminal (3);	.|1.756080	.|0.02646	.|N	.|0.105892	T|T	0.29028|0.29028	0.0721|0.0721	N|N	0.05351|0.05351	-0.065|-0.065	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.13594	.|0.008;0.0;0.0;0.0;0.0	.|B;B;B;B;B	.|0.09377	.|0.004;0.001;0.001;0.003;0.001	T|T	0.07731|0.07731	-1.0757|-1.0757	7|10	0.38643|0.40728	T|T	0.18|0.16	1.5346|1.5346	1.1457|1.1457	0.01775|0.01775	0.4729:0.1149:0.1569:0.2554|0.4729:0.1149:0.1569:0.2554	.|.	.|428;351;393;543;543	.|B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768	.|.;.;.;.;ALBU_HUMAN	G|E	387|543;351;330;393;543;428;552	ENSP00000426179:E387G|ENSP00000295897:K543E;ENSP00000401820:K351E;ENSP00000421027:K393E;ENSP00000422784:K543E;ENSP00000384695:K428E	ENSP00000426179:E387G|ENSP00000295897:K543E	E|K	+|+	2|1	0|0	ALB|ALB	74502867|74502867	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.422000|0.422000	0.31414|0.31414	-0.724000|-0.724000	0.04947|0.04947	-0.612000|-0.612000	0.05701|0.05701	0.528000|0.528000	0.53228|0.53228	GAA|AAG	.		0.383	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
ASIC4	55515	broad.mit.edu;ucsc.edu	37	2	220379297	220379297	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:220379297G>A	ENST00000347842.3	+	1	246	c.232G>A	c.(232-234)Ggc>Agc	p.G78S	AC053503.11_ENST00000429882.1_RNA|ASIC4_ENST00000358078.4_Missense_Mutation_p.G78S	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	78					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										CCCCACCTCGGGCCCCCACCC	0.677																																					p.G78S		.											.	.	.	0			c.G232A						.						12.0	13.0	13.0					2																	220379297		2185	4282	6467	SO:0001583	missense	55515	exon1			ACCTCGGGCCCCC	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.232G>A	2.37:g.220379297G>A	ENSP00000326627:p.Gly78Ser	Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	4.0	NM_182847	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	ENST00000347842.3	37	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516801	0.64634	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.68624	-0.33;-0.34	5.27	3.21	0.36854	.	.	.	.	.	T	0.43765	0.1262	N	0.08118	0	0.21553	N	0.999648	B;B;B	0.17268	0.012;0.021;0.021	B;B;B	0.14023	0.004;0.006;0.01	T	0.29640	-1.0005	9	0.41790	T	0.15	-11.3284	7.3593	0.26737	0.0:0.1328:0.3836:0.4835	.	78;78;78	Q96FT7;Q96FT7-4;Q96FT7-2	ACCN4_HUMAN;.;.	S	78	ENSP00000326627:G78S;ENSP00000350786:G78S	ENSP00000326627:G78S	G	+	1	0	ACCN4	220087541	0.988000	0.35896	0.979000	0.43373	0.987000	0.75469	1.922000	0.40045	1.150000	0.42419	0.561000	0.74099	GGC	.		0.677	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674	
ASS1	445	ucsc.edu;bcgsc.ca	37	9	133333853	133333853	+	Missense_Mutation	SNP	C	C	A	rs147910468		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr9:133333853C>A	ENST00000372394.1	+	5	721	c.240C>A	c.(238-240)agC>agA	p.S80R	ASS1_ENST00000352480.5_Missense_Mutation_p.S80R|ASS1_ENST00000372393.3_Missense_Mutation_p.S80R			P00966	ASSY_HUMAN	argininosuccinate synthase 1	80					acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	TCCAGTCCAGCGCACTGTATG	0.597																																					p.S80R		.											.	ASS1	91	0			c.C240A						.						67.0	66.0	66.0					9																	133333853		2203	4300	6503	SO:0001583	missense	445	exon4			GTCCAGCGCACTG	X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.240C>A	9.37:g.133333853C>A	ENSP00000361471:p.Ser80Arg	Somatic	94.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_054012	Q6LDL2|Q86UZ0|Q96GT4	Missense_Mutation	SNP	ENST00000372394.1	37	CCDS6933.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946506	0.53186	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393;ENST00000422569;ENST00000443588	D;D;D;D;D	0.98633	-5.04;-5.04;-5.04;-5.04;-5.04	4.88	-5.14	0.02875	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.127875	0.49916	U	0.000131	D	0.98308	0.9439	M	0.64404	1.975	0.34728	D	0.729417	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.73708	0.981;0.981;0.981	D	0.98537	1.0630	10	0.87932	D	0	.	13.3652	0.60680	0.0:0.3264:0.0:0.6736	.	80;80;80	A8KAP9;Q5T6L4;P00966	.;.;ASSY_HUMAN	R	80	ENSP00000253004:S80R;ENSP00000361471:S80R;ENSP00000361469:S80R;ENSP00000394212:S80R;ENSP00000397785:S80R	ENSP00000361470:S80R	S	+	3	2	ASS1	132323674	0.000000	0.05858	0.043000	0.18650	0.685000	0.39939	-4.428000	0.00235	-1.247000	0.02507	-0.827000	0.03088	AGC	C|1.000;T|0.000		0.597	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054652.1	NM_000050	
ATP13A4	84239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	193174846	193174846	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr3:193174846G>T	ENST00000342695.4	-	16	2180	c.1858C>A	c.(1858-1860)Ctg>Atg	p.L620M	ATP13A4_ENST00000392443.3_Missense_Mutation_p.L601M	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	620						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		ATGAATGCCAGTCGGTCACCT	0.502																																					p.L620M		.											.	ATP13A4	92	0			c.C1858A						.						105.0	90.0	95.0					3																	193174846		2203	4300	6503	SO:0001583	missense	84239	exon16			ATGCCAGTCGGTC	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.1858C>A	3.37:g.193174846G>T	ENSP00000339182:p.Leu620Met	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	22.0	NM_032279	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	ENST00000342695.4	37	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	G	0.412	-0.912741	0.02415	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	T;T	0.71817	-0.6;-0.6	6.08	0.395	0.16304	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	2.312790	0.01449	N	0.015389	T	0.54598	0.1868	N	0.20328	0.56	0.09310	N	0.999998	B;B;B	0.14438	0.003;0.01;0.003	B;B;B	0.21360	0.01;0.034;0.01	T	0.35176	-0.9799	10	0.11794	T	0.64	-23.6273	6.8172	0.23837	0.0624:0.0941:0.4278:0.4158	.	601;620;620	B7WPN9;Q4VNC1-2;Q4VNC1	.;.;AT134_HUMAN	M	601;620	ENSP00000376238:L601M;ENSP00000339182:L620M	ENSP00000339182:L620M	L	-	1	2	ATP13A4	194657540	0.007000	0.16637	0.745000	0.31077	0.845000	0.48019	0.405000	0.21015	0.119000	0.18210	0.655000	0.94253	CTG	.		0.502	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279	
PTCD1	26024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99021404	99021404	+	Silent	SNP	A	A	G			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:99021404A>G	ENST00000292478.4	-	7	2164	c.1914T>C	c.(1912-1914)ttT>ttC	p.F638F	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.F687F|PTCD1_ENST00000555673.1_Silent_p.F687F	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	638					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			ACACCCGGTCAAAGGTGGGAG	0.582																																					p.F687F		.											.	.	.	0			c.T2061C						.						158.0	141.0	147.0					7																	99021404		2203	4300	6503	SO:0001819	synonymous_variant	100526740	exon8			CCGGTCAAAGGTG	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1914T>C	7.37:g.99021404A>G		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	25.0	NM_001198879	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	ENST00000292478.4	37	CCDS34691.1																																																																																			.		0.582	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
AXDND1	126859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179339142	179339142	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:179339142G>T	ENST00000367618.3	+	4	690	c.303G>T	c.(301-303)tgG>tgT	p.W101C	AXDND1_ENST00000461179.2_3'UTR|AXDND1_ENST00000457238.2_Missense_Mutation_p.W101C	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	101										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						ACCATGTCTGGCATCACCCTG	0.433																																					p.W101C		.											.	AXDND1	93	0			c.G303T						.						81.0	73.0	76.0					1																	179339142		2203	4300	6503	SO:0001583	missense	126859	exon4			TGTCTGGCATCAC	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.303G>T	1.37:g.179339142G>T	ENSP00000356590:p.Trp101Cys	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	50.0	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	37	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643924	0.67244	.	.	ENSG00000162779	ENST00000509175;ENST00000367618;ENST00000360322;ENST00000507383;ENST00000457238;ENST00000508285;ENST00000511889;ENST00000434088	T;T;T	0.79352	-0.39;-1.26;-0.02	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.86435	0.5932	M	0.65498	2.005	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.87667	0.2538	10	0.87932	D	0	-16.8437	14.4325	0.67259	0.0:0.0:1.0:0.0	.	59;101	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	C	59;101;59;59;101;101;59;35	ENSP00000356590:W101C;ENSP00000416712:W101C;ENSP00000391716:W35C	ENSP00000353471:W59C	W	+	3	0	AXDND1	177605765	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.636000	0.67848	2.464000	0.83262	0.579000	0.79373	TGG	.		0.433	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
BCL6	604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	187447378	187447378	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr3:187447378T>A	ENST00000406870.2	-	5	1181	c.815A>T	c.(814-816)gAt>gTt	p.D272V	BCL6_ENST00000232014.4_Missense_Mutation_p.D272V|RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000450123.2_Missense_Mutation_p.D272V|RP11-211G3.3_ENST00000449623.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	272					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GTAGTGCATATCACTTCGTGC	0.547			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.D272V		.		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	BCL6	848	0			c.A815T						.						83.0	87.0	86.0					3																	187447378		2203	4300	6503	SO:0001583	missense	604	exon4			TGCATATCACTTC		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.815A>T	3.37:g.187447378T>A	ENSP00000384371:p.Asp272Val	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	10.0	NM_001134738	A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	ENST00000406870.2	37	CCDS3289.1	.	.	.	.	.	.	.	.	.	.	T	16.33	3.093098	0.56075	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123	T;T;T	0.08720	3.06;3.06;3.08	5.46	5.46	0.80206	.	0.132239	0.64402	D	0.000002	T	0.09992	0.0245	L	0.40543	1.245	0.80722	D	1	P;P	0.48911	0.917;0.808	B;B	0.41860	0.368;0.368	T	0.03413	-1.1039	10	0.56958	D	0.05	.	15.0324	0.71717	0.0:0.0:0.0:1.0	.	272;272	B8PSA7;P41182	.;BCL6_HUMAN	V	272	ENSP00000384371:D272V;ENSP00000232014:D272V;ENSP00000413122:D272V	ENSP00000232014:D272V	D	-	2	0	BCL6	188930072	1.000000	0.71417	0.980000	0.43619	0.942000	0.58702	5.412000	0.66392	2.203000	0.70933	0.459000	0.35465	GAT	.		0.547	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
BCL6	604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	187447392	187447392	+	Silent	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr3:187447392T>C	ENST00000406870.2	-	5	1167	c.801A>G	c.(799-801)gaA>gaG	p.E267E	BCL6_ENST00000232014.4_Silent_p.E267E|RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000450123.2_Silent_p.E267E|RP11-211G3.3_ENST00000449623.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	267					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		TTCGTGCCTCTTCTGGGATTG	0.572			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.E267E		.		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	BCL6	848	0			c.A801G						.						77.0	80.0	79.0					3																	187447392		2203	4300	6503	SO:0001819	synonymous_variant	604	exon4			TGCCTCTTCTGGG		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.801A>G	3.37:g.187447392T>C		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	11.0	NM_001134738	A7E241|B8PSA7|D3DNV5	Silent	SNP	ENST00000406870.2	37	CCDS3289.1																																																																																			.		0.572	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
BRSK2	9024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1466531	1466531	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr11:1466531A>G	ENST00000528841.1	+	10	1204	c.820A>G	c.(820-822)Aag>Gag	p.K274E	BRSK2_ENST00000544817.1_5'UTR|BRSK2_ENST00000531197.1_Missense_Mutation_p.K274E|BRSK2_ENST00000308230.5_Missense_Mutation_p.K274E|BRSK2_ENST00000382179.1_Missense_Mutation_p.K320E|BRSK2_ENST00000528710.1_Missense_Mutation_p.K214E|BRSK2_ENST00000526678.1_Missense_Mutation_p.K274E|BRSK2_ENST00000308219.9_Missense_Mutation_p.K274E			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	274					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		CAGAGGGGGCAAGAATGAGCC	0.692																																					p.K320E		.											.	BRSK2	333	0			c.A958G						.						31.0	39.0	36.0					11																	1466531		2127	4227	6354	SO:0001583	missense	9024	exon10			GGGGGCAAGAATG	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.820A>G	11.37:g.1466531A>G	ENSP00000432000:p.Lys274Glu	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	19.0	NM_001256630	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	ENST00000528841.1	37	CCDS58107.1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.312984	0.40895	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179	T;T;T;T;T;T;T	0.72942	-0.69;-0.69;-0.7;-0.7;-0.7;-0.51;-0.53	3.72	3.72	0.42706	Protein kinase-like domain (1);	0.058569	0.64402	U	0.000003	T	0.76097	0.3940	L	0.54323	1.7	0.80722	D	1	P;D;P;B;B	0.71674	0.913;0.998;0.913;0.354;0.138	P;P;P;B;B	0.60541	0.702;0.876;0.615;0.101;0.06	T	0.74312	-0.3706	10	0.31617	T	0.26	.	12.5717	0.56341	1.0:0.0:0.0:0.0	.	274;320;274;274;274	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	E	274;274;274;274;274;214;320	ENSP00000310697:K274E;ENSP00000431152:K274E;ENSP00000310805:K274E;ENSP00000432000:K274E;ENSP00000433370:K274E;ENSP00000433235:K214E;ENSP00000371614:K320E	ENSP00000310697:K274E	K	+	1	0	BRSK2	1423107	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	5.442000	0.66575	1.569000	0.49696	0.260000	0.18958	AAG	.		0.692	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393033.1	NM_003957	
CACNA2D1	781	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	81588622	81588622	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:81588622C>T	ENST00000356253.5	-	38	3419	c.3164G>A	c.(3163-3165)gGg>gAg	p.G1055E	CACNA2D1_ENST00000535308.1_Missense_Mutation_p.G255E|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.G1043E			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	1055					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GACATCAGGCCCTTTTCGGTA	0.373																																					p.G1043E		.											.	CACNA2D1	96	0			c.G3128A						.						119.0	107.0	111.0					7																	81588622		2203	4300	6503	SO:0001583	missense	781	exon38			TCAGGCCCTTTTC	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.3164G>A	7.37:g.81588622C>T	ENSP00000348589:p.Gly1055Glu	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	5.0	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	C	26.1	4.701399	0.88924	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	T;T;T	0.53640	0.61;0.61;0.61	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.71126	0.3303	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.67345	-0.5694	10	0.34782	T	0.22	-13.5378	20.1393	0.98055	0.0:1.0:0.0:0.0	.	255;1043	B7Z658;P54289-2	.;.	E	1043;1062;1055;255	ENSP00000349320:G1043E;ENSP00000348589:G1055E;ENSP00000443124:G255E	ENSP00000284088:G1062E	G	-	2	0	CACNA2D1	81426558	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.287000	0.78681	2.759000	0.94783	0.563000	0.77884	GGG	.		0.373	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
CAD	790	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27460320	27460320	+	Silent	SNP	C	C	T	rs570532952		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:27460320C>T	ENST00000403525.1	+	27	4425	c.4281C>T	c.(4279-4281)gcC>gcT	p.A1427A	CAD_ENST00000264705.4_Silent_p.A1490A			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGCACAGCCGCTGCCCTGG	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		18959	0.0		0.0	False		,,,				2504	0.001				p.A1490A		.											.	CAD	295	0			c.C4470T						.						79.0	75.0	77.0					2																	27460320		2203	4300	6503	SO:0001819	synonymous_variant	790	exon28			CACAGCCGCTGCC	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4281C>T	2.37:g.27460320C>T		Somatic	205.0	2.0		WXS	Illumina HiSeq	Phase_I	59.0	14.0	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	C	8.742	0.919110	0.17982	.	.	ENSG00000084774	ENST00000458503	.	.	.	4.91	-9.81	0.00487	.	.	.	.	.	T	0.34978	0.0916	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42716	-0.9435	4	.	.	.	3.0384	3.4649	0.07547	0.2732:0.4228:0.168:0.136	.	.	.	.	L	142	.	.	P	+	2	0	CAD	27313824	0.000000	0.05858	0.730000	0.30809	0.943000	0.58893	-5.274000	0.00135	-1.766000	0.01302	-1.267000	0.01435	CCG	.		0.587	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
CD5L	922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	157805798	157805798	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:157805798C>A	ENST00000368174.4	-	3	299	c.203G>T	c.(202-204)gGa>gTa	p.G68V	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	68	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCTGGCAGCTCCACAGCCCAG	0.562																																					p.G68V		.											.	CD5L	91	0			c.G203T						.						151.0	155.0	154.0					1																	157805798		2203	4300	6503	SO:0001583	missense	922	exon3			GCAGCTCCACAGC	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.203G>T	1.37:g.157805798C>A	ENSP00000357156:p.Gly68Val	Somatic	244.0	1.0		WXS	Illumina HiSeq	Phase_I	82.0	49.0	NM_005894	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715138	0.68844	.	.	ENSG00000073754	ENST00000368174	T	0.38887	1.11	4.85	4.85	0.62838	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.312596	0.23017	N	0.052895	T	0.62829	0.2460	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69079	-0.5240	10	0.87932	D	0	.	15.5102	0.75776	0.0:1.0:0.0:0.0	.	68	O43866	CD5L_HUMAN	V	68	ENSP00000357156:G68V	ENSP00000357156:G68V	G	-	2	0	CD5L	156072422	1.000000	0.71417	0.732000	0.30844	0.323000	0.28346	5.528000	0.67129	2.503000	0.84419	0.563000	0.77884	GGA	.		0.562	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
COL4A5	1287	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	107834316	107834316	+	Silent	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chrX:107834316T>C	ENST00000361603.2	+	20	1438	c.1194T>C	c.(1192-1194)ccT>ccC	p.P398P	COL4A5_ENST00000328300.6_Silent_p.P398P	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	398	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						CTCCTGGCCCTCCTGGATTTC	0.473									Alport syndrome with Diffuse Leiomyomatosis																												p.P398P		.											.	COL4A5	133	0			c.T1194C						.						59.0	55.0	56.0					X																	107834316		2203	4300	6503	SO:0001819	synonymous_variant	1287	exon20	Familial Cancer Database		TGGCCCTCCTGGA	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.1194T>C	X.37:g.107834316T>C		Somatic	124.0	1.0		WXS	Illumina HiSeq	Phase_I	37.0	26.0	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	CCDS14543.1																																																																																			.		0.473	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
CPNE8	144402	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	39161460	39161460	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr12:39161460A>T	ENST00000331366.5	-	8	648	c.552T>A	c.(550-552)ttT>ttA	p.F184L	CPNE8_ENST00000360449.3_Missense_Mutation_p.F172L	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	184	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				TACTTCGATAAAATACAAGGA	0.299																																					p.F184L		.											.	CPNE8	91	0			c.T552A						.						75.0	78.0	77.0					12																	39161460		2203	4297	6500	SO:0001583	missense	144402	exon8			TCGATAAAATACA	AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.552T>A	12.37:g.39161460A>T	ENSP00000329748:p.Phe184Leu	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	6.0	NM_153634	Q2TB41|Q86VY2	Missense_Mutation	SNP	ENST00000331366.5	37	CCDS8733.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.952113	0.53293	.	.	ENSG00000139117	ENST00000331366;ENST00000360449	T;T	0.64260	-0.09;-0.09	4.36	4.36	0.52297	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.47040	0.1424	N	0.12853	0.265	0.80722	D	1	B	0.22983	0.078	B	0.33799	0.17	T	0.42032	-0.9475	10	0.27785	T	0.31	-17.7377	13.2488	0.60039	1.0:0.0:0.0:0.0	.	184	Q86YQ8	CPNE8_HUMAN	L	184;172	ENSP00000329748:F184L;ENSP00000353633:F172L	ENSP00000329748:F184L	F	-	3	2	CPNE8	37447727	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.690000	0.47001	1.918000	0.55548	0.482000	0.46254	TTT	.		0.299	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403856.1	NM_153634	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	G	rs121913396|rs121913416		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr3:41266098A>G	ENST00000349496.5	+	3	375	c.95A>G	c.(94-96)gAc>gGc	p.D32G	CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32G|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32G|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32G|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32G	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1	CTNNB1	24361	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95G						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>G	3.37:g.41266098A>G	ENSP00000344456:p.Asp32Gly	Somatic	347.0	2.0		WXS	Illumina HiSeq	Phase_I	117.0	18.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308122	0.81247	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69788	0.3150	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.74137	-0.3762	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	G	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25G;ENSP00000385604:D32G;ENSP00000412219:D32G;ENSP00000379486:D32G;ENSP00000344456:D32G;ENSP00000411226:D25G;ENSP00000379488:D32G;ENSP00000409302:D32G;ENSP00000401599:D32G	ENSP00000344456:D32G	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CYP2C8	1558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	96802834	96802834	+	Splice_Site	SNP	G	G	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr10:96802834G>C	ENST00000371270.3	-	7	1056	c.962C>G	c.(961-963)gCt>gGt	p.A321G	CYP2C8_ENST00000535898.1_Splice_Site_p.A219G|CYP2C8_ENST00000539050.1_Splice_Site_p.A235G	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	321					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	CTGGACTTTAGCTGACAAGAC	0.433																																					p.A321G		.											.	CYP2C8	90	0			c.C962G						.						134.0	110.0	118.0					10																	96802834		2203	4300	6503	SO:0001630	splice_region_variant	1558	exon7			ACTTTAGCTGACA	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.962-1C>G	10.37:g.96802834G>C		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	14.0	NM_000770	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Missense_Mutation	SNP	ENST00000371270.3	37	CCDS7438.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.983095	0.34942	.	.	ENSG00000138115	ENST00000371270;ENST00000535868;ENST00000535898;ENST00000539050	T;T;T	0.13901	2.55;2.55;2.55	4.49	-1.05	0.10036	.	0.235594	0.33854	U	0.004496	T	0.09202	0.0227	L	0.46947	1.48	0.36495	D	0.868631	B;B;B;B	0.13594	0.001;0.003;0.008;0.004	B;B;B;B	0.15052	0.006;0.005;0.01;0.012	T	0.12993	-1.0526	10	0.59425	D	0.04	.	1.8674	0.03201	0.1746:0.1298:0.432:0.2636	.	235;219;289;321	F5H7Q9;B7Z1F6;B7Z8S1;P10632	.;.;.;CP2C8_HUMAN	G	321;288;219;235	ENSP00000360317:A321G;ENSP00000445062:A219G;ENSP00000442343:A235G	ENSP00000360317:A321G	A	-	2	0	CYP2C8	96792824	0.993000	0.37304	0.947000	0.38551	0.903000	0.53119	0.750000	0.26334	0.140000	0.18849	0.585000	0.79938	GCT	.		0.433	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	NM_000770	Missense_Mutation
DAG1	1605	ucsc.edu;bcgsc.ca	37	3	49569129	49569129	+	Silent	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr3:49569129C>T	ENST00000539901.1	+	3	1743	c.1185C>T	c.(1183-1185)acC>acT	p.T395T	DAG1_ENST00000545947.1_Silent_p.T395T|DAG1_ENST00000308775.2_Silent_p.T395T|DAG1_ENST00000515359.2_Silent_p.T395T|DAG1_ENST00000538711.1_Silent_p.T395T|DAG1_ENST00000541308.1_Silent_p.T395T	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	395	Mucin-like domain.|Required for laminin recognition.|Thr-rich.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		AAGCTGGCACCACAGTTCCTG	0.587																																					p.T395T		.											.	DAG1	92	0			c.C1185T						.						112.0	112.0	112.0					3																	49569129		2203	4300	6503	SO:0001819	synonymous_variant	1605	exon4			TGGCACCACAGTT	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.1185C>T	3.37:g.49569129C>T		Somatic	138.0	0.0		WXS	Illumina HiSeq	.	42.0	6.0	NM_001177642	A8K6M7|Q969J9	Silent	SNP	ENST00000539901.1	37	CCDS2799.1																																																																																			.		0.587	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1		
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52428551	52428551	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr3:52428551T>C	ENST00000420323.2	+	67	10958	c.10697T>C	c.(10696-10698)cTg>cCg	p.L3566P		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3631					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCGGACTGGCTGTCAGACCGG	0.592																																					p.L3566P		.											.	DNAH1	67	0			c.T10697C						.						79.0	89.0	85.0					3																	52428551		2059	4197	6256	SO:0001583	missense	25981	exon67			ACTGGCTGTCAGA	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.10697T>C	3.37:g.52428551T>C	ENSP00000401514:p.Leu3566Pro	Somatic	228.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	28.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.586845	0.86851	.	.	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.11821	2.74	5.27	5.27	0.74061	.	0.000000	0.52532	D	0.000064	T	0.54598	0.1868	H	0.98199	4.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.73487	-0.3967	10	0.87932	D	0	.	15.2198	0.73303	0.0:0.0:0.0:1.0	.	3566;3631	C9JXH6;Q9P2D7-2	.;.	P	3566;319	ENSP00000401514:L3566P	ENSP00000273600:L319P	L	+	2	0	DNAH1	52403591	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.170000	0.77587	2.005000	0.58758	0.533000	0.62120	CTG	.		0.592	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
DNAH14	127602	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225586911	225586911	+	Silent	SNP	A	A	G			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:225586911A>G	ENST00000445597.2	+	61	10464	c.10464A>G	c.(10462-10464)aaA>aaG	p.K3488K	DNAH14_ENST00000439375.2_Silent_p.K4496K|DNAH14_ENST00000430092.1_Silent_p.K4496K			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	3488					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CAACGAAGAAACCTCCTAGTC	0.368																																					p.K4496K		.											.	DNAH14	23	0			c.A13488G						.						108.0	100.0	102.0					1																	225586911		692	1591	2283	SO:0001819	synonymous_variant	127602	exon84			GAAGAAACCTCCT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.10464A>G	1.37:g.225586911A>G		Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	10.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	37		.	.	.	.	.	.	.	.	.	.	A	6.100	0.386797	0.11524	.	.	ENSG00000185842	ENST00000428003	.	.	.	5.02	-2.02	0.07388	.	.	.	.	.	T	0.28433	0.0703	.	.	.	0.25414	N	0.98834	.	.	.	.	.	.	T	0.32402	-0.9908	4	.	.	.	.	6.2769	0.20985	0.3422:0.0:0.5038:0.154	.	.	.	.	A	200	.	.	T	+	1	0	DNAH14	223653534	0.000000	0.05858	0.105000	0.21289	0.216000	0.24613	-0.352000	0.07701	-0.201000	0.10284	-0.538000	0.04264	ACC	.		0.368	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
DNAH7	56171	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	196729549	196729549	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:196729549T>C	ENST00000312428.6	-	41	6930	c.6830A>G	c.(6829-6831)aAg>aGg	p.K2277R		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2277					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ATCCTCCCTCTTGGGATCATG	0.378																																					p.K2277R		.											.	DNAH7	102	0			c.A6830G						.						188.0	174.0	178.0					2																	196729549		1891	4125	6016	SO:0001583	missense	56171	exon41			TCCCTCTTGGGAT	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6830A>G	2.37:g.196729549T>C	ENSP00000311273:p.Lys2277Arg	Somatic	202.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	5.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502004	0.26949	.	.	ENSG00000118997	ENST00000312428	T	0.22539	1.95	5.09	2.67	0.31697	.	0.162759	0.51477	N	0.000084	T	0.18635	0.0447	L	0.55481	1.735	0.80722	D	1	B	0.10296	0.003	B	0.15052	0.012	T	0.04811	-1.0925	10	0.28530	T	0.3	.	9.209	0.37306	0.0:0.1837:0.0:0.8163	.	2277	Q8WXX0	DYH7_HUMAN	R	2277	ENSP00000311273:K2277R	ENSP00000311273:K2277R	K	-	2	0	DNAH7	196437794	0.998000	0.40836	0.964000	0.40570	0.592000	0.36648	2.727000	0.47311	0.946000	0.37632	0.377000	0.23210	AAG	.		0.378	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
DOCK7	85440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	62971484	62971484	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:62971484C>T	ENST00000340370.5	-	35	4404	c.4387G>A	c.(4387-4389)Gtt>Att	p.V1463I	DOCK7_ENST00000251157.5_Missense_Mutation_p.V1485I	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1494					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						GTTACAGAAACGGTCTGCAAT	0.383																																					p.V1485I		.											.	DOCK7	92	0			c.G4453A						.						90.0	74.0	80.0					1																	62971484		2203	4300	6503	SO:0001583	missense	85440	exon36			CAGAAACGGTCTG		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.4387G>A	1.37:g.62971484C>T	ENSP00000340742:p.Val1463Ile	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	6.0	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	CCDS30734.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.5|23.5	4.420760|4.420760	0.83559|0.83559	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	.|T;T	.|0.52057	.|0.68;0.68	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68284|0.68284	0.2984|0.2984	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|0.999;0.999;0.999;1.0;0.994;0.988	.|D;P;D;D;P;P	.|0.83275	.|0.993;0.847;0.996;0.996;0.819;0.859	T|T	0.66874|0.66874	-0.5813|-0.5813	5|10	.|0.34782	.|T	.|0.22	.|.	18.4148|18.4148	0.90565|0.90565	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1494;1485;1463;1454;1454;1485	.|Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.|DOCK7_HUMAN;.;.;.;.;.	H|I	656|1494;1485;1463;224	.|ENSP00000251157:V1485I;ENSP00000340742:V1463I	.|ENSP00000251157:V1485I	R|V	-|-	2|1	0|0	DOCK7|DOCK7	62744072|62744072	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.510000|0.510000	0.34073|0.34073	7.818000|7.818000	0.86416|0.86416	2.339000|2.339000	0.79563|0.79563	0.591000|0.591000	0.81541|0.81541	CGT|GTT	.		0.383	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
DNAJB4	11080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	78481825	78481825	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:78481825A>G	ENST00000370763.5	+	3	1165	c.908A>G	c.(907-909)aAt>aGt	p.N303S	GIPC2_ENST00000476882.1_Intron|DNAJB4_ENST00000487931.1_3'UTR	NM_007034.3	NP_008965.2	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	303					protein folding (GO:0006457)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						TTTCCAAAAAATCCTGACCAA	0.403																																					p.N303S		.											.	DNAJB4	226	0			c.A908G						.						120.0	120.0	120.0					1																	78481825		2203	4300	6503	SO:0001583	missense	11080	exon3			CAAAAAATCCTGA	U40992	CCDS684.1	1p31.1	2011-09-02			ENSG00000162616	ENSG00000162616		"""Heat shock proteins / DNAJ (HSP40)"""	14886	protein-coding gene	gene with protein product		611327				9546042, 11147971	Standard	NM_007034		Approved	HLJ1	uc001dij.3	Q9UDY4	OTTHUMG00000040905	ENST00000370763.5:c.908A>G	1.37:g.78481825A>G	ENSP00000359799:p.Asn303Ser	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	12.0	NM_007034	B2R824|Q13431	Missense_Mutation	SNP	ENST00000370763.5	37	CCDS684.1	.	.	.	.	.	.	.	.	.	.	A	10.57	1.387982	0.25118	.	.	ENSG00000162616	ENST00000370763	T	0.43688	0.94	5.96	5.96	0.96718	Chaperone DnaJ, C-terminal (1);HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	T	0.16557	0.0398	N	0.16790	0.44	0.80722	D	1	B	0.12013	0.005	B	0.17098	0.017	T	0.05582	-1.0876	10	0.28530	T	0.3	.	16.4484	0.83959	1.0:0.0:0.0:0.0	.	303	Q9UDY4	DNJB4_HUMAN	S	303	ENSP00000359799:N303S	ENSP00000359799:N303S	N	+	2	0	DNAJB4	78254413	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.833000	0.48159	2.285000	0.76669	0.533000	0.62120	AAT	.		0.403	DNAJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098248.3		
ECT2L	345930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	139202242	139202242	+	Missense_Mutation	SNP	C	C	T	rs368116476		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr6:139202242C>T	ENST00000423192.1	+	14	1975	c.1814C>T	c.(1813-1815)gCg>gTg	p.A605V	RP3-509I19.6_ENST00000572284.1_RNA|ECT2L_ENST00000367682.2_Missense_Mutation_p.A605V|ECT2L_ENST00000541398.1_Missense_Mutation_p.A536V			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	605	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						TCAAACAGAGCGATTCTGAGT	0.368			"""N, Splice, Mis"""		ETP ALL																																p.A605V		.		Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	ECT2L	22	0			c.C1814T						.						114.0	108.0	110.0					6																	139202242		1959	4162	6121	SO:0001583	missense	345930	exon14			ACAGAGCGATTCT		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.1814C>T	6.37:g.139202242C>T	ENSP00000387388:p.Ala605Val	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	17.0	NM_001195037	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	37	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.024108	0.93462	.	.	ENSG00000203734	ENST00000423192;ENST00000367682;ENST00000541398	T;T;T	0.64085	-0.08;-0.08;1.52	5.53	5.53	0.82687	Dbl homology (DH) domain (5);	0.135350	0.27773	U	0.017910	T	0.72244	0.3436	M	0.61703	1.905	0.42102	D	0.991345	D;D	0.89917	1.0;1.0	D;D	0.79108	0.99;0.992	T	0.73871	-0.3846	10	0.59425	D	0.04	-4.1812	16.3823	0.83472	0.0:1.0:0.0:0.0	.	536;605	F5H7S9;Q008S8	.;ECT2L_HUMAN	V	605;605;536	ENSP00000387388:A605V;ENSP00000356655:A605V;ENSP00000442307:A536V	ENSP00000356655:A605V	A	+	2	0	ECT2L	139243935	1.000000	0.71417	0.966000	0.40874	0.989000	0.77384	5.783000	0.68982	2.609000	0.88269	0.655000	0.94253	GCG	.		0.368	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706	
EPHB3	2049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184290761	184290761	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr3:184290761G>T	ENST00000330394.2	+	3	1105	c.653G>T	c.(652-654)gGc>gTc	p.G218V	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	218	Cys-rich.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			ACCACCGCAGGCTTCGCACTC	0.642																																					p.G218V		.											.	EPHB3	1455	0			c.G653T						.						56.0	59.0	58.0					3																	184290761		2203	4300	6503	SO:0001583	missense	2049	exon3			CCGCAGGCTTCGC	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.653G>T	3.37:g.184290761G>T	ENSP00000332118:p.Gly218Val	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	16.0	NM_004443	Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	37	CCDS3268.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951178	0.73787	.	.	ENSG00000182580	ENST00000330394	T	0.73152	-0.72	5.27	5.27	0.74061	.	0.110493	0.64402	D	0.000009	T	0.73225	0.3560	L	0.52905	1.665	0.80722	D	1	P	0.48089	0.905	P	0.46796	0.527	T	0.77507	-0.2562	10	0.87932	D	0	.	17.8822	0.88843	0.0:0.0:1.0:0.0	.	218	P54753	EPHB3_HUMAN	V	218	ENSP00000332118:G218V	ENSP00000332118:G218V	G	+	2	0	EPHB3	185773455	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.290000	0.78711	2.445000	0.82738	0.561000	0.74099	GGC	.		0.642	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443	
EVI2B	2124	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	29632211	29632211	+	Silent	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr17:29632211T>C	ENST00000330927.4	-	2	571	c.417A>G	c.(415-417)ccA>ccG	p.P139P	NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron|EVI2B_ENST00000544462.1_Silent_p.P154P|EVI2B_ENST00000577894.1_Silent_p.P139P	NM_006495.3	NP_006486.3	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B	139						integral component of plasma membrane (GO:0005887)		p.0?(8)|p.?(3)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	12		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		CAAATGACTTTGGTGGTTGTG	0.438																																					p.P139P		.											.	EVI2B	92	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.A417G						.						418.0	347.0	371.0					17																	29632211		2203	4300	6503	SO:0001819	synonymous_variant	2124	exon2			TGACTTTGGTGGT		CCDS11266.1	17q11.2	2011-08-11			ENSG00000185862	ENSG00000185862		"""CD molecules"""	3500	protein-coding gene	gene with protein product		158381				1903357	Standard	NM_006495		Approved	D17S376, EVDB, CD361	uc002hgk.2	P34910	OTTHUMG00000132869	ENST00000330927.4:c.417A>G	17.37:g.29632211T>C		Somatic	617.0	0.0		WXS	Illumina HiSeq	Phase_I	292.0	23.0	NM_006495	B7Z4A7	Silent	SNP	ENST00000330927.4	37	CCDS11266.1																																																																																			.		0.438	EVI2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256349.2	NM_006495	
FARP1	10160	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	99037964	99037964	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr13:99037964G>T	ENST00000319562.6	+	8	920	c.655G>T	c.(655-657)Gcc>Tcc	p.A219S	FARP1_ENST00000595437.1_Missense_Mutation_p.A219S|FARP1_ENST00000376586.2_Missense_Mutation_p.A219S	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	219	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CCTAGAGATTGCCCGTCGGCT	0.473																																					p.A219S		.											.	FARP1	290	0			c.G655T						.						97.0	95.0	96.0					13																	99037964		2203	4300	6503	SO:0001583	missense	10160	exon8			GAGATTGCCCGTC	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.655G>T	13.37:g.99037964G>T	ENSP00000322926:p.Ala219Ser	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	7.0	NM_005766	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	G	31	5.103246	0.94245	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.80033	-1.33;-1.33	5.85	4.99	0.66335	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.103891	0.64402	D	0.000003	D	0.91304	0.7258	M	0.89163	3.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.93055	0.6469	10	0.87932	D	0	.	16.8642	0.86025	0.0:0.1284:0.8716:0.0	.	219;219	Q9Y4F1;C9JME2	FARP1_HUMAN;.	S	219	ENSP00000365771:A219S;ENSP00000322926:A219S	ENSP00000322926:A219S	A	+	1	0	FARP1	97835965	1.000000	0.71417	0.984000	0.44739	0.991000	0.79684	9.869000	0.99810	1.434000	0.47414	0.655000	0.94253	GCC	.		0.473	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
FBN1	2200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48802359	48802359	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr15:48802359A>C	ENST00000316623.5	-	14	2051	c.1596T>G	c.(1594-1596)gaT>gaG	p.D532E		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	532	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTAAACACTCATCAATGTCTA	0.383																																					p.D532E		.											.	FBN1	92	0			c.T1596G						.						74.0	67.0	70.0					15																	48802359		2197	4296	6493	SO:0001583	missense	2200	exon14			ACACTCATCAATG	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.1596T>G	15.37:g.48802359A>C	ENSP00000325527:p.Asp532Glu	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	21.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	A	16.39	3.110957	0.56398	.	.	ENSG00000166147	ENST00000316623	D	0.95307	-3.67	5.5	0.665	0.17896	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.97539	0.9194	H	0.96489	3.83	0.80722	D	1	D	0.63046	0.992	D	0.79108	0.992	D	0.96179	0.9129	10	0.87932	D	0	.	8.7594	0.34665	0.696:0.0:0.304:0.0	.	532	P35555	FBN1_HUMAN	E	532	ENSP00000325527:D532E	ENSP00000325527:D532E	D	-	3	2	FBN1	46589651	0.499000	0.26083	1.000000	0.80357	0.357000	0.29423	-0.007000	0.12810	0.137000	0.18759	-0.326000	0.08463	GAT	.		0.383	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FKBP11	51303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49317594	49317594	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr12:49317594C>T	ENST00000550765.1	-	5	757	c.359G>A	c.(358-360)gGa>gAa	p.G120E	AC073610.5_ENST00000537495.1_Intron|FKBP11_ENST00000453172.2_Missense_Mutation_p.G120E|FKBP11_ENST00000444214.2_Missense_Mutation_p.G18E|RP11-302B13.5_ENST00000398092.4_Intron|FKBP11_ENST00000552878.1_Missense_Mutation_p.G120E|CCDC65_ENST00000266984.5_Intron	NM_016594.2	NP_057678.1	Q9NYL4	FKB11_HUMAN	FK506 binding protein 11, 19 kDa	120	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			kidney(1)|large_intestine(3)|lung(1)	5						TCCCCGTTTTCCATAGGCCAA	0.507																																					p.G120E		.											.	FKBP11	226	0			c.G359A						.						164.0	141.0	149.0					12																	49317594		2203	4300	6503	SO:0001583	missense	51303	exon5			CGTTTTCCATAGG	AF238079	CCDS8773.1, CCDS44870.1, CCDS44871.1	12q13.12	2008-08-04	2002-08-29			ENSG00000134285			18624	protein-coding gene	gene with protein product		610571	"""FK506 binding protein 11 (19 kDa)"""			12036304, 16596453	Standard	NM_016594		Approved	FKBP19	uc001rsp.3	Q9NYL4		ENST00000550765.1:c.359G>A	12.37:g.49317594C>T	ENSP00000449751:p.Gly120Glu	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	13.0	NM_016594	B4DWB7	Missense_Mutation	SNP	ENST00000550765.1	37	CCDS8773.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577281	0.65878	.	.	ENSG00000134285	ENST00000444214;ENST00000550765;ENST00000552878;ENST00000453172	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.16	5.16	0.70880	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.000000	0.85682	D	0.000000	D	0.88959	0.6579	H	0.98155	4.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92981	0.6406	10	0.87932	D	0	-8.3201	17.8082	0.88608	0.0:1.0:0.0:0.0	.	120;120	B4DWB7;Q9NYL4	.;FKB11_HUMAN	E	18;120;120;120	ENSP00000412403:G18E;ENSP00000449751:G120E;ENSP00000447911:G120E;ENSP00000396874:G120E	ENSP00000412403:G18E	G	-	2	0	FKBP11	47603861	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.373000	0.73128	2.574000	0.86865	0.650000	0.86243	GGA	.		0.507	FKBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408927.1	NM_016594	
FRA10AC1	118924	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	95436450	95436450	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr10:95436450T>C	ENST00000359204.4	-	12	985		c.e12-2		FRA10AC1_ENST00000460752.1_5'Flank|FRA10AC1_ENST00000394100.2_Splice_Site|FRA10AC1_ENST00000536233.1_Splice_Site|FRA10AC1_ENST00000371430.2_Splice_Site	NM_145246.4	NP_660289.2	Q70Z53	F10C1_HUMAN	fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1							nucleus (GO:0005634)				NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(1)	14						ATGAATGTCCTGAAAAGGAAA	0.269																																					.		.											.	FRA10AC1	90	0			c.788-2A>G						.						33.0	36.0	35.0					10																	95436450		2192	4268	6460	SO:0001630	splice_region_variant	118924	exon13			ATGTCCTGAAAAG	AK090955	CCDS7430.1	10q23.33	2014-01-28	2010-05-25	2010-05-25	ENSG00000148690	ENSG00000148690			1162	protein-coding gene	gene with protein product		608866	"""chromosome 10 open reading frame 4"""	C10orf4		15203205	Standard	NM_145246		Approved		uc001kiz.2	Q70Z53	OTTHUMG00000018776	ENST00000359204.4:c.788-2A>G	10.37:g.95436450T>C		Somatic	237.0	1.0		WXS	Illumina HiSeq	Phase_I	87.0	45.0	NM_145246	C9JCR4|C9JCR5|C9JMY4|Q70Z49|Q70Z50|Q70Z51|Q70Z52|Q8N293|Q8WVH5|Q96JQ8	Splice_Site	SNP	ENST00000359204.4	37	CCDS7430.1	.	.	.	.	.	.	.	.	.	.	T	12.09	1.832343	0.32421	.	.	ENSG00000148690	ENST00000359204;ENST00000536233;ENST00000371426;ENST00000371430;ENST00000394100	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1899	0.48679	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FRA10AC1	95426440	1.000000	0.71417	0.869000	0.34112	0.379000	0.30106	3.557000	0.53741	1.953000	0.56701	0.460000	0.39030	.	.		0.269	FRA10AC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049439.1	NM_145246	Intron
GLTSCR1	29998	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	48204844	48204844	+	Silent	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr19:48204844G>A	ENST00000396720.3	+	15	4049	c.3855G>A	c.(3853-3855)gaG>gaA	p.E1285E	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1285										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		ACGCCGACGAGGACGGCCCCA	0.701																																					p.E1285E		.											.	GLTSCR1	48	0			c.G3855A						.						5.0	8.0	7.0					19																	48204844		2013	4097	6110	SO:0001819	synonymous_variant	29998	exon15			CGACGAGGACGGC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.3855G>A	19.37:g.48204844G>A		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	6.0	NM_015711	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																			.		0.701	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
GOSR2	9570	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	45000561	45000561	+	Start_Codon_SNP	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr17:45000561G>A	ENST00000393456.2	+	1	60	c.3G>A	c.(1-3)atG>atA	p.M1I	RNU6ATAC3P_ENST00000387974.1_RNA|GOSR2_ENST00000575949.1_Start_Codon_SNP_p.M1I|RP11-63A1.1_ENST00000572349.1_lincRNA|GOSR2_ENST00000225567.4_Start_Codon_SNP_p.M1I|RP11-156P1.2_ENST00000571841.1_Start_Codon_SNP_p.M1I|GOSR2_ENST00000576910.2_Start_Codon_SNP_p.M1I|GOSR2_ENST00000439730.2_Start_Codon_SNP_p.M1I|GOSR2_ENST00000415811.2_Start_Codon_SNP_p.M1I	NM_004287.3	NP_004278.2	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2	1					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|skin(1)	7			BRCA - Breast invasive adenocarcinoma(9;0.102)			CCGGCGACATGGATCCCCTGT	0.701																																					p.M1I		.											.	GOSR2	92	0			c.G3A						.						13.0	16.0	15.0					17																	45000561		1732	3223	4955	SO:0001582	initiator_codon_variant	9570	exon1			CGACATGGATCCC	AF007548	CCDS11507.1, CCDS42355.1, CCDS45719.1	17q21	2006-02-10				ENSG00000108433			4431	protein-coding gene	gene with protein product		604027				9349823, 10198168	Standard	XM_005257843		Approved	GS27, Bos1	uc002ikz.3	O14653		ENST00000393456.2:c.3G>A	17.37:g.45000561G>A	ENSP00000377101:p.Met1Ile	Somatic	210.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	19.0	NM_001012511	D3DXJ5|D3DXJ6|Q8N4B8|Q96DA5|Q9BZZ4	Missense_Mutation	SNP	ENST00000393456.2	37	CCDS42355.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844129	0.71488	.	.	ENSG00000108433	ENST00000225567;ENST00000393456;ENST00000415811;ENST00000439730	T;T;T;T	0.74421	-0.45;-0.36;-0.84;-0.29	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.74306	0.3699	.	.	.	0.80722	D	1	P;B;P;P	0.51449	0.819;0.32;0.887;0.945	B;B;B;P	0.46339	0.245;0.109;0.336;0.513	T	0.77062	-0.2727	9	0.56958	D	0.05	-19.0383	13.9538	0.64135	0.0:0.0:1.0:0.0	.	1;1;1;1	E7EQ34;O14653;O14653-2;Q8N4B8	.;GOSR2_HUMAN;.;.	I	1	ENSP00000225567:M1I;ENSP00000377101:M1I;ENSP00000394559:M1I;ENSP00000390577:M1I	ENSP00000225567:M1I	M	+	3	0	GOSR2	42355560	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	4.367000	0.59498	2.746000	0.94184	0.655000	0.94253	ATG	.		0.701	GOSR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440438.1		Missense_Mutation
HIST1H2BK	85236	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27114511	27114511	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr6:27114511G>T	ENST00000356950.1	-	1	66	c.67C>A	c.(67-69)Cag>Aag	p.Q23K	HIST1H2AH_ENST00000377459.1_5'Flank|MIR3143_ENST00000584253.1_RNA|HIST1H2BK_ENST00000396891.4_Missense_Mutation_p.Q23K			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	23					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						TCCTTCTTCTGCGCCTTAGTC	0.607																																					p.Q23K		.											.	HIST1H2BK	68	0			c.C67A						.						165.0	137.0	146.0					6																	27114511		2203	4300	6503	SO:0001583	missense	85236	exon1			TCTTCTGCGCCTT	AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.67C>A	6.37:g.27114511G>T	ENSP00000349430:p.Gln23Lys	Somatic	201.0	1.0		WXS	Illumina HiSeq	Phase_I	84.0	40.0	NM_080593	A8K7P7|Q2VPI7	Missense_Mutation	SNP	ENST00000356950.1	37	CCDS4621.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820894	0.32237	.	.	ENSG00000197903	ENST00000396891;ENST00000356950	T;T	0.22336	1.96;1.96	4.05	4.05	0.47172	Histone-fold (2);	.	.	.	.	T	0.10380	0.0254	L	0.46741	1.465	0.29563	N	0.850464	B	0.02656	0.0	B	0.01281	0.0	T	0.09997	-1.0649	9	0.49607	T	0.09	.	14.5252	0.67884	0.0:0.0:1.0:0.0	.	23	O60814	H2B1K_HUMAN	K	23	ENSP00000380100:Q23K;ENSP00000349430:Q23K	ENSP00000349430:Q23K	Q	-	1	0	HIST1H2BK	27222490	1.000000	0.71417	0.999000	0.59377	0.027000	0.11550	6.482000	0.73613	2.196000	0.70406	0.650000	0.86243	CAG	.		0.607	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040141.1	NM_080593	
KALRN	8997	ucsc.edu;bcgsc.ca	37	3	124209558	124209558	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr3:124209558G>A	ENST00000240874.3	+	30	4565	c.4408G>A	c.(4408-4410)Gat>Aat	p.D1470N	KALRN_ENST00000460856.1_Missense_Mutation_p.D1461N|KALRN_ENST00000360013.3_Missense_Mutation_p.D1470N	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1470	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CGAGAACCTGGATGTGCAGGG	0.557																																					p.D1470N		.											.	KALRN	738	0			c.G4408A						.						70.0	73.0	72.0					3																	124209558		2203	4300	6503	SO:0001583	missense	8997	exon30			AACCTGGATGTGC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4408G>A	3.37:g.124209558G>A	ENSP00000240874:p.Asp1470Asn	Somatic	64.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.038864|4.038864	0.75617|0.75617	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013|ENST00000354186	T;T;T|.	0.11277|.	2.79;2.79;2.79|.	5.41|5.41	5.41|5.41	0.78517|0.78517	Pleckstrin homology domain (2);|.	0.060315|.	0.64402|.	D|.	0.000004|.	T|.	0.57725|.	0.2073|.	L|L	0.28014|0.28014	0.82|0.82	0.80722|0.80722	D|D	1|1	P;D;P|.	0.54964|.	0.658;0.969;0.768|.	B;D;P|.	0.64877|.	0.345;0.93;0.547|.	T|.	0.50415|.	-0.8831|.	10|.	0.27785|.	T|.	0.31|.	.|.	19.3849|19.3849	0.94553|0.94553	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1461;1470;1470|.	C9IZQ6;O60229;O60229-2|.	.;KALRN_HUMAN;.|.	N|X	1461;1470;1470|1438	ENSP00000418611:D1461N;ENSP00000240874:D1470N;ENSP00000353109:D1470N|.	ENSP00000240874:D1470N|.	D|W	+|+	1|3	0|0	KALRN|KALRN	125692248|125692248	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.936000|0.936000	0.57629|0.57629	9.652000|9.652000	0.98499|0.98499	2.807000|2.807000	0.96579|0.96579	0.650000|0.650000	0.86243|0.86243	GAT|TGG	.		0.557	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
KCNB2	9312	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	73480262	73480262	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr8:73480262C>A	ENST00000523207.1	+	2	881	c.293C>A	c.(292-294)tCc>tAc	p.S98Y		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	98					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GCCTTCACTTCCATTTTAAAT	0.463																																					p.S98Y		.											.	KCNB2	158	0			c.C293A						.						78.0	80.0	79.0					8																	73480262		2203	4300	6503	SO:0001583	missense	9312	exon2			TCACTTCCATTTT	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.293C>A	8.37:g.73480262C>A	ENSP00000430846:p.Ser98Tyr	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	8.0	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040219	0.75732	.	.	ENSG00000182674	ENST00000523207	T	0.76578	-1.03	5.93	5.93	0.95920	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.31577	U	0.007412	T	0.81749	0.4888	N	0.21448	0.665	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	T	0.79415	-0.1813	10	0.32370	T	0.25	.	19.9643	0.97261	0.0:1.0:0.0:0.0	.	98	Q92953	KCNB2_HUMAN	Y	98	ENSP00000430846:S98Y	ENSP00000430846:S98Y	S	+	2	0	KCNB2	73642816	1.000000	0.71417	0.983000	0.44433	0.974000	0.67602	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	TCC	.		0.463	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
KCNK12	56660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	47748598	47748598	+	Silent	SNP	G	G	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:47748598G>C	ENST00000327876.4	-	2	1348	c.741C>G	c.(739-741)ctC>ctG	p.L247L	MSH2_ENST00000461394.1_Intron	NM_022055.1	NP_071338.1	Q9HB15	KCNKC_HUMAN	potassium channel, subfamily K, member 12	247						integral component of membrane (GO:0016021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.0?(2)|p.?(2)		NS(1)|endometrium(1)|lung(3)|ovary(1)	6		all_hematologic(82;0.0495)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AGCAGAAGTAGAGCGAGTCCA	0.652																																					p.L247L		.											.	KCNK12	91	4	Whole gene deletion(2)|Unknown(2)	haematopoietic_and_lymphoid_tissue(3)|prostate(1)	c.C741G						.						47.0	46.0	46.0					2																	47748598		2203	4299	6502	SO:0001819	synonymous_variant	56660	exon2			GAAGTAGAGCGAG	AF287302	CCDS1835.1	2p16.3	2012-03-07			ENSG00000184261	ENSG00000184261		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6274	protein-coding gene	gene with protein product		607366				11060316	Standard	NM_022055		Approved	THIK-2, THIK2, K2p12.1	uc002rwb.3	Q9HB15	OTTHUMG00000129131	ENST00000327876.4:c.741C>G	2.37:g.47748598G>C		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	11.0	NM_022055		Silent	SNP	ENST00000327876.4	37	CCDS1835.1																																																																																			.		0.652	KCNK12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251182.2	NM_022055	
KCNK5	8645	ucsc.edu;bcgsc.ca	37	6	39159107	39159107	+	Silent	SNP	G	G	T	rs146316205	byFrequency	TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr6:39159107G>T	ENST00000359534.3	-	5	1397	c.1059C>A	c.(1057-1059)ccC>ccA	p.P353P		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	353					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						CTTCCAAGGTGGGCACCCGGT	0.662																																					p.P353P		.											.	KCNK5	227	0			c.C1059A						.						55.0	49.0	51.0					6																	39159107		2203	4300	6503	SO:0001819	synonymous_variant	8645	exon5			CAAGGTGGGCACC	AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.1059C>A	6.37:g.39159107G>T		Somatic	85.0	0.0		WXS	Illumina HiSeq	.	34.0	5.0	NM_003740	B2RAQ6|B5TJL2|Q5VV76	Silent	SNP	ENST00000359534.3	37	CCDS4841.1																																																																																			G|1.000;A|0.000		0.662	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040449.1	NM_003740	
KIDINS220	57498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	8934018	8934018	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:8934018G>A	ENST00000256707.3	-	12	1379	c.1198C>T	c.(1198-1200)Ccc>Tcc	p.P400S	KIDINS220_ENST00000427284.1_Missense_Mutation_p.P400S|KIDINS220_ENST00000418530.1_Missense_Mutation_p.P358S|KIDINS220_ENST00000473731.1_Missense_Mutation_p.P400S|KIDINS220_ENST00000319688.5_Missense_Mutation_p.P401S	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	400					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GCTTTGTTGGGCCTATAAAGT	0.413																																					p.P400S		.											.	KIDINS220	93	0			c.C1198T						.						87.0	80.0	82.0					2																	8934018		1817	4078	5895	SO:0001583	missense	57498	exon12			TGTTGGGCCTATA	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.1198C>T	2.37:g.8934018G>A	ENSP00000256707:p.Pro400Ser	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	12.0	NM_020738	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	ENST00000256707.3	37	CCDS42650.1	.	.	.	.	.	.	.	.	.	.	g	18.56	3.650018	0.67472	.	.	ENSG00000134313	ENST00000496383;ENST00000541927;ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000319688	T;T;T;T;T;T;T	0.52983	0.64;2.48;2.48;2.48;2.48;2.48;2.48	5.83	5.83	0.93111	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.62405	0.2425	L	0.35854	1.095	0.80722	D	1	D;D;D;D	0.89917	1.0;0.974;1.0;1.0	D;P;D;D	0.91635	0.996;0.829;0.999;0.999	T	0.59716	-0.7402	10	0.48119	T	0.1	.	20.1862	0.98216	0.0:0.0:1.0:0.0	.	401;401;358;400	B4DK94;E9PH70;Q9ULH0-2;Q9ULH0	.;.;.;KDIS_HUMAN	S	147;84;400;400;358;400;401;401	ENSP00000420364:P147S;ENSP00000256707:P400S;ENSP00000411849:P400S;ENSP00000414923:P358S;ENSP00000418974:P400S;ENSP00000419964:P401S;ENSP00000319947:P401S	ENSP00000256707:P400S	P	-	1	0	KIDINS220	8851469	1.000000	0.71417	0.999000	0.59377	0.211000	0.24417	9.390000	0.97246	2.775000	0.95449	0.632000	0.83419	CCC	.		0.413	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738	
KRTAP29-1	100533177	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	39458417	39458417	+	Silent	SNP	C	C	T	rs201973633		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr17:39458417C>T	ENST00000391353.1	-	1	686	c.687G>A	c.(685-687)tcG>tcA	p.S229S		NM_001257309.1	NP_001244238.1	A8MX34	KR291_HUMAN	keratin associated protein 29-1	229	7 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)											ACACACAAGTCGATGGCTGGC	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		24547	0.0		0.001	False		,,,				2504	0.0				p.S229S		.											.	.	.	0			c.G687A						.																																			SO:0001819	synonymous_variant	100533177	exon1			ACAAGTCGATGGC		CCDS62183.1	17q21.2	2013-06-20			ENSG00000212658	ENSG00000212658		"""Keratin associated proteins"""	34211	protein-coding gene	gene with protein product							Standard	NM_001257309		Approved	KAP29.2	uc031rai.1	A8MX34	OTTHUMG00000133662	ENST00000391353.1:c.687G>A	17.37:g.39458417C>T		Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	12.0	NM_001257309		Silent	SNP	ENST00000391353.1	37																																																																																				C|0.998;T|0.002		0.493	KRTAP29-1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257828.2		
LAMA1	284217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	7017348	7017348	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr18:7017348C>A	ENST00000389658.3	-	20	2830	c.2737G>T	c.(2737-2739)Gtg>Ttg	p.V913L		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	913	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGATGGCACACGGCAGAATGG	0.478																																					p.V913L		.											.	LAMA1	149	0			c.G2737T						.						159.0	122.0	134.0					18																	7017348		2203	4300	6503	SO:0001583	missense	284217	exon20			GGCACACGGCAGA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2737G>T	18.37:g.7017348C>A	ENSP00000374309:p.Val913Leu	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	11.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	7.105	0.574830	0.13623	.	.	ENSG00000101680	ENST00000389658	T	0.61392	0.11	5.5	-0.263	0.12954	EGF-like, laminin (3);	0.569558	0.17079	N	0.187875	T	0.39064	0.1064	L	0.38531	1.155	0.09310	N	1	B	0.17465	0.022	B	0.20577	0.03	T	0.19095	-1.0316	10	0.18276	T	0.48	.	5.8486	0.18679	0.0:0.3242:0.1401:0.5357	.	913	P25391	LAMA1_HUMAN	L	913	ENSP00000374309:V913L	ENSP00000374309:V913L	V	-	1	0	LAMA1	7007348	0.000000	0.05858	0.065000	0.19835	0.225000	0.24961	-0.794000	0.04584	0.023000	0.15187	-0.158000	0.13435	GTG	.		0.478	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LEMD3	23592	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	65563533	65563533	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr12:65563533C>G	ENST00000308330.2	+	1	183	c.157C>G	c.(157-159)Cag>Gag	p.Q53E	LEMD3_ENST00000541171.1_3'UTR	NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	53					negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		AGAGCAGCAACAGCACCGGTC	0.657																																					p.Q53E		.											.	LEMD3	516	0			c.C157G						.						10.0	8.0	9.0					12																	65563533		2152	4236	6388	SO:0001583	missense	23592	exon1			CAGCAACAGCACC	AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.157C>G	12.37:g.65563533C>G	ENSP00000308369:p.Gln53Glu	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	5.0	NM_001167614	Q9NT47|Q9NYA5	Missense_Mutation	SNP	ENST00000308330.2	37	CCDS8972.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748428	0.69533	.	.	ENSG00000174106	ENST00000308330	T	0.42513	0.97	3.49	3.49	0.39957	LEM-like domain (2);	.	.	.	.	T	0.31827	0.0809	N	0.24115	0.695	0.28753	N	0.901327	P;P	0.46656	0.882;0.882	B;B	0.42995	0.404;0.404	T	0.08743	-1.0707	8	.	.	.	-10.3867	13.2998	0.60317	0.0:1.0:0.0:0.0	.	53;53	B4E2K7;Q9Y2U8	.;MAN1_HUMAN	E	53	ENSP00000308369:Q53E	.	Q	+	1	0	LEMD3	63849800	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.883000	0.69721	2.236000	0.73375	0.462000	0.41574	CAG	.		0.657	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401312.2		
LOXHD1	125336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	44089715	44089715	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr18:44089715delC	ENST00000398722.4	-	28	4628	c.4629delG	c.(4627-4629)aagfs	p.K1543fs	LOXHD1_ENST00000300591.6_Frame_Shift_Del_p.K710fs|LOXHD1_ENST00000582408.1_Frame_Shift_Del_p.K648fs|LOXHD1_ENST00000398686.4_Frame_Shift_Del_p.K60fs|LOXHD1_ENST00000579038.1_Frame_Shift_Del_p.K614fs|LOXHD1_ENST00000441893.2_Frame_Shift_Del_p.K692fs|LOXHD1_ENST00000398705.2_Frame_Shift_Del_p.K60fs|LOXHD1_ENST00000536736.1_Frame_Shift_Del_p.K1759fs|LOXHD1_ENST00000441551.2_Frame_Shift_Del_p.K1615fs			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1543	PLAT 11. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GGATCCGCATCTTGGTGAATG	0.572																																					p.K1759fs		.											.	.	.	0			c.5277delG						.						116.0	125.0	122.0					18																	44089715		692	1591	2283	SO:0001589	frameshift_variant	125336	exon34			CCGCATCTTGGTG	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.4629delG	18.37:g.44089715delC	ENSP00000381707:p.Lys1543fs	Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	18.0	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Frame_Shift_Del	DEL	ENST00000398722.4	37																																																																																				.		0.572	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
LPHN2	23266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	82409304	82409304	+	Missense_Mutation	SNP	G	G	A	rs139129579	byFrequency	TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:82409304G>A	ENST00000370728.1	+	8	1694	c.1049G>A	c.(1048-1050)cGa>cAa	p.R350Q	LPHN2_ENST00000370717.2_Missense_Mutation_p.R350Q|LPHN2_ENST00000370721.1_Missense_Mutation_p.R354Q|LPHN2_ENST00000359929.3_Missense_Mutation_p.R350Q|LPHN2_ENST00000335786.5_Missense_Mutation_p.R350Q|LPHN2_ENST00000370723.1_Missense_Mutation_p.R350Q|LPHN2_ENST00000319517.6_Missense_Mutation_p.R350Q|LPHN2_ENST00000370730.1_Missense_Mutation_p.R350Q|LPHN2_ENST00000370715.1_Missense_Mutation_p.R350Q|LPHN2_ENST00000370725.1_Missense_Mutation_p.R350Q|LPHN2_ENST00000370727.1_Missense_Mutation_p.R350Q|LPHN2_ENST00000370713.1_Missense_Mutation_p.R350Q|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000271029.4_Missense_Mutation_p.R350Q|LPHN2_ENST00000394879.1_Missense_Mutation_p.R350Q			O95490	LPHN2_HUMAN	latrophilin 2	350	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CGATTAAACCGAGGAGAATAT	0.383																																					p.R350Q		.											.	LPHN2	525	0			c.G1049A						.	G	GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	156.0	154.0	154.0		1049	4.6	1.0	1	dbSNP_134	154	0,8598		0,0,4299	no	missense	LPHN2	NM_012302.2	43	0,3,6499	AA,AG,GG		0.0,0.0681,0.0231	benign	350/1404	82409304	3,13001	2203	4299	6502	SO:0001583	missense	23266	exon5			TAAACCGAGGAGA	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1049G>A	1.37:g.82409304G>A	ENSP00000359763:p.Arg350Gln	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	13.0	NM_012302	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.33|10.33	1.319664|1.319664	0.23994|0.23994	6.81E-4|6.81E-4	0.0|0.0	ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.|D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.88277	.|-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	5.54|5.54	4.63|4.63	0.57726|0.57726	.|.	.|0.251923	.|0.32218	.|N	.|0.006418	T|T	0.71160|0.71160	0.3307|0.3307	N|N	0.16656|0.16656	0.425|0.425	0.42200|0.42200	D|D	0.991769|0.991769	.|B;B;B	.|0.26081	.|0.141;0.04;0.141	.|B;B;B	.|0.23574	.|0.047;0.007;0.022	T|T	0.69767|0.69767	-0.5056|-0.5056	5|10	.|0.38643	.|T	.|0.18	.|.	14.2889|14.2889	0.66263|0.66263	0.0717:0.0:0.9283:0.0|0.0717:0.0:0.9283:0.0	.|.	.|350;350;350	.|O95490-3;O95490-4;O95490-2	.|.;.;.	K|Q	218|354;350;350;350;350;350;350;350;350;350;350;350;350;350	.|ENSP00000359756:R354Q;ENSP00000359763:R350Q;ENSP00000359765:R350Q;ENSP00000359762:R350Q;ENSP00000359760:R350Q;ENSP00000359758:R350Q;ENSP00000353006:R350Q;ENSP00000359750:R350Q;ENSP00000359748:R350Q;ENSP00000322270:R350Q;ENSP00000359752:R350Q;ENSP00000378344:R350Q;ENSP00000271029:R350Q;ENSP00000337306:R350Q	.|ENSP00000271029:R350Q	E|R	+|+	1|2	0|0	LPHN2|LPHN2	82181892|82181892	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.941000|0.941000	0.58515|0.58515	2.759000|2.759000	0.47573|0.47573	1.320000|1.320000	0.45209|0.45209	0.557000|0.557000	0.71058|0.71058	GAG|CGA	G|1.000;A|0.000		0.383	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	
LRGUK	136332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	133812144	133812144	+	Silent	SNP	C	C	T	rs199883304		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:133812144C>T	ENST00000285928.2	+	1	93	c.24C>T	c.(22-24)ctC>ctT	p.L8L	LRGUK_ENST00000473068.1_3'UTR	NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	8						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)			breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						AGAGGGCTCTCCTGAGGACCA	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		15156	0.001		0.0	False		,,,				2504	0.0				p.L8L		.											.	LRGUK	227	0			c.C24T						.						80.0	87.0	84.0					7																	133812144		2203	4300	6503	SO:0001819	synonymous_variant	136332	exon1			GGCTCTCCTGAGG	AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.24C>T	7.37:g.133812144C>T		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	10.0	NM_144648	Q2M3I1	Silent	SNP	ENST00000285928.2	37	CCDS5830.1																																																																																			C|0.999;T|0.000		0.602	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339442.1	NM_144648	
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	170147487	170147487	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:170147487G>A	ENST00000263816.3	-	8	1075	c.790C>T	c.(790-792)Cat>Tat	p.H264Y	LRP2_ENST00000443831.1_Missense_Mutation_p.H264Y	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	264	LDL-receptor class A 7. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GAACATTTATGAACATCATGA	0.458																																					p.H264Y		.											.	LRP2	175	0			c.C790T						.						111.0	109.0	109.0					2																	170147487		2203	4300	6503	SO:0001583	missense	4036	exon8			ATTTATGAACATC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.790C>T	2.37:g.170147487G>A	ENSP00000263816:p.His264Tyr	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	14.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.639858	0.00799	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	T;T	0.58506	0.33;0.33	4.1	0.0961	0.14488	.	0.421230	0.24072	N	0.041806	T	0.44052	0.1275	L	0.54323	1.7	0.09310	N	1	B;B	0.23316	0.083;0.044	B;B	0.30495	0.116;0.112	T	0.26744	-1.0094	9	.	.	.	.	0.8316	0.01132	0.2232:0.1846:0.4028:0.1894	.	264;264	E9PC35;P98164	.;LRP2_HUMAN	Y	264	ENSP00000263816:H264Y;ENSP00000409813:H264Y	.	H	-	1	0	LRP2	169855733	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	1.195000	0.32186	0.006000	0.14734	-0.941000	0.02677	CAT	.		0.458	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LRRC39	127495	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	100623869	100623869	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:100623869A>T	ENST00000370137.1	-	6	629	c.431T>A	c.(430-432)gTc>gAc	p.V144D	LRRC39_ENST00000342895.3_Missense_Mutation_p.V144D|LRRC39_ENST00000370138.1_Missense_Mutation_p.V144D	NM_001256386.1|NM_144620.3	NP_001243315.1|NP_653221.1	Q96DD0	LRC39_HUMAN	leucine rich repeat containing 39	144										endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	13		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TTCCTTGGGGACAGTCTTGAT	0.353																																					p.V144D		.											.	LRRC39	93	0			c.T431A						.						172.0	176.0	174.0					1																	100623869		2203	4300	6503	SO:0001583	missense	127495	exon6			TTGGGGACAGTCT	AK096892	CCDS766.1, CCDS58014.1	1p21.3	2008-02-05			ENSG00000122477	ENSG00000122477			28228	protein-coding gene	gene with protein product						12975309	Standard	NM_001256385		Approved	MGC14816	uc001dsx.2	Q96DD0	OTTHUMG00000010839	ENST00000370137.1:c.431T>A	1.37:g.100623869A>T	ENSP00000359156:p.Val144Asp	Somatic	164.0	1.0		WXS	Illumina HiSeq	Phase_I	40.0	22.0	NM_144620	B3KUD2|D3DT56|Q5VVK7	Missense_Mutation	SNP	ENST00000370137.1	37	CCDS766.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472905	0.84640	.	.	ENSG00000122477	ENST00000370137;ENST00000370138;ENST00000342895;ENST00000370136	T;T;T	0.18338	2.22;2.22;2.22	5.36	5.36	0.76844	.	0.247909	0.28754	N	0.014244	T	0.26629	0.0651	L	0.59436	1.845	0.80722	D	1	D;D	0.63880	0.993;0.979	P;P	0.61201	0.885;0.771	T	0.01977	-1.1236	10	0.87932	D	0	.	15.6617	0.77193	1.0:0.0:0.0:0.0	.	144;144	Q96DD0-2;Q96DD0	.;LRC39_HUMAN	D	144	ENSP00000359156:V144D;ENSP00000359157:V144D;ENSP00000344470:V144D	ENSP00000344470:V144D	V	-	2	0	LRRC39	100396457	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.998000	0.88491	2.158000	0.67659	0.533000	0.62120	GTC	.		0.353	LRRC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029917.2	NM_144620	
MCTP2	55784	ucsc.edu;bcgsc.ca;mdanderson.org	37	15	94841767	94841767	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr15:94841767C>A	ENST00000357742.4	+	1	273	c.273C>A	c.(271-273)agC>agA	p.S91R	MCTP2_ENST00000331706.4_5'UTR|MCTP2_ENST00000543482.1_Missense_Mutation_p.S91R|MCTP2_ENST00000451018.3_Missense_Mutation_p.S91R	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	91	Poly-Ser.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TTCCCAAGAGCAGCAGTAGCT	0.572																																					p.S91R		.											.	MCTP2	93	0			c.C273A						.						71.0	71.0	71.0					15																	94841767		2197	4298	6495	SO:0001583	missense	55784	exon1			CAAGAGCAGCAGT	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.273C>A	15.37:g.94841767C>A	ENSP00000350377:p.Ser91Arg	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	16.0	4.0	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.376081	0.42105	.	.	ENSG00000140563	ENST00000543482;ENST00000556363;ENST00000451018;ENST00000357742	T;T;T	0.70631	-0.5;-0.3;-0.15	5.04	-1.06	0.10002	.	0.091594	0.47852	D	0.000211	T	0.44350	0.1289	N	0.17082	0.46	0.80722	D	1	B;B;B;B;B	0.06786	0.001;0.001;0.0;0.0;0.001	B;B;B;B;B	0.12156	0.003;0.001;0.001;0.001;0.007	T	0.06881	-1.0802	10	0.14252	T	0.57	.	5.4586	0.16604	0.1229:0.4754:0.0:0.4018	.	91;91;91;91;91	F5H415;Q6DN12-2;Q6DN12;B7Z6H2;G3V2J2	.;.;MCTP2_HUMAN;.;.	R	91	ENSP00000438521:S91R;ENSP00000395109:S91R;ENSP00000350377:S91R	ENSP00000350377:S91R	S	+	3	2	MCTP2	92642771	0.334000	0.24739	0.941000	0.38009	0.922000	0.55478	-0.664000	0.05292	-0.364000	0.08088	-1.012000	0.02466	AGC	.		0.572	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
MFSD6	54842	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	191301480	191301501	+	Frame_Shift_Del	DEL	TGAACTCAAGCACAGCAACCCC	TGAACTCAAGCACAGCAACCCC	-	rs201082615|rs147259731|rs184975766	byFrequency	TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	TGAACTCAAGCACAGCAACCCC	TGAACTCAAGCACAGCAACCCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:191301480_191301501delTGAACTCAAGCACAGCAACCCC	ENST00000392328.1	+	3	1049_1070	c.725_746delTGAACTCAAGCACAGCAACCCC	c.(724-747)ttgaactcaagcacagcaacccctfs	p.LNSSTATP242fs	MFSD6_ENST00000281416.7_Frame_Shift_Del_p.LNSSTATP242fs	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	242					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						GACTTGACTTTGAACTCAAGCACAGCAACCCCTGTCTCCCCA	0.459																																					p.242_249del		.											.	MFSD6	92	0			c.725_746del						.																																			SO:0001589	frameshift_variant	54842	exon3			TGACTTTGAACTC		CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.725_746delTGAACTCAAGCACAGCAACCCC	2.37:g.191301480_191301501delTGAACTCAAGCACAGCAACCCC	ENSP00000376141:p.Leu242fs	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	8.0	NM_017694	D3KSZ4|Q86TH2|Q9NXM3	Frame_Shift_Del	DEL	ENST00000392328.1	37	CCDS2306.1																																																																																			.		0.459	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1		
MID1IP1	58526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	38664209	38664209	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chrX:38664209A>G	ENST00000336949.6	+	2	955	c.10A>G	c.(10-12)Atc>Gtc	p.I4V	MID1IP1_ENST00000378474.3_Missense_Mutation_p.I4V|MID1IP1-AS1_ENST00000436893.1_RNA|MID1IP1_ENST00000457894.1_Missense_Mutation_p.I4V	NM_021242.4	NP_067065.1	Q9NPA3	M1IP1_HUMAN	MID1 interacting protein 1	4					lipid metabolic process (GO:0006629)|negative regulation of microtubule depolymerization (GO:0007026)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of ligase activity (GO:0051351)|protein polymerization (GO:0051258)|regulation of lipid biosynthetic process (GO:0046890)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7						CATGATGCAAATCTGCGACAC	0.617																																					p.I4V		.											.	MID1IP1	130	0			c.A10G						.						102.0	71.0	81.0					X																	38664209		2202	4300	6502	SO:0001583	missense	58526	exon2			ATGCAAATCTGCG		CCDS14249.1	Xp11.4	2012-02-23	2012-02-23		ENSG00000165175	ENSG00000165175			20715	protein-coding gene	gene with protein product	"""gastrulation specific G12 homolog (zebrafish)"""		"""MID1 interacting protein 1 (gastrulation specific G12-like (zebrafish))"""				Standard	NM_001098790		Approved	STRAIT11499, FLJ10386, MIG12, THRSPL, G12-like	uc010ngz.3	Q9NPA3	OTTHUMG00000024092	ENST00000336949.6:c.10A>G	X.37:g.38664209A>G	ENSP00000338706:p.Ile4Val	Somatic	183.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	39.0	NM_021242	D3DWB2	Missense_Mutation	SNP	ENST00000336949.6	37	CCDS14249.1	.	.	.	.	.	.	.	.	.	.	A	16.06	3.015428	0.54468	.	.	ENSG00000165175	ENST00000457894;ENST00000378474;ENST00000336949	.	.	.	4.57	3.4	0.38934	.	0.270105	0.31370	N	0.007779	T	0.40448	0.1117	L	0.34521	1.04	0.42072	D	0.991211	P	0.39094	0.659	B	0.38921	0.285	T	0.31696	-0.9934	9	0.72032	D	0.01	0.3579	8.5973	0.33723	0.9052:0.0:0.0948:0.0	.	4	Q9NPA3	M1IP1_HUMAN	V	4	.	ENSP00000338706:I4V	I	+	1	0	MID1IP1	38549153	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	2.989000	0.49393	0.608000	0.30000	0.430000	0.28490	ATC	.		0.617	MID1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060655.1		
MTOR	2475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	11316988	11316988	+	Splice_Site	SNP	A	A	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:11316988A>T	ENST00000361445.4	-	4	581		c.e4+1			NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)						cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GTAGACACTCACAGCTGCATG	0.557																																					.		.											.	MTOR	1439	0			c.504+2T>A						.						37.0	32.0	34.0					1																	11316988		2203	4300	6503	SO:0001630	splice_region_variant	2475	exon5			ACACTCACAGCTG	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.504+1T>A	1.37:g.11316988A>T		Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	19.0	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Splice_Site	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563445	0.86335	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5192	0.75851	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MTOR	11239575	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	8.888000	0.92464	2.068000	0.61886	0.451000	0.29950	.	.		0.557	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	Intron
NAPEPLD	222236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	102760530	102760530	+	Silent	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:102760530G>A	ENST00000417955.1	-	3	589	c.435C>T	c.(433-435)ctC>ctT	p.L145L	NAPEPLD_ENST00000455523.2_Silent_p.L218L|NAPEPLD_ENST00000427257.1_Silent_p.L145L|NAPEPLD_ENST00000341533.4_Silent_p.L145L|NAPEPLD_ENST00000465647.1_Silent_p.L145L			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	145					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TGGGATCCGTGAGAAATATGA	0.502																																					p.L145L		.											.	NAPEPLD	227	0			c.C435T						.						161.0	124.0	136.0					7																	102760530		2203	4300	6503	SO:0001819	synonymous_variant	222236	exon3			ATCCGTGAGAAAT	BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.435C>T	7.37:g.102760530G>A		Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	35.0	NM_001122838	Q5CZ87|Q769K1	Silent	SNP	ENST00000417955.1	37	CCDS5729.1																																																																																			.		0.502	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347904.1	NM_198990	
NOX3	50508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155776225	155776225	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr6:155776225G>T	ENST00000159060.2	-	2	189	c.87C>A	c.(85-87)gaC>gaA	p.D29E		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	29					detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		AGTAGAACGTGTCAATAAACA	0.328																																					p.D29E		.											.	NOX3	91	0			c.C87A						.						62.0	60.0	61.0					6																	155776225		2203	4300	6503	SO:0001583	missense	50508	exon2			GAACGTGTCAATA	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.87C>A	6.37:g.155776225G>T	ENSP00000159060:p.Asp29Glu	Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	52.0	NM_015718	Q9HBJ9	Missense_Mutation	SNP	ENST00000159060.2	37	CCDS5250.1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413843	0.25465	.	.	ENSG00000074771	ENST00000159060	D	0.94966	-3.57	5.61	3.83	0.44106	.	0.158387	0.44483	D	0.000443	D	0.84079	0.5393	L	0.50333	1.59	0.33157	D	0.546529	P	0.36282	0.546	B	0.30401	0.115	T	0.77405	-0.2600	10	0.29301	T	0.29	-17.4884	8.9582	0.35832	0.2475:0.0:0.7525:0.0	.	29	Q9HBY0	NOX3_HUMAN	E	29	ENSP00000159060:D29E	ENSP00000159060:D29E	D	-	3	2	NOX3	155817917	1.000000	0.71417	0.811000	0.32455	0.895000	0.52256	1.267000	0.33050	0.843000	0.35070	0.650000	0.86243	GAC	.		0.328	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
NRG3	10718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	84498384	84498384	+	Silent	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr10:84498384T>C	ENST00000404547.1	+	3	1005	c.1005T>C	c.(1003-1005)acT>acC	p.T335T	NRG3_ENST00000404576.2_Silent_p.T139T|NRG3_ENST00000372142.2_Silent_p.T114T|NRG3_ENST00000556918.1_Silent_p.T165T|NRG3_ENST00000372141.2_Silent_p.T335T			P56975	NRG3_HUMAN	neuregulin 3	335					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TGCCGAAAACTGATTCCATCT	0.413																																					p.T335T		.											.	NRG3	522	0			c.T1005C						.						157.0	139.0	146.0					10																	84498384		2203	4300	6503	SO:0001819	synonymous_variant	10718	exon3			GAAAACTGATTCC	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1005T>C	10.37:g.84498384T>C		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	21.0	NM_001165972	A4D7U1|Q0PEH2|Q5VYH3	Silent	SNP	ENST00000404547.1	37	CCDS31233.1																																																																																			.		0.413	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	
NRG3	10718	ucsc.edu;bcgsc.ca;mdanderson.org	37	10	84745054	84745054	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr10:84745054T>C	ENST00000404547.1	+	10	1856	c.1856T>C	c.(1855-1857)gTc>gCc	p.V619A	NRG3_ENST00000545131.1_Missense_Mutation_p.V245A|NRG3_ENST00000404576.2_Missense_Mutation_p.V399A|NRG3_ENST00000372142.2_Missense_Mutation_p.V398A|NRG3_ENST00000556918.1_Missense_Mutation_p.V425A|NRG3_ENST00000372141.2_Missense_Mutation_p.V595A|NRG3_ENST00000537893.1_Missense_Mutation_p.V245A			P56975	NRG3_HUMAN	neuregulin 3	619					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ATTTCTGAAGTCAAAAGCATC	0.458																																					p.V595A		.											.	NRG3	522	0			c.T1784C						.						95.0	94.0	94.0					10																	84745054		2203	4300	6503	SO:0001583	missense	10718	exon9			CTGAAGTCAAAAG	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1856T>C	10.37:g.84745054T>C	ENSP00000384796:p.Val619Ala	Somatic	120.0	0.0		WXS	Illumina HiSeq	.	30.0	6.0	NM_001010848	A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	37	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	T	12.54	1.967287	0.34754	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.46063	1.5;1.21;1.22;0.88;1.46;0.94;0.94	5.95	4.76	0.60689	.	0.273189	0.31392	N	0.007724	T	0.31606	0.0802	L	0.40543	1.245	0.31281	N	0.690643	B;B;B;B	0.33171	0.081;0.205;0.4;0.264	B;B;B;B	0.33960	0.033;0.053;0.173;0.054	T	0.44967	-0.9293	10	0.87932	D	0	-20.0263	5.6818	0.17780	0.0:0.084:0.1724:0.7436	.	594;619;398;595	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	A	595;619;594;398;399;425;245;245	ENSP00000361214:V595A;ENSP00000384796:V619A;ENSP00000361215:V398A;ENSP00000385804:V399A;ENSP00000451376:V425A;ENSP00000441201:V245A;ENSP00000440377:V245A	ENSP00000361214:V595A	V	+	2	0	NRG3	84735034	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.419000	0.44671	2.281000	0.76405	0.528000	0.53228	GTC	.		0.458	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	
NSFL1C	55968	broad.mit.edu;ucsc.edu	37	20	1433676	1433676	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr20:1433676C>A	ENST00000216879.4	-	6	1514	c.647G>T	c.(646-648)gGg>gTg	p.G216V	NSFL1C_ENST00000476071.1_Splice_Site_p.G218V|NSFL1C_ENST00000381658.4_Splice_Site_p.G105V|NSFL1C_ENST00000350991.4_Splice_Site_p.G218V|NSFL1C_ENST00000353088.2_Splice_Site_p.G185V|NSFL1C_ENST00000461211.1_5'UTR	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	216	SEP. {ECO:0000255|PROSITE- ProRule:PRU00732}.					chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						TTTCACTCACCCTCTGCGGAT	0.458																																					p.G216V		.											.	NSFL1C	90	0			c.G647T						.						177.0	166.0	170.0					20																	1433676		2203	4300	6503	SO:0001630	splice_region_variant	55968	exon6			ACTCACCCTCTGC	AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.647+1G>T	20.37:g.1433676C>A		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	4.0	NM_016143	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Missense_Mutation	SNP	ENST00000216879.4	37	CCDS13015.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041486	0.93685	.	.	ENSG00000088833	ENST00000353088;ENST00000476071;ENST00000216879;ENST00000381658;ENST00000350991	T;T;T;T;T	0.71817	-0.39;-0.56;-0.59;-0.55;-0.6	5.21	5.21	0.72293	SEP domain (4);	0.000000	0.85682	D	0.000000	D	0.89364	0.6694	H	0.96518	3.835	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.998	D;P;D	0.91635	0.999;0.907;0.984	D	0.92096	0.5684	9	.	.	.	-21.8639	17.5459	0.87861	0.0:1.0:0.0:0.0	.	185;105;216	Q9UNZ2-4;Q9UNZ2-6;Q9UNZ2	.;.;NSF1C_HUMAN	V	185;218;216;105;218	ENSP00000338643:G185V;ENSP00000418529:G218V;ENSP00000216879:G216V;ENSP00000371074:G105V;ENSP00000202584:G218V	.	G	-	2	0	NSFL1C	1381676	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.598000	0.82745	2.890000	0.99128	0.650000	0.86243	GGG	.		0.458	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077525.2	NM_016143	Missense_Mutation
NXF1	10482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62560160	62560160	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr11:62560160T>A	ENST00000532297.1	-	21	2403	c.1774A>T	c.(1774-1776)Aac>Tac	p.N592Y	TMEM223_ENST00000525631.1_5'Flank|NXF1_ENST00000531709.2_3'UTR|NXF1_ENST00000533048.1_5'UTR|TMEM223_ENST00000527073.1_5'Flank|NXF1_ENST00000294172.2_Missense_Mutation_p.N592Y|TMEM223_ENST00000307366.7_5'Flank			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	592	TAP-C. {ECO:0000255|PROSITE- ProRule:PRU00611}.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCCCAGTTGTTGTCCTGAAGG	0.502																																					p.N592Y		.											.	NXF1	228	0			c.A1774T						.						128.0	114.0	118.0					11																	62560160		2201	4299	6500	SO:0001583	missense	10482	exon20			AGTTGTTGTCCTG	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.1774A>T	11.37:g.62560160T>A	ENSP00000436679:p.Asn592Tyr	Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	16.0	NM_006362	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	37	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.396992	0.83120	.	.	ENSG00000162231	ENST00000294172;ENST00000532297	T;T	0.52983	0.64;0.64	5.06	5.06	0.68205	TAP, C-terminal (3);UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.71022	0.3291	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74968	-0.3483	10	0.48119	T	0.1	-29.245	12.7796	0.57469	0.0:0.0:0.0:1.0	.	592	Q9UBU9	NXF1_HUMAN	Y	592	ENSP00000294172:N592Y;ENSP00000436679:N592Y	ENSP00000294172:N592Y	N	-	1	0	NXF1	62316736	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.355000	0.79434	1.921000	0.55644	0.374000	0.22700	AAC	.		0.502	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
OAT	4942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	126092375	126092375	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr10:126092375T>A	ENST00000368845.5	-	6	855	c.763A>T	c.(763-765)Agg>Tgg	p.R255W	OAT_ENST00000467675.1_5'UTR|OAT_ENST00000539214.1_Missense_Mutation_p.R117W	NM_000274.3	NP_000265.1	P04181	OAT_HUMAN	ornithine aminotransferase	255					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-proline biosynthetic process (GO:0055129)|protein hexamerization (GO:0034214)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ornithine-oxo-acid transaminase activity (GO:0004587)|pyridoxal phosphate binding (GO:0030170)			endometrium(2)|large_intestine(1)|lung(2)	5		all_lung(145;0.0271)|Lung NSC(174;0.0436)|Colorectal(57;0.102)|all_neural(114;0.116)			L-Ornithine(DB00129)	ACCTGGTGCCTGGTGCAGAGC	0.512											OREG0020605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R255W		.											.	OAT	68	0			c.A763T						.						117.0	88.0	98.0					10																	126092375		2203	4300	6503	SO:0001583	missense	4942	exon6			GGTGCCTGGTGCA	BC016928	CCDS7639.1, CCDS53586.1	10q26	2014-09-17	2010-01-20		ENSG00000065154	ENSG00000065154	2.6.1.13		8091	protein-coding gene	gene with protein product	"""Ornithine aminotransferase"", ""ornithine aminotransferase precursor"", ""gyrate atrophy"""	613349				1682785	Standard	NM_000274		Approved	HOGA	uc001lhp.3	P04181	OTTHUMG00000019213	ENST00000368845.5:c.763A>T	10.37:g.126092375T>A	ENSP00000357838:p.Arg255Trp	Somatic	152.0	0.0	1547	WXS	Illumina HiSeq	Phase_I	41.0	12.0	NM_000274	D3DRF0|Q16068|Q16069|Q68CS0|Q6IAV9|Q9UD03	Missense_Mutation	SNP	ENST00000368845.5	37	CCDS7639.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.575067	0.86542	.	.	ENSG00000065154	ENST00000539214;ENST00000368845	D;D	0.99060	-5.38;-5.38	4.82	-2.36	0.06663	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.382419	0.31963	N	0.006790	D	0.98648	0.9547	M	0.86953	2.85	0.37842	D	0.929079	P	0.50272	0.933	P	0.53006	0.715	D	0.98327	1.0531	10	0.87932	D	0	-9.3808	10.8424	0.46724	0.0:0.0703:0.3237:0.606	.	255	P04181	OAT_HUMAN	W	117;255	ENSP00000439042:R117W;ENSP00000357838:R255W	ENSP00000357838:R255W	R	-	1	2	OAT	126082365	0.993000	0.37304	0.967000	0.41034	0.996000	0.88848	1.347000	0.33975	-0.390000	0.07774	0.533000	0.62120	AGG	.		0.512	OAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050863.1	NM_000274	
OR8D2	283160	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124189177	124189177	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr11:124189177C>A	ENST00000357438.2	-	1	1007	c.917G>T	c.(916-918)aGg>aTg	p.R306M		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		CTGCCTTCCCCTAGTCATCTT	0.398																																					p.R306M		.											.	OR8D2	113	0			c.G917T						.						98.0	98.0	98.0					11																	124189177		2201	4299	6500	SO:0001583	missense	283160	exon1			CTTCCCCTAGTCA	AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.917G>T	11.37:g.124189177C>A	ENSP00000350022:p.Arg306Met	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	9.0	NM_001002918	B9EH49|Q6IFR0	Missense_Mutation	SNP	ENST00000357438.2	37	CCDS31707.1	.	.	.	.	.	.	.	.	.	.	c	7.982	0.751422	0.15778	.	.	ENSG00000197263	ENST00000357438	T	0.39229	1.09	2.97	0.878	0.19150	.	0.323087	0.22065	N	0.065119	T	0.35278	0.0926	L	0.59967	1.855	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.31475	-0.9942	10	0.51188	T	0.08	.	8.5416	0.33395	0.6119:0.388:0.0:0.0	.	306	Q9GZM6	OR8D2_HUMAN	M	306	ENSP00000350022:R306M	ENSP00000350022:R306M	R	-	2	0	OR8D2	123694387	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	-0.222000	0.09190	0.247000	0.21414	0.590000	0.80494	AGG	.		0.398	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387286.1	NM_001002918	
PAK7	57144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	9546904	9546904	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr20:9546904T>A	ENST00000378429.3	-	6	1664	c.1118A>T	c.(1117-1119)tAc>tTc	p.Y373F	PAK7_ENST00000353224.5_Missense_Mutation_p.Y373F|PAK7_ENST00000378423.1_Missense_Mutation_p.Y373F	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	373	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CCCAGACGGGTACTGGTGACT	0.577																																					p.Y373F		.											.	PAK7	1434	0			c.A1118T						.						184.0	178.0	180.0					20																	9546904		2203	4300	6503	SO:0001583	missense	57144	exon5			GACGGGTACTGGT	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1118A>T	20.37:g.9546904T>A	ENSP00000367686:p.Tyr373Phe	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	9.0	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	T	10.92	1.485918	0.26686	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.29142	1.58;1.58;1.58	5.94	4.81	0.61882	.	0.105803	0.64402	D	0.000002	T	0.37265	0.0997	L	0.43152	1.355	0.46203	D	0.99892	D;B	0.63880	0.993;0.0	P;B	0.52957	0.714;0.001	T	0.05099	-1.0906	9	.	.	.	.	13.154	0.59505	0.0:0.0:0.1335:0.8665	.	373;373	B0AZM9;Q9P286	.;PAK7_HUMAN	F	373;373;373;321	ENSP00000367686:Y373F;ENSP00000322957:Y373F;ENSP00000367679:Y373F	.	Y	-	2	0	PAK7	9494904	1.000000	0.71417	0.993000	0.49108	0.918000	0.54935	2.468000	0.45102	1.031000	0.39867	0.482000	0.46254	TAC	.		0.577	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
PCDHA7	56141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140215321	140215321	+	Silent	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr5:140215321C>T	ENST00000525929.1	+	1	1353	c.1353C>T	c.(1351-1353)aaC>aaT	p.N451N	PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000378125.3_Silent_p.N451N|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	451	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAACGACAACGCCCCGGCGT	0.677																																					p.N451N	NSCLC(160;258 2013 5070 22440 28951)	.											.	PCDHA7	94	0			c.C1353T						.						65.0	69.0	68.0					5																	140215321		2203	4298	6501	SO:0001819	synonymous_variant	56141	exon1			CGACAACGCCCCG	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1353C>T	5.37:g.140215321C>T		Somatic	379.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	55.0	NM_031852	O75282	Silent	SNP	ENST00000525929.1	37	CCDS54918.1																																																																																			.		0.677	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCED1A	64773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2819099	2819099	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr20:2819099C>A	ENST00000360652.2	-	6	1122	c.620G>T	c.(619-621)cGg>cTg	p.R207L	VPS16_ENST00000380469.3_5'Flank|VPS16_ENST00000380445.3_5'Flank|PCED1A_ENST00000356872.3_Missense_Mutation_p.R156L	NM_022760.4	NP_073597.2	Q9H1Q7	PED1A_HUMAN	PC-esterase domain containing 1A	207																	CACATCCCGCCGCAGGGAGCC	0.572																																					p.R207L		.											.	.	.	0			c.G620T						.						57.0	61.0	59.0					20																	2819099		2203	4300	6503	SO:0001583	missense	64773	exon6			TCCCGCCGCAGGG	AK026029	CCDS13035.1, CCDS59442.1	20p13	2012-06-11	2012-06-11	2012-06-11	ENSG00000132635	ENSG00000132635			16212	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 81"", ""family with sequence similarity 113, member A"""	C20orf81, FAM113A		20056006	Standard	NM_022760		Approved	bA12M19.1, FLJ22376	uc002wgz.2	Q9H1Q7	OTTHUMG00000031716	ENST00000360652.2:c.620G>T	20.37:g.2819099C>A	ENSP00000353868:p.Arg207Leu	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	11.0	NM_022760	Q5JUA5|Q5JUA6|Q6PK19|Q86WF5|Q96CG7|Q9H1Q6|Q9H6D1	Missense_Mutation	SNP	ENST00000360652.2	37	CCDS13035.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436922	0.43224	.	.	ENSG00000132635	ENST00000356872;ENST00000360652;ENST00000448755;ENST00000439542	T;T;T;T	0.16897	2.31;2.31;2.31;2.31	4.14	3.19	0.36642	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.075463	0.52532	D	0.000063	T	0.35278	0.0926	L	0.61387	1.9	0.58432	D	0.999995	D;D;D;D	0.89917	0.974;1.0;0.999;0.99	P;D;D;D	0.91635	0.643;0.999;0.997;0.909	T	0.08249	-1.0731	10	0.87932	D	0	-12.4744	9.7095	0.40236	0.0:0.896:0.0:0.104	.	156;203;54;207	Q9H1Q7-2;D3DVX4;B4DEI2;Q9H1Q7	.;.;.;F113A_HUMAN	L	156;207;156;207	ENSP00000349334:R156L;ENSP00000353868:R207L;ENSP00000388935:R156L;ENSP00000401711:R207L	ENSP00000349334:R156L	R	-	2	0	FAM113A	2767099	0.991000	0.36638	1.000000	0.80357	0.994000	0.84299	2.953000	0.49105	1.090000	0.41315	0.563000	0.77884	CGG	.		0.572	PCED1A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077676.2	NM_022760	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82581541	82581541	+	Missense_Mutation	SNP	C	C	T	rs547500251		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:82581541C>T	ENST00000333891.9	-	5	9065	c.8728G>A	c.(8728-8730)Gta>Ata	p.V2910I	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.V2910I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCCATTGTTACGACTGTTCTG	0.443																																					p.V2910I		.											.	PCLO	29	0			c.G8728A						.						205.0	194.0	198.0					7																	82581541		1964	4149	6113	SO:0001583	missense	27445	exon5			TTGTTACGACTGT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8728G>A	7.37:g.82581541C>T	ENSP00000334319:p.Val2910Ile	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	24.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888821	0.33348	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.56444	0.49;0.46	5.68	4.8	0.61643	.	.	.	.	.	T	0.52289	0.1725	M	0.66939	2.045	0.80722	D	1	P;P	0.37061	0.58;0.58	B;B	0.35240	0.198;0.198	T	0.58940	-0.7547	9	0.87932	D	0	.	14.4892	0.67639	0.0:0.9296:0.0:0.0704	.	2910;2910	Q9Y6V0-5;Q9Y6V0-6	.;.	I	2841;2910;2910	ENSP00000334319:V2910I;ENSP00000388393:V2910I	ENSP00000334319:V2910I	V	-	1	0	PCLO	82419477	1.000000	0.71417	0.996000	0.52242	0.865000	0.49528	6.064000	0.71169	1.396000	0.46663	0.563000	0.77884	GTA	.		0.443	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82784846	82784846	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:82784846G>T	ENST00000333891.9	-	2	1448	c.1111C>A	c.(1111-1113)Cct>Act	p.P371T	PCLO_ENST00000423517.2_Missense_Mutation_p.P371T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGAGCTGGAGGCTTAGCAGGA	0.567																																					p.P371T		.											.	PCLO	29	0			c.C1111A						.						51.0	53.0	52.0					7																	82784846		1976	4166	6142	SO:0001583	missense	27445	exon2			CTGGAGGCTTAGC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1111C>A	7.37:g.82784846G>T	ENSP00000334319:p.Pro371Thr	Somatic	251.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	16.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	0.035	-1.310297	0.01342	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.18016	2.24;2.25	4.07	-1.37	0.09056	.	.	.	.	.	T	0.12433	0.0302	L	0.42245	1.32	0.09310	N	0.999997	B;B	0.15141	0.005;0.012	B;B	0.15870	0.005;0.014	T	0.31558	-0.9939	9	0.87932	D	0	.	2.9002	0.05703	0.2141:0.2269:0.45:0.109	.	371;371	Q9Y6V0-5;Q9Y6V0-6	.;.	T	371	ENSP00000334319:P371T;ENSP00000388393:P371T	ENSP00000334319:P371T	P	-	1	0	PCLO	82622782	0.054000	0.20591	0.000000	0.03702	0.268000	0.26511	-0.022000	0.12480	-0.994000	0.03463	-0.797000	0.03246	CCT	.		0.567	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PHKG2	5261	broad.mit.edu;ucsc.edu;mdanderson.org	37	16	30768227	30768227	+	Missense_Mutation	SNP	C	C	T	rs564686049		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr16:30768227C>T	ENST00000563588.1	+	10	1269	c.1030C>T	c.(1030-1032)Cgg>Tgg	p.R344W	PHKG2_ENST00000424889.3_Missense_Mutation_p.R344W|PHKG2_ENST00000328273.7_Missense_Mutation_p.R348W	NM_000294.2	NP_000285.1	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)	344					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|positive regulation of glycogen catabolic process (GO:0045819)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			ovary(1)|skin(1)	2			Colorectal(24;0.198)			TTATGCGCTGCGGTCAGTGCG	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		19732	0.0		0.0	False		,,,				2504	0.001				p.R344W		.											.	PHKG2	334	0			c.C1030T						.						120.0	105.0	110.0					16																	30768227		2197	4300	6497	SO:0001583	missense	5261	exon10			GCGCTGCGGTCAG	S73483, M31606	CCDS10690.1, CCDS54002.1	16p11.2	2008-02-05			ENSG00000156873	ENSG00000156873			8931	protein-coding gene	gene with protein product		172471				2915644, 8020963	Standard	NM_000294		Approved		uc021tgo.1	P15735	OTTHUMG00000132400	ENST00000563588.1:c.1030C>T	16.37:g.30768227C>T	ENSP00000455607:p.Arg344Trp	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	3.0	NM_001172432	A8K0C7|B4DEB7|E9PEU3|P11800	Missense_Mutation	SNP	ENST00000563588.1	37	CCDS10690.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381494	0.82792	.	.	ENSG00000156873	ENST00000328273;ENST00000424889	T	0.33865	1.39	6.07	6.07	0.98685	Protein kinase-like domain (1);	0.000000	0.44483	D	0.000451	T	0.55816	0.1944	M	0.63843	1.955	0.53688	D	0.999971	D;D	0.76494	0.999;0.999	D;D	0.71870	0.945;0.975	T	0.56183	-0.8021	10	0.87932	D	0	-20.7084	12.7814	0.57479	0.2605:0.7395:0.0:0.0	.	344;344	P15735;P15735-2	PHKG2_HUMAN;.	W	344	ENSP00000388571:R344W	ENSP00000329968:R344W	R	+	1	2	PHKG2	30675728	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.406000	0.34646	2.884000	0.98904	0.655000	0.94253	CGG	.		0.612	PHKG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255531.2	NM_000294	
PLB1	151056	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	28812636	28812636	+	Splice_Site	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:28812636T>C	ENST00000327757.5	+	28	2059	c.2015T>C	c.(2014-2016)aTg>aCg	p.M672T	PLB1_ENST00000329020.6_Splice_Site_p.M360T|PLB1_ENST00000422425.2_Splice_Site_p.M661T	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	672	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					TGGAACAATATGGTAAGTGGC	0.527																																					p.M672T		.											.	PLB1	141	0			c.T2015C						.						59.0	59.0	59.0					2																	28812636		2203	4300	6503	SO:0001630	splice_region_variant	151056	exon28			ACAATATGGTAAG		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2016+1T>C	2.37:g.28812636T>C		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	8.0	NM_153021	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.44|14.44	2.537353|2.537353	0.45176|0.45176	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000404858|ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020	.|T;T;T;T	.|0.44881	.|0.91;0.91;0.91;0.91	5.73|5.73	5.73|5.73	0.89815|0.89815	.|Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	.|0.037657	.|0.85682	.|D	.|0.000000	T|T	0.69360|0.69360	0.3102|0.3102	M|M	0.92738|0.92738	3.34|3.34	0.80722|0.80722	D|D	1|1	.|D;D;D;P	.|0.59767	.|0.97;0.986;0.974;0.956	.|P;P;P;P	.|0.61201	.|0.844;0.885;0.786;0.613	T|T	0.77680|0.77680	-0.2497|-0.2497	5|10	.|0.87932	.|D	.|0	-27.2243|-27.2243	13.8321|13.8321	0.63386|0.63386	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|661;672;360;672	.|Q6P1J6-3;Q6P1J6-4;Q6P1J6-2;Q6P1J6	.|.;.;.;PLB1_HUMAN	R|T	660|672;661;382;360	.|ENSP00000330442:M672T;ENSP00000416440:M661T;ENSP00000392493:M382T;ENSP00000330729:M360T	.|ENSP00000330442:M672T	C|M	+|+	1|2	0|0	PLB1|PLB1	28666140|28666140	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.028000|0.028000	0.11728|0.11728	6.756000|6.756000	0.74919|0.74919	2.308000|2.308000	0.77769|0.77769	0.533000|0.533000	0.62120|0.62120	TGC|ATG	.		0.527	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		Missense_Mutation
POC1A	25886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52179895	52179895	+	Missense_Mutation	SNP	C	C	T	rs139462706	byFrequency	TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr3:52179895C>T	ENST00000296484.2	-	6	685	c.646G>A	c.(646-648)Gtg>Atg	p.V216M	POC1A_ENST00000394970.2_Missense_Mutation_p.V216M|POC1A_ENST00000474012.1_Missense_Mutation_p.V178M	NM_015426.4	NP_056241.3	Q8NBT0	POC1A_HUMAN	POC1 centriolar protein A	216					cell projection organization (GO:0030030)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|large_intestine(4)|liver(1)|lung(4)|prostate(3)|skin(1)	14						TGAGTCCGCACGTCCCACACC	0.597																																					p.V216M		.											.	POC1A	90	0			c.G646A						.	C	MET/VAL,MET/VAL,MET/VAL	3,4403	6.2+/-15.9	0,3,2200	112.0	80.0	91.0		646,532,646	2.5	0.2	3	dbSNP_134	91	0,8600		0,0,4300	yes	missense,missense,missense	POC1A	NM_001161580.1,NM_001161581.1,NM_015426.4	21,21,21	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign,benign,benign	216/360,178/370,216/408	52179895	3,13003	2203	4300	6503	SO:0001583	missense	25886	exon6			TCCGCACGTCCCA	AL117629	CCDS2846.1, CCDS54591.1, CCDS54592.1	3p21.2	2014-05-02	2013-08-21	2010-03-26	ENSG00000164087	ENSG00000164087		"""WD repeat domain containing"""	24488	protein-coding gene	gene with protein product		614783	"""WD repeat domain 51A"", ""POC1 centriolar protein homolog A (Chlamydomonas)"""	WDR51A		19109428, 22840364	Standard	NM_015426		Approved	DKFZP434C245	uc003dcu.3	Q8NBT0	OTTHUMG00000157817	ENST00000296484.2:c.646G>A	3.37:g.52179895C>T	ENSP00000296484:p.Val216Met	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	10.0	NM_015426	A4FUW4|E9PFC6|Q0VDF8|Q2TAK6|Q96IK6|Q9UFJ8	Missense_Mutation	SNP	ENST00000296484.2	37	CCDS2846.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101924	0.56183	6.81E-4	0.0	ENSG00000164087	ENST00000296484;ENST00000394970;ENST00000474012	D;D;D	0.81908	-1.55;-1.55;-1.55	5.29	2.46	0.29980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.256906	0.37483	N	0.002076	T	0.75170	0.3813	L	0.35542	1.07	0.33465	D	0.585393	P;P	0.44659	0.84;0.753	B;B	0.44108	0.441;0.203	T	0.81187	-0.1047	10	0.66056	D	0.02	.	9.0415	0.36321	0.0:0.7098:0.0:0.2902	.	216;216	Q8NBT0-2;Q8NBT0	.;POC1A_HUMAN	M	216;216;178	ENSP00000296484:V216M;ENSP00000378421:V216M;ENSP00000418968:V178M	ENSP00000296484:V216M	V	-	1	0	POC1A	52154935	0.894000	0.30519	0.197000	0.23402	0.950000	0.60333	1.596000	0.36718	1.200000	0.43188	0.563000	0.77884	GTG	C|0.999;T|0.001		0.597	POC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349685.1	NM_015426	
PPP1R3A	5506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	113519408	113519408	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:113519408T>C	ENST00000284601.3	-	4	1807	c.1739A>G	c.(1738-1740)gAt>gGt	p.D580G		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	580					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.D580V(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATGAGACACATCTGCTGTGAT	0.483																																					p.D580G		.											PPP1R3A,NS,carcinoma,0	PPP1R3A	832	1	Substitution - Missense(1)	ovary(1)	c.A1739G						.						116.0	111.0	113.0					7																	113519408		2203	4300	6503	SO:0001583	missense	5506	exon4			GACACATCTGCTG	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1739A>G	7.37:g.113519408T>C	ENSP00000284601:p.Asp580Gly	Somatic	228.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	48.0	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.167400	0.38315	.	.	ENSG00000154415	ENST00000284601	T	0.18960	2.18	5.89	2.34	0.29019	.	0.367658	0.26407	N	0.024551	T	0.21427	0.0516	M	0.69823	2.125	0.09310	N	1	B	0.19200	0.034	B	0.12156	0.007	T	0.17410	-1.0370	10	0.44086	T	0.13	-0.3165	7.6128	0.28139	0.0:0.2351:0.0:0.7649	.	580	Q16821	PPR3A_HUMAN	G	580	ENSP00000284601:D580G	ENSP00000284601:D580G	D	-	2	0	PPP1R3A	113306644	0.000000	0.05858	0.004000	0.12327	0.062000	0.15995	0.087000	0.14958	0.505000	0.28104	0.460000	0.39030	GAT	.		0.483	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
PRPF4	9128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	116049016	116049016	+	Silent	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr9:116049016C>T	ENST00000374198.4	+	9	945	c.843C>T	c.(841-843)ttC>ttT	p.F281F	PRPF4_ENST00000374199.4_Silent_p.F280F	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	281				NVGAIVFH -> KKEQLHSI (in Ref. 3; AAC02261). {ECO:0000305}.	gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						CAATTGTATTCCATCCCAAAT	0.443																																					p.F281F		.											.	PRPF4	93	0			c.C843T						.						299.0	292.0	294.0					9																	116049016		2203	4300	6503	SO:0001819	synonymous_variant	9128	exon9			TGTATTCCATCCC	AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.843C>T	9.37:g.116049016C>T		Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	10.0	NM_004697	O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Silent	SNP	ENST00000374198.4	37	CCDS6791.1																																																																																			.		0.443	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053708.2	NM_004697	
PSG1	5669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43382065	43382065	+	Splice_Site	SNP	G	G	A	rs545006367		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr19:43382065G>A	ENST00000436291.2	-	2	546	c.430C>T	c.(430-432)Ctg>Ttg	p.L144L	PSG1_ENST00000312439.6_Splice_Site_p.L144L|PSG1_ENST00000595356.1_Splice_Site_p.L144L|PSG1_ENST00000244296.2_Splice_Site_p.L144L|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000403380.3_Splice_Site_p.P144S|PSG1_ENST00000595124.1_Splice_Site_p.P144S	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	144	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				AATCACTTACGGTGTAAGGTG	0.522													.|||	1	0.000199681	0.0	0.0	5008	,	,		19792	0.0		0.0	False		,,,				2504	0.001				p.L144L		.											.	PSG1	70	0			c.C430T						.						278.0	246.0	257.0					19																	43382065		2201	4299	6500	SO:0001630	splice_region_variant	5669	exon2			ACTTACGGTGTAA		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.430+1C>T	19.37:g.43382065G>A		Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	10.0	NM_001184826	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Silent	SNP	ENST00000436291.2	37	CCDS54275.1	.	.	.	.	.	.	.	.	.	.	N	1.997	-0.430475	0.04669	.	.	ENSG00000231924	ENST00000403380	T	0.00808	5.67	1.64	-3.28	0.05033	.	.	.	.	.	T	0.00608	0.0020	.	.	.	0.80722	D	1	B;B	0.09022	0.002;0.0	B;B	0.11329	0.006;0.004	T	0.51608	-0.8684	7	.	.	.	.	4.5493	0.12105	0.1581:0.4279:0.414:0.0	.	144;144	G5E9F7;Q8NBY8	.;.	S	144	ENSP00000385386:P144S	.	P	-	1	0	PSG1	48073905	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.768000	0.04715	-0.682000	0.05197	-2.968000	0.00081	CCG	.		0.522	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1		Silent
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	109695030	109695030	+	Silent	SNP	T	T	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chrX:109695030T>A	ENST00000465301.2	+	3	1431	c.1185T>A	c.(1183-1185)tcT>tcA	p.S395S	RGAG1_ENST00000540313.1_Silent_p.S395S	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	395										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CAACAGCCTCTGGGGTGATGT	0.512																																					p.S395S		.											.	RGAG1	132	0			c.T1185A						.						187.0	196.0	193.0					X																	109695030		2203	4300	6503	SO:0001819	synonymous_variant	57529	exon3			AGCCTCTGGGGTG	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1185T>A	X.37:g.109695030T>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	12.0	NM_020769	Q9P2M8	Silent	SNP	ENST00000465301.2	37	CCDS14552.1																																																																																			.		0.512	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
RNF213	57674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78328357	78328357	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr17:78328357C>A	ENST00000582970.1	+	36	10986	c.10843C>A	c.(10843-10845)Cag>Aag	p.Q3615K	CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.Q1688K|RNF213_ENST00000508628.2_Missense_Mutation_p.Q3664K|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3615					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GGACGCTCTCCAGGAGGCGGG	0.552																																					p.Q3615K		.											.	RNF213	577	0			c.C10843A						.						52.0	49.0	50.0					17																	78328357		2203	4300	6503	SO:0001583	missense	57674	exon36			GCTCTCCAGGAGG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10843C>A	17.37:g.78328357C>A	ENSP00000464087:p.Gln3615Lys	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	9.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442249	0.43326	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.27402	1.67	4.93	4.93	0.64822	.	0.061356	0.64402	D	0.000002	T	0.60676	0.2287	M	0.82323	2.585	0.40522	D	0.980849	D;D	0.89917	1.0;0.998	D;P	0.87578	0.998;0.872	T	0.67795	-0.5578	10	0.59425	D	0.04	.	18.1568	0.89694	0.0:1.0:0.0:0.0	.	3664;1688	C9JCP4;Q63HN8	.;RN213_HUMAN	K	3615;3664;1688	ENSP00000338218:Q1688K	ENSP00000338218:Q1688K	Q	+	1	0	RNF213	75942952	1.000000	0.71417	0.933000	0.37362	0.689000	0.40095	6.771000	0.74996	2.288000	0.76882	0.650000	0.86243	CAG	.		0.552	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
RNF220	55182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	45111114	45111114	+	Nonsense_Mutation	SNP	A	A	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:45111114A>T	ENST00000355387.2	+	12	1849	c.1399A>T	c.(1399-1401)Aag>Tag	p.K467*	RNF220_ENST00000443020.2_Nonsense_Mutation_p.K254*|TMEM53_ENST00000372242.3_Nonsense_Mutation_p.L159*|TMEM53_ENST00000372244.3_Silent_p.L28L|RNF220_ENST00000372247.2_Nonsense_Mutation_p.K467*|RNF220_ENST00000361799.2_Nonsense_Mutation_p.K467*|RNF220_ENST00000480686.1_3'UTR|TMEM53_ENST00000372243.3_Nonsense_Mutation_p.L69*			Q5VTB9	RN220_HUMAN	ring finger protein 220	467					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						TGAAAGCAGCAAGCAGGAGGC	0.592																																					p.K467X		.											.	RNF220	228	0			c.A1399T						.						108.0	91.0	96.0					1																	45111114		2203	4300	6503	SO:0001587	stop_gained	55182	exon12			AGCAGCAAGCAGG	AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.1399A>T	1.37:g.45111114A>T	ENSP00000347548:p.Lys467*	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	14.0	NM_018150	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Nonsense_Mutation	SNP	ENST00000355387.2	37	CCDS510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	39|39	7.302589|7.302589	0.98196|0.98196	.|.	.|.	ENSG00000187147|ENSG00000126106	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247;ENST00000443020;ENST00000440132;ENST00000335497;ENST00000372248|ENST00000372243;ENST00000372242	.|.	.|.	.|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.87932|0.02654	D|T	0|1	.|.	16.0229|16.0229	0.80512|0.80512	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	X|X	467;467;467;467;254;183;209;210|69;159	.|.	ENSP00000335580:K209X|ENSP00000361316:L159X	K|L	+|-	1|2	0|0	RNF220|TMEM53	44883701|44883701	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	8.527000|8.527000	0.90594|0.90594	2.189000|2.189000	0.69895|0.69895	0.459000|0.459000	0.35465|0.35465	AAG|TTG	.		0.592	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	NM_018150	
RPS2	6187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2013233	2013233	+	Silent	SNP	G	G	A	rs377086871		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr16:2013233G>A	ENST00000343262.4	-	4	348	c.292C>T	c.(292-294)Ctg>Ttg	p.L98L	RPS2_ENST00000530225.1_Silent_p.L98L|RPS2_ENST00000526522.1_Silent_p.L98L|SNHG9_ENST00000459373.1_lincRNA|SNORA10_ENST00000384084.1_RNA|RPS2_ENST00000529806.1_Silent_p.L68L|SNORA64_ENST00000384674.1_RNA	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	98					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						GAGGCCCCCAGGAAGAAATCA	0.448													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18340	0.0		0.0	False		,,,				2504	0.0				p.L98L		.											.	RPS2	90	0			c.C292T						.	G		2,4360		0,2,2179	8.0	8.0	8.0		292	-2.3	0.9	16		8	0,8546		0,0,4273	no	coding-synonymous	RPS2	NM_002952.3		0,2,6452	AA,AG,GG		0.0,0.0459,0.0155		98/294	2013233	2,12906	2181	4273	6454	SO:0001819	synonymous_variant	6187	exon4			CCCCCAGGAAGAA	AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.292C>T	16.37:g.2013233G>A		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	14.0	NM_002952	B2R5G0|D3DU82|Q3MIB1	Silent	SNP	ENST00000343262.4	37	CCDS10452.1																																																																																			.		0.448	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250613.2	NM_002952	
RUNX3	864	ucsc.edu;bcgsc.ca	37	1	25291022	25291022	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr1:25291022G>A	ENST00000338888.3	-	2	286	c.41C>T	c.(40-42)tCg>tTg	p.S14L	RP11-84D1.1_ENST00000456316.1_RNA|RUNX3_ENST00000399916.1_Missense_Mutation_p.S14L			Q13761	RUNX3_HUMAN	runt-related transcription factor 3	0					axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GAAGGTCGGCGAGTAGGTCGG	0.627																																					p.S14L		.											.	RUNX3	414	0			c.C41T						.						63.0	51.0	55.0					1																	25291022		2202	4300	6502	SO:0001583	missense	864	exon1			GTCGGCGAGTAGG	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000338888.3:c.41C>T	1.37:g.25291022G>A	ENSP00000343477:p.Ser14Leu	Somatic	65.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_001031680	B1AJV5|Q12969|Q13760	Missense_Mutation	SNP	ENST00000338888.3	37	CCDS30633.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432925	0.43224	.	.	ENSG00000020633	ENST00000399916;ENST00000338888	D;D	0.96992	-4.2;-4.2	5.67	5.67	0.87782	.	0.738391	0.11146	N	0.594662	D	0.92828	0.7719	N	0.19112	0.55	0.80722	D	1	P;B	0.50710	0.938;0.196	B;B	0.41466	0.358;0.01	D	0.91215	0.5002	10	0.51188	T	0.08	-1.2643	15.2825	0.73797	0.0:0.0:1.0:0.0	.	14;14	Q13761-2;B1AJV5	.;.	L	14	ENSP00000382800:S14L;ENSP00000343477:S14L	ENSP00000343477:S14L	S	-	2	0	RUNX3	25163609	1.000000	0.71417	0.996000	0.52242	0.491000	0.33493	5.755000	0.68750	2.677000	0.91161	0.561000	0.74099	TCG	.		0.627	RUNX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009285.1	NM_004350	
SGCZ	137868	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	13959983	13959983	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr8:13959983T>C	ENST00000382080.1	-	7	1361	c.646A>G	c.(646-648)Atc>Gtc	p.I216V	SGCZ_ENST00000421524.2_Missense_Mutation_p.I169V	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	203					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		GCTTCCATGATCAAGGATCTG	0.423																																					p.I216V		.											.	SGCZ	93	0			c.A646G						.						40.0	40.0	40.0					8																	13959983		2203	4300	6503	SO:0001583	missense	137868	exon7			CCATGATCAAGGA	AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.646A>G	8.37:g.13959983T>C	ENSP00000371512:p.Ile216Val	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	8.0	NM_139167	Q6REU0	Missense_Mutation	SNP	ENST00000382080.1	37	CCDS5992.2	.	.	.	.	.	.	.	.	.	.	T	9.378	1.072148	0.20147	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	D;D	0.94376	-3.41;-3.41	5.75	5.75	0.90469	.	0.158750	0.64402	D	0.000019	D	0.84492	0.5484	N	0.10874	0.06	0.23851	N	0.996666	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.71094	-0.4692	10	0.25751	T	0.34	.	10.3754	0.44079	0.0:0.077:0.0:0.923	.	169;216	Q08AT0;Q96LD1-2	.;.	V	216;169	ENSP00000371512:I216V;ENSP00000405224:I169V	ENSP00000371512:I216V	I	-	1	0	SGCZ	14004354	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.636000	0.54317	2.326000	0.78906	0.533000	0.62120	ATC	.		0.423	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167	
SIPA1L3	23094	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38694768	38694768	+	Splice_Site	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr19:38694768G>A	ENST00000222345.6	+	21	5631	c.5122G>A	c.(5122-5124)Gag>Aag	p.E1708K		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1708					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TTTTTCCAGCGAGGAGCCACC	0.622																																					p.E1708K		.											.	SIPA1L3	91	0			c.G5122A						.						44.0	32.0	37.0					19																	38694768		2187	4256	6443	SO:0001630	splice_region_variant	23094	exon21			TCCAGCGAGGAGC	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.5121-1G>A	19.37:g.38694768G>A		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	6.0	NM_015073	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	37	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	G	8.035	0.762542	0.15914	.	.	ENSG00000105738	ENST00000222345	T	0.30714	1.52	4.22	4.22	0.49857	.	0.372336	0.27126	N	0.020804	T	0.17109	0.0411	N	0.16478	0.41	0.46336	D	0.998995	B	0.32128	0.357	B	0.25140	0.058	T	0.06807	-1.0806	10	0.11485	T	0.65	-11.5782	15.4956	0.75646	0.0:0.0:1.0:0.0	.	1708	O60292	SI1L3_HUMAN	K	1708	ENSP00000222345:E1708K	ENSP00000222345:E1708K	E	+	1	0	SIPA1L3	43386608	1.000000	0.71417	0.938000	0.37757	0.036000	0.12997	5.288000	0.65651	2.173000	0.68751	0.491000	0.48974	GAG	.		0.622	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	Missense_Mutation
SKAP2	8935	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	26779584	26779584	+	Splice_Site	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:26779584C>T	ENST00000345317.2	-	5	621		c.e5-1		SKAP2_ENST00000539623.1_Splice_Site|SKAP2_ENST00000489977.1_Splice_Site	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2						B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						AACTGGGCTCCTATGAGAAGT	0.393																																					.		.											.	SKAP2	91	0			c.308-1G>A						.						53.0	50.0	51.0					7																	26779584		2203	4300	6503	SO:0001630	splice_region_variant	8935	exon6			GGGCTCCTATGAG		CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.308-1G>A	7.37:g.26779584C>T		Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	6.0	NM_003930	A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Splice_Site	SNP	ENST00000345317.2	37	CCDS5400.1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.476900	0.63849	.	.	ENSG00000005020	ENST00000345317;ENST00000535331;ENST00000432747	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6854	0.85304	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SKAP2	26746109	1.000000	0.71417	0.999000	0.59377	0.733000	0.41908	4.413000	0.59795	2.665000	0.90641	0.591000	0.81541	.	.		0.393	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214128.1		Intron
SLC1A5	6510	broad.mit.edu;ucsc.edu	37	19	47280545	47280545	+	Silent	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr19:47280545G>A	ENST00000542575.2	-	6	1804	c.1176C>T	c.(1174-1176)ctC>ctT	p.L392L	SLC1A5_ENST00000594991.1_Silent_p.L216L|SLC1A5_ENST00000434726.2_Silent_p.L190L|SLC1A5_ENST00000412532.2_Silent_p.L164L	NM_005628.2	NP_005619.1	Q15758	AAAT_HUMAN	solute carrier family 1 (neutral amino acid transporter), member 5	392					amino acid transport (GO:0006865)|extracellular amino acid transport (GO:0006860)|glutamine transport (GO:0006868)|ion transport (GO:0006811)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-glutamine transmembrane transporter activity (GO:0015186)|L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)|receptor activity (GO:0004872)|sodium:dicarboxylate symporter activity (GO:0017153)|virus receptor activity (GO:0001618)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(2)|stomach(1)	13		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	CGCACTGGAAGAGCGCGGCAC	0.577																																					p.L392L		.											.	SLC1A5	90	0			c.C1176T						.						65.0	57.0	60.0					19																	47280545		2203	4300	6503	SO:0001819	synonymous_variant	6510	exon6			CTGGAAGAGCGCG	U53347	CCDS12692.1, CCDS46125.1, CCDS46126.1	19q13.32	2013-07-15			ENSG00000105281	ENSG00000105281		"""Solute carriers"""	10943	protein-coding gene	gene with protein product		109190		RDRC, M7V1		8702519, 10051606	Standard	NM_005628		Approved	AAAT, ASCT2	uc002pfs.3	Q15758	OTTHUMG00000183434	ENST00000542575.2:c.1176C>T	19.37:g.47280545G>A		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	5.0	NM_005628	A8K9H5|B4DR77|B4DWS4|B7ZB81|D0EYG6|E9PC01|O95720|Q96RL9|Q9BWQ3|Q9UNP2	Silent	SNP	ENST00000542575.2	37	CCDS12692.1																																																																																			.		0.577	SLC1A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466630.1		
SLC2A10	81031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	45354541	45354541	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr20:45354541G>A	ENST00000359271.2	+	2	1116	c.866G>A	c.(865-867)gGg>gAg	p.G289E		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	289					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				ACCGCCATGGGGCTGGTGGAC	0.652																																					p.G289E		.											.	SLC2A10	91	0			c.G866A						.						91.0	87.0	89.0					20																	45354541		2203	4300	6503	SO:0001583	missense	81031	exon2			CCATGGGGCTGGT	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.866G>A	20.37:g.45354541G>A	ENSP00000352216:p.Gly289Glu	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	12.0	NM_030777	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.730922	0.30684	.	.	ENSG00000197496	ENST00000359271	T	0.74106	-0.81	5.76	3.8	0.43715	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.408064	0.28021	N	0.016918	T	0.70254	0.3203	M	0.67397	2.05	0.34626	D	0.719087	B	0.14012	0.009	B	0.17433	0.018	T	0.70633	-0.4818	10	0.33141	T	0.24	-11.7486	11.0217	0.47722	0.071:0.2991:0.6299:0.0	.	289	O95528	GTR10_HUMAN	E	289	ENSP00000352216:G289E	ENSP00000352216:G289E	G	+	2	0	SLC2A10	44787948	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.920000	0.40025	0.775000	0.33450	0.655000	0.94253	GGG	.		0.652	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2		
SMARCAL1	50485	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	217280006	217280006	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:217280006G>C	ENST00000357276.4	+	3	909	c.579G>C	c.(577-579)aaG>aaC	p.K193N	AC098820.2_ENST00000457694.1_RNA|SMARCAL1_ENST00000358207.5_Missense_Mutation_p.K193N	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	193					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		TAGAGGCCAAGACAGCAAAAG	0.517									Schimke Immuno-Osseous Dysplasia																												p.K193N		.											.	SMARCAL1	293	0			c.G579C						.						81.0	80.0	81.0					2																	217280006		2203	4300	6503	SO:0001583	missense	50485	exon3	Familial Cancer Database	SIOD	GGCCAAGACAGCA	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.579G>C	2.37:g.217280006G>C	ENSP00000349823:p.Lys193Asn	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	8.0	NM_014140	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	G	6.363	0.435168	0.12045	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000427645;ENST00000392128	D;D;T;D	0.86497	-2.09;-2.09;1.42;-2.13	5.23	-1.27	0.09347	.	1.164820	0.06015	N	0.650193	T	0.71685	0.3369	N	0.12746	0.255	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.55366	-0.8152	10	0.20046	T	0.44	-0.55	4.1012	0.10014	0.0706:0.2303:0.3447:0.3543	.	193	Q9NZC9	SMAL1_HUMAN	N	193;193;92;57	ENSP00000349823:K193N;ENSP00000350940:K193N;ENSP00000392997:K92N;ENSP00000375974:K57N	ENSP00000349823:K193N	K	+	3	2	SMARCAL1	216988251	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.536000	0.23129	-0.120000	0.11809	-0.226000	0.12346	AAG	.		0.517	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
MIEF2	125170	ucsc.edu;bcgsc.ca	37	17	18166172	18166172	+	Silent	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr17:18166172C>T	ENST00000323019.4	+	2	349	c.138C>T	c.(136-138)gcC>gcT	p.A46A	MIEF2_ENST00000395706.2_Silent_p.A57A|MIEF2_ENST00000395704.4_Silent_p.A46A|MIEF2_ENST00000577216.1_Intron|MIEF2_ENST00000578621.1_Silent_p.A46A|MIEF2_ENST00000395703.4_Silent_p.A46A|MIEF2_ENST00000578174.1_Silent_p.A46A	NM_001144900.1|NM_139162.3	NP_001138372.1|NP_631901.2	Q96C03	MID49_HUMAN	mitochondrial elongation factor 2	46					mitochondrion organization (GO:0007005)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)											CCACCCTGGCCGTGAAGCGGG	0.677																																					p.A57A		.											.	SMCR7	90	0			c.C171T						.						27.0	26.0	26.0					17																	18166172		2199	4299	6498	SO:0001819	synonymous_variant	125170	exon2			CCTGGCCGTGAAG	BC014973	CCDS11193.1, CCDS45624.1, CCDS45625.1	17p11.2	2013-09-23	2013-09-23	2013-09-23	ENSG00000177427	ENSG00000177427			17920	protein-coding gene	gene with protein product		615498	"""Smith-Magenis syndrome chromosome region, candidate 7"""	SMCR7		11997338, 21508961	Standard	NM_001144900		Approved	MGC23130, MiD49	uc010vxq.2	Q96C03	OTTHUMG00000059392	ENST00000323019.4:c.138C>T	17.37:g.18166172C>T		Somatic	78.0	0.0		WXS	Illumina HiSeq	.	12.0	4.0	NM_148886	J3KPT3|Q6ZRD4|Q96N07	Silent	SNP	ENST00000323019.4	37	CCDS11193.1																																																																																			.		0.677	MIEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132060.2	NM_139162	
SPAG5	10615	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	26912926	26912926	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr17:26912926C>A	ENST00000321765.5	-	7	2028	c.1696G>T	c.(1696-1698)Gag>Tag	p.E566*		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	566	Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					TGCCTTGCCTCCTCCCTTTCT	0.498																																					p.E566X		.											.	SPAG5	90	0			c.G1696T						.						225.0	197.0	207.0					17																	26912926		2203	4300	6503	SO:0001587	stop_gained	10615	exon7			TTGCCTCCTCCCT	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.1696G>T	17.37:g.26912926C>A	ENSP00000323300:p.Glu566*	Somatic	206.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	19.0	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Nonsense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	C	41	8.745863	0.98937	.	.	ENSG00000076382	ENST00000321765;ENST00000536674	.	.	.	5.79	3.63	0.41609	.	0.205973	0.34178	N	0.004186	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-6.2652	11.993	0.53186	0.0:0.6638:0.3362:0.0	.	.	.	.	X	566;63	.	ENSP00000323300:E566X	E	-	1	0	SPAG5	23937053	1.000000	0.71417	0.910000	0.35882	0.997000	0.91878	1.684000	0.37649	1.399000	0.46721	0.655000	0.94253	GAG	.		0.498	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
SPHKAP	80309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	228883534	228883534	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:228883534G>A	ENST00000392056.3	-	7	2082	c.2036C>T	c.(2035-2037)tCc>tTc	p.S679F	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S679F	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	679						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTCATCAATGGAATGCCTCAG	0.413																																					p.S679F		.											.	SPHKAP	167	0			c.C2036T						.						257.0	235.0	242.0					2																	228883534		2203	4300	6503	SO:0001583	missense	80309	exon7			TCAATGGAATGCC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2036C>T	2.37:g.228883534G>A	ENSP00000375909:p.Ser679Phe	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	22.0	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591492	0.46214	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.53640	0.61;0.61	5.62	3.77	0.43336	.	0.211818	0.49916	D	0.000127	T	0.66268	0.2772	M	0.68593	2.085	0.49130	D	0.999751	D;D	0.89917	0.994;1.0	P;D	0.74023	0.819;0.982	T	0.70414	-0.4878	10	0.87932	D	0	.	15.5583	0.76216	0.0:0.2613:0.7387:0.0	.	679;679	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	F	679	ENSP00000375909:S679F;ENSP00000339886:S679F	ENSP00000339886:S679F	S	-	2	0	SPHKAP	228591778	1.000000	0.71417	0.993000	0.49108	0.407000	0.30961	2.855000	0.48333	0.788000	0.33755	0.655000	0.94253	TCC	.		0.413	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
TAP1	6890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32816536	32816536	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr6:32816536G>A	ENST00000354258.4	-	7	1800	c.1639C>T	c.(1639-1641)Cgc>Tgc	p.R547C	PSMB9_ENST00000395330.1_Intron|TAPSAR1_ENST00000453426.1_lincRNA|TAP1_ENST00000425148.2_Missense_Mutation_p.R286C	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	547	Involved in peptide-binding site.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	GGTGGGCAGCGAGGGGTGCGG	0.532																																					p.R547C		.											.	TAP1	91	0			c.C1639T						.						130.0	132.0	131.0					6																	32816536		2203	4300	6503	SO:0001583	missense	6890	exon7			GGCAGCGAGGGGT		CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.1639C>T	6.37:g.32816536G>A	ENSP00000346206:p.Arg547Cys	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	8.0	NM_000593	Q16149|Q96CP4	Missense_Mutation	SNP	ENST00000354258.4	37	CCDS4758.1	.	.	.	.	.	.	.	.	.	.	G	8.083	0.772865	0.16051	.	.	ENSG00000168394	ENST00000354258;ENST00000425148	D;D	0.87334	-2.22;-2.24	5.02	-1.79	0.07932	.	1.376040	0.04789	N	0.431351	T	0.66046	0.2750	L	0.47190	1.495	0.09310	N	0.999999	B	0.13145	0.007	B	0.08055	0.003	T	0.51624	-0.8682	10	0.37606	T	0.19	6.0E-4	5.1321	0.14915	0.4823:0.0:0.3802:0.1375	.	547	Q03518	TAP1_HUMAN	C	547;286	ENSP00000346206:R547C;ENSP00000401919:R286C	ENSP00000346206:R547C	R	-	1	0	TAP1	32924514	0.002000	0.14202	0.028000	0.17463	0.681000	0.39784	-0.198000	0.09505	-0.630000	0.05567	0.643000	0.83706	CGC	.		0.532	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	NM_000593	
TCN1	6947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	59620709	59620709	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr11:59620709C>A	ENST00000257264.3	-	8	1311	c.1207G>T	c.(1207-1209)Gaa>Taa	p.E403*	TCN1_ENST00000532419.1_5'Flank	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	403	Cobalamin binding.|Globular C-terminal beta domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTCAGAAGTTCCCAGTAGGTT	0.512																																					p.E403X		.											.	TCN1	92	0			c.G1207T						.						202.0	196.0	198.0					11																	59620709		2201	4295	6496	SO:0001587	stop_gained	6947	exon8			GAAGTTCCCAGTA	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.1207G>T	11.37:g.59620709C>A	ENSP00000257264:p.Glu403*	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	8.0	NM_001062	A8KAC5|Q8WV77	Nonsense_Mutation	SNP	ENST00000257264.3	37	CCDS7978.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.804790	0.90623	.	.	ENSG00000134827	ENST00000257264	.	.	.	5.21	-3.96	0.04106	.	1.180030	0.06487	N	0.733900	.	.	.	.	.	.	0.54753	D	0.999989	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7525	11.2238	0.48871	0.0:0.1833:0.6546:0.1622	.	.	.	.	X	403	.	ENSP00000257264:E403X	E	-	1	0	TCN1	59377285	0.915000	0.31059	0.279000	0.24732	0.856000	0.48823	-0.314000	0.08092	-0.622000	0.05626	-0.182000	0.12963	GAA	.		0.512	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394503.1	NM_001062	
TMEM67	91147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	94800156	94800156	+	Silent	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr8:94800156T>C	ENST00000453321.3	+	14	1555	c.1497T>C	c.(1495-1497)gaT>gaC	p.D499D	TMEM67_ENST00000409623.3_Silent_p.D418D	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	499					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			ATATCAAAGATGCCAACAGCC	0.363																																					p.D499D		.											.	TMEM67	92	0			c.T1497C						.						157.0	140.0	146.0					8																	94800156		2203	4300	6503	SO:0001819	synonymous_variant	91147	exon14			CAAAGATGCCAAC	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.1497T>C	8.37:g.94800156T>C		Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	31.0	NM_153704	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Silent	SNP	ENST00000453321.3	37	CCDS6258.2	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.648910	0.00785	.	.	ENSG00000164953	ENST00000520680	.	.	.	5.94	-3.95	0.04118	.	.	.	.	.	T	0.54046	0.1834	.	.	.	0.51767	D	0.999932	.	.	.	.	.	.	T	0.50792	-0.8786	4	.	.	.	-9.9885	10.5332	0.44988	0.0:0.3893:0.089:0.5217	.	.	.	.	R	107	.	.	C	+	1	0	TMEM67	94869332	0.981000	0.34729	0.006000	0.13384	0.013000	0.08279	0.212000	0.17497	-1.420000	0.02009	-2.549000	0.00178	TGC	.		0.363	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704	
TNF	7124	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31544935	31544935	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr6:31544935G>A	ENST00000449264.2	+	4	498	c.323G>A	c.(322-324)cGg>cAg	p.R108Q		NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor	108					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	CTGAACCGCCGGGCCAATGCC	0.607									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.R108Q		.											.	TNF	1085	0			c.G323A						.						77.0	76.0	77.0					6																	31544935		1510	2708	4218	SO:0001583	missense	7124	exon4	Familial Cancer Database	incl.: Familial Head and Neck Cancer	ACCGCCGGGCCAA	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.323G>A	6.37:g.31544935G>A	ENSP00000398698:p.Arg108Gln	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	5.0	NM_000594	O43647|Q9P1Q2|Q9UIV3	Missense_Mutation	SNP	ENST00000449264.2	37	CCDS4702.1	.	.	.	.	.	.	.	.	.	.	G	1.267	-0.614212	0.03690	.	.	ENSG00000232810	ENST00000449264	D	0.94457	-3.43	5.41	-1.29	0.09288	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.940149	0.09069	N	0.853148	T	0.73969	0.3655	L	0.35542	1.07	0.09310	N	1	P	0.45283	0.855	B	0.32289	0.143	T	0.70022	-0.4986	10	0.22109	T	0.4	.	3.7113	0.08421	0.2526:0.0:0.3388:0.4086	.	108	P01375	TNFA_HUMAN	Q	108	ENSP00000398698:R108Q	ENSP00000398698:R108Q	R	+	2	0	TNF	31652914	0.000000	0.05858	0.004000	0.12327	0.236000	0.25371	0.179000	0.16840	-0.298000	0.08921	-0.251000	0.11542	CGG	.		0.607	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2		
TP53I11	9537	ucsc.edu;bcgsc.ca	37	11	44959105	44959105	+	Splice_Site	SNP	C	C	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr11:44959105C>A	ENST00000533940.1	-	6	793		c.e6+1		TP53I11_ENST00000308212.5_Splice_Site|TP53I11_ENST00000531130.2_Splice_Site|TP53I11_ENST00000395648.3_Splice_Site|TP53I11_ENST00000525680.1_Splice_Site|TP53I11_ENST00000531928.2_Splice_Site	NM_001258320.1	NP_001245249.1	O14683	P5I11_HUMAN	tumor protein p53 inducible protein 11						negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(1)	5						TAAATGCTCACCTGAGCCCCA	0.547																																					.		.											.	TP53I11	227	0			c.188+1G>T						.						76.0	70.0	72.0					11																	44959105		2203	4299	6502	SO:0001630	splice_region_variant	9537	exon5			TGCTCACCTGAGC	AF010315	CCDS7911.1	11p11.2	2005-09-22				ENSG00000175274			16842	protein-coding gene	gene with protein product						9305847	Standard	NM_006034		Approved	PIG11	uc001myk.3	O14683		ENST00000533940.1:c.188+1G>T	11.37:g.44959105C>A		Somatic	222.0	0.0		WXS	Illumina HiSeq	.	48.0	5.0	NM_001258323	Q3ZCS0	Splice_Site	SNP	ENST00000533940.1	37	CCDS7911.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676278	0.67928	.	.	ENSG00000175274	ENST00000395648;ENST00000308212;ENST00000533940;ENST00000525680;ENST00000528473;ENST00000525683;ENST00000525138;ENST00000533443;ENST00000530035;ENST00000527685	.	.	.	3.95	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3735	0.83374	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53I11	44915681	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.149000	0.77396	1.907000	0.55213	0.462000	0.41574	.	.		0.547	TP53I11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389909.1	NM_006034	Intron
TPH2	121278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	72388234	72388234	+	Silent	SNP	A	A	G			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr12:72388234A>G	ENST00000333850.3	+	8	1098	c.957A>G	c.(955-957)gaA>gaG	p.E319E		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	319					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	CATGCCATGAACTCTTGGGAC	0.393																																					p.E319E		.											.	TPH2	93	0			c.A957G						.						156.0	152.0	153.0					12																	72388234		2203	4300	6503	SO:0001819	synonymous_variant	121278	exon8			CCATGAACTCTTG	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.957A>G	12.37:g.72388234A>G		Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	13.0	NM_173353	A6NGA4|Q14CB0	Silent	SNP	ENST00000333850.3	37	CCDS31859.1																																																																																			.		0.393	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230723949	230723949	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:230723949T>A	ENST00000283943.5	-	3	618	c.440A>T	c.(439-441)cAg>cTg	p.Q147L	TRIP12_ENST00000543084.1_Missense_Mutation_p.Q189L|TRIP12_ENST00000389045.3_Intron|TRIP12_ENST00000389044.4_Missense_Mutation_p.Q189L|TRIP12_ENST00000409677.1_Missense_Mutation_p.Q189L	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	147					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTTTCTTTTCTGACTCCGTGA	0.488																																					p.Q147L		.											.	TRIP12	572	0			c.A440T						.						111.0	114.0	113.0					2																	230723949		2203	4300	6503	SO:0001583	missense	9320	exon3			CTTTTCTGACTCC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.440A>T	2.37:g.230723949T>A	ENSP00000283943:p.Gln147Leu	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	21.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.511511	0.64522	.	.	ENSG00000153827	ENST00000283943;ENST00000389044;ENST00000543084;ENST00000409677;ENST00000453485;ENST00000435716;ENST00000428959;ENST00000430954	T;T	0.50001	0.76;0.76	5.71	4.54	0.55810	.	0.055337	0.85682	N	0.000000	T	0.31040	0.0784	N	0.19112	0.55	0.58432	D	0.999991	B;B;B	0.19817	0.0;0.039;0.0	B;B;B	0.18871	0.0;0.023;0.0	T	0.08310	-1.0728	10	0.48119	T	0.1	.	8.1668	0.31230	0.1338:0.0:0.1402:0.726	.	147;189;147	D4HL82;Q14CA3;Q14669	.;.;TRIPC_HUMAN	L	147;189;189;189;17;147;147;189	ENSP00000283943:Q147L;ENSP00000373696:Q189L	ENSP00000283943:Q147L	Q	-	2	0	TRIP12	230432193	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	3.628000	0.54259	0.969000	0.38237	0.455000	0.32223	CAG	.		0.488	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
TUBGCP4	27229	ucsc.edu;bcgsc.ca	37	15	43675659	43675659	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr15:43675659T>C	ENST00000260383.7	+	7	934	c.680T>C	c.(679-681)aTt>aCt	p.I227T	TUBGCP4_ENST00000564079.1_Missense_Mutation_p.I227T|TUBGCP4_ENST00000399460.3_Missense_Mutation_p.I91T			Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	227					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|spindle pole (GO:0000922)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(4)|prostate(2)|upper_aerodigestive_tract(2)	21		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		GATCTGGGCATTGGGGGACTG	0.517																																					p.I227T		.											.	TUBGCP4	93	0			c.T680C						.						58.0	61.0	60.0					15																	43675659		2012	4182	6194	SO:0001583	missense	27229	exon7			TGGGCATTGGGGG	AJ249677	CCDS42030.1, CCDS66745.1	15q15.3	2014-08-12			ENSG00000137822	ENSG00000137822			16691	protein-coding gene	gene with protein product		609610				10562286	Standard	NM_001286414		Approved	76P, FLJ14797	uc001zrn.3	Q9UGJ1	OTTHUMG00000176647	ENST00000260383.7:c.680T>C	15.37:g.43675659T>C	ENSP00000260383:p.Ile227Thr	Somatic	72.0	0.0		WXS	Illumina HiSeq	.	19.0	4.0	NM_014444	B3KNK6|Q969X3|Q9NVF0	Missense_Mutation	SNP	ENST00000260383.7	37		.	.	.	.	.	.	.	.	.	.	T	17.32	3.360554	0.61403	.	.	ENSG00000137822	ENST00000260383;ENST00000399460	T	0.43688	0.94	5.21	5.21	0.72293	.	0.106628	0.64402	D	0.000004	T	0.35970	0.0950	L	0.43152	1.355	0.58432	D	0.999993	B;B	0.20780	0.048;0.005	B;B	0.24006	0.05;0.012	T	0.13469	-1.0508	10	0.17369	T	0.5	-14.3073	14.5495	0.68057	0.0:0.0:0.0:1.0	.	227;227	Q9UGJ1;Q9UGJ1-2	GCP4_HUMAN;.	T	227;91	ENSP00000260383:I227T	ENSP00000260383:I227T	I	+	2	0	TUBGCP4	41462951	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.655000	0.83696	2.088000	0.63022	0.379000	0.24179	ATT	.		0.517	TUBGCP4-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000432970.1	NM_014444	
WISP2	8839	broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	43344036	43344036	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr20:43344036G>A	ENST00000372868.2	+	2	348	c.5G>A	c.(4-6)aGa>aAa	p.R2K	WISP2_ENST00000190983.4_Missense_Mutation_p.R2K|RP11-445H22.4_ENST00000427303.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA|RP11-445H22.4_ENST00000445420.1_RNA|WISP2_ENST00000372865.4_Missense_Mutation_p.R2K			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	2					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				GGGGACATGAGAGGCACACCG	0.607																																					p.R2K		.											.	WISP2	130	0			c.G5A						.						54.0	46.0	49.0					20																	43344036		2202	4299	6501	SO:0001583	missense	8839	exon1			ACATGAGAGGCAC	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.5G>A	20.37:g.43344036G>A	ENSP00000361959:p.Arg2Lys	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	12.0	5.0	NM_003881	B2R9N4|E1P612|Q6PEG3	Missense_Mutation	SNP	ENST00000372868.2	37	CCDS13336.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192622	0.58017	.	.	ENSG00000064205	ENST00000372868;ENST00000372865;ENST00000190983	T;T;T	0.75050	-0.9;-0.14;-0.9	5.0	2.96	0.34315	.	0.186779	0.37623	N	0.002002	T	0.66752	0.2821	L	0.57536	1.79	0.23341	N	0.997875	P;P	0.46784	0.884;0.884	B;B	0.41466	0.358;0.185	T	0.59064	-0.7524	10	0.07990	T	0.79	-13.3955	13.3239	0.60449	0.0:0.2598:0.7402:0.0	.	2;2	Q6PEG3;O76076	.;WISP2_HUMAN	K	2	ENSP00000361959:R2K;ENSP00000361956:R2K;ENSP00000190983:R2K	ENSP00000190983:R2K	R	+	2	0	WISP2	42777450	0.937000	0.31787	0.995000	0.50966	0.926000	0.56050	0.738000	0.26158	0.578000	0.29487	0.655000	0.94253	AGA	.		0.607	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881	
WNT8A	7478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	137426639	137426639	+	Silent	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr5:137426639C>T	ENST00000398754.1	+	6	938	c.933C>T	c.(931-933)agC>agT	p.S311S	WNT8A_ENST00000506684.1_Silent_p.S329S	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	311					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TCATAAGCAGCTGTAACTGCA	0.562																																					p.S311S		.											.	WNT8A	524	0			c.C933T						.						124.0	131.0	129.0					5																	137426639		2128	4247	6375	SO:0001819	synonymous_variant	7478	exon6			AAGCAGCTGTAAC	AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.933C>T	5.37:g.137426639C>T		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	25.0	NM_058244	Q96S51	Silent	SNP	ENST00000398754.1	37	CCDS43368.1																																																																																			.		0.562	WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280395.1	NM_058244	
YME1L1	10730	hgsc.bcm.edu;bcgsc.ca	37	10	27436456	27436456	+	Frame_Shift_Del	DEL	G	G	-	rs369706082		TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr10:27436456delG	ENST00000326799.3	-	3	458	c.310delC	c.(310-312)cgtfs	p.R104fs	YME1L1_ENST00000375972.3_Intron|YME1L1_ENST00000376016.3_Intron|YME1L1_ENST00000477432.1_Frame_Shift_Del_p.R104fs	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	104					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						GGTTCTGGACGGAtgtgccag	0.448																																					p.R104fs		.											.	YME1L1	91	0			c.310delC						.						221.0	176.0	191.0					10																	27436456		2203	4300	6503	SO:0001589	frameshift_variant	10730	exon3			CTGGACGGATGTG	AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.310delC	10.37:g.27436456delG	ENSP00000318480:p.Arg104fs	Somatic	284.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	43.0	NM_139312	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Frame_Shift_Del	DEL	ENST00000326799.3	37	CCDS7152.1																																																																																			.		0.448	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1	NM_139312	
ZNF185	7739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152106689	152106689	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chrX:152106689C>T	ENST00000370268.4	+	15	1227	c.1190C>T	c.(1189-1191)gCa>gTa	p.A397V	ZNF185_ENST00000535861.1_Missense_Mutation_p.A429V|ZNF185_ENST00000318529.8_Missense_Mutation_p.A176V|ZNF185_ENST00000539731.1_Missense_Mutation_p.A400V|ZNF185_ENST00000324823.6_Missense_Mutation_p.A165V|ZNF185_ENST00000449285.2_Missense_Mutation_p.A398V|ZNF185_ENST00000318504.7_Missense_Mutation_p.A338V|ZNF185_ENST00000370270.2_Missense_Mutation_p.A429V			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	397						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CAGGAGGATGCAAAGGCAGAC	0.572																																					p.A429V		.											.	ZNF185	133	0			c.C1286T						.						54.0	55.0	55.0					X																	152106689		2105	4186	6291	SO:0001583	missense	7739	exon16			AGGATGCAAAGGC	AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.1190C>T	X.37:g.152106689C>T	ENSP00000359291:p.Ala397Val	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	26.0	NM_001178106	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Missense_Mutation	SNP	ENST00000370268.4	37	CCDS48184.1	.	.	.	.	.	.	.	.	.	.	C	4.286	0.052232	0.08291	.	.	ENSG00000147394	ENST00000535861;ENST00000539731;ENST00000449285;ENST00000318504;ENST00000535156;ENST00000324823;ENST00000433245;ENST00000370268;ENST00000318529;ENST00000370270;ENST00000436731	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	3.52	-4.25	0.03766	.	2.230900	0.02245	N	0.066102	T	0.25419	0.0618	L	0.40543	1.245	0.09310	N	1	B;B;B;B;B;B;B;B	0.17667	0.004;0.023;0.001;0.002;0.004;0.004;0.003;0.017	B;B;B;B;B;B;B;B	0.15484	0.004;0.013;0.002;0.004;0.004;0.004;0.007;0.005	T	0.24870	-1.0148	10	0.02654	T	1	4.8009	2.39	0.04376	0.1413:0.497:0.1392:0.2226	.	398;338;368;400;429;397;176;160	O15231-3;B8K2L9;B8K2M0;F5GZL4;F5GXF7;O15231;F8W8V7;O15231-2	.;.;.;.;.;ZN185_HUMAN;.;.	V	429;400;398;338;232;165;263;397;176;160;102	ENSP00000440847:A429V;ENSP00000444367:A400V;ENSP00000395228:A398V;ENSP00000312782:A338V;ENSP00000359291:A397V	ENSP00000312782:A338V	A	+	2	0	ZNF185	151857345	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-1.805000	0.01737	-1.312000	0.02306	0.600000	0.82982	GCA	.		0.572	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150	
ZNF398	57541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	148863347	148863347	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:148863347A>G	ENST00000475153.1	+	3	785	c.518A>G	c.(517-519)aAg>aGg	p.K173R	ZNF398_ENST00000483892.1_Missense_Mutation_p.K2R|ZNF398_ENST00000491174.1_Missense_Mutation_p.K2R|ZNF398_ENST00000420008.2_Missense_Mutation_p.K2R|ZNF398_ENST00000426851.2_Missense_Mutation_p.K2R|ZNF398_ENST00000335901.4_Missense_Mutation_p.K2R|ZNF398_ENST00000540950.1_Missense_Mutation_p.K178R			Q8TD17	ZN398_HUMAN	zinc finger protein 398	173	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			AATATCATGAAGGGCAACTAC	0.453																																					p.K173R		.											.	ZNF398	91	0			c.A518G						.						139.0	134.0	136.0					7																	148863347		2203	4300	6503	SO:0001583	missense	57541	exon3			TCATGAAGGGCAA	AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.518A>G	7.37:g.148863347A>G	ENSP00000420418:p.Lys173Arg	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	25.0	NM_170686	A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Missense_Mutation	SNP	ENST00000475153.1	37	CCDS5894.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.299033	0.60195	.	.	ENSG00000197024	ENST00000426851;ENST00000420008;ENST00000475153;ENST00000483892;ENST00000491174;ENST00000540950;ENST00000335901	T;T;T;T;T;T;T	0.05717	3.4;3.4;4.72;3.4;3.4;4.72;3.4	5.24	5.24	0.73138	Krueppel-associated box (4);	0.000000	0.48767	D	0.000177	T	0.07324	0.0185	N	0.01352	-0.895	0.33048	D	0.532414	D;P	0.69078	0.997;0.543	D;B	0.79108	0.992;0.306	T	0.49952	-0.8884	10	0.62326	D	0.03	-23.2364	13.1015	0.59222	1.0:0.0:0.0:0.0	.	178;173	B4DXA9;Q8TD17	.;ZN398_HUMAN	R	2;2;173;2;2;178;2	ENSP00000389972:K2R;ENSP00000416751:K2R;ENSP00000420418:K173R;ENSP00000418564:K2R;ENSP00000419391:K2R;ENSP00000439340:K178R;ENSP00000338984:K2R	ENSP00000338984:K2R	K	+	2	0	ZNF398	148494280	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.923000	0.48868	1.979000	0.57680	0.460000	0.39030	AAG	.		0.453	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352722.2		
ZNF667	63934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56952618	56952618	+	Silent	SNP	G	G	A			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr19:56952618G>A	ENST00000504904.3	-	7	2465	c.1746C>T	c.(1744-1746)ccC>ccT	p.P582P	ZNF667_ENST00000292069.6_Silent_p.P582P|ZNF667_ENST00000342634.3_Silent_p.P710P|ZNF667_ENST00000591790.1_3'UTR			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	582					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		TACATTCATAGGGTTTCTCTG	0.393																																					p.P582P		.											.	ZNF667	91	0			c.C1746T						.						119.0	115.0	116.0					19																	56952618		2203	4300	6503	SO:0001819	synonymous_variant	63934	exon5			TTCATAGGGTTTC		CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.1746C>T	19.37:g.56952618G>A		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	11.0	NM_022103	B2RMS6|B9EK36|Q6B093|Q9H807	Silent	SNP	ENST00000504904.3	37	CCDS12944.1																																																																																			.		0.393	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458394.1	NM_022103	
ZNF70	7621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24086004	24086004	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr22:24086004A>T	ENST00000341976.3	-	2	1784	c.1324T>A	c.(1324-1326)Tct>Act	p.S442T		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						TTCTCCCCAGAATGAATCTTC	0.537																																					p.S442T		.											.	ZNF70	92	0			c.T1324A						.						105.0	111.0	109.0					22																	24086004		2203	4300	6503	SO:0001583	missense	7621	exon2			CCCCAGAATGAAT	X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.1324T>A	22.37:g.24086004A>T	ENSP00000339314:p.Ser442Thr	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	23.0	NM_021916		Missense_Mutation	SNP	ENST00000341976.3	37	CCDS13812.1	.	.	.	.	.	.	.	.	.	.	A	0.018	-1.471305	0.01044	.	.	ENSG00000187792	ENST00000341976	T	0.07688	3.17	3.55	2.53	0.30540	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02193	0.0068	N	0.01529	-0.815	0.22142	N	0.999333	B	0.02656	0.0	B	0.01281	0.0	T	0.45731	-0.9241	9	0.02654	T	1	.	4.3065	0.10949	0.2421:0.6393:0.0:0.1186	.	442	Q9UC06	ZNF70_HUMAN	T	442	ENSP00000339314:S442T	ENSP00000339314:S442T	S	-	1	0	ZNF70	22416004	0.000000	0.05858	0.482000	0.27366	0.419000	0.31324	-1.198000	0.03035	1.068000	0.40764	-0.406000	0.06334	TCT	.		0.537	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319881.1	NM_021916	
ZNF804B	219578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	88964537	88964537	+	Silent	SNP	C	C	T			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr7:88964537C>T	ENST00000333190.4	+	4	2850	c.2241C>T	c.(2239-2241)caC>caT	p.H747H		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	747							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AAAGAGAACACCACTCAGTTG	0.413										HNSCC(36;0.09)																											p.H747H		.											.	ZNF804B	101	0			c.C2241T						.						86.0	79.0	81.0					7																	88964537		2203	4300	6503	SO:0001819	synonymous_variant	219578	exon4			AGAACACCACTCA	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2241C>T	7.37:g.88964537C>T		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	6.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Silent	SNP	ENST00000333190.4	37	CCDS5613.1																																																																																			.		0.413	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
MEIS3	56917	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	47912456	47912457	+	Missense_Mutation	DNP	TC	TC	AG			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	TC	TC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr19:47912456_47912457TC>AG	ENST00000558555.1	-	8	944_945	c.757_758GA>CT	c.(757-759)GAt>CTt	p.D253L	MEIS3_ENST00000559524.1_Missense_Mutation_p.D253L|MEIS3_ENST00000331559.5_Missense_Mutation_p.D236L|MEIS3_ENST00000560253.1_5'UTR|MEIS3_ENST00000561096.1_Missense_Mutation_p.D341L|MEIS3_ENST00000561293.1_Missense_Mutation_p.D253L|MEIS3_ENST00000441740.2_Missense_Mutation_p.D236L			Q99687	MEIS3_HUMAN	Meis homeobox 3	253	Asp/Glu-rich (acidic).				negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		CAAGTCCTCATCTTCTCCACCA	0.599																																					p.D341L		.											.	.	.	0			.						.																																			SO:0001583	missense	56917	.			TCCTCATCTTCTC	BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.757_758delinsAG	19.37:g.47912456_47912457delinsAG	ENSP00000454073:p.Asp253Leu	Somatic	93.0	0.0		WXS	Illumina GAIIx	Phase_I	19.0	4.0	.	A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	DNP	ENST00000558555.1	37																																																																																				.		0.599	MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000417642.1	XM_085929	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32724674	32724675	+	Silent	DNP	TC	TC	AT			TCGA-EP-A2KC-01A-11D-A20W-10	TCGA-EP-A2KC-10A-01D-A20W-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0fa04a7-a506-4a22-b41f-ee8b13a9d83c	da91c6e7-c91e-4c80-bb15-8e0cd4881866	g.chr2:32724674_32724675TC>AT	ENST00000421745.2	+	46	8663_8664	c.8529_8530TC>AT	c.(8527-8532)acTCtg>acATtg	p.2843_2844TL>TL		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2843					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TAGAATTCACTCTGGAGCAGAA	0.446																																					p.F2842F	Pancreas(94;175 1509 16028 18060 45422)	.											.	.	.	0			.						.																																			SO:0001819	synonymous_variant	57448	.			ATTCACTCTGGAG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	Exception_encountered	2.37:g.32724674_32724675delinsAT		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	9.0	.	Q9ULD1	Silent	DNP	ENST00000421745.2	37	CCDS33175.2																																																																																			.		0.446	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
