#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACOX1	51	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73975154	73975154	+	Start_Codon_SNP	SNP	T	T	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr17:73975154T>G	ENST00000301608.4	-	1	61	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	TEN1_ENST00000397640.1_5'Flank|TEN1_ENST00000416485.1_5'Flank|ACOX1_ENST00000591857.1_5'UTR|ACOX1_ENST00000293217.5_Start_Codon_SNP_p.M1L|ACOX1_ENST00000537812.1_5'UTR|TEN1_ENST00000588202.1_5'Flank|TEN1-CDK3_ENST00000567351.1_RNA	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	1					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	TCCGGGTTCATGGCGACGACC	0.662																																					p.M1L		.											.	ACOX1	91	0			c.A1C						.						44.0	45.0	45.0					17																	73975154		2203	4300	6503	SO:0001582	initiator_codon_variant	51	exon1			GGTTCATGGCGAC	U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.1A>C	17.37:g.73975154T>G	ENSP00000301608:p.Met1Leu	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	8.0	NM_007292	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	ENST00000301608.4	37	CCDS11735.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.661759	0.67700	.	.	ENSG00000161533	ENST00000301608;ENST00000293217;ENST00000539791	T;T	0.58506	0.33;2.97	4.74	3.66	0.41972	Acyl-CoA dehydrogenase/oxidase (1);	0.081695	0.85682	D	0.000000	T	0.51312	0.1667	.	.	.	0.80722	D	1	B;P	0.39903	0.413;0.694	B;B	0.40410	0.139;0.328	T	0.52162	-0.8612	9	0.62326	D	0.03	-18.5528	9.23	0.37430	0.0:0.1543:0.0:0.8457	.	1;1	Q15067;Q15067-2	ACOX1_HUMAN;.	L	1	ENSP00000301608:M1L;ENSP00000293217:M1L	ENSP00000293217:M1L	M	-	1	0	ACOX1	71486749	1.000000	0.71417	0.969000	0.41365	0.566000	0.35808	3.817000	0.55668	0.829000	0.34733	0.523000	0.50628	ATG	.		0.662	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439503.1		Missense_Mutation
ACTR1A	10121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	104247919	104247919	+	Silent	SNP	A	A	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr10:104247919A>C	ENST00000369905.4	-	4	366	c.303T>G	c.(301-303)acT>acG	p.T101T	ACTR1A_ENST00000487599.1_Silent_p.T101T|ACTR1A_ENST00000446605.2_Silent_p.T54T|ACTR1A_ENST00000545684.1_Silent_p.T27T	NM_005736.3	NP_005727.1	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)	101					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|microtubule associated complex (GO:0005875)	ATP binding (GO:0005524)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	13		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		CCTCTGAGAAAGTCTGCAGCT	0.493																																					p.T101T		.											.	ACTR1A	90	0			c.T303G						.						145.0	120.0	129.0					10																	104247919		2203	4300	6503	SO:0001819	synonymous_variant	10121	exon4			TGAGAAAGTCTGC	X82206	CCDS7536.1	10q24	2008-07-08	2001-11-28		ENSG00000138107	ENSG00000138107			167	protein-coding gene	gene with protein product		605143	"""ARP1 (actin-related protein 1, yeast) homolog A (centractin alpha)"""			1528266	Standard	NM_005736		Approved	ARP1	uc001kvv.3	P61163	OTTHUMG00000018956	ENST00000369905.4:c.303T>G	10.37:g.104247919A>C		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	17.0	NM_005736	B2R6B0|P42024	Silent	SNP	ENST00000369905.4	37	CCDS7536.1																																																																																			.		0.493	ACTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050053.1		
ADAMTSL3	57188	ucsc.edu;bcgsc.ca	37	15	84611387	84611387	+	Silent	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr15:84611387T>C	ENST00000286744.5	+	18	2381	c.2157T>C	c.(2155-2157)tgT>tgC	p.C719C	ADAMTSL3_ENST00000567476.1_Silent_p.C719C	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	719	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			CAGCTACCTGTGGAGTTGGAA	0.542																																					p.C719C		.											.	ADAMTSL3	1153	0			c.T2157C						.						93.0	94.0	94.0					15																	84611387		2203	4300	6503	SO:0001819	synonymous_variant	57188	exon18			TACCTGTGGAGTT	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2157T>C	15.37:g.84611387T>C		Somatic	60.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_207517	A1A566|A1A567|Q9ULI7	Silent	SNP	ENST00000286744.5	37	CCDS10326.1																																																																																			.		0.542	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
ADD3	120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	111883814	111883814	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr10:111883814C>G	ENST00000356080.4	+	10	1550	c.1183C>G	c.(1183-1185)Cga>Gga	p.R395G	ADD3_ENST00000277900.8_Missense_Mutation_p.R395G|ADD3_ENST00000360162.3_Missense_Mutation_p.R395G	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	395						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		TCCTCTCATTCGAGAGAAGCC	0.448																																					p.R395G		.											.	ADD3	157	0			c.C1183G						.						110.0	96.0	101.0					10																	111883814		2203	4300	6503	SO:0001583	missense	120	exon10			CTCATTCGAGAGA	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.1183C>G	10.37:g.111883814C>G	ENSP00000348381:p.Arg395Gly	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	22.0	NM_001121	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	37	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126136	0.77549	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.25250	1.81;1.81;1.81	6.03	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.52175	0.1718	M	0.80982	2.52	0.80722	D	1	D;D	0.71674	0.998;0.994	D;D	0.71870	0.975;0.954	T	0.55276	-0.8166	10	0.87932	D	0	-8.6307	14.5785	0.68268	0.2131:0.7869:0.0:0.0	.	395;395	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	G	395	ENSP00000353286:R395G;ENSP00000348381:R395G;ENSP00000277900:R395G	ENSP00000277900:R395G	R	+	1	2	ADD3	111873804	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.951000	0.56684	2.861000	0.98227	0.655000	0.94253	CGA	.		0.448	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	
ALB	213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74274387	74274388	+	Frame_Shift_Ins	INS	-	-	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr4:74274387_74274388insA	ENST00000295897.4	+	4	436_437	c.347_348insA	c.(346-351)gcaaaafs	p.AK116fs	ALB_ENST00000505649.1_3'UTR|ALB_ENST00000509063.1_Frame_Shift_Ins_p.AK116fs|ALB_ENST00000415165.2_Intron|ALB_ENST00000401494.3_Intron|ALB_ENST00000503124.1_Intron	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GACTGCTGTGCAAAACAAGAAC	0.441																																					p.A116fs		.											.	ALB	96	0			c.347_348insA						.																																			SO:0001589	frameshift_variant	213	exon4			GCTGTGCAAAACA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.351dupA	4.37:g.74274391_74274391dupA	ENSP00000295897:p.Ala116fs	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	19.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Ins	INS	ENST00000295897.4	37	CCDS3555.1																																																																																			.		0.441	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	
ALOX5	240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	45939709	45939709	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr10:45939709C>T	ENST00000374391.2	+	13	1873	c.1820C>T	c.(1819-1821)gCg>gTg	p.A607V	ALOX5_ENST00000542434.1_Intron|RP11-67C2.2_ENST00000435635.1_RNA	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	607	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	GCAGTGTGGGCGCTGAGCCAG	0.667																																					p.A607V		.											.	ALOX5	228	0			c.C1820T						.						14.0	14.0	14.0					10																	45939709		2144	4213	6357	SO:0001583	missense	240	exon13			TGTGGGCGCTGAG	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1820C>T	10.37:g.45939709C>T	ENSP00000363512:p.Ala607Val	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	11.0	NM_000698	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.102526	0.56183	.	.	ENSG00000012779	ENST00000374391	D	0.89196	-2.48	4.91	4.91	0.64330	Lipoxygenase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.89392	0.6702	L	0.35249	1.045	0.80722	D	1	D;D	0.89917	0.999;1.0	P;P	0.60236	0.846;0.871	D	0.87271	0.2286	10	0.27082	T	0.32	-34.4302	15.6441	0.77033	0.0:1.0:0.0:0.0	.	575;607	E5FPY8;P09917	.;LOX5_HUMAN	V	607	ENSP00000363512:A607V	ENSP00000363512:A607V	A	+	2	0	ALOX5	45259715	1.000000	0.71417	0.972000	0.41901	0.990000	0.78478	7.651000	0.83577	2.559000	0.86315	0.650000	0.86243	GCG	.		0.667	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		
ANKRD24	170961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4224480	4224480	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr19:4224480G>C	ENST00000600132.1	+	22	3695	c.3419G>C	c.(3418-3420)aGa>aCa	p.R1140T	ANKRD24_ENST00000318934.4_Missense_Mutation_p.R1140T|ANKRD24_ENST00000262970.5_Missense_Mutation_p.R1230T	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	1140										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		CAGATGCAGAGACTCCAGGCT	0.617																																					p.R1140T		.											.	ANKRD24	68	0			c.G3419C						.						45.0	52.0	50.0					19																	4224480		2105	4240	6345	SO:0001583	missense	170961	exon22			TGCAGAGACTCCA	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.3419G>C	19.37:g.4224480G>C	ENSP00000471252:p.Arg1140Thr	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	15.0	NM_133475	O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	37	CCDS45925.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645540	0.67358	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.36340	1.28;1.26	5.39	5.39	0.77823	.	.	.	.	.	T	0.47229	0.1434	L	0.44542	1.39	0.09310	N	1	D	0.53885	0.963	P	0.55749	0.783	T	0.39078	-0.9631	9	0.66056	D	0.02	.	14.6299	0.68647	0.0:0.0:1.0:0.0	.	1140	Q8TF21	ANR24_HUMAN	T	1140;1230	ENSP00000321731:R1140T;ENSP00000262970:R1230T	ENSP00000262970:R1230T	R	+	2	0	ANKRD24	4175480	0.199000	0.23386	0.008000	0.14137	0.957000	0.61999	3.193000	0.50997	2.542000	0.85734	0.484000	0.47621	AGA	.		0.617	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
ARG1	383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	131904974	131904974	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr6:131904974A>G	ENST00000368087.3	+	8	1034	c.895A>G	c.(895-897)Ata>Gta	p.I299V	MED23_ENST00000479213.1_5'Flank|ARG1_ENST00000356962.2_Missense_Mutation_p.I307V|MED23_ENST00000354577.4_Intron			P05089	ARGI1_HUMAN	arginase 1	299					arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|liver development (GO:0001889)|lung development (GO:0030324)|mammary gland involution (GO:0060056)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of endothelial cell proliferation (GO:0001938)|protein homotrimerization (GO:0070207)|regulation of L-arginine import (GO:0010963)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to herbicide (GO:0009635)|response to manganese ion (GO:0010042)|response to methylmercury (GO:0051597)|response to selenium ion (GO:0010269)|response to vitamin A (GO:0033189)|response to vitamin E (GO:0033197)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	arginase activity (GO:0004053)|manganese ion binding (GO:0030145)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|skin(3)	14	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0106)|OV - Ovarian serous cystadenocarcinoma(155;0.0713)	L-Ornithine(DB00129)	AGCAGTTGCAATAACCTTGGC	0.443																																					p.I307V		.											.	ARG1	91	0			c.A919G						.						149.0	129.0	136.0					6																	131904974		2203	4300	6503	SO:0001583	missense	383	exon8			GTTGCAATAACCT		CCDS5145.1, CCDS59038.1	6q23	2013-05-01	2013-05-01		ENSG00000118520	ENSG00000118520	3.5.3.1		663	protein-coding gene	gene with protein product		608313	"""arginase, liver"""			22959135	Standard	NM_000045		Approved		uc003qcp.2	P05089	OTTHUMG00000015566	ENST00000368087.3:c.895A>G	6.37:g.131904974A>G	ENSP00000357066:p.Ile299Val	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	44.0	NM_001244438	A6NEA0|Q5JWT5|Q5JWT6|Q8TE72|Q9BS50	Missense_Mutation	SNP	ENST00000368087.3	37	CCDS5145.1	.	.	.	.	.	.	.	.	.	.	A	0.286	-0.983316	0.02180	.	.	ENSG00000118520	ENST00000368087;ENST00000356962;ENST00000476845	D;D;D	0.87029	-1.79;-1.79;-2.2	6.01	-12.0	0.00017	Ureohydrolase domain (1);	0.478827	0.24642	N	0.036796	T	0.29288	0.0729	N	0.01515	-0.825	0.58432	D	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.60525	-0.7246	10	0.13470	T	0.59	-0.439	4.1367	0.10174	0.2305:0.1302:0.4215:0.2178	.	307;299	P05089-2;P05089	.;ARGI1_HUMAN	V	299;307;213	ENSP00000357066:I299V;ENSP00000349446:I307V;ENSP00000417694:I213V	ENSP00000349446:I307V	I	+	1	0	ARG1	131946667	0.000000	0.05858	0.000000	0.03702	0.813000	0.45954	-2.288000	0.01150	-3.324000	0.00187	-0.911000	0.02809	ATA	.		0.443	ARG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042223.1		
ATXN7	6314	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	3	63898497	63898497	+	Missense_Mutation	SNP	A	A	G	rs199663915	byFrequency	TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr3:63898497A>G	ENST00000295900.6	+	3	773	c.223A>G	c.(223-225)Atg>Gtg	p.M75V	ATXN7_ENST00000398590.3_Missense_Mutation_p.M75V|ATXN7_ENST00000538065.1_Missense_Mutation_p.M75V|ATXN7_ENST00000487717.1_Missense_Mutation_p.M75V	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	75					cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		GGCCGCCGCAATGGCGACGGT	0.721													A|||	23	0.00459265	0.0174	0.0	5008	,	,		3795	0.0		0.0	False		,,,				2504	0.0				p.M75V		.											.	ATXN7	90	0			c.A223G						.	A	VAL/MET,VAL/MET	44,3748		0,44,1852	35.0	38.0	37.0		223,223	3.8	1.0	3	dbSNP_134	37	0,8184		0,0,4092	yes	missense,missense	ATXN7	NM_000333.3,NM_001177387.1	21,21	0,44,5944	GG,GA,AA		0.0,1.1603,0.3674	possibly-damaging,possibly-damaging	75/893,75/946	63898497	44,11932	1896	4092	5988	SO:0001583	missense	6314	exon3			GCCGCAATGGCGA	AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.223A>G	3.37:g.63898497A>G	ENSP00000295900:p.Met75Val	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	15.0	NM_000333	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	ENST00000295900.6	37	CCDS43102.1	9	0.004120879120879121	9	0.018292682926829267	0	0.0	0	0.0	0	0.0	A	18.15	3.559892	0.65538	0.011603	0.0	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000539129	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	3.79	3.79	0.43588	.	0.000000	0.85682	U	0.000000	T	0.32912	0.0845	L	0.60455	1.87	0.58432	D	0.999999	D;P	0.56035	0.974;0.956	D;D	0.70487	0.969;0.931	T	0.41233	-0.9520	10	0.72032	D	0.01	-6.2461	12.549	0.56216	1.0:0.0:0.0:0.0	.	75;75	O15265-2;O15265	.;ATX7_HUMAN	V	75	ENSP00000381590:M75V;ENSP00000295900:M75V;ENSP00000420234:M75V;ENSP00000439585:M75V	ENSP00000295900:M75V	M	+	1	0	ATXN7	63873537	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	7.561000	0.82288	1.343000	0.45638	0.377000	0.23210	ATG	A|0.996;G|0.004		0.721	ATXN7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352070.1	NM_000333	
BARD1	580	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	215646146	215646146	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:215646146C>T	ENST00000260947.4	-	4	586	c.452G>A	c.(451-453)aGt>aAt	p.S151N	BARD1_ENST00000449967.2_Missense_Mutation_p.S7N|BARD1_ENST00000471787.1_5'UTR	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	151					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GACTTTCTTACTTCGAGGGCT	0.348									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.S151N		.											.	BARD1	415	0			c.G452A						.						101.0	102.0	101.0					2																	215646146		2203	4300	6503	SO:0001583	missense	580	exon4	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	TTCTTACTTCGAG		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.452G>A	2.37:g.215646146C>T	ENSP00000260947:p.Ser151Asn	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	7.0	NM_000465	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Missense_Mutation	SNP	ENST00000260947.4	37	CCDS2397.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515707	0.85389	.	.	ENSG00000138376	ENST00000260947;ENST00000449967	T;T	0.76968	-1.06;-1.05	6.05	6.05	0.98169	.	0.044664	0.85682	D	0.000000	D	0.87124	0.6099	M	0.74258	2.255	0.43959	D	0.996638	D;D	0.76494	0.999;0.999	D;D	0.68353	0.947;0.957	D	0.86525	0.1818	10	0.49607	T	0.09	-16.3037	16.0133	0.80420	0.0:0.8664:0.1336:0.0	.	7;151	E7EUI3;Q99728	.;BARD1_HUMAN	N	151;7	ENSP00000260947:S151N;ENSP00000406752:S7N	ENSP00000260947:S151N	S	-	2	0	BARD1	215354391	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.432000	0.52824	2.878000	0.98634	0.650000	0.86243	AGT	.		0.348	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256602.1	NM_000465	
BPTF	2186	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65822352	65822352	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr17:65822352A>G	ENST00000321892.4	+	1	573	c.512A>G	c.(511-513)gAt>gGt	p.D171G	BPTF_ENST00000424123.3_Missense_Mutation_p.D32G|BPTF_ENST00000335221.5_Missense_Mutation_p.D171G|BPTF_ENST00000306378.6_Missense_Mutation_p.D171G			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	171	Asp-rich.|Glu-rich.				anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GAGGACGACGATGACTCCGAT	0.587																																					p.D171G		.											.	BPTF	94	0			c.A512G						.						98.0	88.0	91.0					17																	65822352		2203	4300	6503	SO:0001583	missense	2186	exon1			ACGACGATGACTC	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.512A>G	17.37:g.65822352A>G	ENSP00000315454:p.Asp171Gly	Somatic	222.0	1.0		WXS	Illumina HiSeq	Phase_I	114.0	17.0	NM_004459	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	A	9.944	1.218237	0.22373	.	.	ENSG00000171634	ENST00000544491;ENST00000306378;ENST00000335221;ENST00000321892;ENST00000544778	T;T;T	0.81163	-1.46;-1.46;-1.46	2.65	2.65	0.31530	.	.	.	.	.	T	0.70245	0.3202	L	0.43923	1.385	0.36727	D	0.881507	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.08055	0.0;0.003;0.003	T	0.69833	-0.5038	9	0.54805	T	0.06	-0.7897	5.7788	0.18294	0.8681:0.0:0.1319:0.0	.	171;171;171	Q12830;Q12830-2;Q12830-4	BPTF_HUMAN;.;.	G	76;171;171;171;32	ENSP00000307208:D171G;ENSP00000334351:D171G;ENSP00000315454:D171G	ENSP00000307208:D171G	D	+	2	0	BPTF	63252814	1.000000	0.71417	0.412000	0.26496	0.877000	0.50540	5.870000	0.69620	1.217000	0.43442	0.254000	0.18369	GAT	.		0.587	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
C5orf42	65250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	37226698	37226698	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr5:37226698T>A	ENST00000508244.1	-	11	2092	c.1999A>T	c.(1999-2001)Act>Tct	p.T667S	C5orf42_ENST00000425232.2_Missense_Mutation_p.T667S|C5orf42_ENST00000274258.7_5'UTR			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	667						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AGTTTTACAGTATTTGAGGTC	0.318																																					p.T667S		.											.	C5orf42	94	0			c.A1999T						.						37.0	30.0	32.0					5																	37226698		692	1591	2283	SO:0001583	missense	65250	exon12			TTACAGTATTTGA		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.1999A>T	5.37:g.37226698T>A	ENSP00000421690:p.Thr667Ser	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	41.0	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	16.45	3.125779	0.56721	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	D;D	0.98381	-4.9;-4.9	5.22	4.06	0.47325	.	0.158419	0.41712	U	0.000829	D	0.98333	0.9447	M	0.73598	2.24	0.80722	D	1	D	0.61697	0.99	P	0.61722	0.893	D	0.97907	1.0306	10	0.54805	T	0.06	-8.2488	10.8567	0.46802	0.0:0.0745:0.0:0.9255	.	667	E9PH94	.	S	667	ENSP00000421690:T667S;ENSP00000389014:T667S	ENSP00000389014:T667S	T	-	1	0	C5orf42	37262455	1.000000	0.71417	0.575000	0.28536	0.957000	0.61999	3.508000	0.53378	0.831000	0.34780	0.482000	0.46254	ACT	.		0.318	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
CCDC141	285025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179753268	179753268	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:179753268C>A	ENST00000409284.1	-	9	1510	c.1393G>T	c.(1393-1395)Ggt>Tgt	p.G465C	CCDC141_ENST00000420890.2_Missense_Mutation_p.G465C			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	465										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CGTAGGTAACCCTCCACTGAG	0.443																																					p.G465C		.											.	CCDC141	78	0			c.G1393T						.																																			SO:0001583	missense	285025	exon9			GGTAACCCTCCAC	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000409284.1:c.1393G>T	2.37:g.179753268C>A	ENSP00000386503:p.Gly465Cys	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	19.0	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000409284.1	37		.	.	.	.	.	.	.	.	.	.	C	17.30	3.354473	0.61293	.	.	ENSG00000163492	ENST00000420890;ENST00000443758;ENST00000446116;ENST00000409284	T;T	0.46063	0.88;1.49	5.76	3.97	0.46021	.	.	.	.	.	T	0.50871	0.1641	L	0.54323	1.7	0.80722	D	1	D	0.63880	0.993	P	0.55667	0.781	T	0.51252	-0.8729	9	0.62326	D	0.03	.	11.6381	0.51215	0.0:0.8536:0.0:0.1464	.	465	B8ZZB3	.	C	465;465;400;465	ENSP00000395995:G465C;ENSP00000390190:G465C	ENSP00000386503:G465C	G	-	1	0	CCDC141	179461513	0.979000	0.34478	0.712000	0.30502	0.958000	0.62258	3.470000	0.53100	0.775000	0.33450	0.563000	0.77884	GGT	.		0.443	CCDC141-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000335873.1	NM_173648	
CCDC36	339834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49294178	49294178	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr3:49294178G>A	ENST00000438782.1	+	8	1484	c.1248G>A	c.(1246-1248)atG>atA	p.M416I	CCDC36_ENST00000296449.5_Missense_Mutation_p.M416I|CCDC36_ENST00000452691.2_Missense_Mutation_p.M416I			Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	416										endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|urinary_tract(3)	14				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		CCCAAAGTATGTTTTTGTGTG	0.463																																					p.M416I		.											.	CCDC36	92	0			c.G1248A						.						102.0	105.0	104.0					3																	49294178		2203	4300	6503	SO:0001583	missense	339834	exon8			AAGTATGTTTTTG	AK058049	CCDS33755.2	3p21.31	2009-08-06			ENSG00000173421	ENSG00000173421			27945	protein-coding gene	gene with protein product	"""cancer/testis antigen 74"""						Standard	NM_178173		Approved	FLJ25320, CT74	uc011bck.1	Q8IYA8	OTTHUMG00000155920	ENST00000438782.1:c.1248G>A	3.37:g.49294178G>A	ENSP00000391788:p.Met416Ile	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	17.0	NM_001135197	C9JJL0|Q05DG9|Q96LP7	Missense_Mutation	SNP	ENST00000438782.1	37	CCDS33755.2	.	.	.	.	.	.	.	.	.	.	G	14.33	2.503317	0.44558	.	.	ENSG00000173421	ENST00000296449;ENST00000438782;ENST00000452691;ENST00000309062	T;T;T	0.41065	1.01;1.01;1.01	5.14	0.046	0.14232	.	1.023130	0.07771	N	0.951799	T	0.24122	0.0584	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.22661	-1.0210	10	0.28530	T	0.3	3.69	4.2145	0.10528	0.3871:0.1664:0.4465:0.0	.	416	Q8IYA8	CCD36_HUMAN	I	416;416;416;396	ENSP00000296449:M416I;ENSP00000391788:M416I;ENSP00000407837:M416I	ENSP00000296449:M416I	M	+	3	0	CCDC36	49269182	0.000000	0.05858	0.000000	0.03702	0.974000	0.67602	-0.161000	0.10026	0.092000	0.17331	0.655000	0.94253	ATG	.		0.463	CCDC36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342332.1	NM_178173	
CD200R1L	344807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	112548190	112548190	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr3:112548190T>C	ENST00000398214.1	-	2	313	c.88A>G	c.(88-90)Aac>Gac	p.N30D	CD200R1L_ENST00000448932.1_Missense_Mutation_p.N9D|CD200R1L_ENST00000488794.1_Missense_Mutation_p.N9D	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	30						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						GTTGAATAGTTCTGTGTCATC	0.388																																					p.N30D		.											.	CD200R1L	91	0			c.A88G						.						145.0	139.0	141.0					3																	112548190		2148	4279	6427	SO:0001583	missense	344807	exon2			AATAGTTCTGTGT	AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.88A>G	3.37:g.112548190T>C	ENSP00000381272:p.Asn30Asp	Somatic	231.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	34.0	NM_001008784	Q6WHB7	Missense_Mutation	SNP	ENST00000398214.1	37	CCDS43131.1	.	.	.	.	.	.	.	.	.	.	T	12.25	1.880352	0.33162	.	.	ENSG00000206531	ENST00000398214;ENST00000488794;ENST00000448932	T;T;T	0.19250	2.16;2.2;2.2	1.71	0.348	0.16026	.	0.868493	0.09575	N	0.783729	T	0.22859	0.0552	L	0.55834	1.745	0.09310	N	1	D	0.57257	0.979	P	0.49999	0.628	T	0.17684	-1.0361	10	0.24483	T	0.36	.	3.8221	0.08839	0.0:0.2132:0.0:0.7868	.	30	Q6Q8B3	MO2R2_HUMAN	D	30;9;9	ENSP00000381272:N30D;ENSP00000418413:N9D;ENSP00000415132:N9D	ENSP00000381272:N30D	N	-	1	0	CD200R1L	114030880	0.000000	0.05858	0.002000	0.10522	0.066000	0.16364	-0.236000	0.09003	0.076000	0.16826	0.379000	0.24179	AAC	.		0.388	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354365.1	NM_001008784	
CD2	914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	117311336	117311336	+	Silent	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:117311336C>A	ENST00000369478.3	+	5	1095	c.987C>A	c.(985-987)ccC>ccA	p.P329P		NM_001767.3	NP_001758.2	P06729	CD2_HUMAN	CD2 molecule	329	Pro-rich.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|membrane raft polarization (GO:0001766)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of myeloid dendritic cell activation (GO:0030887)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of T cell differentiation (GO:0045580)|single organismal cell-cell adhesion (GO:0016337)|T cell activation (GO:0042110)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			NS(1)|breast(2)|large_intestine(3)|liver(1)|lung(8)|skin(2)|stomach(1)	18	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	CGCCCCTCCCCAGACCTCGAG	0.537																																					p.P329P	NSCLC(14;263 555 26380 43512 51332)	.											.	CD2	153	0			c.C987A						.						74.0	82.0	79.0					1																	117311336		2203	4300	6503	SO:0001819	synonymous_variant	914	exon5			CCTCCCCAGACCT	BC033583	CCDS889.1	1p13	2013-01-11	2006-03-28		ENSG00000116824	ENSG00000116824		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1639	protein-coding gene	gene with protein product		186990	"""CD2 antigen (p50), sheep red blood cell receptor"""	SRBC		2437578	Standard	NM_001767		Approved		uc001egu.4	P06729	OTTHUMG00000022750	ENST00000369478.3:c.987C>A	1.37:g.117311336C>A		Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	35.0	NM_001767	Q96TE5	Silent	SNP	ENST00000369478.3	37	CCDS889.1																																																																																			.		0.537	CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059039.2	NM_001767	
CD300C	10871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72539019	72539020	+	Nonsense_Mutation	DNP	CG	CG	AT	rs147705680		TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr17:72539019_72539020CG>AT	ENST00000330793.1	-	3	867_868	c.507_508CG>AT	c.(505-510)ccCGaa>ccATaa	p.E170*		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	170	Pro-rich.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						GGGCTGGGTTCGGGGCTGTCCT	0.663																																					p.E170X|p.P169P	Esophageal Squamous(66;421 1121 20537 25337 27468)	.											.	CD300C	90	0			c.G508T|c.C507A						.																																			SO:0001587	stop_gained	10871	exon3			TGGGTTCGGGGCT|GGGTTCGGGGCTG	BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.507_508delinsAT	17.37:g.72539019_72539020delinsAT	ENSP00000329507:p.Glu170*	Somatic	144.0|145.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0|121.0	37.0	NM_006678		Nonsense_Mutation|Silent	SNP	ENST00000330793.1	37	CCDS11701.1																																																																																			.|G|1.000;A|0.000		0.663	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145084.1	NM_006678	
CDH13	1012	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	83816877	83816877	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr16:83816877G>T	ENST00000566620.1	+	13	2224	c.1934G>T	c.(1933-1935)aGc>aTc	p.S645I	CDH13_ENST00000428848.3_Missense_Mutation_p.S606I|CDH13_ENST00000268613.10_Missense_Mutation_p.S692I	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	645	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		GCCCTGGTAAGCCTTCTTCAA	0.443																																					p.S692I		.											.	CDH13	67	0			c.G2075T						.						77.0	71.0	73.0					16																	83816877		1959	4148	6107	SO:0001583	missense	1012	exon14			TGGTAAGCCTTCT	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1934G>T	16.37:g.83816877G>T	ENSP00000454435:p.Ser645Ile	Somatic	92.0	1.0		WXS	Illumina HiSeq	Phase_I	49.0	14.0	NM_001220488	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	37	CCDS58486.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.352008	0.24512	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143;ENST00000538855;ENST00000539548;ENST00000540531	T	0.55930	0.49	5.19	5.19	0.71726	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.52565	0.1742	M	0.68952	2.095	0.80722	D	1	B;B;B	0.12013	0.004;0.005;0.002	B;B;B	0.18263	0.02;0.021;0.007	T	0.53989	-0.8360	9	0.62326	D	0.03	.	13.3461	0.60573	0.0:0.0:0.8319:0.1681	.	606;692;645	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	I	692;645;606;347;204;335	ENSP00000268613:S692I	ENSP00000268613:S692I	S	+	2	0	CDH13	82374378	1.000000	0.71417	0.996000	0.52242	0.643000	0.38383	4.188000	0.58351	2.410000	0.81850	0.655000	0.94253	AGC	.		0.443	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257	
CDH18	1016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	19483500	19483500	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr5:19483500G>A	ENST00000507958.1	-	14	2782	c.1792C>T	c.(1792-1794)Cgg>Tgg	p.R598W	CDH18_ENST00000502796.1_Silent_p.C561C|CDH18_ENST00000382275.1_Missense_Mutation_p.R598W|CDH18_ENST00000274170.4_Missense_Mutation_p.R598W|CDH18_ENST00000506372.1_Silent_p.C562C			Q13634	CAD18_HUMAN	cadherin 18, type 2	598	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TGGCAGGTCCGCACACGCCCA	0.522																																					p.R598W		.											.	CDH18	159	0			c.C1792T						.						78.0	69.0	72.0					5																	19483500		2203	4300	6503	SO:0001583	missense	1016	exon12			AGGTCCGCACACG	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1792C>T	5.37:g.19483500G>A	ENSP00000425093:p.Arg598Trp	Somatic	234.0	0.0		WXS	Illumina HiSeq	Phase_I	322.0	61.0	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350073	0.82132	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	T;T;T	0.60299	0.2;0.2;0.2	5.54	5.54	0.83059	Cadherin (1);	0.120662	0.53938	D	0.000054	T	0.64034	0.2562	L	0.50333	1.59	0.47778	D	0.999513	D	0.69078	0.997	P	0.57468	0.821	T	0.62224	-0.6899	9	.	.	.	.	11.9208	0.52791	0.0:0.0:0.7291:0.2709	.	598	Q13634	CAD18_HUMAN	W	598	ENSP00000371710:R598W;ENSP00000425093:R598W;ENSP00000274170:R598W	.	R	-	1	2	CDH18	19519257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.741000	0.47426	2.615000	0.88500	0.655000	0.94253	CGG	.		0.522	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
CHRNA4	1137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61978128	61978128	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr20:61978128C>A	ENST00000370263.4	-	6	2067	c.1846G>T	c.(1846-1848)Ggc>Tgc	p.G616C	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	616					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	AGGAAGAGGCCCACCGTCCCC	0.647																																					p.G616C		.											.	CHRNA4	91	0			c.G1846T						.						101.0	63.0	76.0					20																	61978128		2202	4298	6500	SO:0001583	missense	1137	exon6			AGAGGCCCACCGT		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.1846G>T	20.37:g.61978128C>A	ENSP00000359285:p.Gly616Cys	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	29.0	NM_000744	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846034	0.91277	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	D	0.86769	-2.17	4.43	4.43	0.53597	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.152326	0.64402	D	0.000015	D	0.93566	0.7946	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	0.985;1.0	D;D	0.97110	0.964;1.0	D	0.94674	0.7859	10	0.87932	D	0	.	17.3789	0.87399	0.0:1.0:0.0:0.0	.	545;616	Q4VAQ5;P43681	.;ACHA4_HUMAN	C	522;616;545	ENSP00000359285:G616C	ENSP00000359280:G522C	G	-	1	0	CHRNA4	61448572	1.000000	0.71417	0.995000	0.50966	0.877000	0.50540	7.574000	0.82434	2.177000	0.69029	0.511000	0.50034	GGC	.		0.647	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
CROCC	9696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17256975	17256975	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:17256975G>T	ENST00000375541.5	+	7	804	c.735G>T	c.(733-735)caG>caT	p.Q245H	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		AGCTGGACCAGGCAGGCTCGG	0.647																																					p.Q245H		.											.	CROCC	137	0			c.G735T						.						41.0	36.0	38.0					1																	17256975		2199	4292	6491	SO:0001583	missense	9696	exon7			GGACCAGGCAGGC	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.735G>T	1.37:g.17256975G>T	ENSP00000364691:p.Gln245His	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	25.0	NM_014675		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.239464	0.39598	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.12361	2.69	5.21	4.3	0.51218	.	.	.	.	.	T	0.22704	0.0548	L	0.38175	1.15	0.47341	D	0.999391	D;D	0.65815	0.974;0.995	P;P	0.60415	0.827;0.874	T	0.00773	-1.1572	9	0.49607	T	0.09	.	12.2477	0.54581	0.0837:0.0:0.9163:0.0	.	108;245	A1L0S8;Q5TZA2	.;CROCC_HUMAN	H	245;126	ENSP00000364691:Q245H	ENSP00000364691:Q245H	Q	+	3	2	CROCC	17129562	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	2.345000	0.44018	1.187000	0.43000	0.555000	0.69702	CAG	.		0.647	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
CRTC3	64784	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	91150628	91150628	+	Silent	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr15:91150628T>C	ENST00000268184.6	+	6	499	c.495T>C	c.(493-495)gcT>gcC	p.A165A	CRTC3_ENST00000420329.2_Silent_p.A165A|CTD-3065B20.3_ENST00000559839.1_RNA|CRTC3_ENST00000558619.1_3'UTR			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	165					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			CTGATTCTGCTCTTCACACGA	0.522			T	MAML2	salivary gland mucoepidermoid																																p.A165A		.		Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	.	CRTC3	393	0			c.T495C						.						111.0	95.0	101.0					15																	91150628		2198	4298	6496	SO:0001819	synonymous_variant	64784	exon6			TTCTGCTCTTCAC		CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.495T>C	15.37:g.91150628T>C		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	5.0	NM_022769	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Silent	SNP	ENST00000268184.6	37	CCDS32331.1																																																																																			.		0.522	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41274911	41274911	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr3:41274911T>A	ENST00000349496.5	+	8	1441	c.1161T>A	c.(1159-1161)aaT>aaA	p.N387K	CTNNB1_ENST00000396185.3_Missense_Mutation_p.N387K|CTNNB1_ENST00000405570.1_Missense_Mutation_p.N387K|CTNNB1_ENST00000453024.1_Missense_Mutation_p.N380K|CTNNB1_ENST00000396183.3_Missense_Mutation_p.N387K	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	387					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.N387K(4)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTCTCAGGAATCTTTCAGATG	0.393		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.N387K	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	24361	4	Substitution - Missense(4)	large_intestine(1)|prostate(1)|liver(1)|kidney(1)	c.T1161A						.						102.0	93.0	96.0					3																	41274911		2203	4300	6503	SO:0001583	missense	1499	exon8	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CAGGAATCTTTCA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1161T>A	3.37:g.41274911T>A	ENSP00000344456:p.Asn387Lys	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	22.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	19.46	3.832364	0.71258	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79	5.72	1.33	0.21861	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90263	0.6955	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.88091	0.2813	10	0.54805	T	0.06	-10.1444	8.463	0.32938	0.0:0.3714:0.0:0.6286	.	315;387	B4DSW9;P35222	.;CTNB1_HUMAN	K	387;387;387;380;387	ENSP00000385604:N387K;ENSP00000379486:N387K;ENSP00000344456:N387K;ENSP00000411226:N380K;ENSP00000379488:N387K	ENSP00000344456:N387K	N	+	3	2	CTNNB1	41249915	0.995000	0.38212	0.998000	0.56505	0.998000	0.95712	0.358000	0.20216	0.227000	0.20999	0.533000	0.62120	AAT	.		0.393	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DCC	1630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	50918256	50918256	+	Splice_Site	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr18:50918256A>G	ENST00000442544.2	+	17	3303	c.2687A>G	c.(2686-2688)aAg>aGg	p.K896R	DCC_ENST00000581580.1_Splice_Site_p.K531R|DCC_ENST00000412726.1_Splice_Site_p.K724R	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	896	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GCAAAATACAAGGTGAAGTTC	0.423																																					p.K896R		.											.	DCC	225	0			c.A2687G						.						64.0	63.0	63.0					18																	50918256		2203	4300	6503	SO:0001630	splice_region_variant	1630	exon17			AATACAAGGTGAA	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.2688+1A>G	18.37:g.50918256A>G		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	20.0	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.489428	0.44249	.	.	ENSG00000187323	ENST00000442544;ENST00000412726	T;T	0.56611	0.45;0.45	5.24	5.24	0.73138	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.51719	0.1691	L	0.39692	1.235	0.52099	D	0.999949	B;B;P	0.38167	0.145;0.145;0.621	B;B;P	0.47251	0.093;0.093;0.542	T	0.42515	-0.9447	10	0.15066	T	0.55	.	14.1331	0.65268	1.0:0.0:0.0:0.0	.	724;724;896	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	R	896;724	ENSP00000389140:K896R;ENSP00000397322:K724R	ENSP00000397322:K724R	K	+	2	0	DCC	49172254	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.164000	0.94755	1.981000	0.57761	0.377000	0.23210	AAG	.		0.423	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	Missense_Mutation
DHX37	57647	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	125451669	125451669	+	Splice_Site	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr12:125451669C>T	ENST00000308736.2	-	11	1602	c.1504G>A	c.(1504-1506)Gaa>Aaa	p.E502K	DHX37_ENST00000544745.1_Splice_Site_p.E289K	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	502	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		TCCTCTTTACCTTGTGGCCGG	0.667																																					p.E502K		.											.	DHX37	227	0			c.G1504A						.						45.0	35.0	38.0					12																	125451669		2203	4300	6503	SO:0001630	splice_region_variant	57647	exon11			CTTTACCTTGTGG	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1504+1G>A	12.37:g.125451669C>T		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	7.0	NM_032656	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.142791	0.37825	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.13307	2.6;2.6	4.96	4.96	0.65561	Helicase, C-terminal (1);	0.512553	0.15366	U	0.266111	T	0.09512	0.0234	N	0.13272	0.32	0.53688	D	0.999971	B	0.02656	0.0	B	0.04013	0.001	T	0.25012	-1.0144	9	.	.	.	-9.1	15.9979	0.80265	0.0:1.0:0.0:0.0	.	502	Q8IY37	DHX37_HUMAN	K	502;289	ENSP00000311135:E502K;ENSP00000439009:E289K	.	E	-	1	0	DHX37	124017622	1.000000	0.71417	0.959000	0.39883	0.063000	0.16089	3.301000	0.51842	2.308000	0.77769	0.655000	0.94253	GAA	.		0.667	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	Missense_Mutation
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	13794081	13794081	+	Silent	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr5:13794081A>G	ENST00000265104.4	-	48	8078	c.7974T>C	c.(7972-7974)gaT>gaC	p.D2658D		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2658	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCATATTCACATCATCAATAA	0.348									Kartagener syndrome																												p.D2658D		.											.	DNAH5	182	0			c.T7974C						.						110.0	101.0	104.0					5																	13794081		2203	4300	6503	SO:0001819	synonymous_variant	1767	exon48	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	ATTCACATCATCA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.7974T>C	5.37:g.13794081A>G		Somatic	243.0	0.0		WXS	Illumina HiSeq	Phase_I	225.0	118.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																			.		0.348	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DNER	92737	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230231627	230231627	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:230231627G>T	ENST00000341772.4	-	12	2198	c.2064C>A	c.(2062-2064)agC>agA	p.S688R		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	688					central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		TGCTGAACTCGCTGTCGATGC	0.572																																					p.S688R		.											.	DNER	524	0			c.C2064A						.						71.0	67.0	68.0					2																	230231627		2203	4300	6503	SO:0001583	missense	92737	exon12			GAACTCGCTGTCG	AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.2064C>A	2.37:g.230231627G>T	ENSP00000345229:p.Ser688Arg	Somatic	120.0	1.0		WXS	Illumina HiSeq	Phase_I	65.0	14.0	NM_139072	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	37	CCDS33390.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.823122	0.71143	.	.	ENSG00000187957	ENST00000341772;ENST00000543700	D	0.86030	-2.06	5.93	2.71	0.32032	.	0.000000	0.85682	D	0.000000	T	0.81564	0.4849	N	0.24115	0.695	0.51482	D	0.999925	D	0.63046	0.992	P	0.56916	0.809	T	0.80308	-0.1437	10	0.66056	D	0.02	.	6.9849	0.24723	0.463:0.0:0.537:0.0	.	688	Q8NFT8	DNER_HUMAN	R	688;406	ENSP00000345229:S688R	ENSP00000345229:S688R	S	-	3	2	DNER	229939871	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.896000	0.28377	0.836000	0.34901	0.551000	0.68910	AGC	.		0.572	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	NM_139072	
DYRK1A	1859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	21	38865436	38865436	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr21:38865436G>T	ENST00000398960.2	+	7	1144	c.1069G>T	c.(1069-1071)Gga>Tga	p.G357*	DYRK1A_ENST00000321219.8_Nonsense_Mutation_p.G357*|DYRK1A_ENST00000455387.2_Nonsense_Mutation_p.G129*|DYRK1A_ENST00000398956.2_Nonsense_Mutation_p.G357*|DYRK1A_ENST00000338785.3_Nonsense_Mutation_p.G357*|DYRK1A_ENST00000451934.1_Nonsense_Mutation_p.G357*|DYRK1A_ENST00000339659.4_Nonsense_Mutation_p.G348*	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	357	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			G -> R (in Ref. 6; CAA05059). {ECO:0000305}.	circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AATGCACACTGGAGAACCTCT	0.413																																					p.G357X	Melanoma(114;464 1602 31203 43785 45765)	.											.	DYRK1A	792	0			c.G1069T						.						169.0	153.0	159.0					21																	38865436		2203	4300	6503	SO:0001587	stop_gained	1859	exon7			CACACTGGAGAAC	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1069G>T	21.37:g.38865436G>T	ENSP00000381932:p.Gly357*	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	16.0	NM_001396	O60769|Q92582|Q92810|Q9UNM5	Nonsense_Mutation	SNP	ENST00000398960.2	37	CCDS42925.1	.	.	.	.	.	.	.	.	.	.	G	51	17.496504	0.99887	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956;ENST00000455387	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3431	0.98773	0.0:0.0:1.0:0.0	.	.	.	.	X	357;348;357;357;357;357;129	.	ENSP00000319032:G357X	G	+	1	0	DYRK1A	37787306	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.880000	0.98712	0.650000	0.86243	GGA	.		0.413	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	NM_001396	
EFNB2	1948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	107164993	107164993	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr13:107164993G>A	ENST00000245323.4	-	2	439	c.290C>T	c.(289-291)cCt>cTt	p.P97L		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	97	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					GTTGAGGAGAGGGGTATTTTC	0.378																																					p.P97L		.											.	EFNB2	91	0			c.C290T						.						169.0	170.0	170.0					13																	107164993		2203	4300	6503	SO:0001583	missense	1948	exon2			AGGAGAGGGGTAT	L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.290C>T	13.37:g.107164993G>A	ENSP00000245323:p.Pro97Leu	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	36.0	NM_004093	Q5JV56	Missense_Mutation	SNP	ENST00000245323.4	37	CCDS9507.1	.	.	.	.	.	.	.	.	.	.	G	6.077	0.382471	0.11524	.	.	ENSG00000125266	ENST00000245323	D	0.92699	-3.09	5.41	5.41	0.78517	Cupredoxin (2);	0.048352	0.85682	D	0.000000	T	0.79913	0.4528	N	0.01529	-0.815	0.80722	D	1	B	0.10296	0.003	B	0.17979	0.02	T	0.76013	-0.3114	10	0.08179	T	0.78	.	19.571	0.95419	0.0:0.0:1.0:0.0	.	97	P52799	EFNB2_HUMAN	L	97	ENSP00000245323:P97L	ENSP00000245323:P97L	P	-	2	0	EFNB2	105962994	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.379000	0.73154	2.709000	0.92574	0.655000	0.94253	CCT	.		0.378	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045733.4	NM_004093	
ELK4	2005	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	205589534	205589534	+	Missense_Mutation	SNP	T	T	A	rs368269938		TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:205589534T>A	ENST00000357992.4	-	3	979	c.640A>T	c.(640-642)Att>Ttt	p.I214F	ELK4_ENST00000468523.1_5'Flank|ELK4_ENST00000289703.4_Missense_Mutation_p.I214F	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)	214					cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			GATGGAGAAATACTTGGGCCA	0.483			T	SLC45A3	prostate																																p.I214F		.		Dom	yes		1	1q32	2005	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""		E	.	ELK4	658	0			c.A640T						.						83.0	86.0	85.0					1																	205589534		2203	4300	6503	SO:0001583	missense	2005	exon3			GAGAAATACTTGG	M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.640A>T	1.37:g.205589534T>A	ENSP00000350681:p.Ile214Phe	Somatic	186.0	1.0		WXS	Illumina HiSeq	Phase_I	177.0	21.0	NM_021795	P28323|Q6GSJ2	Missense_Mutation	SNP	ENST00000357992.4	37	CCDS1456.1	.	.	.	.	.	.	.	.	.	.	T	11.66	1.704837	0.30232	.	.	ENSG00000158711	ENST00000539916;ENST00000357992;ENST00000289703	T;T	0.31247	1.75;1.5	5.81	-2.9	0.05648	.	0.767209	0.13194	N	0.406481	T	0.10937	0.0267	N	0.08118	0	0.09310	N	1	P;B	0.42203	0.773;0.148	B;B	0.37304	0.246;0.049	T	0.30822	-0.9965	10	0.21540	T	0.41	.	5.967	0.19330	0.0:0.2848:0.2312:0.4839	.	214;214	P28324-2;P28324	.;ELK4_HUMAN	F	304;214;214	ENSP00000350681:I214F;ENSP00000289703:I214F	ENSP00000289703:I214F	I	-	1	0	ELK4	203856157	0.008000	0.16893	0.037000	0.18230	0.735000	0.41995	0.033000	0.13754	-0.502000	0.06596	0.533000	0.62120	ATT	.		0.483	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090615.1	NM_021795	
ENAM	10117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71508497	71508497	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr4:71508497A>G	ENST00000396073.3	+	9	1635	c.1354A>G	c.(1354-1356)Aag>Gag	p.K452E	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	452					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			AGTTCCTACAAAGAATCCAAC	0.423																																					p.K452E		.											.	ENAM	93	0			c.A1354G						.						34.0	36.0	35.0					4																	71508497		2191	4300	6491	SO:0001583	missense	10117	exon9			CCTACAAAGAATC	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1354A>G	4.37:g.71508497A>G	ENSP00000379383:p.Lys452Glu	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	12.0	NM_031889	Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	A	11.19	1.564318	0.27915	.	.	ENSG00000132464	ENST00000396073	T	0.35421	1.31	5.93	3.32	0.38043	.	0.091579	0.48286	D	0.000190	T	0.32224	0.0822	L	0.53249	1.67	0.23430	N	0.997698	P	0.40553	0.721	B	0.38755	0.281	T	0.19484	-1.0304	10	0.54805	T	0.06	-7.7204	9.6873	0.40107	0.6596:0.3404:0.0:0.0	.	452	Q9NRM1	ENAM_HUMAN	E	452	ENSP00000379383:K452E	ENSP00000379383:K452E	K	+	1	0	ENAM	71727361	0.853000	0.29707	0.771000	0.31576	0.104000	0.19210	1.436000	0.34980	1.044000	0.40200	0.533000	0.62120	AAG	.		0.423	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
ERBB4	2066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	212543852	212543852	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:212543852C>A	ENST00000342788.4	-	13	1857	c.1547G>T	c.(1546-1548)gGg>gTg	p.G516V	ERBB4_ENST00000436443.1_Missense_Mutation_p.G516V|ERBB4_ENST00000402597.1_Missense_Mutation_p.G516V	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	516	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TTGGTCTGGCCCAGGTCCCCA	0.488										TSP Lung(8;0.080)																											p.G516V		.											.	ERBB4	1461	0			c.G1547T						.						86.0	76.0	80.0					2																	212543852		2203	4300	6503	SO:0001583	missense	2066	exon13			TCTGGCCCAGGTC	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1547G>T	2.37:g.212543852C>A	ENSP00000342235:p.Gly516Val	Somatic	256.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	43.0	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.7|20.7	4.027090|4.027090	0.75390|0.75390	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000260943|ENST00000342788;ENST00000436443;ENST00000402597	T|T;T;T	0.50813|0.52057	0.73|0.68;0.68;0.68	5.33|5.33	4.46|4.46	0.54185|0.54185	.|Growth factor, receptor (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.76807|0.76807	0.4039|0.4039	H|H	0.95043|0.95043	3.615|3.615	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|1.0;0.999;0.999;1.0;1.0	D|D	0.83648|0.83648	0.0154|0.0154	8|10	0.87932|0.87932	D|D	0|0	.|.	13.2211|13.2211	0.59887|0.59887	0.0:0.921:0.0:0.079|0.0:0.921:0.0:0.079	.|.	.|516;516;375;516;516	.|Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.|.;.;.;.;ERBB4_HUMAN	C|V	516|516	ENSP00000260943:G516C|ENSP00000342235:G516V;ENSP00000403204:G516V;ENSP00000385565:G516V	ENSP00000260943:G516C|ENSP00000342235:G516V	G|G	-|-	1|2	0|0	ERBB4|ERBB4	212252097|212252097	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.876000|0.876000	0.50452|0.50452	5.482000|5.482000	0.66833|0.66833	1.247000|1.247000	0.43917|0.43917	0.591000|0.591000	0.81541|0.81541	GGC|GGG	.		0.488	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
EVPL	2125	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74011082	74011082	+	Missense_Mutation	SNP	A	A	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr17:74011082A>T	ENST00000301607.3	-	17	2390	c.2137T>A	c.(2137-2139)Ttc>Atc	p.F713I	EVPL_ENST00000586740.1_Missense_Mutation_p.F735I	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	713	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						TCTTGGCAGAACTCCTGGAAG	0.677																																					p.F713I		.											.	EVPL	93	0			c.T2137A						.						38.0	42.0	40.0					17																	74011082		2203	4299	6502	SO:0001583	missense	2125	exon17			GGCAGAACTCCTG	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.2137T>A	17.37:g.74011082A>T	ENSP00000301607:p.Phe713Ile	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	5.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.757021	0.89843	.	.	ENSG00000167880	ENST00000301607	T	0.63255	-0.03	5.36	5.36	0.76844	.	0.288822	0.39274	N	0.001411	T	0.58666	0.2138	M	0.65975	2.015	0.37540	D	0.918257	P;P	0.50156	0.932;0.651	B;B	0.42771	0.397;0.198	T	0.63301	-0.6668	10	0.25751	T	0.34	-36.7388	10.0881	0.42430	0.9249:0.0:0.0751:0.0	.	735;713	B7ZLH8;Q92817	.;EVPL_HUMAN	I	713	ENSP00000301607:F713I	ENSP00000301607:F713I	F	-	1	0	EVPL	71522677	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.087000	0.71362	2.168000	0.68352	0.533000	0.62120	TTC	.		0.677	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
FAM120A	23196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	96318785	96318785	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr9:96318785G>T	ENST00000277165.6	+	13	2590	c.2396G>T	c.(2395-2397)tGg>tTg	p.W799L	FAM120A_ENST00000340893.4_Missense_Mutation_p.W799L|FAM120A_ENST00000333936.5_Missense_Mutation_p.W827L	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	799						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TGTTGTCCTTGGATGTATTTT	0.502																																					p.W799L		.											.	FAM120A	90	0			c.G2396T						.						188.0	186.0	187.0					9																	96318785		2203	4300	6503	SO:0001583	missense	23196	exon13			GTCCTTGGATGTA	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.2396G>T	9.37:g.96318785G>T	ENSP00000277165:p.Trp799Leu	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	34.0	NM_014612	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	ENST00000277165.6	37	CCDS6706.1	.	.	.	.	.	.	.	.	.	.	G	34	5.291703	0.95546	.	.	ENSG00000048828	ENST00000277165;ENST00000333936;ENST00000340893;ENST00000427765	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000001	T	0.70710	0.3255	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.994	T	0.71517	-0.4569	10	0.87932	D	0	-8.7224	20.3214	0.98679	0.0:0.0:1.0:0.0	.	799;827;799	Q9NZB2-4;Q9NZB2-6;Q9NZB2	.;.;F120A_HUMAN	L	799;827;799;221	ENSP00000277165:W799L;ENSP00000334918:W827L;ENSP00000344698:W799L;ENSP00000412440:W221L	ENSP00000277165:W799L	W	+	2	0	FAM120A	95358606	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.837000	0.99465	2.804000	0.96469	0.655000	0.94253	TGG	.		0.502	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053160.2	NM_014612	
FAT4	79633	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	126367520	126367520	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr4:126367520G>T	ENST00000394329.3	+	8	7279	c.7266G>T	c.(7264-7266)ttG>ttT	p.L2422F	FAT4_ENST00000335110.5_Missense_Mutation_p.L720F	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2422	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCAGCGCATTGTTAGATAGGG	0.448																																					p.L2422F		.											.	FAT4	108	0			c.G7266T						.						127.0	125.0	126.0					4																	126367520		2203	4300	6503	SO:0001583	missense	79633	exon8			CGCATTGTTAGAT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7266G>T	4.37:g.126367520G>T	ENSP00000377862:p.Leu2422Phe	Somatic	110.0	1.0		WXS	Illumina HiSeq	Phase_I	48.0	13.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	12.92	2.083694	0.36758	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.51325	0.71;0.71	5.69	3.02	0.34903	Cadherin (4);Cadherin-like (1);	0.000000	0.28016	U	0.016933	T	0.50446	0.1616	L	0.27975	0.815	0.43841	D	0.996424	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.98	T	0.48514	-0.9029	10	0.56958	D	0.05	.	7.3199	0.26521	0.2599:0.1128:0.6272:0.0	.	720;2422	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	F	2422;720	ENSP00000377862:L2422F;ENSP00000335169:L720F	ENSP00000335169:L720F	L	+	3	2	FAT4	126586970	0.979000	0.34478	0.344000	0.25628	0.198000	0.23893	0.064000	0.14437	0.756000	0.33013	0.655000	0.94253	TTG	.		0.448	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	39261907	39261907	+	Silent	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr13:39261907C>A	ENST00000280481.7	+	1	642	c.426C>A	c.(424-426)ggC>ggA	p.G142G		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	142					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTCACCTGGGCGCGCGCAGCC	0.687																																					p.G142G		.											.	FREM2	100	0			c.C426A						.						29.0	29.0	29.0					13																	39261907		2196	4297	6493	SO:0001819	synonymous_variant	341640	exon1			CCTGGGCGCGCGC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.426C>A	13.37:g.39261907C>A		Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	17.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																			.		0.687	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
GAB4	128954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	17450871	17450871	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr22:17450871G>T	ENST00000400588.1	-	4	1006	c.899C>A	c.(898-900)aCc>aAc	p.T300N	GAB4_ENST00000523144.1_Intron	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	300										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GCTGCCTCTGGTGTGGCCATG	0.597																																					p.T300N		.											.	GAB4	91	0			c.C899A						.						75.0	84.0	81.0					22																	17450871		2184	4293	6477	SO:0001583	missense	128954	exon4			CCTCTGGTGTGGC	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.899C>A	22.37:g.17450871G>T	ENSP00000383431:p.Thr300Asn	Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	29.0	NM_001037814		Missense_Mutation	SNP	ENST00000400588.1	37	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	G	7.774	0.708157	0.15239	.	.	ENSG00000215568	ENST00000400588	T	0.42131	0.98	1.97	1.97	0.26223	.	0.408932	0.25503	N	0.030225	T	0.29491	0.0735	L	0.38175	1.15	0.28401	N	0.918643	P	0.47409	0.895	B	0.43838	0.433	T	0.14008	-1.0488	10	0.09590	T	0.72	.	9.9586	0.41682	0.0:0.0:1.0:0.0	.	300	Q2WGN9	GAB4_HUMAN	N	300	ENSP00000383431:T300N	ENSP00000383431:T300N	T	-	2	0	GAB4	15830871	1.000000	0.71417	0.999000	0.59377	0.058000	0.15608	8.431000	0.90285	1.398000	0.46701	0.411000	0.27672	ACC	.		0.597	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882	
GADL1	339896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	30827899	30827899	+	Splice_Site	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr3:30827899C>T	ENST00000282538.5	-	13	1401		c.e13-1			NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1						carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						TACTAGGTACCTAAAATTAAA	0.323																																					.		.											.	GADL1	90	0			c.1251-1G>A						.						104.0	96.0	99.0					3																	30827899		2194	4297	6491	SO:0001630	splice_region_variant	339896	exon14			AGGTACCTAAAAT	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1251-1G>A	3.37:g.30827899C>T		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	16.0	NM_207359		Splice_Site	SNP	ENST00000282538.5	37	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056184	0.76074	.	.	ENSG00000144644	ENST00000282538	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1922	0.89810	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GADL1	30802903	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.187000	0.65087	2.831000	0.97527	0.650000	0.86243	.	.		0.323	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	NM_207359	Intron
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	89989829	89989829	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr5:89989829C>A	ENST00000405460.2	+	33	7352	c.7256C>A	c.(7255-7257)cCt>cAt	p.P2419H		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2419					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CAAGGGGTGCCTGACCCACTT	0.483																																					p.P2419H		.											.	GPR98	103	0			c.C7256A						.						81.0	78.0	79.0					5																	89989829		1907	4120	6027	SO:0001583	missense	84059	exon33			GGGTGCCTGACCC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7256C>A	5.37:g.89989829C>A	ENSP00000384582:p.Pro2419His	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	31.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281408	0.59758	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.29142	1.58	5.97	5.97	0.96955	.	0.045090	0.85682	D	0.000000	T	0.57961	0.2089	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.56860	-0.7909	10	0.87932	D	0	.	20.4135	0.99023	0.0:1.0:0.0:0.0	.	2419;2419	E7ETI5;Q8WXG9	.;GPR98_HUMAN	H	2419	ENSP00000384582:P2419H	ENSP00000296619:P2419H	P	+	2	0	GPR98	90025585	0.997000	0.39634	1.000000	0.80357	0.036000	0.12997	5.910000	0.69931	2.835000	0.97688	0.591000	0.81541	CCT	.		0.483	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GRIA1	2890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	153149817	153149817	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr5:153149817G>A	ENST00000285900.5	+	13	2455	c.2112G>A	c.(2110-2112)atG>atA	p.M704I	GRIA1_ENST00000521843.2_Missense_Mutation_p.M635I|GRIA1_ENST00000340592.5_Missense_Mutation_p.M704I|GRIA1_ENST00000448073.4_Missense_Mutation_p.M714I|GRIA1_ENST00000518783.1_Missense_Mutation_p.M714I|GRIA1_ENST00000518142.1_Missense_Mutation_p.M624I	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	704					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	AGGAGGGGATGATTCGAGTGA	0.488																																					p.M714I		.											.	GRIA1	96	0			c.G2142A						.						139.0	125.0	130.0					5																	153149817		2203	4300	6503	SO:0001583	missense	2890	exon13			GGGGATGATTCGA		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2112G>A	5.37:g.153149817G>A	ENSP00000285900:p.Met704Ile	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	63.0	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	G	2.259	-0.369632	0.05069	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.36157	1.82;1.82;1.27;1.82;1.82;1.82;1.27	5.41	5.41	0.78517	Ionotropic glutamate receptor (2);	0.039962	0.85682	D	0.000000	T	0.08891	0.0220	N	0.00039	-2.51	0.47547	D	0.999458	B;B;B;B;B	0.23249	0.082;0.082;0.002;0.066;0.004	B;B;B;B;B	0.24006	0.05;0.05;0.002;0.03;0.007	T	0.41645	-0.9497	10	0.17369	T	0.5	.	18.1724	0.89751	0.0:0.0:1.0:0.0	.	714;714;624;704;704	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	I	704;704;624;658;704;637;635;714;714	ENSP00000285900:M704I;ENSP00000427920:M624I;ENSP00000339343:M704I;ENSP00000427864:M637I;ENSP00000442108:M635I;ENSP00000428994:M714I;ENSP00000415569:M714I	ENSP00000285900:M704I	M	+	3	0	GRIA1	153130010	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.553000	0.36255	2.525000	0.85131	0.655000	0.94253	ATG	.		0.488	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
HOOK1	51361	ucsc.edu;bcgsc.ca	37	1	60287594	60287594	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:60287594T>C	ENST00000371208.3	+	2	385	c.128T>C	c.(127-129)aTg>aCg	p.M43T	HOOK1_ENST00000465876.1_3'UTR|HOOK1_ENST00000395561.2_Start_Codon_SNP_p.M1T	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	43	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					GGAGTTGCCATGGCACAAGTT	0.403																																					p.M43T		.											.	HOOK1	154	0			c.T128C						.						133.0	116.0	122.0					1																	60287594		2203	4300	6503	SO:0001583	missense	51361	exon2			TTGCCATGGCACA	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.128T>C	1.37:g.60287594T>C	ENSP00000360252:p.Met43Thr	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_015888	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	ENST00000371208.3	37	CCDS612.1	.	.	.	.	.	.	.	.	.	.	T	18.64	3.667880	0.67814	.	.	ENSG00000134709	ENST00000455990;ENST00000371208;ENST00000395561	T;T;T	0.46063	0.88;0.88;0.88	5.77	4.63	0.57726	.	0.071241	0.85682	D	0.000000	T	0.56077	0.1961	M	0.74881	2.28	0.80722	D	1	P	0.41265	0.744	P	0.53360	0.724	T	0.60596	-0.7232	10	0.87932	D	0	.	9.936	0.41552	0.0:0.0805:0.0:0.9195	.	43	Q9UJC3	HOOK1_HUMAN	T	43;43;1	ENSP00000398860:M43T;ENSP00000360252:M43T;ENSP00000378928:M1T	ENSP00000360252:M43T	M	+	2	0	HOOK1	60060182	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.240000	0.58701	2.194000	0.70268	0.528000	0.53228	ATG	.		0.403	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024934.1	NM_015888	
HIST2H2AC	8338	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	149858529	149858529	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:149858529C>G	ENST00000331380.2	+	1	5	c.5C>G	c.(4-6)tCt>tGt	p.S2C	BOLA1_ENST00000369153.2_5'Flank|HIST2H2BE_ENST00000369155.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	2						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			TCAGTCATGTCTGGTCGTGGC	0.537																																					p.S2C		.											.	HIST2H2AC	92	0			c.C5G						.						86.0	92.0	90.0					1																	149858529		2203	4300	6503	SO:0001583	missense	8338	exon1			TCATGTCTGGTCG	AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.5C>G	1.37:g.149858529C>G	ENSP00000332194:p.Ser2Cys	Somatic	86.0	1.0		WXS	Illumina HiSeq	Phase_I	155.0	67.0	NM_003517	Q6DRA7|Q8IUE5	Missense_Mutation	SNP	ENST00000331380.2	37	CCDS937.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.492022	0.26774	.	.	ENSG00000184260	ENST00000331380	D	0.86694	-2.16	5.81	4.88	0.63580	Histone-fold (2);	0.000000	0.43747	D	0.000528	D	0.94650	0.8275	H	0.97516	4.02	0.33744	D	0.619773	D	0.76494	0.999	D	0.63957	0.92	D	0.96545	0.9403	10	0.87932	D	0	.	15.5214	0.75869	0.0:0.861:0.139:0.0	.	2	Q16777	H2A2C_HUMAN	C	2	ENSP00000332194:S2C	ENSP00000332194:S2C	S	+	2	0	HIST2H2AC	148125153	0.994000	0.37717	0.974000	0.42286	0.715000	0.41141	3.157000	0.50716	1.424000	0.47217	0.655000	0.94253	TCT	.		0.537	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087128.1	NM_003517	
KIAA1407	57577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113720527	113720527	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr3:113720527T>C	ENST00000295878.3	-	13	2224	c.2078A>G	c.(2077-2079)cAa>cGa	p.Q693R	KIAA1407_ENST00000545063.1_3'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	693										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						TTCCTCCTCTTGGGCCTTTAA	0.408																																					p.Q693R		.											.	KIAA1407	92	0			c.A2078G						.						213.0	209.0	210.0					3																	113720527		2203	4300	6503	SO:0001583	missense	57577	exon13			TCCTCTTGGGCCT	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2078A>G	3.37:g.113720527T>C	ENSP00000295878:p.Gln693Arg	Somatic	319.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	63.0	NM_020817	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	37	CCDS2977.1	.	.	.	.	.	.	.	.	.	.	T	12.73	2.027008	0.35797	.	.	ENSG00000163617	ENST00000295878	T	0.29655	1.56	5.19	4.0	0.46444	.	0.250949	0.41194	D	0.000933	T	0.36441	0.0967	L	0.59912	1.85	0.80722	D	1	P	0.50272	0.933	P	0.51582	0.674	T	0.08953	-1.0697	10	0.21014	T	0.42	.	9.4002	0.38428	0.159:0.0:0.0:0.841	.	693	Q8NCU4	K1407_HUMAN	R	693	ENSP00000295878:Q693R	ENSP00000295878:Q693R	Q	-	2	0	KIAA1407	115203217	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.265000	0.43311	1.059000	0.40554	0.528000	0.53228	CAA	.		0.408	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
KLK8	11202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51503826	51503826	+	Silent	SNP	T	T	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr19:51503826T>A	ENST00000600767.1	-	4	573	c.84A>T	c.(82-84)gcA>gcT	p.A28A	KLK8_ENST00000347619.4_Intron|KLK8_ENST00000391806.2_Silent_p.A73A|KLK8_ENST00000320838.5_Intron|KLK8_ENST00000593490.1_Intron|KLK8_ENST00000598195.1_5'Flank|KLK8_ENST00000291726.7_Silent_p.A28A|KLK9_ENST00000250366.6_3'UTR|KLK9_ENST00000376832.4_3'UTR|CTB-147C22.9_ENST00000594512.1_RNA			O60259	KLK8_HUMAN	kallikrein-related peptidase 8	28					cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		TGTCCTCCTGTGCCCTGGAGT	0.642																																					p.A73A		.											.	KLK8	604	0			c.A219T						.						65.0	58.0	60.0					19																	51503826		2203	4300	6503	SO:0001819	synonymous_variant	11202	exon3			CTCCTGTGCCCTG	AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.84A>T	19.37:g.51503826T>A		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	28.0	NM_144505	Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Silent	SNP	ENST00000600767.1	37	CCDS12813.1																																																																																			.		0.642	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465032.2	NM_007196	
LDLRAD4	753	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	13645383	13645383	+	Silent	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr18:13645383T>C	ENST00000359446.5	+	6	1116	c.648T>C	c.(646-648)agT>agC	p.S216S	LDLRAD4_ENST00000585931.1_Silent_p.S139S|LDLRAD4_ENST00000361205.4_Silent_p.S216S|LDLRAD4_ENST00000586765.1_Silent_p.S161S|LDLRAD4_ENST00000592991.1_Silent_p.S118S|LDLRAD4_ENST00000399848.3_Silent_p.S198S|RP11-701H16.4_ENST00000588397.1_RNA|LDLRAD4_ENST00000587757.1_Silent_p.S179S	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4	216					negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)										TATTTGACAGTGATTTAATAG	0.582																																					p.S198S		.											.	.	.	0			c.T594C						.						78.0	86.0	84.0					18																	13645383		2203	4300	6503	SO:0001819	synonymous_variant	753	exon6			TGACAGTGATTTA	AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.648T>C	18.37:g.13645383T>C		Somatic	91.0	1.0		WXS	Illumina HiSeq	Phase_I	64.0	18.0	NM_181482	B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	Silent	SNP	ENST00000359446.5	37	CCDS32793.1																																																																																			.		0.582	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458326.1	NM_181481	
LILRA6	79168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54746124	54746124	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr19:54746124C>T	ENST00000396365.2	-	3	172	c.133G>A	c.(133-135)Gtg>Atg	p.V45M	LILRB3_ENST00000407860.2_Missense_Mutation_p.V45M|LILRA6_ENST00000419410.2_Missense_Mutation_p.V45M|LILRA6_ENST00000270464.5_Missense_Mutation_p.V45M|LILRA6_ENST00000440558.2_Missense_Mutation_p.V45M|LILRA6_ENST00000391735.3_Missense_Mutation_p.V45M|LILRA6_ENST00000245621.5_Missense_Mutation_p.V45M	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	45					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CAGATGGTCACGGGGCTCCCC	0.597																																					p.V45M		.											.	LILRA6	24	0			c.G133A						.						123.0	129.0	127.0					19																	54746124		2203	4300	6503	SO:0001583	missense	79168	exon3			TGGTCACGGGGCT	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.133G>A	19.37:g.54746124C>T	ENSP00000379651:p.Val45Met	Somatic	601.0	0.0		WXS	Illumina HiSeq	Phase_I	379.0	57.0	NM_024318		Missense_Mutation	SNP	ENST00000396365.2	37	CCDS42610.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.036077	0.35893	.	.	ENSG00000204577;ENSG00000244482;ENSG00000244482;ENSG00000244482;ENSG00000244482;ENSG00000244482;ENSG00000244482;ENSG00000244482	ENST00000407860;ENST00000440558;ENST00000270464;ENST00000419410;ENST00000391735;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31;2.31;2.31	3.93	0.456	0.16655	Immunoglobulin-like fold (1);	0.129146	0.35124	N	0.003429	T	0.35364	0.0929	M	0.79805	2.47	0.09310	N	0.999999	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.998;0.995;0.998;1.0;1.0;1.0;1.0;1.0;1.0	D;P;P;P;D;D;D;D;D;D	0.87578	0.916;0.814;0.773;0.846;0.991;0.918;0.919;0.963;0.998;0.98	T	0.08994	-1.0695	10	0.38643	T	0.18	.	6.3692	0.21471	0.0:0.6643:0.0:0.3357	.	45;45;45;45;45;45;45;45;45;45	C9JFH3;Q6PI73-2;B5MCX0;B5ME96;Q6PI73;F8WCY4;F8WD89;D3YTC4;F8W6G6;O75022-2	.;.;.;.;LIRA6_HUMAN;.;.;.;.;.	M	45	ENSP00000384274:V45M;ENSP00000390120:V45M;ENSP00000270464:V45M;ENSP00000411227:V45M;ENSP00000375615:V45M;ENSP00000379651:V45M;ENSP00000245621:V45M	ENSP00000245621:V45M	V	-	1	0	LILRB3;LILRA6	59437936	0.000000	0.05858	0.079000	0.20413	0.013000	0.08279	-0.719000	0.04974	-0.013000	0.14199	0.184000	0.17185	GTG	.		0.597	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
LILRB4	11006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55176617	55176617	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr19:55176617C>T	ENST00000391736.1	+	8	1058	c.743C>T	c.(742-744)tCa>tTa	p.S248L	LILRB4_ENST00000430952.2_Missense_Mutation_p.S248L|LILRB4_ENST00000391734.3_Missense_Mutation_p.S248L|LILRB4_ENST00000270452.2_Missense_Mutation_p.S248L|LILRB4_ENST00000391733.3_Missense_Mutation_p.S248L	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	248					immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		CCTACAGGGTCAGTCCCCCAC	0.647																																					p.S248L		.											.	LILRB4	93	0			c.C743T						.						43.0	37.0	39.0					19																	55176617		2203	4300	6503	SO:0001583	missense	11006	exon6			CAGGGTCAGTCCC	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.743C>T	19.37:g.55176617C>T	ENSP00000375616:p.Ser248Leu	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	38.0	NM_006847	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	C	4.788	0.146516	0.09134	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.00493	7.08;7.08;7.08;7.04;7.1;7.0	1.26	1.26	0.21427	.	.	.	.	.	T	0.00524	0.0017	L	0.55213	1.73	0.09310	N	1	B;B;B;B;P	0.48230	0.068;0.141;0.22;0.274;0.907	B;B;B;B;B	0.44224	0.012;0.012;0.061;0.084;0.444	T	0.53464	-0.8435	9	0.41790	T	0.15	.	5.8815	0.18858	0.0:1.0:0.0:0.0	.	248;247;248;248;248	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	L	248;248;248;248;248;247	ENSP00000375616:S248L;ENSP00000270452:S248L;ENSP00000408995:S248L;ENSP00000375614:S248L;ENSP00000375613:S248L;ENSP00000401962:S247L	ENSP00000270452:S248L	S	+	2	0	LILRB4	59868429	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.326000	0.07965	0.969000	0.38237	0.407000	0.27541	TCA	.		0.647	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
MAP1B	4131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71489897	71489897	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr5:71489897G>A	ENST00000296755.7	+	5	1013	c.715G>A	c.(715-717)Gtc>Atc	p.V239I		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	239					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ATCAGTGGAAGTCCCATCTCC	0.453																																					p.V239I	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B	155	0			c.G715A						.						109.0	104.0	106.0					5																	71489897		2203	4300	6503	SO:0001583	missense	4131	exon5			GTGGAAGTCCCAT	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.715G>A	5.37:g.71489897G>A	ENSP00000296755:p.Val239Ile	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	13.0	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	G	9.782	1.175522	0.21704	.	.	ENSG00000131711	ENST00000296755;ENST00000511641;ENST00000504492	T;T;T	0.21932	1.98;1.98;1.98	6.08	6.08	0.98989	.	0.000000	0.64402	D	0.000013	T	0.16471	0.0396	L	0.33485	1.01	0.37405	D	0.913005	B;B	0.31077	0.307;0.307	B;B	0.20767	0.031;0.031	T	0.05649	-1.0872	10	0.48119	T	0.1	-18.972	13.8168	0.63297	0.0695:0.0:0.9305:0.0	.	113;239	A2BDK6;P46821	.;MAP1B_HUMAN	I	239;256;113	ENSP00000296755:V239I;ENSP00000423444:V256I;ENSP00000423416:V113I	ENSP00000296755:V239I	V	+	1	0	MAP1B	71525653	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.233000	0.72320	2.894000	0.99253	0.591000	0.81541	GTC	.		0.453	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
KMT2B	9757	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36220117	36220117	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr19:36220117A>G	ENST00000222270.7	+	22	4837	c.4837A>G	c.(4837-4839)Atc>Gtc	p.I1613V	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.I1613V	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1613					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CAACTGTGCCATCTGGTCGGC	0.637																																					p.I1613V		.											.	MLL4	697	0			c.A4837G						.						53.0	52.0	53.0					19																	36220117		2131	4242	6373	SO:0001583	missense	8085	exon22			TGTGCCATCTGGT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.4837A>G	19.37:g.36220117A>G	ENSP00000222270:p.Ile1613Val	Somatic	153.0	1.0		WXS	Illumina HiSeq	Phase_I	132.0	37.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	A	9.696	1.153161	0.21371	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	T;T	0.70282	-0.47;-0.47	5.13	5.13	0.70059	.	0.000000	0.45361	D	0.000368	T	0.61223	0.2330	L	0.31845	0.965	0.30052	N	0.811659	B	0.33919	0.432	B	0.33196	0.159	T	0.67241	-0.5720	10	0.72032	D	0.01	.	14.0545	0.64759	1.0:0.0:0.0:0.0	.	1613	Q9UMN6	MLL4_HUMAN	V	1613	ENSP00000222270:I1613V;ENSP00000398837:I1613V	ENSP00000222270:I1613V	I	+	1	0	AD000671.1	40911957	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	1.571000	0.36450	2.156000	0.67533	0.533000	0.62120	ATC	.		0.637	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
MMRN1	22915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	90856345	90856345	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr4:90856345C>A	ENST00000394980.1	+	7	1833	c.1514C>A	c.(1513-1515)tCc>tAc	p.S505Y	MMRN1_ENST00000508372.1_Missense_Mutation_p.S247Y|MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000264790.2_Missense_Mutation_p.S505Y			Q13201	MMRN1_HUMAN	multimerin 1	505					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TATTATGAATCCCTCAATAAA	0.383																																					p.S505Y		.											.	MMRN1	94	0			c.C1514A						.						92.0	90.0	91.0					4																	90856345		2203	4300	6503	SO:0001583	missense	22915	exon6			ATGAATCCCTCAA	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.1514C>A	4.37:g.90856345C>A	ENSP00000378431:p.Ser505Tyr	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	26.0	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	37	CCDS3635.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.426915	0.25726	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000508372	T;T;T	0.74632	-0.56;-0.56;-0.86	5.12	5.12	0.69794	.	0.082304	0.52532	D	0.000078	D	0.84415	0.5467	M	0.68952	2.095	0.80722	D	1	D	0.76494	0.999	D	0.62955	0.909	D	0.85271	0.1056	10	0.62326	D	0.03	.	19.4343	0.94785	0.0:1.0:0.0:0.0	.	505	Q13201	MMRN1_HUMAN	Y	505;505;247	ENSP00000378431:S505Y;ENSP00000264790:S505Y;ENSP00000426461:S247Y	ENSP00000264790:S505Y	S	+	2	0	MMRN1	91075368	1.000000	0.71417	0.958000	0.39756	0.022000	0.10575	2.521000	0.45563	2.751000	0.94390	0.591000	0.81541	TCC	.		0.383	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
MNS1	55329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	56748716	56748716	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr15:56748716C>G	ENST00000260453.3	-	3	393	c.229G>C	c.(229-231)Gaa>Caa	p.E77Q		NM_018365.2	NP_060835.1	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	77	Glu-rich.				cilium organization (GO:0044782)|left/right axis specification (GO:0070986)|meiotic nuclear division (GO:0007126)	axoneme (GO:0005930)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)|sperm flagellum (GO:0036126)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	20				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		TTGTTTTCTTCTGCCTGAACG	0.328																																					p.E77Q		.											.	MNS1	91	0			c.G229C						.						146.0	133.0	137.0					15																	56748716		2191	4292	6483	SO:0001583	missense	55329	exon3			TTTCTTCTGCCTG	AK002084	CCDS10158.1	15q21.3	2013-01-16			ENSG00000138587	ENSG00000138587			29636	protein-coding gene	gene with protein product	"""spermatogenesis associated 40"""	610766				7625268, 8032679	Standard	NM_018365		Approved	FLJ11222, SPATA40	uc002adr.2	Q8NEH6	OTTHUMG00000132034	ENST00000260453.3:c.229G>C	15.37:g.56748716C>G	ENSP00000260453:p.Glu77Gln	Somatic	279.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	32.0	NM_018365	Q8IYT6|Q9NUP4	Missense_Mutation	SNP	ENST00000260453.3	37	CCDS10158.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643694	0.47258	.	.	ENSG00000138587	ENST00000260453	T	0.15952	2.38	5.87	4.91	0.64330	.	0.043082	0.85682	D	0.000000	T	0.13756	0.0333	L	0.38175	1.15	0.58432	D	0.999997	B	0.32653	0.379	B	0.27380	0.079	T	0.06499	-1.0823	10	0.23302	T	0.38	-24.5181	15.5183	0.75842	0.0:0.8612:0.1388:0.0	.	77	Q8NEH6	MNS1_HUMAN	Q	77	ENSP00000260453:E77Q	ENSP00000260453:E77Q	E	-	1	0	MNS1	54536008	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.044000	0.49830	2.941000	0.99782	0.655000	0.94253	GAA	.		0.328	MNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255047.2	NM_018365	
MS4A15	219995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	60543106	60543106	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr11:60543106G>A	ENST00000405633.3	+	7	720	c.641G>A	c.(640-642)aGc>aAc	p.S214N	MS4A15_ENST00000528170.1_Missense_Mutation_p.S173N|MS4A15_ENST00000337911.4_Missense_Mutation_p.S121N	NM_001098835.1	NP_001092305.1	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member 15	214						integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(3)	6						AACGCCTTCAGCGCAGACTTC	0.577											OREG0020991	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S214N		.											.	MS4A15	69	0			c.G641A						.						144.0	147.0	146.0					11																	60543106		2203	4300	6503	SO:0001583	missense	219995	exon7			CCTTCAGCGCAGA	AY584608	CCDS7991.1, CCDS44617.1, CCDS60802.1	11q12.2	2008-03-25							28573	protein-coding gene	gene with protein product							Standard	NM_001098835		Approved		uc009ynf.1	Q8N5U1		ENST00000405633.3:c.641G>A	11.37:g.60543106G>A	ENSP00000386022:p.Ser214Asn	Somatic	99.0	0.0	1046	WXS	Illumina HiSeq	Phase_I	45.0	17.0	NM_001098835	A9UJY6|A9UJY7|F2Z2J5	Missense_Mutation	SNP	ENST00000405633.3	37	CCDS44617.1	.	.	.	.	.	.	.	.	.	.	G	7.611	0.674789	0.14841	.	.	ENSG00000166961	ENST00000528170;ENST00000337911;ENST00000405633	T;T;T	0.14766	2.48;2.52;2.94	5.25	4.34	0.51931	.	0.648678	0.16274	N	0.221645	T	0.12475	0.0303	L	0.57536	1.79	0.20703	N	0.999865	B;B	0.31383	0.321;0.115	B;B	0.23275	0.045;0.045	T	0.21008	-1.0258	10	0.17369	T	0.5	-20.6529	9.7942	0.40724	0.0954:0.0:0.9046:0.0	.	173;214	F2Z2J5;Q8N5U1	.;M4A15_HUMAN	N	173;121;214	ENSP00000434165:S173N;ENSP00000338692:S121N;ENSP00000386022:S214N	ENSP00000338692:S121N	S	+	2	0	MS4A15	60299682	0.972000	0.33761	0.996000	0.52242	0.260000	0.26232	2.068000	0.41471	1.206000	0.43276	-0.148000	0.13756	AGC	.		0.577	MS4A15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395618.1		
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8994178	8994178	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr19:8994178C>A	ENST00000397910.4	-	65	41710	c.41507G>T	c.(41506-41508)gGc>gTc	p.G13836V	MUC16_ENST00000380951.5_Missense_Mutation_p.G477V	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13839	SEA 12. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTACAGAGGGCCAACACTGGT	0.527																																					p.G13836V		.											.	MUC16	566	0			c.G41507T						.						114.0	101.0	105.0					19																	8994178		2000	4175	6175	SO:0001583	missense	94025	exon65			AGAGGGCCAACAC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41507G>T	19.37:g.8994178C>A	ENSP00000381008:p.Gly13836Val	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	22.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	14.26|14.26	2.483391|2.483391	0.44147|0.44147	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T;T	.|0.39056	.|1.1;1.1	3.74|3.74	2.67|2.67	0.31697|0.31697	.|SEA (1);	.|0.203527	.|0.24523	.|N	.|0.037787	T|T	0.65048|0.65048	0.2654|0.2654	M|M	0.87547|0.87547	2.89|2.89	.|.	.|.	.|.	.|D;D	.|0.89917	.|0.994;1.0	.|D;D	.|0.87578	.|0.936;0.998	T|T	0.75752|0.75752	-0.3207|-0.3207	4|9	.|0.87932	.|D	.|0	.|.	9.4867|9.4867	0.38933|0.38933	0.0:0.7852:0.2148:0.0|0.0:0.7852:0.2148:0.0	.|.	.|21481;13836	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	S|V	676|13836;477	.|ENSP00000381008:G13836V;ENSP00000370338:G477V	.|ENSP00000370338:G477V	A|G	-|-	1|2	0|0	MUC16|MUC16	8855178|8855178	0.005000|0.005000	0.15991|0.15991	0.001000|0.001000	0.08648|0.08648	0.212000|0.212000	0.24457|0.24457	0.338000|0.338000	0.19858|0.19858	0.905000|0.905000	0.36596|0.36596	0.650000|0.650000	0.86243|0.86243	GCC|GGC	.		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	108220704	108220704	+	Splice_Site	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr3:108220704T>C	ENST00000273353.3	-	4	312		c.e4-2			NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15							cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GCTCAGACTCTGCAGAGAGAA	0.378																																					.		.											.	MYH15	73	0			c.256-2A>G						.						135.0	130.0	132.0					3																	108220704		1890	4120	6010	SO:0001630	splice_region_variant	22989	exon5			AGACTCTGCAGAG	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.256-2A>G	3.37:g.108220704T>C		Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	19.0	NM_014981		Splice_Site	SNP	ENST00000273353.3	37	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.938203	0.52972	.	.	ENSG00000144821	ENST00000273353	.	.	.	5.58	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2051	0.48765	0.0:0.073:0.0:0.927	.	.	.	.	.	-1	.	.	.	-	.	.	MYH15	109703394	1.000000	0.71417	0.237000	0.24090	0.191000	0.23601	5.616000	0.67709	0.941000	0.37499	0.482000	0.46254	.	.		0.378	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	Intron
NFKBIA	4792	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	35871997	35872005	+	In_Frame_Del	DEL	CCAAGGACA	CCAAGGACA	-			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	CCAAGGACA	CCAAGGACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr14:35871997_35872005delCCAAGGACA	ENST00000216797.5	-	4	709_717	c.608_616delTGTCCTTGG	c.(607-618)gtgtccttgggt>ggt	p.VSL203del	NFKBIA_ENST00000557389.1_In_Frame_Del_p.VSL113del|NFKBIA_ENST00000557140.1_In_Frame_Del_p.VSL203del|NFKBIA_ENST00000557100.1_Intron	NM_020529.2	NP_065390.1	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	203					apoptotic process (GO:0006915)|cellular response to cold (GO:0070417)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|cytoplasmic sequestering of transcription factor (GO:0042994)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein import into nucleus, translocation (GO:0000060)|regulation of cell proliferation (GO:0042127)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to exogenous dsRNA (GO:0043330)|response to muramyl dipeptide (GO:0032495)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|nuclear localization sequence binding (GO:0008139)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(1)|large_intestine(2)|liver(1)	7	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Acetylsalicylic acid(DB00945)	ACATCAGCACCCAAGGACACCAAAAGCTC	0.502																																					p.203_206del		.											.	NFKBIA	721	0			c.608_616del						.																																			SO:0001651	inframe_deletion	4792	exon4			CAGCACCCAAGGA		CCDS9656.1	14q13	2014-09-17			ENSG00000100906	ENSG00000100906		"""Ankyrin repeat domain containing"""	7797	protein-coding gene	gene with protein product		164008		NFKBI		1829648	Standard	NM_020529		Approved	IKBA, MAD-3, IkappaBalpha	uc001wtf.4	P25963	OTTHUMG00000140220	ENST00000216797.5:c.608_616delTGTCCTTGG	14.37:g.35871997_35872005delCCAAGGACA	ENSP00000216797:p.Val203_Leu205del	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	12.0	NM_020529	B2R8L6	In_Frame_Del	DEL	ENST00000216797.5	37	CCDS9656.1																																																																																			.		0.502	NFKBIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276683.1	NM_020529	
NXPH2	11249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	139428887	139428887	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:139428887T>C	ENST00000272641.3	-	2	506	c.400A>G	c.(400-402)Att>Gtt	p.I134V		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	134	III.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		TGGTCAACAATTTTCCCTGTG	0.408																																					p.I134V		.											.	NXPH2	72	0			c.A400G						.						58.0	52.0	54.0					2																	139428887		1868	4116	5984	SO:0001583	missense	11249	exon2			CAACAATTTTCCC	AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.400A>G	2.37:g.139428887T>C	ENSP00000272641:p.Ile134Val	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	30.0	NM_007226	B7WP24|Q494R1|Q75QC3	Missense_Mutation	SNP	ENST00000272641.3	37	CCDS46421.1	.	.	.	.	.	.	.	.	.	.	T	17.18	3.322995	0.60634	.	.	ENSG00000144227	ENST00000272641	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.68256	0.2981	L	0.41824	1.3	0.58432	D	0.999999	D	0.63046	0.992	D	0.80764	0.994	T	0.66208	-0.5981	8	.	.	.	-21.3489	16.2026	0.82095	0.0:0.0:0.0:1.0	.	134	O95156	NXPH2_HUMAN	V	134	.	.	I	-	1	0	NXPH2	139145357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.285000	0.76669	0.533000	0.62120	ATT	.		0.408	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331901.1		
OGFOD3	79701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80373361	80373361	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr17:80373361C>T	ENST00000313056.5	-	2	368	c.217G>A	c.(217-219)Gtc>Atc	p.V73I	Y_RNA_ENST00000364369.1_RNA|HEXDC_ENST00000337014.6_5'Flank|OGFOD3_ENST00000329197.5_Missense_Mutation_p.V73I	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	73						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										CGGGCCAGGACCTCTGCGACC	0.662																																					p.V73I		.											.	.	.	0			c.G217A						.						74.0	75.0	75.0					17																	80373361		2202	4299	6501	SO:0001583	missense	79701	exon2			CCAGGACCTCTGC	BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.217G>A	17.37:g.80373361C>T	ENSP00000320116:p.Val73Ile	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	25.0	NM_175902	C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	ENST00000313056.5	37	CCDS11811.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869700	0.51588	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.33654	1.86;1.4	5.0	5.0	0.66597	.	0.154165	0.43919	D	0.000506	T	0.44371	0.1290	L	0.50333	1.59	0.41997	D	0.990875	P;D	0.60575	0.893;0.988	B;P	0.52386	0.446;0.697	T	0.25257	-1.0137	10	0.28530	T	0.3	-40.5448	15.8258	0.78706	0.0:1.0:0.0:0.0	.	73;73	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	I	73	ENSP00000320116:V73I;ENSP00000330075:V73I	ENSP00000320116:V73I	V	-	1	0	C17orf101	77966650	1.000000	0.71417	0.983000	0.44433	0.024000	0.10985	3.342000	0.52159	2.299000	0.77371	0.655000	0.94253	GTC	.		0.662	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442895.1	NM_175902	
OR10Q1	219960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57995759	57995759	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr11:57995759T>A	ENST00000316770.2	-	1	631	c.589A>T	c.(589-591)Atc>Ttc	p.I197F		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				TGCACGCGGATGTCAGCGCAG	0.597																																					p.I197F		.											.	OR10Q1	70	0			c.A589T						.						77.0	65.0	69.0					11																	57995759		2201	4295	6496	SO:0001583	missense	219960	exon1			CGCGGATGTCAGC	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.589A>T	11.37:g.57995759T>A	ENSP00000314324:p.Ile197Phe	Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	42.0	NM_001004471	Q6IFG4	Missense_Mutation	SNP	ENST00000316770.2	37	CCDS31547.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.480804	0.26598	.	.	ENSG00000180475	ENST00000316770	T	0.00130	8.69	4.47	3.32	0.38043	GPCR, rhodopsin-like superfamily (1);	0.332026	0.21704	N	0.070378	T	0.00328	0.0010	M	0.72576	2.205	0.24380	N	0.994799	P	0.50066	0.931	P	0.58077	0.832	T	0.37126	-0.9719	10	0.87932	D	0	.	9.3326	0.38032	0.1608:0.0:0.0:0.8392	.	197	Q8NGQ4	O10Q1_HUMAN	F	197	ENSP00000314324:I197F	ENSP00000314324:I197F	I	-	1	0	OR10Q1	57752335	0.782000	0.28689	0.294000	0.24946	0.016000	0.09150	1.131000	0.31406	0.726000	0.32339	-0.481000	0.04817	ATC	.		0.597	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471	
PCDH11Y	83259	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	Y	4968507	4968507	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chrY:4968507A>G	ENST00000333703.4	+	5	3368	c.2855A>G	c.(2854-2856)gAc>gGc	p.D952G	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.D963G|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.D963G	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	963					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TTCAAGCCTGACAGCCCTGAT	0.458																																					p.D963G		.											.	.	.	0			c.A2888G						.																																			SO:0001583	missense	83259	exon2			AGCCTGACAGCCC	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.2855A>G	Y.37:g.4968507A>G	ENSP00000330552:p.Asp952Gly	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	21.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	CCDS14776.1																																																																																			.		0.458	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
PDK4	5166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	95222151	95222151	+	Silent	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr7:95222151G>A	ENST00000005178.5	-	4	647	c.450C>T	c.(448-450)gtC>gtT	p.V150V		NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	150	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			TTTGATTGGTGACTGGGTCAA	0.383																																					p.V150V		.											.	PDK4	358	0			c.C450T						.						161.0	155.0	157.0					7																	95222151		2203	4300	6503	SO:0001819	synonymous_variant	5166	exon4			ATTGGTGACTGGG	U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.450C>T	7.37:g.95222151G>A		Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	35.0	NM_002612		Silent	SNP	ENST00000005178.5	37	CCDS5643.1																																																																																			.		0.383	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333298.1	NM_002612	
PER1	5187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	8051980	8051980	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr17:8051980T>C	ENST00000317276.4	-	8	1267	c.1030A>G	c.(1030-1032)Atc>Gtc	p.I344V	PER1_ENST00000354903.5_Missense_Mutation_p.I328V|PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Missense_Mutation_p.I324V	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	344					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CCCGAATGGATGCGCTCTGCA	0.617			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.I344V		.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	723	0			c.A1030G						.						80.0	80.0	80.0					17																	8051980		2203	4300	6503	SO:0001583	missense	5187	exon8			AATGGATGCGCTC	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.1030A>G	17.37:g.8051980T>C	ENSP00000314420:p.Ile344Val	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	19.0	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	37	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	T	8.750	0.921047	0.17982	.	.	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.34667	2.79;1.35	4.83	1.35	0.21983	.	0.170445	0.51477	N	0.000087	T	0.18087	0.0434	N	0.02830	-0.485	0.38959	D	0.958516	B;P	0.40970	0.063;0.734	B;P	0.50825	0.054;0.651	T	0.24476	-1.0159	10	0.02654	T	1	-9.7898	7.3697	0.26794	0.0:0.2772:0.0:0.7228	.	328;344	B4DI49;O15534	.;PER1_HUMAN	V	344;328	ENSP00000314420:I344V;ENSP00000346979:I328V	ENSP00000314420:I344V	I	-	1	0	PER1	7992705	0.249000	0.23941	0.986000	0.45419	0.922000	0.55478	0.693000	0.25497	0.295000	0.22570	0.460000	0.39030	ATC	.		0.617	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
PGAM5	192111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	133291565	133291565	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr12:133291565C>T	ENST00000498926.2	+	2	371	c.313C>T	c.(313-315)Cat>Tat	p.H105Y	PXMP2_ENST00000545677.1_Missense_Mutation_p.A144V|PGAM5_ENST00000543955.1_5'UTR|PGAM5_ENST00000454808.2_5'UTR|PGAM5_ENST00000317555.2_Missense_Mutation_p.H105Y	NM_001170543.1|NM_001170544.1	NP_001164014.1|NP_001164015.1	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5	105					dephosphorylation (GO:0016311)|necroptotic process (GO:0070266)|positive regulation of GTPase activity (GO:0043547)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein complex binding (GO:0032403)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		CCTCATCAGGCATTCCCAGTA	0.587																																					p.H105Y		.											.	PGAM5	90	0			c.C313T						.						130.0	86.0	101.0					12																	133291565		2202	4300	6502	SO:0001583	missense	192111	exon2			ATCAGGCATTCCC	BC008196	CCDS9280.1, CCDS53845.1	12q24.33	2011-07-28			ENSG00000247077	ENSG00000247077			28763	protein-coding gene	gene with protein product		614939				11283018	Standard	NM_001170543		Approved	MGC5352, BXLBv68	uc009zyv.3	Q96HS1	OTTHUMG00000168021	ENST00000498926.2:c.313C>T	12.37:g.133291565C>T	ENSP00000438465:p.His105Tyr	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	25.0	NM_138575	A9LN06|C9IZY7|Q96JB0	Missense_Mutation	SNP	ENST00000498926.2	37	CCDS53845.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.7|26.7	4.758363|4.758363	0.89843|0.89843	.|.	.|.	ENSG00000176894|ENSG00000247077	ENST00000545677|ENST00000317555;ENST00000498926	.|T;D	.|0.90261	.|-0.65;-2.64	4.64|4.64	4.64|4.64	0.57946|0.57946	.|Histidine phosphatase superfamily, clade-1 (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97492|0.97492	0.9179|0.9179	H|H	0.99026|0.99026	4.405|4.405	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.994;0.999	D|D	0.99806|0.99806	1.1038|1.1038	6|10	0.87932|0.87932	D|D	0|0	-2.6454|-2.6454	17.5103|17.5103	0.87758|0.87758	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|105;105	.|Q96HS1;Q96HS1-2	.|PGAM5_HUMAN;.	V|Y	144|105	.|ENSP00000321503:H105Y;ENSP00000438465:H105Y	ENSP00000444697:A144V|ENSP00000321503:H105Y	A|H	+|+	2|1	0|0	PXMP2|PGAM5	131801638|131801638	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	7.448000|7.448000	0.80631|0.80631	2.136000|2.136000	0.66102|0.66102	0.462000|0.462000	0.41574|0.41574	GCA|CAT	.		0.587	PGAM5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397562.1	NM_138575	
PIGM	93183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160001525	160001525	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:160001525C>G	ENST00000368090.2	-	1	258	c.5G>C	c.(4-6)gGc>gCc	p.G2A		NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M	2					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTTGGTGGAGCCCATGATCTG	0.582																																					p.G2A		.											.	PIGM	228	0			c.G5C						.						42.0	48.0	45.0					1																	160001525		2203	4300	6503	SO:0001583	missense	93183	exon1			GTGGAGCCCATGA	AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081	ENST00000368090.2:c.5G>C	1.37:g.160001525C>G	ENSP00000357069:p.Gly2Ala	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	17.0	NM_145167		Missense_Mutation	SNP	ENST00000368090.2	37	CCDS1192.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836149	0.32421	.	.	ENSG00000143315	ENST00000368090	T	0.39997	1.05	4.63	-4.04	0.04010	.	1.050460	0.07514	N	0.909476	T	0.04679	0.0127	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27468	-1.0073	9	.	.	.	-4.1484	1.1246	0.01732	0.1368:0.2197:0.2694:0.3741	.	2	Q9H3S5	PIGM_HUMAN	A	2	ENSP00000357069:G2A	.	G	-	2	0	PIGM	158268149	0.000000	0.05858	0.001000	0.08648	0.345000	0.29048	-0.514000	0.06298	-1.179000	0.02737	0.561000	0.74099	GGC	.		0.582	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060643.2	NM_145167	
POMC	5443	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	25384548	25384548	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:25384548G>C	ENST00000405623.1	-	3	661	c.206C>G	c.(205-207)cCt>cGt	p.P69R	POMC_ENST00000264708.3_Missense_Mutation_p.P69R|RP11-509E16.1_ENST00000567599.1_lincRNA|POMC_ENST00000380794.1_Missense_Mutation_p.P69R|POMC_ENST00000395826.2_Missense_Mutation_p.P69R			P01189	COLI_HUMAN	proopiomelanocortin	69					cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	CTCGGTCAGAGGCTGCTCGTC	0.687																																					p.P69R	Colon(110;1515 1566 8452 10082 43216)	.											.	POMC	91	0			c.C206G	GRCh37	CD064616	POMC	D		.						13.0	10.0	11.0					2																	25384548		2017	3975	5992	SO:0001583	missense	5443	exon4			GTCAGAGGCTGCT		CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.206C>G	2.37:g.25384548G>C	ENSP00000384092:p.Pro69Arg	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	19.0	NM_001035256	P78442|Q53T23|Q9UD39|Q9UD40	Missense_Mutation	SNP	ENST00000405623.1	37	CCDS1717.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112128	0.37242	.	.	ENSG00000115138	ENST00000380794;ENST00000405623;ENST00000264708;ENST00000395826;ENST00000449220	D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74	5.19	3.27	0.37495	Pro-opiomelanocortin N-terminal (1);	0.114016	0.64402	D	0.000010	D	0.87414	0.6171	M	0.72118	2.19	0.54753	D	0.999982	D	0.58970	0.984	P	0.59889	0.865	D	0.86808	0.1996	10	0.87932	D	0	-17.9688	10.087	0.42423	0.1787:0.0:0.8213:0.0	.	69	P01189	COLI_HUMAN	R	69	ENSP00000370171:P69R;ENSP00000384092:P69R;ENSP00000264708:P69R;ENSP00000379170:P69R;ENSP00000387993:P69R	ENSP00000264708:P69R	P	-	2	0	POMC	25238052	1.000000	0.71417	0.709000	0.30452	0.083000	0.17756	3.390000	0.52523	0.595000	0.29777	-0.224000	0.12420	CCT	.		0.687	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	NM_001035256	
PRG4	10216	hgsc.bcm.edu;bcgsc.ca	37	1	186277380	186277380	+	Silent	SNP	T	T	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:186277380T>A	ENST00000445192.2	+	7	2574	c.2529T>A	c.(2527-2529)gcT>gcA	p.A843A	PRG4_ENST00000367485.4_Silent_p.A750A|PRG4_ENST00000367486.3_Silent_p.A800A|PRG4_ENST00000367484.3_Silent_p.A372A|PRG4_ENST00000367483.4_Silent_p.A802A	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	843	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AGAAGCCTGCTCCAACTACTC	0.542																																					p.A843A		.											.	PRG4	91	0			c.T2529A						.						195.0	226.0	215.0					1																	186277380		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon7			GCCTGCTCCAACT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2529T>A	1.37:g.186277380T>A		Somatic	277.0	0.0		WXS	Illumina HiSeq	Phase_I	261.0	23.0	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																			.		0.542	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PSRC1	84722	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109823808	109823808	+	Silent	SNP	C	C	A	rs374475468		TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:109823808C>A	ENST00000438534.2	-	5	723	c.585G>T	c.(583-585)tcG>tcT	p.S195S	PSRC1_ENST00000369903.2_Silent_p.S195S|PSRC1_ENST00000409267.1_Silent_p.S195S|PSRC1_ENST00000369909.2_Silent_p.S195S|PSRC1_ENST00000369907.3_Silent_p.S195S|PSRC1_ENST00000409138.2_Silent_p.S195S|PSRC1_ENST00000369904.3_Silent_p.S195S	NM_001005290.3	NP_001005290.1	Q6PGN9	PSRC1_HUMAN	proline/serine-rich coiled-coil 1	195	4 X 4 AA repeats of P-X-X-P.				microtubule bundle formation (GO:0001578)|mitotic metaphase plate congression (GO:0007080)|negative regulation of cell growth (GO:0030308)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mitotic spindle organization (GO:0060236)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	microtubule binding (GO:0008017)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	7		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0286)|Lung(183;0.0658)|COAD - Colon adenocarcinoma(174;0.112)|Epithelial(280;0.188)|all cancers(265;0.213)		CTGGGGGAGTCGATCGGGTAA	0.572																																					p.S195S		.											.	PSRC1	90	0			c.G585T						.						24.0	30.0	28.0					1																	109823808		2203	4300	6503	SO:0001819	synonymous_variant	84722	exon5			GGGAGTCGATCGG		CCDS797.1, CCDS30791.1	1p13.3	2008-02-05			ENSG00000134222	ENSG00000134222			24472	protein-coding gene	gene with protein product	"""differential display and activated by p53"""	613126				12427559, 10618717	Standard	NM_001032291		Approved	DDA3	uc001dxd.3	Q6PGN9	OTTHUMG00000012000	ENST00000438534.2:c.585G>T	1.37:g.109823808C>A		Somatic	115.0	1.0		WXS	Illumina HiSeq	Phase_I	66.0	14.0	NM_001032291	Q5T2Z3|Q6ZTI8|Q71MG3|Q9BV77	Silent	SNP	ENST00000438534.2	37																																																																																				.		0.572	PSRC1-202	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000335567.3	NM_032636	
PRG4	10216	hgsc.bcm.edu;bcgsc.ca	37	1	186277383	186277383	+	Silent	SNP	A	A	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:186277383A>C	ENST00000445192.2	+	7	2577	c.2532A>C	c.(2530-2532)ccA>ccC	p.P844P	PRG4_ENST00000367485.4_Silent_p.P751P|PRG4_ENST00000367486.3_Silent_p.P801P|PRG4_ENST00000367484.3_Silent_p.P373P|PRG4_ENST00000367483.4_Silent_p.P803P	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	844	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AGCCTGCTCCAACTACTCCTG	0.542																																					p.P844P		.											.	PRG4	91	0			c.A2532C						.						194.0	224.0	214.0					1																	186277383		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon7			TGCTCCAACTACT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2532A>C	1.37:g.186277383A>C		Somatic	275.0	0.0		WXS	Illumina HiSeq	Phase_I	266.0	29.0	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																			.		0.542	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PTPRQ	374462	bcgsc.ca;mdanderson.org	37	12	80839305	80839305	+	Silent	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr12:80839305A>G	ENST00000266688.5	+	3	198	c.198A>G	c.(196-198)agA>agG	p.R66R				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	108	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CCGGGGAAAGAGTCGGATCTG	0.363																																					p.R66R		.											.	.	.	0			c.A198G						.						92.0	82.0	85.0					12																	80839305		692	1590	2282	SO:0001819	synonymous_variant	374462	exon3			GGAAAGAGTCGGA	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.198A>G	12.37:g.80839305A>G		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_1	12.0	3.0	NM_001145026		Silent	SNP	ENST00000266688.5	37																																																																																				.		0.363	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
RAD1	5810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	34914840	34914840	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr5:34914840A>G	ENST00000382038.2	-	2	1577	c.158T>C	c.(157-159)gTg>gCg	p.V53A	RAD1_ENST00000341754.4_Missense_Mutation_p.V53A|BRIX1_ENST00000336767.5_5'Flank	NM_002853.3	NP_002844.1	O60671	RAD1_HUMAN	RAD1 checkpoint DNA exonuclease	53					cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|meiotic recombination checkpoint (GO:0051598)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|substantia nigra development (GO:0021762)	chromosome (GO:0005694)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|damaged DNA binding (GO:0003684)|exodeoxyribonuclease III activity (GO:0008853)			endometrium(3)|large_intestine(1)|lung(5)|urinary_tract(1)	10	all_lung(31;0.000107)	Lung NSC(810;5.19e-05)|Ovarian(839;0.0448)|Breast(839;0.198)	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			TGCATTTTCCACTGTTACTTT	0.383								Other conserved DNA damage response genes																													p.V53A		.											.	RAD1	227	0			c.T158C						.						175.0	162.0	167.0					5																	34914840		2203	4300	6503	SO:0001583	missense	5810	exon2			TTTTCCACTGTTA	AF074717	CCDS3905.1	5p13	2014-08-08	2014-08-08		ENSG00000113456	ENSG00000113456	3.1.11.2		9806	protein-coding gene	gene with protein product	"""exonuclease homolog RAD1"", ""checkpoint control protein HRAD1"", ""cell cycle checkpoint protein Hrad1"", ""Rad1-like DNA damage checkpoint"", ""DNA repair exonuclease REC1"""	603153	"""RAD1 (S. pombe) homolog"", ""RAD1 homolog (S. pombe)"""			9716408, 9828137	Standard	NR_026591		Approved	HRAD1, REC1	uc003jix.3	O60671	OTTHUMG00000090783	ENST00000382038.2:c.158T>C	5.37:g.34914840A>G	ENSP00000371469:p.Val53Ala	Somatic	179.0	1.0		WXS	Illumina HiSeq	Phase_I	185.0	116.0	NM_002853	O75572|O95304|Q1W161|Q5KSM0|Q5KSM1|Q9UEP1	Missense_Mutation	SNP	ENST00000382038.2	37	CCDS3905.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.050769	0.75960	.	.	ENSG00000113456	ENST00000382038;ENST00000341754;ENST00000542494	T;T	0.10005	2.92;2.92	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.23965	0.0580	L	0.47078	1.49	0.80722	D	1	P	0.38129	0.619	P	0.53224	0.721	T	0.00451	-1.1731	10	0.52906	T	0.07	.	16.0193	0.80468	1.0:0.0:0.0:0.0	.	53	O60671	RAD1_HUMAN	A	53	ENSP00000371469:V53A;ENSP00000340879:V53A	ENSP00000313467:V53A	V	-	2	0	RAD1	34950597	1.000000	0.71417	0.997000	0.53966	0.686000	0.39977	8.574000	0.90763	2.190000	0.69967	0.533000	0.62120	GTG	.		0.383	RAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207567.1	NM_002853	
RASD2	23551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	35947948	35947948	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr22:35947948G>A	ENST00000216127.4	+	3	1312	c.670G>A	c.(670-672)Gag>Aag	p.E224K		NM_014310.3	NP_055125.2	Q96D21	RHES_HUMAN	RASD family, member 2	224	Interaction with GNB1, GNB2 and GNB3.				locomotory behavior (GO:0007626)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein sumoylation (GO:0033235)|regulation of cAMP-mediated signaling (GO:0043949)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission, dopaminergic (GO:0001963)	plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	13						CCGCGTCAAGGAGATGGACGC	0.642																																					p.E224K		.											.	RASD2	659	0			c.G670A						.						96.0	80.0	85.0					22																	35947948		2203	4300	6503	SO:0001583	missense	23551	exon3			GTCAAGGAGATGG	AF279143	CCDS13916.1	22q13.1	2014-05-09			ENSG00000100302	ENSG00000100302			18229	protein-coding gene	gene with protein product	"""tumor endothelial marker 2"", ""Ras homolog enriched in striatum"""	612842				10947988, 10467249, 14724584	Standard	NM_014310		Approved	TEM2, Rhes, MGC:4834	uc003anx.3	Q96D21	OTTHUMG00000150607	ENST00000216127.4:c.670G>A	22.37:g.35947948G>A	ENSP00000216127:p.Glu224Lys	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	15.0	NM_014310	O95520|Q5THY8	Missense_Mutation	SNP	ENST00000216127.4	37	CCDS13916.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.843199	0.32606	.	.	ENSG00000100302	ENST00000216127	T	0.70631	-0.5	5.68	5.68	0.88126	.	0.479994	0.25294	N	0.031720	T	0.60612	0.2282	N	0.22421	0.69	0.42256	D	0.991998	B	0.02656	0.0	B	0.04013	0.001	T	0.53194	-0.8473	10	0.27785	T	0.31	.	19.8575	0.96767	0.0:0.0:1.0:0.0	.	224	Q96D21	RHES_HUMAN	K	224	ENSP00000216127:E224K	ENSP00000216127:E224K	E	+	1	0	RASD2	34277894	1.000000	0.71417	0.992000	0.48379	0.913000	0.54294	7.935000	0.87658	2.705000	0.92388	0.556000	0.70494	GAG	.		0.642	RASD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319063.1	NM_014310	
RASGRP4	115727	broad.mit.edu;bcgsc.ca	37	19	38905729	38905729	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr19:38905729T>C	ENST00000587738.1	-	9	1059	c.989A>G	c.(988-990)cAc>cGc	p.H330R	RASGRP4_ENST00000433821.2_Intron|RASGRP4_ENST00000293062.9_Missense_Mutation_p.H233R|RASGRP4_ENST00000426920.2_Intron|RASGRP4_ENST00000454404.2_Missense_Mutation_p.H296R|RASGRP4_ENST00000586305.1_Missense_Mutation_p.H316R|RASGRP4_ENST00000587753.1_Intron			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	330	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GTAGTTGTTGTGGGAGGCAAG	0.652																																					p.H330R		.											.	RASGRP4	660	0			c.A989G						.						9.0	11.0	10.0					19																	38905729		1961	4143	6104	SO:0001583	missense	115727	exon9			TTGTTGTGGGAGG	AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.989A>G	19.37:g.38905729T>C	ENSP00000465772:p.His330Arg	Somatic	144.0	1.0		WXS	Illumina HiSeq	Phase_I	140.0	6.0	NM_170604	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	ENST00000587738.1	37	CCDS46068.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.313935	0.40996	.	.	ENSG00000171777	ENST00000293062;ENST00000405332;ENST00000454404	T	0.27402	1.67	4.62	2.47	0.30058	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.568609	0.20803	N	0.085381	T	0.23054	0.0557	L	0.29908	0.895	0.35650	D	0.811695	B;B;B;B	0.25904	0.137;0.004;0.0;0.004	B;B;B;B	0.37304	0.246;0.004;0.003;0.004	T	0.18999	-1.0319	10	0.23891	T	0.37	-17.3612	5.8704	0.18801	0.0:0.3537:0.0:0.6463	.	233;296;316;330	C0LTP7;C0LTP4;Q8TDF6-2;Q8TDF6	.;.;.;GRP4_HUMAN	R	233;330;330	ENSP00000293062:H233R	ENSP00000293062:H233R	H	-	2	0	RASGRP4	43597569	0.894000	0.30519	1.000000	0.80357	0.957000	0.61999	0.297000	0.19101	0.296000	0.22592	0.402000	0.26972	CAC	.		0.652	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460540.1	NM_170604	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237802427	237802427	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:237802427G>A	ENST00000366574.2	+	46	7358	c.7041G>A	c.(7039-7041)atG>atA	p.M2347I	RYR2_ENST00000360064.6_Missense_Mutation_p.M2345I|RYR2_ENST00000542537.1_Missense_Mutation_p.M2331I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2347	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGCAGCAATGGAAGAAGCCA	0.493																																					p.M2347I		.											.	RYR2	158	0			c.G7041A						.						113.0	116.0	115.0					1																	237802427		1929	4122	6051	SO:0001583	missense	6262	exon46			AGCAATGGAAGAA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7041G>A	1.37:g.237802427G>A	ENSP00000355533:p.Met2347Ile	Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	93.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.805433	0.31961	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97752	-4.52;-4.52;-4.52	5.05	4.14	0.48551	.	0.000000	0.85682	D	0.000000	D	0.92515	0.7623	N	0.25890	0.77	0.80722	D	1	B	0.19817	0.039	B	0.19666	0.026	D	0.86251	0.1649	10	0.02654	T	1	.	8.7322	0.34505	0.0766:0.0:0.7738:0.1496	.	2347	Q92736	RYR2_HUMAN	I	2347;2345;2331	ENSP00000355533:M2347I;ENSP00000353174:M2345I;ENSP00000443798:M2331I	ENSP00000353174:M2345I	M	+	3	0	RYR2	235869050	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.546000	0.60705	1.256000	0.44068	0.561000	0.74099	ATG	.		0.493	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SAMSN1	64092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	15873032	15873032	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr21:15873032A>G	ENST00000400566.1	-	6	667	c.586T>C	c.(586-588)Tgc>Cgc	p.C196R	SAMSN1_ENST00000400564.1_Missense_Mutation_p.C28R|SAMSN1_ENST00000463807.1_5'Flank|SAMSN1_ENST00000285670.2_Missense_Mutation_p.C264R	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	196	SH3.				negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		GGTGTTTTGCAAATAATGTCT	0.373																																					p.C264R		.											.	SAMSN1	94	0			c.T790C						.						187.0	165.0	172.0					21																	15873032		1847	4101	5948	SO:0001583	missense	64092	exon7			TTTTGCAAATAAT	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.586T>C	21.37:g.15873032A>G	ENSP00000383411:p.Cys196Arg	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	12.0	NM_001256370	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	ENST00000400566.1	37	CCDS42906.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.094882	0.56075	.	.	ENSG00000155307	ENST00000285670;ENST00000400566;ENST00000400564	T;T;T	0.26518	3.34;3.34;1.73	5.77	3.34	0.38264	Src homology-3 domain (2);Variant SH3 (1);	0.174005	0.64402	D	0.000006	T	0.13243	0.0321	N	0.00300	-1.685	0.58432	D	0.999997	D;D;P	0.64830	0.994;0.96;0.955	P;P;P	0.59221	0.854;0.788;0.632	T	0.44892	-0.9298	10	0.33940	T	0.23	-6.0622	11.0838	0.48074	0.7523:0.0:0.0:0.2476	.	28;264;196	Q9NSI8-2;F8WAA1;Q9NSI8	.;.;SAMN1_HUMAN	R	264;196;28	ENSP00000285670:C264R;ENSP00000383411:C196R;ENSP00000383409:C28R	ENSP00000285670:C264R	C	-	1	0	SAMSN1	14794903	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.293000	0.59037	0.409000	0.25649	0.528000	0.53228	TGC	.		0.373	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1		
SF3B1	23451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	198267752	198267752	+	Missense_Mutation	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:198267752A>G	ENST00000335508.6	-	13	1818	c.1727T>C	c.(1726-1728)gTg>gCg	p.V576A	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	576					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTCAATGACCACGAGGATCTG	0.333			Mis		myelodysplastic syndrome																																p.V576A		.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	140	0			c.T1727C						.						54.0	52.0	53.0					2																	198267752		2203	4298	6501	SO:0001583	missense	23451	exon13			ATGACCACGAGGA	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1727T>C	2.37:g.198267752A>G	ENSP00000335321:p.Val576Ala	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	23.0	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.262632	0.80358	.	.	ENSG00000115524	ENST00000335508	T	0.63744	-0.06	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.063724	0.64402	D	0.000008	T	0.74496	0.3724	M	0.82923	2.615	0.80722	D	1	P	0.41524	0.753	P	0.48770	0.589	T	0.78807	-0.2059	10	0.72032	D	0.01	.	15.71	0.77620	1.0:0.0:0.0:0.0	.	576	O75533	SF3B1_HUMAN	A	576	ENSP00000335321:V576A	ENSP00000335321:V576A	V	-	2	0	SF3B1	197975997	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	9.227000	0.95236	2.105000	0.64084	0.533000	0.62120	GTG	.		0.333	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
SF3B3	23450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70595533	70595533	+	Splice_Site	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr16:70595533G>A	ENST00000302516.5	+	17	2345	c.2134G>A	c.(2134-2136)Gta>Ata	p.V712I		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	712					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				TTCCCCTCAGGTATTGGCCAT	0.443																																					p.V712I		.											.	SF3B3	91	0			c.G2134A						.						107.0	105.0	106.0					16																	70595533		2198	4300	6498	SO:0001630	splice_region_variant	23450	exon17			CCTCAGGTATTGG	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2134-1G>A	16.37:g.70595533G>A		Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	8.0	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434964	0.62955	.	.	ENSG00000189091	ENST00000302516	T	0.37058	1.22	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.36826	0.0981	L	0.46741	1.465	0.80722	D	1	B	0.22346	0.068	B	0.24006	0.05	T	0.08269	-1.0730	9	.	.	.	.	20.282	0.98514	0.0:0.0:1.0:0.0	.	712	Q15393	SF3B3_HUMAN	I	712	ENSP00000305790:V712I	.	V	+	1	0	SF3B3	69153034	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.807000	0.99171	2.786000	0.95864	0.563000	0.77884	GTA	.		0.443	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	Missense_Mutation
SFMBT2	57713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	7327859	7327860	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr10:7327859_7327860GA>TT	ENST00000361972.4	-	5	583_584	c.493_494TC>AA	c.(493-495)TCg>AAg	p.S165K	SFMBT2_ENST00000379713.3_Missense_Mutation_p.S165K|SFMBT2_ENST00000397167.1_Missense_Mutation_p.S165K	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	165					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.S165L(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TGCTGTCCTCGAACCAGTCAAG	0.426																																					p.S165X|p.S165T		.											.	SFMBT2	141	1	Substitution - Missense(1)	NS(1)	c.C494A|c.T493A						.																																			SO:0001583	missense	57713	exon5			GTCCTCGAACCAG|TCCTCGAACCAGT	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.493_494delinsTT	10.37:g.7327859_7327860delinsTT	ENSP00000355109:p.Ser165Lys	Somatic	233.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	31.0	NM_001029880	A7MD09|Q9HCF5	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000361972.4	37	CCDS31138.1																																																																																			.		0.426	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
SGPP2	130367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	223423159	223423159	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:223423159C>T	ENST00000321276.7	+	5	828	c.742C>T	c.(742-744)Ctc>Ttc	p.L248F		NM_152386.2	NP_689599.2	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphatase 2	248					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	sphingosine-1-phosphate phosphatase activity (GO:0042392)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	18		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		GGCCAGCCCCCTCTTCCCCGT	0.572																																					p.L248F		.											.	SGPP2	91	0			c.C742T						.						145.0	129.0	134.0					2																	223423159		2203	4300	6503	SO:0001583	missense	130367	exon5			AGCCCCCTCTTCC	AF542512	CCDS2453.1	2q36.3	2010-05-26	2010-05-26		ENSG00000163082	ENSG00000163082			19953	protein-coding gene	gene with protein product		612827				12411432	Standard	NM_152386		Approved	SPP2, FLJ39004	uc010zlo.2	Q8IWX5	OTTHUMG00000133156	ENST00000321276.7:c.742C>T	2.37:g.223423159C>T	ENSP00000315137:p.Leu248Phe	Somatic	356.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	55.0	NM_152386	A3KPB4|Q8N8Q6	Missense_Mutation	SNP	ENST00000321276.7	37	CCDS2453.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848654	0.32699	.	.	ENSG00000163082	ENST00000321276	.	.	.	5.19	5.19	0.71726	.	0.154766	0.44902	D	0.000413	T	0.39682	0.1087	L	0.28115	0.83	0.47214	D	0.999355	B	0.24920	0.114	B	0.21360	0.034	T	0.24119	-1.0169	9	0.13470	T	0.59	-29.0954	9.9835	0.41828	0.0:0.8747:0.0:0.1253	.	248	Q8IWX5	SGPP2_HUMAN	F	248	.	ENSP00000315137:L248F	L	+	1	0	SGPP2	223131403	0.711000	0.27906	1.000000	0.80357	0.931000	0.56810	1.247000	0.32815	2.402000	0.81655	0.655000	0.94253	CTC	.		0.572	SGPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256856.2		
SHC1	6464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154941042	154941042	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:154941042A>C	ENST00000368445.5	-	4	893	c.679T>G	c.(679-681)Ttt>Gtt	p.F227V	SHC1_ENST00000606391.1_Missense_Mutation_p.F28V|SHC1_ENST00000448116.2_Missense_Mutation_p.F227V|SHC1_ENST00000368449.4_5'UTR|SHC1_ENST00000368453.4_Missense_Mutation_p.F117V|SHC1_ENST00000368450.1_Missense_Mutation_p.F117V|SHC1_ENST00000490667.1_5'Flank	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	227	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ATTCCAGCAAATTTCAGGTTA	0.582																																					p.F227V	NSCLC(4;32 234 1864 2492 3259 13747 17376)	.											.	SHC1	847	0			c.T679G						.						139.0	143.0	141.0					1																	154941042		2203	4300	6503	SO:0001583	missense	6464	exon4			CAGCAAATTTCAG	U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.679T>G	1.37:g.154941042A>C	ENSP00000357430:p.Phe227Val	Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	64.0	NM_183001	B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Missense_Mutation	SNP	ENST00000368445.5	37	CCDS30881.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.414936	0.83449	.	.	ENSG00000160691	ENST00000368445;ENST00000448116;ENST00000368449;ENST00000368453;ENST00000368450;ENST00000368443;ENST00000412170;ENST00000366442	T;T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16;2.16	4.92	4.92	0.64577	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.35451	0.0932	M	0.71206	2.165	0.80722	D	1	D;D	0.58620	0.983;0.964	D;D	0.73708	0.981;0.973	T	0.10870	-1.0611	10	0.48119	T	0.1	.	14.7303	0.69377	1.0:0.0:0.0:0.0	.	227;227	P29353-6;P29353	.;SHC1_HUMAN	V	227;227;28;117;117;163;117;117	ENSP00000357430:F227V;ENSP00000401303:F227V;ENSP00000357434:F28V;ENSP00000357438:F117V;ENSP00000357435:F117V;ENSP00000398441:F117V;ENSP00000396162:F117V	ENSP00000396162:F117V	F	-	1	0	SHC1	153207666	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.761000	0.91691	2.066000	0.61787	0.383000	0.25322	TTT	.		0.582	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001	
SLC39A4	55630	hgsc.bcm.edu;broad.mit.edu	37	8	145641255	145641255	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr8:145641255G>A	ENST00000301305.3	-	2	518	c.413C>T	c.(412-414)cCg>cTg	p.P138L	SLC39A4_ENST00000276833.5_Missense_Mutation_p.P113L|SLC39A4_ENST00000531013.1_5'Flank	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	138					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			GCTCAGGCCCGGGGTCAGGGC	0.706																																					p.P138L		.											.	SLC39A4	90	0			c.C413T						.						10.0	12.0	11.0					8																	145641255		2166	4252	6418	SO:0001583	missense	55630	exon2			AGGCCCGGGGTCA	AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.413C>T	8.37:g.145641255G>A	ENSP00000301305:p.Pro138Leu	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	7.0	NM_130849	Q7L5S5|Q9H6T8|Q9NXC4	Missense_Mutation	SNP	ENST00000301305.3	37	CCDS6424.1	.	.	.	.	.	.	.	.	.	.	G	3.253	-0.152854	0.06585	.	.	ENSG00000147804	ENST00000276833;ENST00000301305	T;T	0.52526	0.66;0.66	4.4	-5.19	0.02832	.	9.789490	0.00628	N	0.000469	T	0.24044	0.0582	N	0.08118	0	0.20821	N	0.999843	B;B	0.10296	0.0;0.003	B;B	0.06405	0.001;0.002	T	0.10359	-1.0633	10	0.21540	T	0.41	-2.7766	5.8431	0.18645	0.5706:0.0:0.2018:0.2275	.	138;113	Q6P5W5;A6NDY5	S39A4_HUMAN;.	L	113;138	ENSP00000276833:P113L;ENSP00000301305:P138L	ENSP00000276833:P113L	P	-	2	0	SLC39A4	145612063	0.000000	0.05858	0.079000	0.20413	0.008000	0.06430	-1.143000	0.03200	-1.080000	0.03109	-0.683000	0.03753	CCG	.		0.706	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382688.1		
SLC44A5	204962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	75684996	75684996	+	Missense_Mutation	SNP	T	T	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:75684996T>A	ENST00000370855.5	-	16	1325	c.1212A>T	c.(1210-1212)aaA>aaT	p.K404N	SLC44A5_ENST00000370859.3_Missense_Mutation_p.K404N|SLC44A5_ENST00000535611.1_Missense_Mutation_p.K274N	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	404					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						GAGCTATGACTTTGTATACAG	0.373																																					p.K404N		.											.	SLC44A5	95	0			c.A1212T						.						104.0	96.0	99.0					1																	75684996		2203	4300	6503	SO:0001583	missense	204962	exon16			TATGACTTTGTAT	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1212A>T	1.37:g.75684996T>A	ENSP00000359892:p.Lys404Asn	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	20.0	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.286165	0.40394	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.23348	1.91;1.91;1.91	5.04	5.04	0.67666	.	0.149246	0.64402	D	0.000013	T	0.33990	0.0882	M	0.81614	2.55	0.58432	D	0.999997	P;B;P;P;P	0.48764	0.915;0.389;0.853;0.896;0.896	P;B;P;P;P	0.57720	0.826;0.285;0.826;0.726;0.802	T	0.25606	-1.0127	10	0.14252	T	0.57	-9.9512	15.0851	0.72145	0.0:0.0:0.0:1.0	.	398;443;404;404;443	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	N	404;443;404;274;397	ENSP00000359896:K404N;ENSP00000359892:K404N;ENSP00000443090:K274N	ENSP00000359892:K404N	K	-	3	2	SLC44A5	75457584	1.000000	0.71417	0.503000	0.27626	0.043000	0.13939	4.298000	0.59067	2.025000	0.59659	0.533000	0.62120	AAA	.		0.373	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
SMARCAD1	56916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	95198291	95198291	+	Missense_Mutation	SNP	G	G	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr4:95198291G>T	ENST00000354268.4	+	16	2136	c.2063G>T	c.(2062-2064)aGa>aTa	p.R688I	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.R688I|SMARCAD1_ENST00000509418.1_Missense_Mutation_p.R258I			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	688					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		GAAATACGAAGAATGTTTTCC	0.373																																					p.R688I		.											.	SMARCAD1	229	0			c.G2063T						.						165.0	161.0	162.0					4																	95198291		2203	4300	6503	SO:0001583	missense	56916	exon16			TACGAAGAATGTT	AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.2063G>T	4.37:g.95198291G>T	ENSP00000346217:p.Arg688Ile	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	19.0	NM_001128429	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319756	0.60524	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	D;D;D;D	0.93811	-3.24;-3.24;-3.24;-3.29	5.52	5.52	0.82312	SNF2-related (1);	0.000000	0.51477	D	0.000086	D	0.92951	0.7757	L	0.45744	1.44	0.80722	D	1	B;B	0.26602	0.154;0.127	B;B	0.38755	0.281;0.185	D	0.89850	0.4009	10	0.33141	T	0.24	-21.537	19.4533	0.94876	0.0:0.0:1.0:0.0	.	688;688	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	I	688;688;688;258	ENSP00000351947:R688I;ENSP00000415576:R688I;ENSP00000346217:R688I;ENSP00000423286:R258I	ENSP00000346217:R688I	R	+	2	0	SMARCAD1	95417314	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.475000	0.81041	2.604000	0.88044	0.555000	0.69702	AGA	.		0.373	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
SPESP1	246777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	69238762	69238762	+	Missense_Mutation	SNP	G	G	C	rs543376040		TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr15:69238762G>C	ENST00000310673.3	+	2	1043	c.889G>C	c.(889-891)Gaa>Caa	p.E297Q	NOX5_ENST00000448182.3_Intron|RP11-809H16.2_ENST00000557966.1_RNA|NOX5_ENST00000455873.3_Intron|NOX5_ENST00000260364.5_Intron	NM_145658.3	NP_663633.1	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1	297				E -> V (in Ref. 1; AAM69364). {ECO:0000305}.	acrosome reaction (GO:0007340)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	19						TGATGACATCGAAACTGTTAT	0.343																																					p.E297Q		.											.	SPESP1	90	0			c.G889C						.																																			SO:0001583	missense	246777	exon2			GACATCGAAACTG	AF275321	CCDS10230.1	15q22.31	2011-04-15				ENSG00000258484			15570	protein-coding gene	gene with protein product		609399				12773409	Standard	NM_145658		Approved	SP-ESP	uc002arn.2	Q6UW49		ENST00000310673.3:c.889G>C	15.37:g.69238762G>C	ENSP00000312284:p.Glu297Gln	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	12.0	NM_145658	Q8NG22|Q8WVH8	Missense_Mutation	SNP	ENST00000310673.3	37	CCDS10230.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716215	0.30413	.	.	ENSG00000258484	ENST00000310673	T	0.24538	1.85	5.33	1.36	0.22044	.	0.848427	0.10122	N	0.713266	T	0.29945	0.0749	L	0.32530	0.975	0.09310	N	1	D	0.59767	0.986	P	0.57101	0.813	T	0.15378	-1.0439	10	0.49607	T	0.09	-3.5278	6.813	0.23814	0.3748:0.0:0.6252:0.0	.	297	Q6UW49	SPESP_HUMAN	Q	297	ENSP00000312284:E297Q	ENSP00000312284:E297Q	E	+	1	0	SPESP1	67025816	0.071000	0.21146	0.027000	0.17364	0.352000	0.29268	0.380000	0.20602	0.339000	0.23719	0.655000	0.94253	GAA	.		0.343	SPESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257125.1	NM_145658	
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	158612680	158612680	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr1:158612680T>C	ENST00000368147.4	-	32	4709	c.4529A>G	c.(4528-4530)gAg>gGg	p.E1510G		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1510					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTCCAGCTCCTCAAGGTCTCG	0.478																																					p.E1510G		.											.	SPTA1	142	0			c.A4529G						.						172.0	163.0	166.0					1																	158612680		1995	4166	6161	SO:0001583	missense	6708	exon32			AGCTCCTCAAGGT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4529A>G	1.37:g.158612680T>C	ENSP00000357129:p.Glu1510Gly	Somatic	276.0	0.0		WXS	Illumina HiSeq	Phase_I	292.0	13.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.106445	0.77096	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.37584	1.19;1.19	5.2	5.2	0.72013	.	0.256644	0.20373	N	0.093604	T	0.31918	0.0812	M	0.62209	1.925	0.46654	D	0.99914	P	0.36599	0.56	B	0.42625	0.393	T	0.24799	-1.0150	10	0.66056	D	0.02	.	14.0466	0.64708	0.0:0.0:0.0:1.0	.	1510	P02549	SPTA1_HUMAN	G	1510	ENSP00000357130:E1510G;ENSP00000357129:E1510G	ENSP00000357129:E1510G	E	-	2	0	SPTA1	156879304	1.000000	0.71417	0.675000	0.29917	0.638000	0.38207	7.330000	0.79181	2.189000	0.69895	0.533000	0.62120	GAG	.		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SRBD1	55133	broad.mit.edu;bcgsc.ca	37	2	45616467	45616467	+	Silent	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:45616467G>A	ENST00000263736.4	-	21	3032	c.2970C>T	c.(2968-2970)gaC>gaT	p.D990D	SRBD1_ENST00000535761.1_Silent_p.D509D|SRBD1_ENST00000490133.1_5'UTR	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	990	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			CCCGAATGAGGTCCAGAGTAA	0.443																																					p.D990D		.											.	SRBD1	90	0			c.C2970T						.						86.0	85.0	85.0					2																	45616467		2203	4299	6502	SO:0001819	synonymous_variant	55133	exon21			AATGAGGTCCAGA	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.2970C>T	2.37:g.45616467G>A		Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	5.0	NM_018079	Q53T56|Q96TA4|Q9NW11	Silent	SNP	ENST00000263736.4	37	CCDS1823.1																																																																																			.		0.443	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
STARD13	90627	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	33703451	33703451	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr13:33703451G>C	ENST00000336934.5	-	5	1479	c.1363C>G	c.(1363-1365)Cga>Gga	p.R455G	STARD13_ENST00000255486.4_Missense_Mutation_p.R447G|STARD13_ENST00000399365.3_Missense_Mutation_p.R337G	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	455					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		ATACTGACTCGGCTGGCTCTG	0.562																																					p.R455G		.											.	STARD13	94	0			c.C1363G						.						59.0	59.0	59.0					13																	33703451		2203	4300	6503	SO:0001583	missense	90627	exon5			TGACTCGGCTGGC	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.1363C>G	13.37:g.33703451G>C	ENSP00000338785:p.Arg455Gly	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	20.0	NM_178006	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	37	CCDS9348.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106770	0.56291	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934;ENST00000399364	T;T;T	0.10005	2.92;2.95;2.95	5.82	0.185	0.15096	.	0.050408	0.85682	D	0.000000	T	0.34774	0.0909	M	0.83603	2.65	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.989;0.998	T	0.44065	-0.9352	10	0.56958	D	0.05	.	17.1869	0.86868	0.0:0.0:0.3381:0.6619	.	447;420;455;447	Q9Y3M8-5;Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;.;STA13_HUMAN;.	G	337;447;455;447	ENSP00000382300:R337G;ENSP00000255486:R447G;ENSP00000338785:R455G	ENSP00000255486:R447G	R	-	1	2	STARD13	32601451	1.000000	0.71417	0.053000	0.19242	0.981000	0.71138	1.444000	0.35068	0.050000	0.15949	0.655000	0.94253	CGA	.		0.562	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466	
TBC1D21	161514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74177139	74177139	+	Missense_Mutation	SNP	A	A	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr15:74177139A>C	ENST00000300504.2	+	5	468	c.385A>C	c.(385-387)Atc>Ctc	p.I129L	TBC1D21_ENST00000535547.2_Missense_Mutation_p.I93L|TBC1D21_ENST00000562056.1_Intron	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	129	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						CATTCAGAAAATCTATGACAA	0.522																																					p.I129L		.											.	TBC1D21	92	0			c.A385C						.						98.0	79.0	85.0					15																	74177139		2198	4297	6495	SO:0001583	missense	161514	exon5			CAGAAAATCTATG	BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.385A>C	15.37:g.74177139A>C	ENSP00000300504:p.Ile129Leu	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	33.0	NM_153356	B9A6M2	Missense_Mutation	SNP	ENST00000300504.2	37	CCDS10252.1	.	.	.	.	.	.	.	.	.	.	A	3.053	-0.194900	0.06259	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	T;T	0.10860	2.83;2.83	5.45	4.54	0.55810	Rab-GAP/TBC domain (4);	0.130000	0.35349	N	0.003272	T	0.03564	0.0102	N	0.01352	-0.895	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39375	-0.9617	10	0.11794	T	0.64	.	11.8283	0.52280	0.1757:0.8243:0.0:0.0	.	93;129	B9A6M2;Q8IYX1	.;TBC21_HUMAN	L	129;93	ENSP00000300504:I129L;ENSP00000439325:I93L	ENSP00000300504:I129L	I	+	1	0	TBC1D21	71964192	0.999000	0.42202	0.982000	0.44146	0.751000	0.42716	2.548000	0.45794	1.304000	0.44892	-0.233000	0.12211	ATC	.		0.522	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268994.1	NM_153356	
TECTA	7007	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	120989400	120989400	+	Silent	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr11:120989400C>T	ENST00000392793.1	+	7	1447	c.1176C>T	c.(1174-1176)atC>atT	p.I392I	TECTA_ENST00000264037.2_Silent_p.I392I			O75443	TECTA_HUMAN	tectorin alpha	392	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		AGATTCTCATCCCCAAAGGAA	0.522																																					p.I392I		.											.	TECTA	225	0			c.C1176T						.						66.0	70.0	69.0					11																	120989400		2203	4299	6502	SO:0001819	synonymous_variant	7007	exon6			TCTCATCCCCAAA	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.1176C>T	11.37:g.120989400C>T		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	12.0	NM_005422		Silent	SNP	ENST00000392793.1	37	CCDS8434.1																																																																																			.		0.522	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
TMF1	7110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	69084238	69084238	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr3:69084238C>A	ENST00000398559.2	-	9	2396	c.2180G>T	c.(2179-2181)cGt>cTt	p.R727L	CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000599467.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.R730L|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000601511.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	727					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TTGTTCTGTACGCTGCAATGC	0.433																																					p.R727L		.											.	TMF1	90	0			c.G2180T						.						194.0	194.0	194.0					3																	69084238		1952	4145	6097	SO:0001583	missense	7110	exon9			TCTGTACGCTGCA		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.2180G>T	3.37:g.69084238C>A	ENSP00000381567:p.Arg727Leu	Somatic	183.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	41.0	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	ENST00000398559.2	37	CCDS43105.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669977	0.88348	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248	T;T	0.24538	1.85;1.85	5.03	5.03	0.67393	.	0.049125	0.85682	D	0.000000	T	0.49423	0.1556	L	0.59912	1.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.46119	-0.9214	10	0.52906	T	0.07	-10.6806	18.7275	0.91720	0.0:1.0:0.0:0.0	.	730;727	P82094-2;P82094	.;TMF1_HUMAN	L	727;730;643	ENSP00000381567:R727L;ENSP00000438706:R730L	ENSP00000348582:R643L	R	-	2	0	TMF1	69166928	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	7.776000	0.85560	2.486000	0.83907	0.655000	0.94253	CGT	.		0.433	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
TRPC4	7223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	38211433	38211433	+	Silent	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr13:38211433T>C	ENST00000379705.3	-	11	3398	c.2541A>G	c.(2539-2541)ttA>ttG	p.L847L	TRPC4_ENST00000447043.1_Intron|TRPC4_ENST00000426868.2_Intron|TRPC4_ENST00000355779.2_Intron|TRPC4_ENST00000338947.5_Silent_p.L674L|TRPC4_ENST00000379681.3_Silent_p.L852L|TRPC4_ENST00000358477.2_Intron|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000379679.1_Silent_p.L674L			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	847	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		GTCTATGAAATAACCCAAAGT	0.443																																					p.L852L		.											.	TRPC4	159	0			c.A2556G						.						75.0	76.0	75.0					13																	38211433		2203	4300	6503	SO:0001819	synonymous_variant	7223	exon11			ATGAAATAACCCA	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2541A>G	13.37:g.38211433T>C		Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	26.0	NM_003306	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	ENST00000379705.3	37	CCDS9365.1																																																																																			.		0.443	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
TTLL4	9654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219619007	219619007	+	Silent	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr2:219619007T>C	ENST00000392102.1	+	20	3835	c.3495T>C	c.(3493-3495)tcT>tcC	p.S1165S	TTLL4_ENST00000457313.1_Missense_Mutation_p.L968P|TTLL4_ENST00000442769.1_Silent_p.S1101S|TTLL4_ENST00000258398.4_Silent_p.S1165S	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	1165					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		CCAGCCTTTCTACCCAGACGT	0.532																																					p.S1165S	GBM(172;1818 2053 15407 20943 49753)	.											.	TTLL4	93	0			c.T3495C						.						135.0	132.0	133.0					2																	219619007		2203	4300	6503	SO:0001819	synonymous_variant	9654	exon20			CCTTTCTACCCAG		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.3495T>C	2.37:g.219619007T>C		Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	29.0	NM_014640	A8K6V5|Q8WW29	Silent	SNP	ENST00000392102.1	37	CCDS2422.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.237|0.237	-1.016493|-1.016493	0.02078|0.02078	.|.	.|.	ENSG00000135912|ENSG00000135912	ENST00000457313|ENST00000417855	T|.	0.03920|.	3.76|.	4.76|4.76	-8.26|-8.26	0.01021|0.01021	.|.	.|.	.|.	.|.	.|.	T|T	0.39226|0.39226	0.1070|0.1070	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.42085|0.42085	-0.9472|-0.9472	8|4	0.27082|.	T|.	0.32|.	.|.	15.1222|15.1222	0.72453|0.72453	0.0:0.2323:0.0:0.7677|0.0:0.2323:0.0:0.7677	.|.	968|.	E9PH58|.	.|.	P|H	968|157	ENSP00000393332:L968P|.	ENSP00000393332:L968P|.	L|Y	+|+	2|1	0|0	TTLL4|TTLL4	219327251|219327251	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-1.139000|-1.139000	0.03213|0.03213	-1.893000|-1.893000	0.01106|0.01106	-1.601000|-1.601000	0.00813|0.00813	CTA|TAC	.		0.532	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
UBE2N	7334	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	93835640	93835640	+	Missense_Mutation	SNP	C	C	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr12:93835640C>A	ENST00000318066.2	-	1	398	c.21G>T	c.(19-21)agG>agT	p.R7S	UBE2N_ENST00000550657.1_Missense_Mutation_p.R7S|UBE2N_ENST00000549833.1_5'Flank|UBE2N_ENST00000552442.1_Missense_Mutation_p.R7S	NM_003348.3	NP_003339.1	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N	7					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|DNA double-strand break processing (GO:0000729)|double-strand break repair via homologous recombination (GO:0000724)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone ubiquitination (GO:0016574)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone modification (GO:0031058)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|postreplication repair (GO:0006301)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of DNA repair (GO:0006282)|regulation of histone ubiquitination (GO:0033182)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-MMS2 complex (GO:0031372)|UBC13-UEV1A complex (GO:0035370)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)	p.R7S(1)		endometrium(3)|liver(2)|lung(5)	10						CCTTGATGATCCTGCGGGGCA	0.692								Direct reversal of damage;Rad6 pathway																													p.R7S	Pancreas(197;738 2228 30225 32034 33454)	.											.	UBE2N	659	1	Substitution - Missense(1)	lung(1)	c.G21T						.						32.0	35.0	34.0					12																	93835640		2203	4300	6503	SO:0001583	missense	7334	exon1			GATGATCCTGCGG	D83004	CCDS31875.1	12q22	2011-05-19	2011-05-19			ENSG00000177889		"""Ubiquitin-conjugating enzymes E2"""	12492	protein-coding gene	gene with protein product		603679	"""ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)"", ""ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)"""			8902611	Standard	NM_003348		Approved	UbcH-ben, UBC13, MGC8489	uc001tcp.3	P61088	OTTHUMG00000170156	ENST00000318066.2:c.21G>T	12.37:g.93835640C>A	ENSP00000316176:p.Arg7Ser	Somatic	257.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	55.0	NM_003348	Q16781|Q53Y81	Missense_Mutation	SNP	ENST00000318066.2	37	CCDS31875.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.047672	0.75846	.	.	ENSG00000177889	ENST00000318066;ENST00000550657;ENST00000552442	T;T;T	0.79454	-1.27;-1.27;-1.27	4.68	4.68	0.58851	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.47852	U	0.000205	D	0.92391	0.7585	H	0.98664	4.295	0.58432	D	0.999995	D	0.71674	0.998	D	0.74348	0.983	D	0.94877	0.8035	10	0.87932	D	0	0.6113	14.9532	0.71091	0.0:1.0:0.0:0.0	.	7	P61088	UBE2N_HUMAN	S	7	ENSP00000316176:R7S;ENSP00000449352:R7S;ENSP00000448352:R7S	ENSP00000316176:R7S	R	-	3	2	UBE2N	92359771	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.501000	0.60393	2.581000	0.87130	0.557000	0.71058	AGG	.		0.692	UBE2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407710.1	NM_003348	
USP47	55031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	11963990	11963990	+	Missense_Mutation	SNP	C	C	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr11:11963990C>G	ENST00000399455.2	+	21	2602	c.2482C>G	c.(2482-2484)Cta>Gta	p.L828V	USP47_ENST00000527733.1_Missense_Mutation_p.L808V|USP47_ENST00000539466.1_5'UTR|USP47_ENST00000339865.5_Missense_Mutation_p.L740V	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	828					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		ATTTGTTTTGCTACCTGAACA	0.428																																					p.L740V		.											.	USP47	660	0			c.C2218G						.						109.0	100.0	103.0					11																	11963990		1860	4095	5955	SO:0001583	missense	55031	exon19			GTTTTGCTACCTG	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.2482C>G	11.37:g.11963990C>G	ENSP00000382382:p.Leu828Val	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	14.0	NM_017944	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	ENST00000399455.2	37		.	.	.	.	.	.	.	.	.	.	C	15.52	2.856656	0.51376	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455;ENST00000540365	T;T;T	0.11604	2.78;2.77;2.76	5.81	2.59	0.31030	.	0.066887	0.64402	D	0.000010	T	0.16896	0.0406	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.998	D;D;D	0.68039	0.934;0.91;0.955	T	0.01114	-1.1447	10	0.56958	D	0.05	.	8.0802	0.30739	0.0:0.5189:0.0:0.4811	.	828;808;740	Q96K76;E9PM46;Q96K76-2	UBP47_HUMAN;.;.	V	740;808;828;25	ENSP00000339957:L740V;ENSP00000433146:L808V;ENSP00000382382:L828V	ENSP00000339957:L740V	L	+	1	2	USP47	11920566	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	1.148000	0.31614	0.267000	0.21916	0.591000	0.81541	CTA	.		0.428	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944	
WDFY4	57705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	50025347	50025347	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr10:50025347C>T	ENST00000325239.5	+	31	5425	c.5398C>T	c.(5398-5400)Cag>Tag	p.Q1800*	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1800						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CAGCGTGCTGCAGTTCCTCAG	0.667																																					p.Q1800X		.											.	WDFY4	22	0			c.C5398T						.						42.0	50.0	47.0					10																	50025347		692	1591	2283	SO:0001587	stop_gained	57705	exon32			GTGCTGCAGTTCC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.5398C>T	10.37:g.50025347C>T	ENSP00000320563:p.Gln1800*	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	19.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Nonsense_Mutation	SNP	ENST00000325239.5	37	CCDS44385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	9.923434|9.923434	0.99297|0.99297	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002;ENST00000374161|ENST00000426033;ENST00000325239	.|.	.|.	.|.	5.45|5.45	3.54|3.54	0.40534|0.40534	.|.	.|0.083518	.|0.49305	.|D	.|0.000146	T|.	0.68531|.	0.3011|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.65672|.	-0.6111|.	4|.	.|.	.|.	.|.	.|.	13.28|13.28	0.60208|0.60208	0.2892:0.7108:0.0:0.0|0.2892:0.7108:0.0:0.0	.|.	.|.	.|.	.|.	V|X	890;346|1800	.|.	.|.	A|Q	+|+	2|1	0|0	WDFY4|WDFY4	49695353|49695353	1.000000|1.000000	0.71417|0.71417	0.895000|0.895000	0.35142|0.35142	0.123000|0.123000	0.20343|0.20343	2.998000|2.998000	0.49465|0.49465	0.633000|0.633000	0.30452|0.30452	-0.181000|-0.181000	0.13052|0.13052	GCA|CAG	.		0.667	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
WDR24	84219	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	735892	735892	+	Missense_Mutation	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr16:735892G>A	ENST00000248142.6	-	9	1939	c.1940C>T	c.(1939-1941)tCg>tTg	p.S647L	JMJD8_ENST00000412368.2_5'Flank|JMJD8_ENST00000293882.4_5'Flank|JMJD8_ENST00000562824.1_5'Flank|JMJD8_ENST00000609261.1_5'Flank|JMJD8_ENST00000454700.1_5'Flank|JMJD8_ENST00000562111.1_5'Flank|WDR24_ENST00000293883.4_Missense_Mutation_p.S517L			Q96S15	WDR24_HUMAN	WD repeat domain 24	647										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				GAGTGTGGCCGAGGAGTCGAG	0.622																																					p.S517L		.											.	WDR24	91	0			c.C1550T						.						125.0	123.0	123.0					16																	735892		2201	4300	6501	SO:0001583	missense	84219	exon5			GTGGCCGAGGAGT	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.1940C>T	16.37:g.735892G>A	ENSP00000248142:p.Ser647Leu	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	30.0	NM_032259	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	ENST00000248142.6	37		.	.	.	.	.	.	.	.	.	.	G	12.35	1.911432	0.33721	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	T;T	0.78595	-1.19;0.23	4.66	4.66	0.58398	.	0.278573	0.29660	N	0.011521	T	0.60495	0.2273	N	0.14661	0.345	0.39880	D	0.973628	B	0.33022	0.394	B	0.22880	0.042	T	0.63065	-0.6720	10	0.30854	T	0.27	-10.1837	16.2618	0.82550	0.0:0.0:1.0:0.0	.	517	Q96S15-2	.	L	647;517	ENSP00000248142:S647L;ENSP00000293883:S517L	ENSP00000248142:S647L	S	-	2	0	WDR24	675893	1.000000	0.71417	0.962000	0.40283	0.206000	0.24218	5.741000	0.68638	2.423000	0.82170	0.561000	0.74099	TCG	.		0.622	WDR24-201	KNOWN	basic	protein_coding	protein_coding		NM_032259	
WDR24	84219	ucsc.edu;bcgsc.ca	37	16	737415	737415	+	Splice_Site	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr16:737415C>T	ENST00000248142.6	-	7	1050	c.1051G>A	c.(1051-1053)Ggc>Agc	p.G351S	JMJD8_ENST00000412368.2_5'Flank|JMJD8_ENST00000293882.4_5'Flank|LA16c-313D11.12_ENST00000566927.1_RNA|JMJD8_ENST00000454700.1_5'Flank|WDR24_ENST00000293883.4_Splice_Site_p.G221S			Q96S15	WDR24_HUMAN	WD repeat domain 24	351										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				GCCAACCAGCCCCTGTGGGAA	0.627																																					p.G221S		.											.	WDR24	91	0			c.G661A						.						44.0	44.0	44.0					16																	737415		2200	4300	6500	SO:0001630	splice_region_variant	84219	exon3			ACCAGCCCCTGTG	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.1050-1G>A	16.37:g.737415C>T		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_032259	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	ENST00000248142.6	37		.	.	.	.	.	.	.	.	.	.	C	14.16	2.453202	0.43531	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	T;T	0.59364	0.27;0.27	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.41627	0.1167	L	0.34521	1.04	0.80722	D	1	B	0.33637	0.42	B	0.25506	0.061	T	0.37820	-0.9689	10	0.07030	T	0.85	-16.1433	17.2905	0.87154	0.0:1.0:0.0:0.0	.	221	Q96S15-2	.	S	351;221	ENSP00000248142:G351S;ENSP00000293883:G221S	ENSP00000248142:G351S	G	-	1	0	WDR24	677416	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.009000	0.76347	2.623000	0.88846	0.655000	0.94253	GGC	.		0.627	WDR24-201	KNOWN	basic	protein_coding	protein_coding		NM_032259	Missense_Mutation
WDR87	83889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38384931	38384931	+	Missense_Mutation	SNP	C	C	T			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr19:38384931C>T	ENST00000303868.5	-	4	1519	c.1295G>A	c.(1294-1296)cGg>cAg	p.R432Q	WDR87_ENST00000447313.2_Missense_Mutation_p.R471Q	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	432										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						CTCTAGACCCCGCCCCAAGTT	0.512																																					p.R432Q		.											.	.	.	0			c.G1295A						.						45.0	45.0	45.0					19																	38384931		692	1591	2283	SO:0001583	missense	83889	exon4			AGACCCCGCCCCA	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.1295G>A	19.37:g.38384931C>T	ENSP00000368025:p.Arg432Gln	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	16.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	37	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	C	9.135	1.012357	0.19277	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.35421	1.31;2.86	5.88	2.5	0.30297	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.385414	0.22708	N	0.056612	T	0.30166	0.0756	M	0.67953	2.075	0.24573	N	0.993912	B;B	0.31485	0.325;0.325	B;B	0.21546	0.035;0.035	T	0.25047	-1.0143	10	0.54805	T	0.06	-3.9849	6.3781	0.21519	0.0:0.6866:0.1494:0.164	.	432;471	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	Q	471;432	ENSP00000405012:R471Q;ENSP00000368025:R432Q	ENSP00000368025:R432Q	R	-	2	0	WDR87	43076771	0.011000	0.17503	0.898000	0.35279	0.631000	0.37964	0.638000	0.24674	0.827000	0.34685	-0.149000	0.13747	CGG	.		0.512	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
ZBTB10	65986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	81412172	81412172	+	Silent	SNP	A	A	G			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr8:81412172A>G	ENST00000430430.1	+	3	2195	c.1416A>G	c.(1414-1416)ccA>ccG	p.P472P	ZBTB10_ENST00000426744.2_Silent_p.P472P|ZBTB10_ENST00000455036.3_Silent_p.P472P|ZBTB10_ENST00000379091.4_Silent_p.P180P	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	472					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			CAGAAGCTCCAGAGTCTGTAG	0.373																																					p.P472P		.											.	ZBTB10	522	0			c.A1416G						.						85.0	86.0	86.0					8																	81412172		1806	4074	5880	SO:0001819	synonymous_variant	65986	exon2			AGCTCCAGAGTCT	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.1416A>G	8.37:g.81412172A>G		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	16.0	NM_023929	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Silent	SNP	ENST00000430430.1	37	CCDS47880.1																																																																																			.		0.373	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929	
ZCCHC7	84186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	37302184	37302184	+	Splice_Site	SNP	G	G	A			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr9:37302184G>A	ENST00000336755.5	+	3	716		c.e3-1		ZCCHC7_ENST00000461038.1_Splice_Site|ZCCHC7_ENST00000534928.1_Splice_Site	NM_032226.2	NP_115602.2	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7							cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	30				GBM - Glioblastoma multiforme(29;0.0137)		TTGTTTTGTAGGAGAAGATGG	0.294																																					.		.											.	ZCCHC7	92	0			c.611-1G>A						.						93.0	99.0	97.0					9																	37302184		2203	4297	6500	SO:0001630	splice_region_variant	84186	exon3			TTTGTAGGAGAAG	AK026264	CCDS6608.2	9p13.1	2008-05-02			ENSG00000147905	ENSG00000147905		"""Zinc fingers, CCHC domain containing"""	26209	protein-coding gene	gene with protein product							Standard	NM_032226		Approved	FLJ22611, AIR1	uc003zzq.3	Q8N3Z6	OTTHUMG00000019915	ENST00000336755.5:c.611-1G>A	9.37:g.37302184G>A		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	7.0	NM_032226	B2RCI4|D3DRQ0|Q5T0Q8|Q5T0Q9|Q5T0R0|Q8N2M1|Q8N4J2|Q8TBK8|Q9H648|Q9P0F0	Splice_Site	SNP	ENST00000336755.5	37	CCDS6608.2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082142	0.76528	.	.	ENSG00000147905	ENST00000336755	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9706	0.92713	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZCCHC7	37292184	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.747000	0.68689	2.775000	0.95449	0.650000	0.86243	.	.		0.294	ZCCHC7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052453.2	NM_032226	Intron
ZMYM5	9205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	20411886	20411886	+	Silent	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr13:20411886T>C	ENST00000337963.4	-	6	1212	c.948A>G	c.(946-948)acA>acG	p.T316T	ZMYM5_ENST00000382907.4_3'UTR|ZMYM5_ENST00000382905.4_Silent_p.T316T	NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	316						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		ACAAACAAGATGTACTATAAA	0.338																																					p.T316T		.											.	ZMYM5	90	0			c.A948G						.						55.0	57.0	56.0					13																	20411886		2203	4293	6496	SO:0001819	synonymous_variant	9205	exon6			ACAAGATGTACTA	AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.948A>G	13.37:g.20411886T>C		Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	12.0	NM_001039650	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Silent	SNP	ENST00000337963.4	37																																																																																				.		0.338	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242	
ZNF169	169841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	97063227	97063227	+	Missense_Mutation	SNP	T	T	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr9:97063227T>C	ENST00000395395.2	+	5	1477	c.1387T>C	c.(1387-1389)Tgt>Cgt	p.C463R	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	463					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				GTGCCCTGATTGTGGGCGTGG	0.582																																					p.C463R		.											.	ZNF169	92	0			c.T1387C						.						68.0	64.0	65.0					9																	97063227		2203	4300	6503	SO:0001583	missense	169841	exon5			CCTGATTGTGGGC	U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.1387T>C	9.37:g.97063227T>C	ENSP00000378792:p.Cys463Arg	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	17.0	NM_194320	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	ENST00000395395.2	37	CCDS6709.2	.	.	.	.	.	.	.	.	.	.	T	17.05	3.289253	0.59976	.	.	ENSG00000175787	ENST00000395395;ENST00000340911	D	0.85955	-2.05	2.83	2.83	0.33086	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93733	0.7997	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93853	0.7147	9	0.87932	D	0	.	9.4444	0.38688	0.0:0.0:0.0:1.0	.	463	Q14929	ZN169_HUMAN	R	463;272	ENSP00000378792:C463R	ENSP00000340711:C272R	C	+	1	0	ZNF169	96103048	1.000000	0.71417	0.981000	0.43875	0.880000	0.50808	6.388000	0.73195	1.556000	0.49512	0.491000	0.48974	TGT	.		0.582	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253714.1	NM_194320	
ZNF169	169841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	97063234	97063234	+	Missense_Mutation	SNP	G	G	C			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr9:97063234G>C	ENST00000395395.2	+	5	1484	c.1394G>C	c.(1393-1395)cGt>cCt	p.R465P	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				GATTGTGGGCGTGGCTTTGGT	0.577																																					p.R465P		.											.	ZNF169	92	0			c.G1394C						.						72.0	65.0	67.0					9																	97063234		2203	4300	6503	SO:0001583	missense	169841	exon5			GTGGGCGTGGCTT	U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.1394G>C	9.37:g.97063234G>C	ENSP00000378792:p.Arg465Pro	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	16.0	NM_194320	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	ENST00000395395.2	37	CCDS6709.2	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686586	0.47991	.	.	ENSG00000175787	ENST00000395395;ENST00000340911	T	0.19806	2.12	2.83	1.9	0.25705	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41743	0.1172	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.32508	-0.9904	9	0.87932	D	0	.	9.1112	0.36730	0.0:0.0:0.7796:0.2204	.	465	Q14929	ZN169_HUMAN	P	465;274	ENSP00000378792:R465P	ENSP00000340711:R274P	R	+	2	0	ZNF169	96103055	0.900000	0.30661	0.995000	0.50966	0.938000	0.57974	2.159000	0.42339	0.750000	0.32877	-0.251000	0.11542	CGT	.		0.577	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253714.1	NM_194320	
VWA3A	146177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	22162149	22162150	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-EP-A3JL-01A-11D-A20W-10	TCGA-EP-A3JL-10A-01D-A20W-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c3e9b90-d106-48ce-a6d4-999adc5870e0	87055f49-edc2-4751-a7c5-8715fea95a43	g.chr16:22162149_22162150CC>AA	ENST00000389398.5	+	30	3359_3360	c.3263_3264CC>AA	c.(3262-3264)tCC>tAA	p.S1088*	VWA3A_ENST00000563755.1_Nonsense_Mutation_p.S190*|VWA3A_ENST00000389397.4_Nonsense_Mutation_p.S190*	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	1088	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		CACACCATTTCCTTGAACTGCT	0.48																																					p.S1088*		.											.	.	.	0			.						.																																			SO:0001587	stop_gained	146177	.			CCATTTCCTTGAA	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		Exception_encountered	16.37:g.22162149_22162150delinsAA	ENSP00000374049:p.Ser1088*	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	17.0	.	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Nonsense_Mutation	DNP	ENST00000389398.5	37	CCDS45441.1																																																																																			.		0.480	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		
