#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48506582	48506582	+	Missense_Mutation	SNP	G	G	A	rs201934902		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:48506582G>A	ENST00000435803.1	+	44	12869	c.12845G>A	c.(12844-12846)cGt>cAt	p.R4282H	ABCA13_ENST00000544596.1_Intron	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4282					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GACCTCACCCGTGTGCTTCTG	0.488													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16684	0.0		0.0	False		,,,				2504	0.0				p.R4282H		.											.	ABCA13	521	0			c.G12845A						.	G	HIS/ARG	1,4073		0,1,2036	120.0	128.0	125.0		12845	-5.8	0.0	7		125	0,8388		0,0,4194	no	missense	ABCA13	NM_152701.3	29	0,1,6230	AA,AG,GG		0.0,0.0245,0.0080	benign	4282/5059	48506582	1,12461	2037	4194	6231	SO:0001583	missense	154664	exon44			TCACCCGTGTGCT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12845G>A	7.37:g.48506582G>A	ENSP00000411096:p.Arg4282His	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	17.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	3.527	-0.096461	0.07010	2.45E-4	0.0	ENSG00000179869	ENST00000435803	D	0.85702	-2.02	5.29	-5.82	0.02333	.	1.077030	0.07302	N	0.874270	T	0.57051	0.2027	N	0.02916	-0.46	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.57539	-0.7794	10	0.02654	T	1	.	6.6606	0.23012	0.2491:0.29:0.4608:0.0	.	1984;4282	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	H	4282	ENSP00000411096:R4282H	ENSP00000411096:R4282H	R	+	2	0	ABCA13	48477128	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-1.346000	0.02634	-0.625000	0.05604	-0.290000	0.09829	CGT	G|0.999;A|0.000		0.488	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABCA6	23460	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	67084357	67084357	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:67084357T>A	ENST00000284425.2	-	28	3823	c.3649A>T	c.(3649-3651)Atg>Ttg	p.M1217L	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1217					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TTTAGTTCCATGCATCTTAGA	0.294																																					p.M1217L		.											.	ABCA6	159	0			c.A3649T						.						96.0	93.0	94.0					17																	67084357		2203	4299	6502	SO:0001583	missense	23460	exon28			GTTCCATGCATCT	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.3649A>T	17.37:g.67084357T>A	ENSP00000284425:p.Met1217Leu	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	12.0	NM_080284	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	T	1.206	-0.631137	0.03584	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.83673	-1.75	4.68	-7.28	0.01456	.	0.924044	0.08913	N	0.875584	T	0.43211	0.1237	N	0.00355	-1.605	0.53005	D	0.999969	B	0.02656	0.0	B	0.01281	0.0	T	0.44742	-0.9308	10	0.02654	T	1	.	10.1124	0.42570	0.3211:0.0:0.5532:0.1257	.	1217	Q8N139	ABCA6_HUMAN	L	1217;77	ENSP00000284425:M1217L	ENSP00000284425:M1217L	M	-	1	0	ABCA6	64595952	0.087000	0.21565	0.445000	0.26908	0.780000	0.44128	-0.144000	0.10280	-1.500000	0.01819	0.379000	0.24179	ATG	.		0.294	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
ABCC8	6833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	17418528	17418528	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:17418528G>A	ENST00000389817.3	-	33	4122	c.4054C>T	c.(4054-4056)Cgc>Tgc	p.R1352C	ABCC8_ENST00000302539.4_Missense_Mutation_p.R1353C			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1352	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> H (in LIH; partially impairs ATP- dependent potassium channel function). {ECO:0000269|PubMed:15356046}.|R -> P (in HHF1; dbSNP:rs28936370). {ECO:0000269|PubMed:9769320}.		carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CTGTCGTAGCGCACGCTCAGG	0.627																																					p.R1352C		.											.	ABCC8	91	0			c.C4054T						.						134.0	107.0	116.0					11																	17418528		2200	4293	6493	SO:0001583	missense	6833	exon33			CGTAGCGCACGCT	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.4054C>T	11.37:g.17418528G>A	ENSP00000374467:p.Arg1352Cys	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	26.0	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.3|25.3	4.626477|4.626477	0.87560|0.87560	.|.	.|.	ENSG00000006071|ENSG00000006071	ENST00000528374|ENST00000389817;ENST00000302539	.|D;D	.|0.90955	.|-2.76;-2.76	4.83|4.83	4.83|4.83	0.62350|0.62350	.|ABC transporter-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94162|0.94162	0.8127|0.8127	L|L	0.53561|0.53561	1.675|1.675	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.94829|0.94829	0.7994|0.7994	5|10	.|0.87932	.|D	.|0	.|.	18.2867|18.2867	0.90117|0.90117	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1352	.|Q09428	.|ABCC8_HUMAN	V|C	179|1352;1353	.|ENSP00000374467:R1352C;ENSP00000303960:R1353C	.|ENSP00000303960:R1353C	A|R	-|-	2|1	0|0	ABCC8|ABCC8	17375104|17375104	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	7.637000|7.637000	0.83313|0.83313	2.386000|2.386000	0.81285|0.81285	0.555000|0.555000	0.69702|0.69702	GCG|CGC	.		0.627	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
ACACB	32	ucsc.edu;bcgsc.ca	37	12	109679059	109679059	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:109679059A>G	ENST00000338432.7	+	36	5114	c.4995A>G	c.(4993-4995)aaA>aaG	p.K1665K	ACACB_ENST00000377854.5_Silent_p.K1595K|ACACB_ENST00000377848.3_Silent_p.K1665K|ACACB_ENST00000543201.1_Silent_p.K331K			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1665					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GCCTCTACAAAGAAGTGACTG	0.542																																					p.K1665K		.											.	ACACB	98	0			c.A4995G						.						151.0	146.0	148.0					12																	109679059		2203	4300	6503	SO:0001819	synonymous_variant	32	exon35			CTACAAAGAAGTG	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.4995A>G	12.37:g.109679059A>G		Somatic	42.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	37	CCDS31898.1																																																																																			.		0.542	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
ACCS	84680	ucsc.edu;bcgsc.ca	37	11	44089461	44089461	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:44089461C>A	ENST00000263776.8	+	2	718	c.284C>A	c.(283-285)cCc>cAc	p.P95H	ACCS_ENST00000533208.1_Intron|ACCS_ENST00000432284.2_Missense_Mutation_p.P95H	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	95					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GACAAGAACCCCAGTGTGAGT	0.522																																					p.P95H	Esophageal Squamous(158;148 1889 8077 23160 41213)	.											.	ACCS	155	0			c.C284A						.						55.0	41.0	46.0					11																	44089461		2203	4300	6503	SO:0001583	missense	84680	exon2			AGAACCCCAGTGT	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.284C>A	11.37:g.44089461C>A	ENSP00000263776:p.Pro95His	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	40.0	5.0	NM_032592	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	37	CCDS7907.1	.	.	.	.	.	.	.	.	.	.	C	19.70	3.876013	0.72180	.	.	ENSG00000110455	ENST00000524990;ENST00000263776;ENST00000432284	T;T;T	0.41758	0.99;1.88;0.99	5.57	4.66	0.58398	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.63343	0.2503	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.993	T	0.65429	-0.6170	9	.	.	.	-26.9369	13.4844	0.61357	0.0:0.9236:0.0:0.0764	.	95;95	B4E219;Q96QU6	.;1A1L1_HUMAN	H	95	ENSP00000434156:P95H;ENSP00000263776:P95H;ENSP00000391775:P95H	.	P	+	2	0	ACCS	44046037	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.888000	0.63164	1.365000	0.46057	0.591000	0.81541	CCC	.		0.522	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592	
ACO2	50	ucsc.edu;bcgsc.ca	37	22	41914547	41914547	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr22:41914547G>A	ENST00000216254.4	+	8	1025	c.1003G>A	c.(1003-1005)Gac>Aac	p.D335N	ACO2_ENST00000396512.3_Missense_Mutation_p.D360N|ACO2_ENST00000466237.1_3'UTR	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	335					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)			breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						CTGCCATTATGACCAACTAAT	0.478																																					p.D335N		.											.	ACO2	290	0			c.G1003A						.						147.0	141.0	143.0					22																	41914547		2203	4300	6503	SO:0001583	missense	50	exon8			CATTATGACCAAC	AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.1003G>A	22.37:g.41914547G>A	ENSP00000216254:p.Asp335Asn	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001098	O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Missense_Mutation	SNP	ENST00000216254.4	37	CCDS14017.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.331071	0.81690	.	.	ENSG00000100412	ENST00000541439;ENST00000544234;ENST00000216254;ENST00000396512	T;T	0.55413	0.52;0.52	5.97	4.95	0.65309	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (1);	0.040310	0.85682	D	0.000000	T	0.70919	0.3279	M	0.93678	3.445	0.80722	D	1	P;B	0.40731	0.728;0.212	P;B	0.46585	0.521;0.363	T	0.78648	-0.2122	10	0.72032	D	0.01	.	15.5997	0.76613	0.0669:0.0:0.9331:0.0	.	360;335	A2A274;Q99798	.;ACON_HUMAN	N	56;316;335;360	ENSP00000216254:D335N;ENSP00000379769:D360N	ENSP00000216254:D335N	D	+	1	0	ACO2	40244493	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.959000	0.93110	2.828000	0.97474	0.655000	0.94253	GAC	.		0.478	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259151.1	NM_001098	
ACTN1	87	ucsc.edu;bcgsc.ca	37	14	69347583	69347583	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:69347583G>T	ENST00000193403.6	-	17	2460	c.2077C>A	c.(2077-2079)Cag>Aag	p.Q693K	ACTN1_ENST00000394419.4_Missense_Mutation_p.Q693K|ACTN1_ENST00000438964.2_Missense_Mutation_p.Q693K|ACTN1_ENST00000538545.2_Missense_Mutation_p.Q693K|ACTN1_ENST00000376839.3_Missense_Mutation_p.Q628K	NM_001102.3	NP_001093.1	P12814	ACTN1_HUMAN	actinin, alpha 1	693	Interaction with DDN.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of apoptotic process (GO:0042981)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|double-stranded RNA binding (GO:0003725)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|vinculin binding (GO:0017166)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(9)|prostate(2)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TGGATGAGCTGGTGGTCGCCC	0.597																																					p.Q693K		.											.	ACTN1	514	0			c.C2077A						.						164.0	135.0	145.0					14																	69347583		2203	4300	6503	SO:0001583	missense	87	exon17			TGAGCTGGTGGTC	M95178	CCDS9792.1, CCDS45129.1, CCDS45130.1	14q24.1	2014-08-08			ENSG00000072110	ENSG00000072110		"""EF-hand domain containing"""	163	protein-coding gene	gene with protein product		102575				2349951	Standard	NM_001102		Approved		uc001xkm.3	P12814	OTTHUMG00000171386	ENST00000193403.6:c.2077C>A	14.37:g.69347583G>T	ENSP00000193403:p.Gln693Lys	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	57.0	5.0	NM_001102	B3V8S3|B4DHH3|B7TY16|Q1HE25|Q9BTN1	Missense_Mutation	SNP	ENST00000193403.6	37	CCDS9792.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.190317|4.190317	0.78789|0.78789	.|.	.|.	ENSG00000072110|ENSG00000072110	ENST00000553290|ENST00000193403;ENST00000394419;ENST00000438964;ENST00000376839;ENST00000538545;ENST00000544964	.|T;T;T;T;T;T	.|0.44881	.|0.91;0.91;0.91;0.91;0.91;0.91	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67040|0.67040	0.2851|0.2851	M|M	0.80508|0.80508	2.5|2.5	0.80722|0.80722	D|D	1|1	.|P;B;P;B;P	.|0.51933	.|0.949;0.265;0.833;0.365;0.867	.|D;B;B;B;P	.|0.68765	.|0.96;0.196;0.342;0.361;0.736	T|T	0.70274|0.70274	-0.4917|-0.4917	5|10	.|0.54805	.|T	.|0.06	.|.	18.1662|18.1662	0.89727|0.89727	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|324;693;693;693;340	.|B7Z2W3;P12814-2;Q1HE25;P12814;B4DFY0	.|.;.;.;ACTN1_HUMAN;.	Q|K	132|693;693;693;628;693;222	.|ENSP00000193403:Q693K;ENSP00000377941:Q693K;ENSP00000414272:Q693K;ENSP00000366035:Q628K;ENSP00000439828:Q693K;ENSP00000444422:Q222K	.|ENSP00000193403:Q693K	P|Q	-|-	2|1	0|0	ACTN1|ACTN1	68417336|68417336	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.657000|9.657000	0.98554|0.98554	2.524000|2.524000	0.85096|0.85096	0.655000|0.655000	0.94253|0.94253	CCA|CAG	.		0.597	ACTN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413233.3	NM_001102	
ACVRL1	94	ucsc.edu;bcgsc.ca	37	12	52309921	52309921	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:52309921C>A	ENST00000388922.4	+	8	1433	c.1150C>A	c.(1150-1152)Cag>Aag	p.Q384K	ACVRL1_ENST00000419526.2_Missense_Mutation_p.Q210K|ACVRL1_ENST00000550683.1_Missense_Mutation_p.Q398K	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	384	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	GCTGGACGAGCAGATCCGCAC	0.602																																					p.Q384K		.											.	ACVRL1	521	0			c.C1150A						.						104.0	88.0	94.0					12																	52309921		2203	4300	6503	SO:0001583	missense	94	exon8			GACGAGCAGATCC	L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.1150C>A	12.37:g.52309921C>A	ENSP00000373574:p.Gln384Lys	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_000020	A6NGA8	Missense_Mutation	SNP	ENST00000388922.4	37	CCDS31804.1	.	.	.	.	.	.	.	.	.	.	C	9.339	1.062493	0.19987	.	.	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683;ENST00000548659;ENST00000419526	D;D;D	0.93019	-3.15;-3.15;-3.15	4.98	1.98	0.26296	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.534882	0.15863	N	0.240923	D	0.86552	0.5960	N	0.11313	0.125	0.31326	N	0.685384	B;B	0.22080	0.064;0.028	B;B	0.27380	0.079;0.028	T	0.81887	-0.0726	10	0.72032	D	0.01	.	13.7076	0.62648	0.5705:0.4295:0.0:0.0	.	210;384	E7EN07;P37023	.;ACVL1_HUMAN	K	384;384;398;210;210	ENSP00000373574:Q384K;ENSP00000447884:Q398K;ENSP00000392492:Q210K	ENSP00000267008:Q384K	Q	+	1	0	ACVRL1	50596188	0.001000	0.12720	0.999000	0.59377	0.100000	0.18952	0.077000	0.14738	0.308000	0.22923	-0.261000	0.10672	CAG	.		0.602	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2		
ADAMTS18	170692	ucsc.edu;bcgsc.ca	37	16	77369704	77369704	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:77369704C>A	ENST00000282849.5	-	12	2226	c.1808G>T	c.(1807-1809)cGg>cTg	p.R603L		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	603	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ACCACATGTCCGGGAACATTC	0.577																																					p.R603L		.											.	ADAMTS18	1036	0			c.G1808T						.						174.0	172.0	173.0					16																	77369704		2198	4300	6498	SO:0001583	missense	170692	exon12			CATGTCCGGGAAC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.1808G>T	16.37:g.77369704C>A	ENSP00000282849:p.Arg603Leu	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	20.0	4.0	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	35	5.557779	0.96514	.	.	ENSG00000140873	ENST00000282849	T	0.52057	0.68	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.71533	0.3351	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.978;0.999	T	0.74028	-0.3796	10	0.87932	D	0	.	18.9284	0.92554	0.0:1.0:0.0:0.0	.	603;603	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	L	603	ENSP00000282849:R603L	ENSP00000282849:R603L	R	-	2	0	ADAMTS18	75927205	0.989000	0.36119	0.627000	0.29227	0.986000	0.74619	7.696000	0.84270	2.712000	0.92718	0.650000	0.86243	CGG	.		0.577	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
ADARB2	105	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	1284338	1284338	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:1284338A>C	ENST00000381312.1	-	5	1542	c.1217T>G	c.(1216-1218)gTc>gGc	p.V406G	ADARB2_ENST00000469464.1_5'Flank	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	406					mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CAGGGCCACGACCTGCGCCTG	0.682																																					p.V406G		.											.	ADARB2	153	0			c.T1217G						.						23.0	16.0	18.0					10																	1284338		2183	4265	6448	SO:0001583	missense	105	exon5			GCCACGACCTGCG	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1217T>G	10.37:g.1284338A>C	ENSP00000370713:p.Val406Gly	Somatic	26.0	1.0		WXS	Illumina HiSeq	Phase_I	16.0	5.0	NM_018702	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	ENST00000381312.1	37	CCDS7058.1	.	.	.	.	.	.	.	.	.	.	A	18.87	3.714537	0.68730	.	.	ENSG00000185736	ENST00000381312	T	0.35789	1.29	5.7	5.7	0.88788	Adenosine deaminase/editase (1);	0.000000	0.85682	D	0.000000	T	0.67011	0.2848	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74375	-0.3686	10	0.87932	D	0	-45.4128	15.9676	0.79985	1.0:0.0:0.0:0.0	.	406	Q9NS39	RED2_HUMAN	G	406	ENSP00000370713:V406G	ENSP00000370713:V406G	V	-	2	0	ADARB2	1274338	1.000000	0.71417	0.947000	0.38551	0.249000	0.25844	9.180000	0.94867	2.172000	0.68678	0.379000	0.24179	GTC	.		0.682	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702	
ADAT1	23536	ucsc.edu;bcgsc.ca	37	16	75646506	75646506	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:75646506G>A	ENST00000307921.3	-	7	823	c.678C>T	c.(676-678)atC>atT	p.I226I		NM_012091.3	NP_036223.2	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	226	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.		I -> V (in dbSNP:rs56029288).		tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|RNA binding (GO:0003723)|tRNA-specific adenosine deaminase activity (GO:0008251)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)	19						TGCCTGGTGAGATTGGGCCAC	0.517																																					p.I226I		.											.	ADAT1	92	0			c.C678T						.						206.0	202.0	203.0					16																	75646506		2198	4300	6498	SO:0001819	synonymous_variant	23536	exon7			TGGTGAGATTGGG	AF125188	CCDS10922.1	16q23	2008-02-05			ENSG00000065457	ENSG00000065457			228	protein-coding gene	gene with protein product		604230				10430867	Standard	NM_012091		Approved		uc002feo.2	Q9BUB4	OTTHUMG00000137611	ENST00000307921.3:c.678C>T	16.37:g.75646506G>A		Somatic	64.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_012091	Q9NVB7|Q9UNG3	Silent	SNP	ENST00000307921.3	37	CCDS10922.1																																																																																			.		0.517	ADAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269027.1	NM_012091	
ADCY10	55811	hgsc.bcm.edu;bcgsc.ca	37	1	167802265	167802267	+	In_Frame_Del	DEL	GAA	GAA	-	rs369038387		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:167802265_167802267delGAA	ENST00000367851.4	-	25	3735_3737	c.3551_3553delTTC	c.(3550-3555)tttcat>tat	p.1184_1185FH>Y	ADCY10_ENST00000367848.1_In_Frame_Del_p.1092_1093FH>Y|ADCY10_ENST00000545172.1_In_Frame_Del_p.1031_1032FH>Y	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1184					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TTCACATAATGAAAGTGTCTGTT	0.488																																					p.1184_1185del		.											.	ADCY10	493	0			c.3551_3553del						.																																			SO:0001651	inframe_deletion	55811	exon25			CATAATGAAAGTG	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.3551_3553delTTC	1.37:g.167802265_167802267delGAA	ENSP00000356825:p.Phe1184_His1185delinsTyr	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	28.0	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	In_Frame_Del	DEL	ENST00000367851.4	37	CCDS1265.1																																																																																			.		0.488	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
ADSSL1	122622	ucsc.edu;bcgsc.ca	37	14	105207562	105207562	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:105207562C>A	ENST00000330877.2	+	8	860	c.775C>A	c.(775-777)Ctc>Atc	p.L259I	ADSSL1_ENST00000332972.5_Missense_Mutation_p.L302I	NM_152328.3	NP_689541.1			adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		CAACGCCGCCCTCCTCGACAT	0.607																																					p.L302I		.											.	ADSSL1	515	0			c.C904A						.						48.0	49.0	49.0					14																	105207562		2203	4299	6502	SO:0001583	missense	122622	exon8			GCCGCCCTCCTCG	AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000330877.2:c.775C>A	14.37:g.105207562C>A	ENSP00000331260:p.Leu259Ile	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_199165		Missense_Mutation	SNP	ENST00000330877.2	37	CCDS9990.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.147192	0.77888	.	.	ENSG00000185100	ENST00000330877;ENST00000332972	T;T	0.50813	0.73;0.73	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000001	T	0.69251	0.3090	M	0.89534	3.04	0.80722	D	1	D;P	0.55800	0.973;0.887	P;P	0.62740	0.891;0.906	T	0.74962	-0.3485	10	0.87932	D	0	-17.9623	9.112	0.36734	0.0:0.8283:0.0:0.1717	.	302;259	Q8N142-2;Q8N142	.;PURA1_HUMAN	I	259;302	ENSP00000331260:L259I;ENSP00000333019:L302I	ENSP00000331260:L259I	L	+	1	0	ADSSL1	104278607	1.000000	0.71417	0.842000	0.33263	0.777000	0.43975	3.252000	0.51461	2.394000	0.81467	0.655000	0.94253	CTC	.		0.607	ADSSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410529.1		
AKAP12	9590	ucsc.edu;bcgsc.ca	37	6	151672032	151672032	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:151672032G>A	ENST00000253332.1	+	3	2695	c.2506G>A	c.(2506-2508)Gcc>Acc	p.A836T	AKAP12_ENST00000354675.6_Missense_Mutation_p.A738T|AKAP12_ENST00000359755.5_Missense_Mutation_p.A731T|AKAP12_ENST00000402676.2_Missense_Mutation_p.A836T			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	836					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GCCAACAGGGGCCAACGAAGA	0.517																																					p.A836T	Melanoma(141;1616 1805 10049 24534 51979)	.											.	AKAP12	293	0			c.G2506A						.						90.0	102.0	98.0					6																	151672032		2203	4300	6503	SO:0001583	missense	9590	exon4			ACAGGGGCCAACG	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.2506G>A	6.37:g.151672032G>A	ENSP00000253332:p.Ala836Thr	Somatic	75.0	0.0		WXS	Illumina HiSeq	.	58.0	5.0	NM_005100	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Missense_Mutation	SNP	ENST00000253332.1	37	CCDS5229.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563840	0.45694	.	.	ENSG00000131016	ENST00000402676;ENST00000253332;ENST00000354675;ENST00000359755	T;T;T;T	0.07021	3.23;3.23;3.23;3.23	5.63	4.75	0.60458	.	1.004170	0.08027	N	0.992956	T	0.01976	0.0062	N	0.22421	0.69	0.09310	N	1	B;B;B	0.24823	0.112;0.112;0.068	B;B;B	0.23852	0.049;0.049;0.022	T	0.46456	-0.9190	10	0.21014	T	0.42	.	8.6504	0.34031	0.2208:0.0:0.7791:0.0	.	731;738;836	Q02952-3;Q02952-2;Q02952	.;.;AKA12_HUMAN	T	836;836;738;731	ENSP00000384537:A836T;ENSP00000253332:A836T;ENSP00000346702:A738T;ENSP00000352794:A731T	ENSP00000253332:A836T	A	+	1	0	AKAP12	151713725	0.891000	0.30450	0.006000	0.13384	0.006000	0.05464	2.563000	0.45922	1.353000	0.45828	0.655000	0.94253	GCC	.		0.517	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
AKAP1	8165	ucsc.edu;bcgsc.ca	37	17	55184293	55184293	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:55184293T>C	ENST00000337714.3	+	2	1701	c.1468T>C	c.(1468-1470)Tgc>Cgc	p.C490R	AKAP1_ENST00000539273.1_Missense_Mutation_p.C490R|AKAP1_ENST00000571629.1_Missense_Mutation_p.C490R|AKAP1_ENST00000572557.1_Missense_Mutation_p.C490R|AKAP1_ENST00000314126.3_Missense_Mutation_p.C490R	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	490					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					CTGTGTCACCTGCATGTCAGA	0.577																																					p.C490R		.											.	AKAP1	227	0			c.T1468C						.						114.0	111.0	112.0					17																	55184293		2203	4300	6503	SO:0001583	missense	8165	exon3			GTCACCTGCATGT	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.1468T>C	17.37:g.55184293T>C	ENSP00000337736:p.Cys490Arg	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001242902	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	ENST00000337714.3	37	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	T	13.55	2.271529	0.40194	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.58060	0.83;0.36;0.83	6.17	6.17	0.99709	.	0.042622	0.85682	D	0.000000	T	0.73164	0.3552	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76072	-0.3093	10	0.87932	D	0	-7.6251	16.0034	0.80327	0.0:0.0:0.0:1.0	.	490	Q92667	AKAP1_HUMAN	R	490;490;532;490	ENSP00000337736:C490R;ENSP00000314075:C490R;ENSP00000443139:C490R	ENSP00000314075:C490R	C	+	1	0	AKAP1	52539292	0.619000	0.27059	0.466000	0.27168	0.047000	0.14425	1.773000	0.38563	2.371000	0.80710	0.533000	0.62120	TGC	.		0.577	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1		
AKIRIN1	79647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	39463936	39463936	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:39463936C>T	ENST00000432648.3	+	2	472	c.314C>T	c.(313-315)tCg>tTg	p.S105L	AKIRIN1_ENST00000372984.4_Intron|AKIRIN1_ENST00000446189.2_Missense_Mutation_p.S105L	NM_024595.2	NP_078871.1	Q9H9L7	AKIR1_HUMAN	akirin 1	105						nuclear membrane (GO:0031965)|nucleus (GO:0005634)				lung(1)|prostate(1)|skin(1)	3						GCTTGTGCTTCGGAAAGTCAA	0.388																																					p.S105L		.											.	AKIRIN1	90	0			c.C314T						.						85.0	83.0	84.0					1																	39463936		2203	4300	6503	SO:0001583	missense	79647	exon2			GTGCTTCGGAAAG	AK022728	CCDS433.1, CCDS44113.1	1p34.3	2013-10-11	2008-06-23	2008-06-23	ENSG00000174574	ENSG00000174574			25744	protein-coding gene	gene with protein product		615164	"""chromosome 1 open reading frame 108"""	C1orf108		19200367	Standard	NM_024595		Approved	FLJ12666	uc001ccw.3	Q9H9L7	OTTHUMG00000007496	ENST00000432648.3:c.314C>T	1.37:g.39463936C>T	ENSP00000392678:p.Ser105Leu	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	24.0	NM_024595	B4DZU6|Q0VDB3|Q53FK8	Missense_Mutation	SNP	ENST00000432648.3	37	CCDS433.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.982818|3.982818	0.74474|0.74474	.|.	.|.	ENSG00000174574|ENSG00000174574	ENST00000531822|ENST00000432648;ENST00000446189	.|T;T	.|0.64260	.|-0.09;-0.09	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.274240	.|0.34777	.|N	.|0.003686	T|T	0.61714|0.61714	0.2369|0.2369	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D;P	.|0.56521	.|0.976;0.948	.|P;B	.|0.51385	.|0.668;0.254	T|T	0.65841|0.65841	-0.6070|-0.6070	5|10	.|0.62326	.|D	.|0.03	-6.9641|-6.9641	16.4569|16.4569	0.84021|0.84021	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|105;105	.|B4DZU6;Q9H9L7	.|.;AKIR1_HUMAN	W|L	67|105	.|ENSP00000392678:S105L;ENSP00000389866:S105L	.|ENSP00000392678:S105L	R|S	+|+	1|2	2|0	AKIRIN1|AKIRIN1	39236523|39236523	0.988000|0.988000	0.35896|0.35896	0.966000|0.966000	0.40874|0.40874	0.982000|0.982000	0.71751|0.71751	2.292000|2.292000	0.43549|0.43549	2.534000|2.534000	0.85438|0.85438	0.563000|0.563000	0.77884|0.77884	CGG|TCG	.		0.388	AKIRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019687.2	NM_024595	
AMBRA1	55626	ucsc.edu;bcgsc.ca	37	11	46419099	46419099	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:46419099T>C	ENST00000458649.2	-	18	4216	c.3798A>G	c.(3796-3798)ccA>ccG	p.P1266P	AMBRA1_ENST00000426438.1_Silent_p.P1237P|AMBRA1_ENST00000314845.3_Silent_p.P1176P|AMBRA1_ENST00000534300.1_Silent_p.P1206P|AMBRA1_ENST00000528950.1_Silent_p.P1237P|AMBRA1_ENST00000533727.1_Silent_p.P1147P|AMBRA1_ENST00000298834.3_Silent_p.P1206P			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1266					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AGTGGAGGGTTGGTCCCTCAG	0.637																																					p.P1269P		.											.	AMBRA1	136	0			c.A3807G						.						79.0	76.0	77.0					11																	46419099		2202	4299	6501	SO:0001819	synonymous_variant	55626	exon20			GAGGGTTGGTCCC	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3798A>G	11.37:g.46419099T>C		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001267782	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	ENST00000458649.2	37																																																																																				.		0.637	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
AMER3	205147	ucsc.edu;bcgsc.ca	37	2	131520641	131520641	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:131520641C>T	ENST00000423981.1	+	2	1106	c.996C>T	c.(994-996)ccC>ccT	p.P332P	AMER3_ENST00000321420.4_Silent_p.P332P	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	332					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										TTTCAGGCCCCCAGGGGACAG	0.652																																					p.P332P		.											.	.	.	0			c.C996T						.						34.0	40.0	38.0					2																	131520641		2203	4300	6503	SO:0001819	synonymous_variant	205147	exon2			AGGCCCCCAGGGG	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.996C>T	2.37:g.131520641C>T		Somatic	37.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_152698	B7ZLH6	Silent	SNP	ENST00000423981.1	37	CCDS2164.1																																																																																			.		0.652	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
AMT	275	ucsc.edu;bcgsc.ca	37	3	49459665	49459665	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:49459665C>T	ENST00000273588.3	-	2	432	c.130G>A	c.(130-132)Gcc>Acc	p.A44T	AMT_ENST00000476226.1_5'UTR|AMT_ENST00000395338.2_Missense_Mutation_p.A44T|AMT_ENST00000458307.2_Missense_Mutation_p.A44T|AMT_ENST00000546031.1_Intron|NICN1-AS1_ENST00000424915.1_RNA|AMT_ENST00000538581.1_Intron|NICN1_ENST00000422593.1_5'Flank	NM_000481.3	NP_000472.2	P48728	GCST_HUMAN	aminomethyltransferase	44					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|transaminase activity (GO:0008483)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Tetrahydrofolic acid(DB00116)	CCGCCGTGGGCCAGGTGGAAG	0.662																																					p.A44T		.											.	AMT	91	0			c.G130A						.						106.0	112.0	110.0					3																	49459665		2203	4300	6503	SO:0001583	missense	275	exon2			CGTGGGCCAGGTG	D13811	CCDS2797.1, CCDS54583.1, CCDS54584.1, CCDS54585.1	3p21.2-p21.1	2014-09-17	2006-05-22		ENSG00000145020	ENSG00000145020	2.1.2.10		473	protein-coding gene	gene with protein product	"""glycine cleavage system protein T"""	238310	"""aminomethyltransferase (glycine cleavage system protein T)"""			1993704, 8188235	Standard	NM_000481		Approved	GCST, NKH	uc003cww.3	P48728	OTTHUMG00000156847	ENST00000273588.3:c.130G>A	3.37:g.49459665C>T	ENSP00000273588:p.Ala44Thr	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	27.0	5.0	NM_001164712	A8K3I5|B4DE61|B4DJQ0|E9PBG1|Q96IG6	Missense_Mutation	SNP	ENST00000273588.3	37	CCDS2797.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.31|16.31	3.088626|3.088626	0.55968|0.55968	.|.	.|.	ENSG00000145020|ENSG00000145020	ENST00000395338;ENST00000458307;ENST00000273588|ENST00000427987	D;D;D|.	0.85013|.	-1.93;-1.93;-1.93|.	5.22|5.22	3.29|3.29	0.37713|0.37713	.|.	0.276760|.	0.33534|.	N|.	0.004812|.	T|T	0.52933|0.52933	0.1765|0.1765	L|L	0.41236|0.41236	1.265|1.265	0.80722|0.80722	D|D	1|1	B;B;B|.	0.29936|.	0.262;0.073;0.073|.	B;B;B|.	0.32533|.	0.147;0.032;0.032|.	T|T	0.44528|0.44528	-0.9322|-0.9322	10|5	0.44086|.	T|.	0.13|.	-16.34|-16.34	8.3146|8.3146	0.32093|0.32093	0.0:0.7476:0.1617:0.0906|0.0:0.7476:0.1617:0.0906	.|.	44;44;44|.	B4DJQ0;E9PBG1;P48728|.	.;.;GCST_HUMAN|.	T|D	44|41	ENSP00000378747:A44T;ENSP00000415619:A44T;ENSP00000273588:A44T|.	ENSP00000273588:A44T|.	A|G	-|-	1|2	0|0	AMT|AMT	49434669|49434669	0.000000|0.000000	0.05858|0.05858	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	0.018000|0.018000	0.13422|0.13422	2.581000|2.581000	0.87130|0.87130	0.655000|0.655000	0.94253|0.94253	GCC|GGC	.		0.662	AMT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346216.2	NM_000481	
ANKHD1	54882	hgsc.bcm.edu;bcgsc.ca	37	5	139903797	139903798	+	Frame_Shift_Ins	INS	-	-	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:139903797_139903798insG	ENST00000360839.2	+	25	4618_4619	c.4464_4465insG	c.(4465-4467)gaafs	p.E1489fs	ANKHD1_ENST00000297183.6_Frame_Shift_Ins_p.E1489fs|ANKHD1-EIF4EBP3_ENST00000532219.1_Frame_Shift_Ins_p.E1489fs|ANKHD1_ENST00000544120.1_5'Flank	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1489						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACCAGAGGATGAAGATGAAGA	0.342																																					p.D1488fs		.											.	ANKHD1	185	0			c.4464_4465insG						.																																			SO:0001589	frameshift_variant	54882	exon25			AGAGGATGAAGAT	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.4465dupG	5.37:g.139903798_139903798dupG	ENSP00000354085:p.Glu1489fs	Somatic	410.0	0.0		WXS	Illumina HiSeq	Phase_I	478.0	160.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Frame_Shift_Ins	INS	ENST00000360839.2	37	CCDS4225.1																																																																																			.		0.342	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
ANKLE2	23141	ucsc.edu;bcgsc.ca	37	12	133303866	133303866	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:133303866G>A	ENST00000357997.5	-	13	2868	c.2779C>T	c.(2779-2781)Cgc>Tgc	p.R927C	ANKLE2_ENST00000542657.1_Missense_Mutation_p.R282C|ANKLE2_ENST00000539605.1_Missense_Mutation_p.R865C|ANKLE2_ENST00000542282.1_Missense_Mutation_p.R282C|ANKLE2_ENST00000542374.1_5'Flank	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	927					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		GCCATCCTGCGGAGCTGGCTC	0.607																																					p.R927C		.											.	ANKLE2	68	0			c.C2779T						.						10.0	12.0	12.0					12																	133303866		1939	4103	6042	SO:0001583	missense	23141	exon13			TCCTGCGGAGCTG	AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.2779C>T	12.37:g.133303866G>A	ENSP00000350686:p.Arg927Cys	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	19.0	4.0	NM_015114	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	ENST00000357997.5	37	CCDS41869.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.812785	0.50527	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000542282;ENST00000542657	T;T;T;T	0.48201	1.84;1.83;0.82;0.82	5.61	3.45	0.39498	.	0.777800	0.11748	N	0.533315	T	0.42607	0.1210	L	0.51422	1.61	0.09310	N	1	B	0.15719	0.014	B	0.06405	0.002	T	0.39800	-0.9596	10	0.72032	D	0.01	-6.0803	9.9966	0.41902	0.2373:0.0:0.7627:0.0	.	927	Q86XL3	ANKL2_HUMAN	C	865;927;282;282	ENSP00000446268:R865C;ENSP00000350686:R927C;ENSP00000437807:R282C;ENSP00000438551:R282C	ENSP00000350686:R927C	R	-	1	0	ANKLE2	131813939	0.899000	0.30636	0.137000	0.22149	0.031000	0.12232	3.250000	0.51445	1.369000	0.46134	0.655000	0.94253	CGC	.		0.607	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397712.1		
ARHGAP35	2909	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	47422780	47422780	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:47422780G>A	ENST00000404338.3	+	1	848	c.848G>A	c.(847-849)cGc>cAc	p.R283H		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	283	FF 1.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										CTGGTGAGTCGCATTGTGAAA	0.463																																					p.R283H		.											.	.	.	0			c.G848A						.						45.0	46.0	45.0					19																	47422780		2015	4209	6224	SO:0001583	missense	2909	exon1			TGAGTCGCATTGT	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.848G>A	19.37:g.47422780G>A	ENSP00000385720:p.Arg283His	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	8.0	NM_004491	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.865554	0.32977	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	T	0.07114	3.22	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.10035	0.0246	L	0.36672	1.1	0.80722	D	1	B	0.14438	0.01	B	0.12837	0.008	T	0.18147	-1.0346	10	0.31617	T	0.26	-27.4434	19.2296	0.93833	0.0:0.0:1.0:0.0	.	283	Q9NRY4-2	.	H	283	ENSP00000385720:R283H	ENSP00000324820:R283H	R	+	2	0	ARHGAP35	52114620	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.909000	0.63314	2.835000	0.97688	0.650000	0.86243	CGC	.		0.463	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
ARHGEF10L	55160	ucsc.edu;bcgsc.ca	37	1	17907119	17907119	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:17907119C>A	ENST00000361221.3	+	2	188	c.29C>A	c.(28-30)cCt>cAt	p.P10H	ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.P10H|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.P10H|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.P10H	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	10						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CCTCCACAGCCTGCCATAGGT	0.602																																					p.P10H		.											.	ARHGEF10L	292	0			c.C29A						.						109.0	83.0	92.0					1																	17907119		2203	4300	6503	SO:0001583	missense	55160	exon2			CACAGCCTGCCAT	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.29C>A	1.37:g.17907119C>A	ENSP00000355060:p.Pro10His	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	23.0	4.0	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	CCDS182.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.527201	0.44969	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415	T;T;T;T	0.63255	0.3;-0.03;0.1;-0.03	4.28	4.28	0.50868	.	0.211741	0.31709	N	0.007181	T	0.54143	0.1840	N	0.19112	0.55	0.80722	D	1	P;B;P;P	0.48694	0.892;0.002;0.471;0.914	P;B;B;P	0.48815	0.591;0.005;0.391;0.466	T	0.60900	-0.7171	10	0.87932	D	0	-5.7733	12.3936	0.55373	0.0:1.0:0.0:0.0	.	10;10;10;10	Q9HCE6-5;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;ARGAL_HUMAN	H	10	ENSP00000355060:P10H;ENSP00000399401:P10H;ENSP00000394621:P10H;ENSP00000364564:P10H	ENSP00000355060:P10H	P	+	2	0	ARHGEF10L	17779706	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.163000	0.50763	2.382000	0.81193	0.462000	0.41574	CCT	.		0.602	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
ARHGEF40	55701	ucsc.edu;bcgsc.ca	37	14	21550107	21550107	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:21550107C>T	ENST00000298694.4	+	14	3207	c.3080C>T	c.(3079-3081)gCa>gTa	p.A1027V	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.A1027V			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	1027						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						GCTCCAGAAGCAGAGGGCAGG	0.657																																					p.A1027V		.											.	ARHGEF40	228	0			c.C3080T						.						21.0	21.0	21.0					14																	21550107		2201	4295	6496	SO:0001583	missense	55701	exon14			CAGAAGCAGAGGG		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.3080C>T	14.37:g.21550107C>T	ENSP00000298694:p.Ala1027Val	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.332130	0.24167	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.02552	4.3;4.25	5.54	3.69	0.42338	.	0.255456	0.28082	N	0.016672	T	0.01905	0.0060	N	0.14661	0.345	0.09310	N	1	B;B;B	0.15930	0.015;0.005;0.004	B;B;B	0.17722	0.007;0.003;0.019	T	0.47209	-0.9135	10	0.27785	T	0.31	.	6.4352	0.21819	0.181:0.7293:0.0:0.0897	.	1027;1027;313	Q8TER5-4;Q8TER5;Q8TER5-2	.;ARH40_HUMAN;.	V	1027	ENSP00000298694:A1027V;ENSP00000298693:A1027V	ENSP00000298693:A1027V	A	+	2	0	ARHGEF40	20619947	1.000000	0.71417	0.652000	0.29579	0.733000	0.41908	0.999000	0.29757	0.862000	0.35528	0.655000	0.94253	GCA	.		0.657	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	27101342	27101342	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:27101342G>T	ENST00000324856.7	+	18	4995	c.4624G>T	c.(4624-4626)Gaa>Taa	p.E1542*	ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000457599.2_Intron|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.E1159*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1542					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.E1542*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGCCAACCACGAAGGCTCGTG	0.642			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.E1542X		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,NS,carcinoma,0	ARID1A	584	1	Substitution - Nonsense(1)	ovary(1)	c.G4624T						.						60.0	63.0	62.0					1																	27101342		2203	4300	6503	SO:0001587	stop_gained	8289	exon18			AACCACGAAGGCT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4624G>T	1.37:g.27101342G>T	ENSP00000320485:p.Glu1542*	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	36.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.343878|10.343878	0.99388|0.99388	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000374152|ENST00000430799	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.045702|.	0.85682|.	D|.	0.000000|.	.|T	.|0.75287	.|0.3829	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72743	.|-0.4201	.|4	0.42905|.	T|.	0.14|.	-7.5866|-7.5866	19.3941|19.3941	0.94598|0.94598	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1542;1159|438	.|.	ENSP00000320485:E1542X|.	E|R	+|+	1|2	0|0	ARID1A|ARID1A	26973929|26973929	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.479000|0.479000	0.33129|0.33129	9.144000|9.144000	0.94629|0.94629	2.822000|2.822000	0.97130|0.97130	0.557000|0.557000	0.71058|0.71058	GAA|CGA	.		0.642	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ASB2	51676	ucsc.edu;bcgsc.ca	37	14	94405781	94405781	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:94405781C>T	ENST00000315988.4	-	6	1634	c.1146G>A	c.(1144-1146)ctG>ctA	p.L382L	ASB2_ENST00000556337.1_5'UTR|RP11-131H24.4_ENST00000557646.1_5'Flank|ASB2_ENST00000555019.1_Silent_p.L430L	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	382					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		CGTGTTGCAGCAGCAGCTCGG	0.697																																					p.L430L		.											.	ASB2	228	0			c.G1290A						.						43.0	35.0	38.0					14																	94405781		2202	4299	6501	SO:0001819	synonymous_variant	51676	exon8			TTGCAGCAGCAGC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1146G>A	14.37:g.94405781C>T		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_001202429	B2RDP9|B4E166|Q9NSU5|Q9Y567	Silent	SNP	ENST00000315988.4	37	CCDS9915.1																																																																																			.		0.697	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
ATG2A	23130	ucsc.edu;bcgsc.ca	37	11	64664266	64664266	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:64664266G>T	ENST00000377264.3	-	38	5338	c.5226C>A	c.(5224-5226)ccC>ccA	p.P1742P	ATG2A_ENST00000421419.2_Silent_p.P1744P	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1742					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CCAGCAGGCCGGGCAGCTGGT	0.622											OREG0004026	type=REGULATORY REGION|Gene=BC027481|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.P1742P		.											.	ATG2A	69	0			c.C5226A						.						58.0	60.0	60.0					11																	64664266		2201	4297	6498	SO:0001819	synonymous_variant	23130	exon38			CAGGCCGGGCAGC		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.5226C>A	11.37:g.64664266G>T		Somatic	30.0	0.0	1078	WXS	Illumina HiSeq	.	44.0	4.0	NM_015104	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Silent	SNP	ENST00000377264.3	37	CCDS31602.1																																																																																			.		0.622	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
ATP13A1	57130	ucsc.edu;bcgsc.ca	37	19	19756683	19756683	+	Splice_Site	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:19756683T>C	ENST00000357324.6	-	24	3386	c.3360A>G	c.(3358-3360)aaA>aaG	p.K1120K	GMIP_ENST00000445806.2_5'Flank|ATP13A1_ENST00000291503.5_Splice_Site_p.K1002K|GMIP_ENST00000587238.1_5'Flank|GMIP_ENST00000203556.4_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	1120						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CAGGCCTTACTTTGTAATTGA	0.577																																					p.K1120K	Esophageal Squamous(142;920 1789 9047 14684 24777)	.											.	ATP13A1	138	0			c.A3360G						.						164.0	153.0	157.0					19																	19756683		2203	4300	6503	SO:0001630	splice_region_variant	57130	exon24			CCTTACTTTGTAA	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.3360+1A>G	19.37:g.19756683T>C		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Silent	SNP	ENST00000357324.6	37	CCDS32970.2																																																																																			.		0.577	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	Silent
ATP4A	495	ucsc.edu;bcgsc.ca	37	19	36043982	36043982	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:36043982T>C	ENST00000262623.3	-	18	2736	c.2708A>G	c.(2707-2709)gAc>gGc	p.D903G		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	903					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	TAGGTGGTGGTCCTCCCACTG	0.647																																					p.D903G		.											.	ATP4A	91	0			c.A2708G						.						91.0	86.0	88.0					19																	36043982		2203	4300	6503	SO:0001583	missense	495	exon18			TGGTGGTCCTCCC		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.2708A>G	19.37:g.36043982T>C	ENSP00000262623:p.Asp903Gly	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	T	15.81	2.943556	0.53079	.	.	ENSG00000105675	ENST00000262623	D	0.88818	-2.43	4.61	4.61	0.57282	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.225469	0.32802	N	0.005632	D	0.88987	0.6587	M	0.81497	2.545	0.29305	N	0.868409	B	0.14438	0.01	B	0.23275	0.045	D	0.85541	0.1215	10	0.72032	D	0.01	.	12.0135	0.53301	0.0:0.0:0.0:1.0	.	903	P20648	ATP4A_HUMAN	G	903	ENSP00000262623:D903G	ENSP00000262623:D903G	D	-	2	0	ATP4A	40735822	0.879000	0.30193	1.000000	0.80357	0.987000	0.75469	5.766000	0.68843	1.926000	0.55796	0.454000	0.30748	GAC	.		0.647	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
AXIN1	8312	broad.mit.edu;bcgsc.ca	37	16	339439	339439	+	Splice_Site	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:339439C>T	ENST00000262320.3	-	10	2834		c.e10+1		AXIN1_ENST00000354866.3_Splice_Site	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1						activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CTCACACTCACCTGTAGCTGC	0.632																																					.		.											.	AXIN1	684	0			c.2354+1G>A						.						59.0	59.0	59.0					16																	339439		2202	4299	6501	SO:0001630	splice_region_variant	8312	exon10			CACTCACCTGTAG	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.2462+1G>A	16.37:g.339439C>T		Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	8.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Splice_Site	SNP	ENST00000262320.3	37	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005112	0.35415	.	.	ENSG00000103126	ENST00000262320;ENST00000354866;ENST00000457798	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.06	0.86544	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AXIN1	279440	1.000000	0.71417	0.983000	0.44433	0.204000	0.24138	7.650000	0.83521	2.042000	0.60477	0.313000	0.20887	.	.		0.632	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		Intron
BCO1	53630	ucsc.edu;bcgsc.ca	37	16	81295852	81295852	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:81295852G>T	ENST00000258168.2	+	4	896	c.435G>T	c.(433-435)agG>agT	p.R145S	BCMO1_ENST00000564552.1_Missense_Mutation_p.R145S|BCMO1_ENST00000425577.2_Missense_Mutation_p.R76S	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						ATTACATCAGGAAAATCAACC	0.498																																					p.R145S		.											.	BCMO1	90	0			c.G435T						.						147.0	136.0	140.0					16																	81295852		2202	4300	6502	SO:0001583	missense	53630	exon4			CATCAGGAAAATC																												ENST00000258168.2:c.435G>T	16.37:g.81295852G>T	ENSP00000258168:p.Arg145Ser	Somatic	60.0	0.0		WXS	Illumina HiSeq	.	29.0	5.0	NM_017429		Missense_Mutation	SNP	ENST00000258168.2	37	CCDS10934.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302295	0.60195	.	.	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.94723	-3.5;-3.5	5.79	4.83	0.62350	.	0.165435	0.56097	N	0.000022	D	0.93739	0.7999	M	0.70275	2.135	0.39894	D	0.973802	P;B;P	0.44090	0.6;0.153;0.826	B;B;P	0.44860	0.254;0.095;0.462	D	0.92562	0.6059	10	0.29301	T	0.29	-25.8305	12.6124	0.56558	0.1375:0.0:0.8625:0.0	.	76;145;76	E7EM88;Q9HAY6;B4DJC0	.;BCDO1_HUMAN;.	S	145;76	ENSP00000258168:R145S;ENSP00000400586:R76S	ENSP00000258168:R145S	R	+	3	2	BCMO1	79853353	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.187000	0.50950	1.456000	0.47831	0.549000	0.68633	AGG	.		0.498	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269056.1		
BCOR	54880	hgsc.bcm.edu;bcgsc.ca	37	X	39922119	39922119	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:39922119G>T	ENST00000378444.4	-	9	4281	c.4053C>A	c.(4051-4053)acC>acA	p.T1351T	BCOR_ENST00000378455.4_Silent_p.T1299T|BCOR_ENST00000342274.4_Silent_p.T1317T|BCOR_ENST00000397354.3_Silent_p.T1317T|BCOR_ENST00000378463.1_Silent_p.T194T	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1351					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CGCTGTTGTCGGTGTATTTCT	0.517			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.T1351T		.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR	229	0			c.C4053A						.						126.0	98.0	108.0					X																	39922119		2202	4300	6502	SO:0001819	synonymous_variant	54880	exon9			GTTGTCGGTGTAT	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4053C>A	X.37:g.39922119G>T		Somatic	183.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	8.0	NM_001123385	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	37	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	G	7.436	0.639723	0.14386	.	.	ENSG00000183337	ENST00000427012	.	.	.	5.67	3.81	0.43845	.	.	.	.	.	T	0.59582	0.2204	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53592	-0.8417	4	.	.	.	-8.1494	9.5913	0.39548	0.0:0.1328:0.5743:0.2929	.	.	.	.	Q	46	.	.	P	-	2	0	BCOR	39807063	0.883000	0.30277	0.951000	0.38953	0.926000	0.56050	-0.084000	0.11268	0.497000	0.27926	0.600000	0.82982	CCG	.		0.517	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
BEST4	266675	ucsc.edu;bcgsc.ca	37	1	45253103	45253103	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:45253103G>T	ENST00000372207.3	-	2	187	c.188C>A	c.(187-189)gCt>gAt	p.A63D		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	63						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					GGCCACCTGAGCATACACGTA	0.592																																					p.A63D		.											.	BEST4	91	0			c.C188A						.						218.0	219.0	219.0					1																	45253103		2203	4300	6503	SO:0001583	missense	266675	exon2			ACCTGAGCATACA	AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.188C>A	1.37:g.45253103G>T	ENSP00000361281:p.Ala63Asp	Somatic	63.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_153274	Q5JR93	Missense_Mutation	SNP	ENST00000372207.3	37	CCDS514.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465118	0.43839	.	.	ENSG00000142959	ENST00000372207	D	0.98512	-4.97	5.0	4.06	0.47325	.	0.270310	0.35407	N	0.003239	D	0.94748	0.8305	N	0.24115	0.695	0.41802	D	0.98992	B	0.14012	0.009	B	0.17979	0.02	D	0.91843	0.5485	10	0.48119	T	0.1	-9.5872	10.6205	0.45476	0.0:0.0:0.6511:0.3489	.	63	Q8NFU0	BEST4_HUMAN	D	63	ENSP00000361281:A63D	ENSP00000361281:A63D	A	-	2	0	BEST4	45025690	0.347000	0.24853	0.630000	0.29268	0.883000	0.51084	2.103000	0.41806	1.187000	0.43000	0.561000	0.74099	GCT	.		0.592	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023425.1	NM_153274	
BRCA1	672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41228578	41228578	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:41228578C>G	ENST00000357654.3	-	13	4529	c.4411G>C	c.(4411-4413)Ggc>Cgc	p.G1471R	BRCA1_ENST00000309486.4_Missense_Mutation_p.G1175R|BRCA1_ENST00000468300.1_Missense_Mutation_p.G367R|BRCA1_ENST00000346315.3_Intron|BRCA1_ENST00000352993.3_Missense_Mutation_p.G329R|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.G1492R|BRCA1_ENST00000493795.1_Missense_Mutation_p.G1424R|BRCA1_ENST00000491747.2_Missense_Mutation_p.G367R|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000351666.3_Missense_Mutation_p.G288R|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1471					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GCAGAAAGGCCTTCTGGATTC	0.368			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.G1492R		.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	3415	0			c.G4474C						.						145.0	138.0	140.0					17																	41228578		2202	4300	6502	SO:0001583	missense	672	exon14	Familial Cancer Database		AAAGGCCTTCTGG	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4411G>C	17.37:g.41228578C>G	ENSP00000350283:p.Gly1471Arg	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	29.0	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	CCDS11453.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.836|8.836	0.941068|0.941068	0.18281|0.18281	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000352993;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825|ENST00000461574	T;T;T;T;T;T;T;T;T;T;T|.	0.56444|.	0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46|.	4.97|4.97	-3.6|-3.6	0.04570|0.04570	.|.	1.054980|.	0.07355|.	N|.	0.883009|.	T|T	0.14874|0.14874	0.0359|0.0359	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;P;B;B;B;B;B;B|.	0.46706|.	0.002;0.883;0.001;0.037;0.001;0.004;0.201;0.007|.	B;B;B;B;B;B;B;B|.	0.39419|.	0.004;0.299;0.001;0.03;0.001;0.002;0.055;0.005|.	T|T	0.29397|0.29397	-1.0013|-1.0013	10|5	0.39692|.	T|.	0.17|.	.|.	6.6577|6.6577	0.22996|0.22996	0.0:0.4305:0.1377:0.4318|0.0:0.4305:0.1377:0.4318	.|.	367;320;366;368;367;1493;1471;1471|.	E7EUM2;B4DES0;E7ETR2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2|.	.;.;.;.;.;.;BRCA1_HUMAN;.|.	R|N	1471;1492;329;288;1175;367;320;1493;1424;366;367;242;321;243|234	ENSP00000350283:G1471R;ENSP00000312236:G329R;ENSP00000338007:G288R;ENSP00000310938:G1175R;ENSP00000417148:G367R;ENSP00000377294:G320R;ENSP00000418775:G1424R;ENSP00000420412:G367R;ENSP00000419481:G242R;ENSP00000418819:G321R;ENSP00000418212:G243R|.	ENSP00000310938:G1175R|.	G|K	-|-	1|3	0|2	BRCA1|BRCA1	38482104|38482104	0.000000|0.000000	0.05858|0.05858	0.007000|0.007000	0.13788|0.13788	0.960000|0.960000	0.62799|0.62799	-0.366000|-0.366000	0.07563|0.07563	-0.901000|-0.901000	0.03891|0.03891	-0.291000|-0.291000	0.09656|0.09656	GGC|AAG	.		0.368	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
BRD8	10902	ucsc.edu;bcgsc.ca	37	5	137481515	137481515	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:137481515T>C	ENST00000254900.5	-	24	3702	c.3331A>G	c.(3331-3333)Act>Gct	p.T1111A		NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	1111					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GGCAGGAGAGTCTTCTTAAAT	0.403																																					p.T1111A		.											.	BRD8	91	0			c.A3331G						.						77.0	75.0	76.0					5																	137481515		2203	4300	6503	SO:0001583	missense	10902	exon24			GGAGAGTCTTCTT	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3331A>G	5.37:g.137481515T>C	ENSP00000254900:p.Thr1111Ala	Somatic	66.0	0.0		WXS	Illumina HiSeq	.	54.0	5.0	NM_139199	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	T	3.444	-0.113361	0.06881	.	.	ENSG00000112983	ENST00000254900;ENST00000427976	T;T	0.17054	2.3;2.3	5.3	5.3	0.74995	Bromodomain (3);	0.000000	0.46442	D	0.000287	T	0.11281	0.0275	L	0.29908	0.895	0.80722	D	1	B	0.11235	0.004	B	0.12837	0.008	T	0.05225	-1.0898	10	0.02654	T	1	.	12.6442	0.56725	0.0:0.0:0.0:1.0	.	1111	Q9H0E9	BRD8_HUMAN	A	1111;217	ENSP00000254900:T1111A;ENSP00000392646:T217A	ENSP00000254900:T1111A	T	-	1	0	BRD8	137509414	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.191000	0.42640	2.018000	0.59344	0.533000	0.62120	ACT	.		0.403	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
C10orf10	11067	ucsc.edu;bcgsc.ca	37	10	45473438	45473438	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:45473438G>A	ENST00000298295.3	-	2	258	c.41C>T	c.(40-42)aCa>aTa	p.T14I	C10orf10_ENST00000496638.1_Intron|RASSF4_ENST00000374417.2_Intron|RASSF4_ENST00000340258.5_Intron|RASSF4_ENST00000472561.1_Intron|RASSF4_ENST00000334940.6_Intron	NM_007021.3	NP_008952.1	Q9NTK1	DEPP_HUMAN	chromosome 10 open reading frame 10	14						mitochondrion (GO:0005739)				lung(1)	1						CTCCCGAATTGTGGGCAGATG	0.612																																					p.T14I		.											.	C10orf10	90	0			c.C41T						.						43.0	49.0	47.0					10																	45473438		2203	4298	6501	SO:0001583	missense	11067	exon2			CGAATTGTGGGCA	AB022718	CCDS7210.1	10q11.21	2014-07-31			ENSG00000165507	ENSG00000165507			23355	protein-coding gene	gene with protein product	"""decidual protein induced by progesterone"", ""fasting induced"", ""fat-specific expressed gene"""	611309				24530860, 19937567, 16123073	Standard	NM_007021		Approved	DEPP, FIG, Fseg	uc001jbr.4	Q9NTK1	OTTHUMG00000018063	ENST00000298295.3:c.41C>T	10.37:g.45473438G>A	ENSP00000298295:p.Thr14Ile	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_007021	B2R6A1|O94997|Q5T735|Q76MX8	Missense_Mutation	SNP	ENST00000298295.3	37	CCDS7210.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754317	0.89843	.	.	ENSG00000165507	ENST00000298295;ENST00000432283;ENST00000448778	T;T	0.60171	0.25;0.21	5.63	5.63	0.86233	.	0.000000	0.48286	D	0.000181	T	0.67674	0.2918	L	0.36672	1.1	0.39604	D	0.969786	D	0.76494	0.999	D	0.77557	0.99	T	0.71189	-0.4666	10	0.87932	D	0	-12.6472	15.1661	0.72825	0.0:0.0:1.0:0.0	.	14	Q9NTK1	DEPP_HUMAN	I	14	ENSP00000298295:T14I;ENSP00000414494:T14I	ENSP00000298295:T14I	T	-	2	0	C10orf10	44793444	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	4.685000	0.61693	2.646000	0.89796	0.561000	0.74099	ACA	.		0.612	C10orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047758.1	NM_007021	
NUTM1	256646	ucsc.edu;bcgsc.ca	37	15	34649666	34649666	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:34649666A>G	ENST00000333756.4	+	7	3528	c.3373A>G	c.(3373-3375)Agg>Ggg	p.R1125G	NUTM1_ENST00000537011.1_Missense_Mutation_p.R1153G|NUTM1_ENST00000438749.3_Missense_Mutation_p.R1143G	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	1125						cytoplasm (GO:0005737)|nucleus (GO:0005634)											CACGGGCAGAAGGAAGAAACG	0.582																																					p.R1125G		.											.	C15orf55	206	0			c.A3373G						.						76.0	79.0	78.0					15																	34649666		2201	4298	6499	SO:0001583	missense	256646	exon7			GGCAGAAGGAAGA	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.3373A>G	15.37:g.34649666A>G	ENSP00000329448:p.Arg1125Gly	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_175741	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	ENST00000333756.4	37	CCDS32190.1	.	.	.	.	.	.	.	.	.	.	A	18.99	3.740159	0.69304	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.50001	0.76;0.76;0.76	6.08	4.89	0.63831	.	0.280346	0.31335	N	0.007829	T	0.59473	0.2196	M	0.74881	2.28	0.34398	D	0.694914	B;P;D	0.59767	0.418;0.553;0.986	B;B;P	0.55615	0.168;0.316;0.78	T	0.73895	-0.3838	10	0.87932	D	0	.	9.7297	0.40352	0.8261:0.1739:0.0:0.0	.	1143;1153;1125	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	G	1153;1143;1125	ENSP00000444896:R1153G;ENSP00000407031:R1143G;ENSP00000329448:R1125G	ENSP00000329448:R1125G	R	+	1	2	C15orf55	32436958	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	2.637000	0.46553	2.333000	0.79357	0.533000	0.62120	AGG	.		0.582	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741	
C15orf39	56905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75498804	75498804	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:75498804T>C	ENST00000360639.2	+	2	735	c.415T>C	c.(415-417)Tgc>Cgc	p.C139R	C15orf39_ENST00000394987.4_Missense_Mutation_p.C139R|C15orf39_ENST00000567617.1_Missense_Mutation_p.C139R			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	139						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						CAACCCTCTGTGCTATGGGCT	0.622																																					p.C139R		.											.	C15orf39	90	0			c.T415C						.						54.0	51.0	52.0					15																	75498804		2197	4295	6492	SO:0001583	missense	56905	exon2			CCTCTGTGCTATG	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.415T>C	15.37:g.75498804T>C	ENSP00000353854:p.Cys139Arg	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	22.0	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	ENST00000360639.2	37	CCDS10276.1	.	.	.	.	.	.	.	.	.	.	T	13.31	2.199280	0.38806	.	.	ENSG00000167173	ENST00000360639;ENST00000394987	T;T	0.71698	-0.59;-0.59	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.78748	0.4332	L	0.60455	1.87	0.58432	D	0.99999	D	0.71674	0.998	D	0.78314	0.991	T	0.80174	-0.1492	10	0.87932	D	0	-12.1195	7.7302	0.28783	0.0:0.0949:0.0:0.9051	.	139	Q6ZRI6	CO039_HUMAN	R	139	ENSP00000353854:C139R;ENSP00000378438:C139R	ENSP00000353854:C139R	C	+	1	0	C15orf39	73285857	0.998000	0.40836	0.999000	0.59377	0.929000	0.56500	4.534000	0.60622	1.938000	0.56188	0.459000	0.35465	TGC	.		0.622	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
C17orf49	124944	ucsc.edu;bcgsc.ca	37	17	6919194	6919194	+	Splice_Site	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:6919194T>C	ENST00000439424.2	+	3	294	c.218T>C	c.(217-219)gTg>gCg	p.V73A	RNASEK-C17orf49_ENST00000547302.2_Splice_Site_p.W114R|MIR497HG_ENST00000572453.1_RNA|MIR497HG_ENST00000385056.1_RNA|C17orf49_ENST00000552775.1_Splice_Site_p.V47A|MIR497HG_ENST00000443997.1_RNA|C17orf49_ENST00000546760.1_Splice_Site_p.V73A|RP11-589P10.7_ENST00000572547.1_RNA|C17orf49_ENST00000552402.1_Intron|MIR497HG_ENST00000385194.1_RNA|AC040977.1_ENST00000593646.1_5'Flank|C17orf49_ENST00000546495.1_Splice_Site_p.V73A	NM_001142798.2|NM_174893.3	NP_001136270.1|NP_777553.1	Q8IXM2	BAP18_HUMAN	chromosome 17 open reading frame 49	73	SANT.				chromatin modification (GO:0016568)	MLL1 complex (GO:0071339)|NURF complex (GO:0016589)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|ovary(1)	4						GAACGGACAGTGTGAGGGAGG	0.552																																					p.V73A		.											.	C17orf49	135	0			c.T218C						.						87.0	69.0	75.0					17																	6919194		2203	4300	6503	SO:0001630	splice_region_variant	124944	exon3			GGACAGTGTGAGG	AK055800	CCDS32542.1, CCDS45595.1, CCDS45596.1	17p13.1	2013-02-11			ENSG00000258315	ENSG00000258315			28737	protein-coding gene	gene with protein product	"""BPTF associated protein of 18 kDa"", ""human embryo lung cellular protein interacting with SARS-CoV nsp-10"""						Standard	NM_174893		Approved	MGC49942, BAP18, HEPIS		Q8IXM2	OTTHUMG00000170147	ENST00000439424.2:c.218+1T>C	17.37:g.6919194T>C		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_174893	B4DIV3|C9J4G0|E9PB29	Missense_Mutation	SNP	ENST00000439424.2	37	CCDS32542.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.173428|5.173428	0.94807|0.94807	.|.	.|.	ENSG00000161939;ENSG00000258315;ENSG00000258315;ENSG00000258315;ENSG00000258315|ENSG00000161939	ENST00000293804;ENST00000546495;ENST00000546760;ENST00000439424;ENST00000552775|ENST00000547302	.|.	.|.	.|.	4.57|4.57	4.57|4.57	0.56435|0.56435	SANT domain, DNA binding (1);Homeodomain-like (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.69360|0.69360	0.3102|0.3102	M|M	0.79258|0.79258	2.445|2.445	.|.	.|.	.|.	D;D;D|.	0.67145|.	0.996;0.982;0.996|.	D;P;D|.	0.72625|.	0.978;0.763;0.978|.	T|T	0.78349|0.78349	-0.2238|-0.2238	8|4	0.87932|.	D|.	0|.	-8.7061|-8.7061	11.9239|11.9239	0.52808|0.52808	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	73;73;47|.	C9J4G0;Q8IXM2;F8W1H0|.	.;BAP18_HUMAN;.|.	A|R	73;73;73;73;47|114	.|.	ENSP00000411851:V73A|.	V|W	+|+	2|1	0|0	AC040977.1;C17orf49|C17orf49	6859918|6859918	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.218000|6.218000	0.72224|0.72224	1.900000|1.900000	0.55004|0.55004	0.460000|0.460000	0.39030|0.39030	GTG|TGG	.		0.552	C17orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407666.1	NM_174893	Missense_Mutation
CACNA1A	773	ucsc.edu;bcgsc.ca	37	19	13363877	13363877	+	Silent	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:13363877C>A	ENST00000360228.5	-	30	4793	c.4794G>T	c.(4792-4794)cgG>cgT	p.R1598R	CACNA1A_ENST00000573710.2_Silent_p.R1599R|CACNA1A_ENST00000574822.1_5'UTR	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1599					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TGTTGAACACCCGCAGGGCAT	0.527																																					p.R1599R		.											.	CACNA1A	67	0			c.G4797T						.						90.0	88.0	88.0					19																	13363877		1941	4147	6088	SO:0001819	synonymous_variant	773	exon30			GAACACCCGCAGG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.4794G>T	19.37:g.13363877C>A		Somatic	59.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																			.		0.527	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CACNA1A	773	broad.mit.edu;mdanderson.org	37	19	13410090	13410090	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:13410090A>T	ENST00000360228.5	-	19	2356	c.2357T>A	c.(2356-2358)tTg>tAg	p.L786*	CACNA1A_ENST00000573710.2_Nonsense_Mutation_p.L787*	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	787					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GCTGGCCAGCAAGTTCTGCTT	0.592																																					p.L787X		.											.	CACNA1A	67	0			c.T2360A						.						83.0	89.0	87.0					19																	13410090		2074	4206	6280	SO:0001587	stop_gained	773	exon19			GCCAGCAAGTTCT	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2357T>A	19.37:g.13410090A>T	ENSP00000353362:p.Leu786*	Somatic	8.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	7.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Nonsense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	A	41	9.042884	0.99046	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	.	.	.	4.0	4.0	0.46444	.	0.411496	0.14347	U	0.325322	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.0135	0.53301	1.0:0.0:0.0:0.0	.	.	.	.	X	786;790;787;787	.	ENSP00000317661:L787X	L	-	2	0	CACNA1A	13271090	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	4.668000	0.61568	1.685000	0.51034	0.459000	0.35465	TTG	.		0.592	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CAPN11	11131	ucsc.edu;bcgsc.ca	37	6	44150676	44150676	+	Splice_Site	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:44150676A>G	ENST00000398776.1	+	20	1976		c.e20-1		CAPN11_ENST00000542245.1_Splice_Site	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTGTCTCTTCAGGACATCTTC	0.527																																					.		.											.	CAPN11	136	0			c.1939-2A>G						.						53.0	50.0	51.0					6																	44150676		1949	4151	6100	SO:0001630	splice_region_variant	11131	exon20			CTCTTCAGGACAT	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1939-1A>G	6.37:g.44150676A>G		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_007058	B2RA64|Q5T3G1|Q8N4R5	Splice_Site	SNP	ENST00000398776.1	37	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	A	19.88	3.909824	0.72983	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2495	0.66011	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CAPN11	44258654	1.000000	0.71417	0.991000	0.47740	0.852000	0.48524	7.073000	0.76784	2.147000	0.66899	0.523000	0.50628	.	.		0.527	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		Intron
CBFA2T3	863	ucsc.edu;bcgsc.ca	37	16	88958805	88958805	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:88958805G>A	ENST00000268679.4	-	4	864	c.468C>T	c.(466-468)tcC>tcT	p.S156S	CBFA2T3_ENST00000360302.2_Silent_p.S70S|CBFA2T3_ENST00000436887.2_Silent_p.S131S|CBFA2T3_ENST00000327483.5_Silent_p.S70S|CBFA2T3_ENST00000448839.1_Silent_p.S80S	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	156	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		AGGAGGCTGTGGACGAGGTGG	0.642			T	RUNX1	AML																																p.S156S		.		Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	.	CBFA2T3	722	0			c.C468T						.						145.0	101.0	116.0					16																	88958805		2197	4300	6497	SO:0001819	synonymous_variant	863	exon4			GGCTGTGGACGAG	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.468C>T	16.37:g.88958805G>A		Somatic	62.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_005187	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Silent	SNP	ENST00000268679.4	37	CCDS10972.1																																																																																			.		0.642	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187	
CCDC77	84318	ucsc.edu;bcgsc.ca	37	12	550073	550073	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:550073C>A	ENST00000239830.4	+	12	1410	c.1231C>A	c.(1231-1233)Cgt>Agt	p.R411S	CCDC77_ENST00000540180.1_Missense_Mutation_p.R379S|CCDC77_ENST00000412006.2_Missense_Mutation_p.R379S|CCDC77_ENST00000422000.1_Missense_Mutation_p.R379S	NM_032358.3	NP_115734.1	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77	411						centrosome (GO:0005813)|membrane (GO:0016020)				cervix(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			GGCATTGGAGCGTCGACGTAT	0.423																																					p.R411S		.											.	CCDC77	91	0			c.C1231A						.						89.0	81.0	83.0					12																	550073		2203	4300	6503	SO:0001583	missense	84318	exon12			TTGGAGCGTCGAC	AK027638	CCDS8503.1, CCDS44781.1	12p13.33	2006-02-16			ENSG00000120647	ENSG00000120647			28203	protein-coding gene	gene with protein product						12477932	Standard	NM_001130148		Approved	MGC13183	uc001qig.3	Q9BR77	OTTHUMG00000129214	ENST00000239830.4:c.1231C>A	12.37:g.550073C>A	ENSP00000239830:p.Arg411Ser	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_032358	B4DDE8	Missense_Mutation	SNP	ENST00000239830.4	37	CCDS8503.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821836	0.32237	.	.	ENSG00000120647	ENST00000540180;ENST00000422000;ENST00000543504;ENST00000239830;ENST00000412006	T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69	5.94	3.81	0.43845	.	0.377447	0.31415	N	0.007688	T	0.21801	0.0525	L	0.52573	1.65	0.31125	N	0.708411	B	0.17465	0.022	B	0.17098	0.017	T	0.11421	-1.0588	10	0.33940	T	0.23	-1.813	8.1801	0.31305	0.7034:0.2134:0.0832:0.0	.	411	Q9BR77	CCD77_HUMAN	S	379;379;379;411;379	ENSP00000440554:R379S;ENSP00000391870:R379S;ENSP00000445873:R379S;ENSP00000239830:R411S;ENSP00000412925:R379S	ENSP00000239830:R411S	R	+	1	0	CCDC77	420334	1.000000	0.71417	0.735000	0.30896	0.002000	0.02628	5.843000	0.69424	1.290000	0.44636	0.563000	0.77884	CGT	.		0.423	CCDC77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251296.1	NM_032358	
CCDC83	220047	ucsc.edu;bcgsc.ca	37	11	85597247	85597247	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:85597247G>A	ENST00000342404.3	+	5	564	c.348G>A	c.(346-348)atG>atA	p.M116I	CCDC83_ENST00000376067.1_Intron|CCDC83_ENST00000529676.2_Intron|CCDC83_ENST00000280245.4_Missense_Mutation_p.M116I			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	116										breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				CAACAGATATGCGCATGCAAA	0.333																																					p.M116I		.											.	CCDC83	91	0			c.G348A						.						59.0	54.0	56.0					11																	85597247		2203	4299	6502	SO:0001583	missense	220047	exon5			AGATATGCGCATG	AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.348G>A	11.37:g.85597247G>A	ENSP00000344512:p.Met116Ile	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_173556	B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	Missense_Mutation	SNP	ENST00000342404.3	37		.	.	.	.	.	.	.	.	.	.	G	13.68	2.309831	0.40895	.	.	ENSG00000150676	ENST00000280245;ENST00000342404	T;T	0.46819	0.89;0.86	5.26	5.26	0.73747	.	0.121502	0.56097	D	0.000024	T	0.66406	0.2786	M	0.66939	2.045	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.78314	0.991;0.986	T	0.66118	-0.6003	9	.	.	.	-22.5372	15.773	0.78187	0.0:0.0:1.0:0.0	.	116;116	Q8IWF9;Q8IWF9-2	CCD83_HUMAN;.	I	116	ENSP00000280245:M116I;ENSP00000344512:M116I	.	M	+	3	0	CCDC83	85274895	1.000000	0.71417	0.999000	0.59377	0.087000	0.18053	3.918000	0.56432	2.433000	0.82419	0.650000	0.86243	ATG	.		0.333	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392215.1	NM_173556	
CD27	939	ucsc.edu;bcgsc.ca	37	12	6560517	6560517	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:6560517C>A	ENST00000266557.3	+	6	971	c.742C>A	c.(742-744)Cag>Aag	p.Q248K	CD27-AS1_ENST00000399492.2_RNA|CD27_ENST00000541233.1_3'UTR|TAPBPL_ENST00000544021.1_5'Flank|CD27-AS1_ENST00000545339.1_RNA|TAPBPL_ENST00000266556.7_5'Flank	NM_001242.4	NP_001233	P26842	CD27_HUMAN	CD27 molecule	248					cell surface receptor signaling pathway (GO:0007166)|extrinsic apoptotic signaling pathway (GO:0097191)|immunoglobulin mediated immune response (GO:0016064)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of JNK cascade (GO:0046330)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|response to ethanol (GO:0045471)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|transmembrane signaling receptor activity (GO:0004888)			kidney(1)|large_intestine(5)|lung(1)|urinary_tract(3)	10						CATCCCCATCCAGGAGGATTA	0.637																																					p.Q248K		.											.	CD27	659	0			c.C742A						.						57.0	53.0	54.0					12																	6560517		2203	4300	6503	SO:0001583	missense	939	exon6			CCCATCCAGGAGG	M63928	CCDS8545.1	12p13	2014-09-17	2006-10-27	2006-10-27	ENSG00000139193	ENSG00000139193		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11922	protein-coding gene	gene with protein product		186711	"""tumor necrosis factor receptor superfamily, member 7"""	TNFRSF7		2442250, 8530100	Standard	NM_001242		Approved	S152, Tp55	uc001qod.3	P26842	OTTHUMG00000168316	ENST00000266557.3:c.742C>A	12.37:g.6560517C>A	ENSP00000266557:p.Gln248Lys	Somatic	59.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_001242	B2RDZ0	Missense_Mutation	SNP	ENST00000266557.3	37	CCDS8545.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.033686	0.75504	.	.	ENSG00000139193	ENST00000266557	D	0.96716	-4.1	4.07	4.07	0.47477	.	0.633204	0.14541	N	0.313260	D	0.97284	0.9112	M	0.63843	1.955	0.35123	D	0.767263	D	0.63880	0.993	D	0.74674	0.984	D	0.98908	1.0779	10	0.87932	D	0	-16.4962	11.6551	0.51313	0.0:1.0:0.0:0.0	.	248	P26842	CD27_HUMAN	K	248	ENSP00000266557:Q248K	ENSP00000266557:Q248K	Q	+	1	0	CD27	6430778	1.000000	0.71417	0.958000	0.39756	0.884000	0.51177	3.347000	0.52200	2.121000	0.65114	0.561000	0.74099	CAG	.		0.637	CD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399258.1		
CD163L1	283316	ucsc.edu;bcgsc.ca	37	12	7519864	7519864	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:7519864T>C	ENST00000313599.3	-	18	4304	c.4247A>G	c.(4246-4248)aAg>aGg	p.K1416R	CD163L1_ENST00000416109.2_Missense_Mutation_p.K1426R|CD163L1_ENST00000396630.1_Intron			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1416						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						GTCCTCTCTCTTGAGGCAGGT	0.488																																					p.K1416R		.											.	CD163L1	100	0			c.A4247G						.						73.0	64.0	67.0					12																	7519864		2203	4300	6503	SO:0001583	missense	283316	exon18			TCTCTCTTGAGGC	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.4247A>G	12.37:g.7519864T>C	ENSP00000315945:p.Lys1416Arg	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	T	9.852	1.193944	0.22037	.	.	ENSG00000177675	ENST00000313599;ENST00000416109	T;T	0.01388	4.95;4.95	1.93	-3.65	0.04502	.	.	.	.	.	T	0.01156	0.0038	N	0.08118	0	0.09310	N	1	P;D	0.60575	0.828;0.988	B;P	0.54759	0.15;0.76	T	0.41787	-0.9489	9	0.36615	T	0.2	.	0.0857	0.00035	0.2452:0.1869:0.2477:0.3202	.	1426;1416	E7EVK4;Q9NR16	.;C163B_HUMAN	R	1416;1426	ENSP00000315945:K1416R;ENSP00000393474:K1426R	ENSP00000315945:K1416R	K	-	2	0	CD163L1	7411131	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.650000	0.05378	-0.481000	0.06792	0.454000	0.30748	AAG	.		0.488	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
CDC45	8318	ucsc.edu;bcgsc.ca	37	22	19486623	19486623	+	Splice_Site	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr22:19486623G>T	ENST00000407835.1	+	10	909		c.e10-1		CDC45_ENST00000437685.2_Splice_Site|CDC45_ENST00000263201.1_Splice_Site|CDC45_ENST00000404724.3_Splice_Site			O75419	CDC45_HUMAN	cell division cycle 45						DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						TCTTCTTCCAGGTGGGCCATC	0.587																																					.		.											.	CDC45	227	0			c.516-1G>T						.						135.0	100.0	112.0					22																	19486623		2203	4300	6503	SO:0001630	splice_region_variant	8318	exon8			CTTCCAGGTGGGC	AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.654-1G>T	22.37:g.19486623G>T		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_001178011	B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Splice_Site	SNP	ENST00000407835.1	37	CCDS13762.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.856125	0.71834	.	.	ENSG00000093009	ENST00000407835;ENST00000437685;ENST00000263201;ENST00000404724	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9936	0.89176	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDC45	17866623	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	8.889000	0.92470	2.530000	0.85305	0.561000	0.74099	.	.		0.587	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317903.1	NM_003504	Intron
C10orf105	414152	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73491946	73491946	+	Intron	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:73491946G>A	ENST00000398786.2	-	1	97				CDH23_ENST00000224721.6_Silent_p.E1311E	NM_001168390.1	NP_001161862.1	Q8TEF2	CJ105_HUMAN	chromosome 10 open reading frame 105							integral component of membrane (GO:0016021)											TGCTCAACGAGCTGGACGAGG	0.582																																					p.E1306E		.											.	CDH23	563	0			c.G3918A						.						68.0	70.0	69.0					10																	73491946		2068	4212	6280	SO:0001627	intron_variant	64072	exon31			CAACGAGCTGGAC	AK074172	CCDS44430.1	10q22.1	2012-06-01			ENSG00000214688	ENSG00000214688			20304	protein-coding gene	gene with protein product							Standard	NM_001164375		Approved	FLJ00245	uc001jsa.2	Q8TEF2	OTTHUMG00000018427	ENST00000398786.2:c.4+5538C>T	10.37:g.73491946G>A		Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	15.0	NM_022124		Silent	SNP	ENST00000398786.2	37	CCDS44430.1																																																																																			.		0.582	C10orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048551.2	NM_001164375	
CDK5RAP2	55755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	123199606	123199606	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:123199606G>A	ENST00000349780.4	-	25	4101	c.3922C>T	c.(3922-3924)Ctg>Ttg	p.L1308L	CDK5RAP2_ENST00000359309.3_Silent_p.L1267L|CDK5RAP2_ENST00000360822.3_Silent_p.L1276L|CDK5RAP2_ENST00000360190.4_Silent_p.L1308L	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1308					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TTCTCCAGCAGCTCAGCACAT	0.493																																					p.L1308L		.											.	CDK5RAP2	229	0			c.C3922T						.						158.0	119.0	132.0					9																	123199606		2203	4300	6503	SO:0001819	synonymous_variant	55755	exon25			CCAGCAGCTCAGC	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.3922C>T	9.37:g.123199606G>A		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	33.0	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	ENST00000349780.4	37	CCDS6823.1																																																																																			.		0.493	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
CDKL2	8999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	76551045	76551045	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:76551045A>G	ENST00000429927.2	-	2	831	c.128T>C	c.(127-129)aTg>aCg	p.M43T	CDKL2_ENST00000307465.4_Missense_Mutation_p.M43T	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	43	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CTTTTTAACCATTTTGTCATC	0.323																																					p.M43T		.											.	CDKL2	454	0			c.T128C						.						174.0	166.0	169.0					4																	76551045		2202	4300	6502	SO:0001583	missense	8999	exon2			TTAACCATTTTGT	U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.128T>C	4.37:g.76551045A>G	ENSP00000412365:p.Met43Thr	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	54.0	NM_003948	B2R695	Missense_Mutation	SNP	ENST00000429927.2	37	CCDS3570.1	.	.	.	.	.	.	.	.	.	.	A	4.164	0.028925	0.08054	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	T;T	0.63744	-0.06;-0.06	5.04	2.68	0.31781	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.38348	0.1037	N	0.11845	0.185	0.30427	N	0.777591	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.30416	-0.9979	9	0.10902	T	0.67	-19.8366	8.963	0.35858	0.8371:0.0:0.1629:0.0	.	43;43	B4DH08;Q92772	.;CDKL2_HUMAN	T	43	ENSP00000412365:M43T;ENSP00000306340:M43T	ENSP00000306340:M43T	M	-	2	0	CDKL2	76770069	0.986000	0.35501	1.000000	0.80357	0.998000	0.95712	1.208000	0.32345	1.055000	0.40461	0.533000	0.62120	ATG	.		0.323	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252409.2	NM_003948	
CECR5	27440	ucsc.edu;bcgsc.ca	37	22	17626008	17626008	+	Splice_Site	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr22:17626008C>A	ENST00000336737.4	-	4	469		c.e4-1		CECR5_ENST00000399852.3_Intron|CECR5_ENST00000155674.5_Splice_Site	NM_033070.2	NP_149061.1	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5							mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(10)|pancreas(1)|prostate(1)	21		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				GAAGCCCAGTCTGGAGCAAGC	0.522																																					.		.											.	CECR5	514	0			c.354-1G>T						.						104.0	75.0	85.0					22																	17626008		2203	4300	6503	SO:0001630	splice_region_variant	27440	exon5			CCCAGTCTGGAGC	AF273270	CCDS13741.1, CCDS33595.1	22q11.2	2008-06-12			ENSG00000069998	ENSG00000069998			1843	protein-coding gene	gene with protein product						11381032	Standard	NM_017829		Approved		uc002zmf.3	Q9BXW7	OTTHUMG00000150071	ENST00000336737.4:c.444-1G>T	22.37:g.17626008C>A		Somatic	22.0	0.0		WXS	Illumina HiSeq	.	26.0	5.0	NM_017829	B2RCK5|Q9BXW8|Q9NWA8|Q9NX41	Splice_Site	SNP	ENST00000336737.4	37	CCDS33595.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.583338	0.46006	.	.	ENSG00000069998	ENST00000155674;ENST00000336737	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2231	0.89907	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CECR5	16006008	1.000000	0.71417	0.945000	0.38365	0.258000	0.26162	7.653000	0.83643	2.571000	0.86741	0.561000	0.74099	.	.		0.522	CECR5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316100.1	NM_017829	Intron
CENPC	1060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	68396566	68396566	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:68396566C>A	ENST00000273853.6	-	5	548	c.298G>T	c.(298-300)Gtt>Ttt	p.V100F		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	100					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										GGTTCTACAACAAACTGTAGA	0.388																																					p.V100F		.											.	CENPC1	205	0			c.G298T						.						68.0	67.0	67.0					4																	68396566		1826	4082	5908	SO:0001583	missense	1060	exon5			CTACAACAAACTG	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.298G>T	4.37:g.68396566C>A	ENSP00000273853:p.Val100Phe	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	18.0	NM_001812	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	37	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	C	6.723	0.502156	0.12822	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.22	-8.44	0.00950	.	2.868950	0.01019	N	0.003950	T	0.13200	0.0320	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.24225	-1.0166	9	0.10902	T	0.67	2.1738	1.7234	0.02916	0.2099:0.3068:0.3181:0.1651	.	100;100	Q8IW27;Q03188	.;CENPC_HUMAN	F	100	.	ENSP00000273853:V100F	V	-	1	0	CENPC1	68079161	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-3.781000	0.00368	-2.873000	0.00322	-0.982000	0.02568	GTT	.		0.388	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
CHST10	9486	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	101014572	101014572	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:101014572G>A	ENST00000264249.3	-	5	610	c.225C>T	c.(223-225)ctC>ctT	p.L75L	CHST10_ENST00000542617.1_Silent_p.L123L|CHST10_ENST00000409701.1_Silent_p.L75L	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	75					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						GGGGCTGAACGAGCTGGCTGT	0.577																																					p.L75L		.											.	CHST10	91	0			c.C225T						.						102.0	104.0	103.0					2																	101014572		2203	4300	6503	SO:0001819	synonymous_variant	9486	exon5			CTGAACGAGCTGG	BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.225C>T	2.37:g.101014572G>A		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	18.0	NM_004854	Q53T18	Silent	SNP	ENST00000264249.3	37	CCDS2047.1																																																																																			.		0.577	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854	
CILP2	148113	ucsc.edu;bcgsc.ca	37	19	19653699	19653699	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:19653699G>A	ENST00000291495.5	+	6	980	c.895G>A	c.(895-897)Gag>Aag	p.E299K	CILP2_ENST00000586018.1_Missense_Mutation_p.E305K	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	299	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GAAACACCCTGAGTCCCGAGT	0.602																																					p.E299K		.											.	CILP2	91	0			c.G895A						.						124.0	122.0	123.0					19																	19653699		2203	4300	6503	SO:0001583	missense	148113	exon6			CACCCTGAGTCCC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.895G>A	19.37:g.19653699G>A	ENSP00000291495:p.Glu299Lys	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_153221	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	32	5.151897	0.94645	.	.	ENSG00000160161	ENST00000291495	T	0.39787	1.06	5.3	4.22	0.49857	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.162084	0.53938	D	0.000053	T	0.50309	0.1608	L	0.46614	1.455	0.52099	D	0.999946	B;P	0.36753	0.382;0.568	P;P	0.49953	0.549;0.627	T	0.52815	-0.8525	10	0.62326	D	0.03	-11.6805	13.3766	0.60743	0.0:0.1597:0.8403:0.0	.	299;299	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	K	299	ENSP00000291495:E299K	ENSP00000291495:E299K	E	+	1	0	CILP2	19514699	0.999000	0.42202	0.943000	0.38184	0.972000	0.66771	2.777000	0.47717	1.182000	0.42928	0.555000	0.69702	GAG	.		0.602	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
CIRH1A	84916	ucsc.edu;bcgsc.ca	37	16	69167467	69167467	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:69167467A>G	ENST00000314423.7	+	2	282	c.105A>G	c.(103-105)cgA>cgG	p.R35R	CHTF8_ENST00000522091.1_5'Flank|CHTF8_ENST00000523421.1_5'Flank|CHTF8_ENST00000306585.6_5'Flank|CIRH1A_ENST00000352319.4_Silent_p.R35R|CHTF8_ENST00000519520.1_5'Flank|CIRH1A_ENST00000563094.1_Silent_p.R35R|CHTF8_ENST00000520529.1_5'Flank|CHTF8_ENST00000448552.2_5'Flank|CHTF8_ENST00000398235.2_5'Flank			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	35					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		CTGTTTCACGAACAGATGGCA	0.378																																					p.R35R	Melanoma(69;1156 1278 4951 8715 52012)	.											.	CIRH1A	90	0			c.A105G						.						108.0	99.0	102.0					16																	69167467		2198	4300	6498	SO:0001819	synonymous_variant	84916	exon2			TTCACGAACAGAT	AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.105A>G	16.37:g.69167467A>G		Somatic	57.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_032830	Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Silent	SNP	ENST00000314423.7	37	CCDS10872.1																																																																																			.		0.378	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268950.2	NM_032830	
CLTCL1	8218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	19168279	19168279	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr22:19168279T>A	ENST00000263200.10	-	31	4940	c.4868A>T	c.(4867-4869)gAg>gTg	p.E1623V	CLTCL1_ENST00000353891.5_Missense_Mutation_p.E1566V|SLC25A1_ENST00000461267.1_5'Flank|CLTCL1_ENST00000442042.2_5'UTR|SLC25A1_ENST00000215882.5_5'Flank|SLC25A1_ENST00000451283.1_5'Flank|CLTCL1_ENST00000427926.1_Missense_Mutation_p.E1623V	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1623	Heavy chain arm.|Proximal segment.|Trimerization. {ECO:0000250}.			RKQEEHVTEPAPLVFDFDGHE -> PPSKRSM (in Ref. 3; AAB40908/AAB40909). {ECO:0000305}.	anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CACATGCTCCTCTTGCTTGCG	0.607			T	?	ALCL																																p.E1623V		.		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	CLTCL1	230	0			c.A4868T						.						86.0	93.0	91.0					22																	19168279		2132	4251	6383	SO:0001583	missense	8218	exon31			TGCTCCTCTTGCT		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.4868A>T	22.37:g.19168279T>A	ENSP00000445677:p.Glu1623Val	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	26.0	NM_007098	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.484759	0.26598	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.32988	1.43;1.43;1.43	4.69	2.52	0.30459	.	0.224775	0.36002	N	0.002851	T	0.27349	0.0671	L	0.50993	1.605	0.45005	D	0.998021	B;B;B	0.31680	0.005;0.335;0.081	B;B;B	0.36567	0.012;0.086;0.228	T	0.04165	-1.0972	10	0.48119	T	0.1	-2.4268	6.2511	0.20845	0.0:0.0809:0.3076:0.6115	.	1566;352;1623	P53675-2;B7Z1Z7;P53675	.;.;CLH2_HUMAN	V	1566;1623;1623	ENSP00000439662:E1566V;ENSP00000445677:E1623V;ENSP00000441158:E1623V	ENSP00000445677:E1623V	E	-	2	0	CLTCL1	17548279	0.999000	0.42202	0.000000	0.03702	0.001000	0.01503	3.028000	0.49705	0.302000	0.22762	-0.313000	0.08912	GAG	.		0.607	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
COL11A2	1302	ucsc.edu;bcgsc.ca	37	6	33146492	33146492	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:33146492A>G	ENST00000374708.4	-	16	1683	c.1425T>C	c.(1423-1425)gaT>gaC	p.D475D	COL11A2_ENST00000477772.1_5'Flank|COL11A2_ENST00000357486.1_Silent_p.D540D|COL11A2_ENST00000395197.1_Silent_p.D501D|COL11A2_ENST00000374713.1_Silent_p.D514D|COL11A2_ENST00000361917.1_Silent_p.D454D|COL11A2_ENST00000374714.1_Silent_p.D535D|COL11A2_ENST00000374712.1_Silent_p.D480D|COL11A2_ENST00000341947.2_Silent_p.D561D	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	561	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CTGGGAGTCCATCAAAACCTC	0.567																																					p.D561D	Melanoma(1;90 116 3946 5341 17093)	.											.	COL11A2	95	0			c.T1683C						.						203.0	182.0	189.0					6																	33146492		1511	2709	4220	SO:0001819	synonymous_variant	1302	exon18			GAGTCCATCAAAA	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1425T>C	6.37:g.33146492A>G		Somatic	43.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000374708.4	37	CCDS43452.1																																																																																			.		0.567	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
COL12A1	1303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	75855116	75855116	+	Missense_Mutation	SNP	G	G	A	rs373216375		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:75855116G>A	ENST00000322507.8	-	25	4925	c.4616C>T	c.(4615-4617)aCg>aTg	p.T1539M	COL12A1_ENST00000345356.6_Missense_Mutation_p.T375M|COL12A1_ENST00000416123.2_Missense_Mutation_p.T1539M|COL12A1_ENST00000483888.2_Missense_Mutation_p.T1539M	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1539	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGCATACTCCGTGTTGGGAAC	0.478																																					p.T1539M		.											.	COL12A1	142	0			c.C4616T						.						98.0	104.0	102.0					6																	75855116		2089	4232	6321	SO:0001583	missense	1303	exon25			TACTCCGTGTTGG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4616C>T	6.37:g.75855116G>A	ENSP00000325146:p.Thr1539Met	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	17.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.823489	0.50739	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	5.34	4.46	0.54185	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.064401	0.64402	D	0.000009	T	0.78457	0.4286	M	0.89715	3.055	0.51233	D	0.999917	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83526	0.0088	10	0.56958	D	0.05	.	15.3834	0.74679	0.0:0.0:0.8594:0.1406	.	375;1539	Q99715-2;Q99715	.;COCA1_HUMAN	M	1539;1539;375;1539;1539	ENSP00000325146:T1539M;ENSP00000305147:T375M;ENSP00000412864:T1539M;ENSP00000421216:T1539M	ENSP00000325146:T1539M	T	-	2	0	COL12A1	75911836	1.000000	0.71417	0.663000	0.29738	0.024000	0.10985	9.395000	0.97266	1.226000	0.43582	0.655000	0.94253	ACG	.		0.478	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
CLVS2	134829	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	123319163	123319163	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:123319163C>T	ENST00000275162.5	+	2	1576	c.241C>T	c.(241-243)Cag>Tag	p.Q81*	CLVS2_ENST00000368438.1_Intron	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	81					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						GTACCGGCAGCAGAACCTGGA	0.562																																					p.Q81X		.											.	CLVS2	27	0			c.C241T						.						122.0	112.0	115.0					6																	123319163		2203	4300	6503	SO:0001587	stop_gained	134829	exon2			CGGCAGCAGAACC	AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.241C>T	6.37:g.123319163C>T	ENSP00000275162:p.Gln81*	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	12.0	NM_001010852	B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Nonsense_Mutation	SNP	ENST00000275162.5	37	CCDS34525.1	.	.	.	.	.	.	.	.	.	.	C	50	16.096191	0.99854	.	.	ENSG00000146352	ENST00000275162	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.4933	19.3486	0.94374	0.0:1.0:0.0:0.0	.	.	.	.	X	81	.	ENSP00000275162:Q81X	Q	+	1	0	CLVS2	123360862	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.925000	0.70062	2.814000	0.96858	0.585000	0.79938	CAG	.		0.562	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042042.2	NM_001010852	
COL20A1	57642	ucsc.edu;bcgsc.ca	37	20	61944481	61944481	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr20:61944481G>T	ENST00000358894.6	+	17	2189	c.2089G>T	c.(2089-2091)Ggg>Tgg	p.G697W	COL20A1_ENST00000422202.1_Missense_Mutation_p.G704W|COL20A1_ENST00000326996.6_Missense_Mutation_p.G697W|COL20A1_ENST00000435874.1_Missense_Mutation_p.G704W	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	697	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					CTCTGTCCCAGGGAACCTCGG	0.672																																					p.G697W		.											.	COL20A1	90	0			c.G2089T						.						30.0	32.0	32.0					20																	61944481		1939	4111	6050	SO:0001583	missense	57642	exon17			GTCCCAGGGAACC	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.2089G>T	20.37:g.61944481G>T	ENSP00000351767:p.Gly697Trp	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_020882	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022713	0.54683	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	3.85	3.85	0.44370	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.76449	0.3989	M	0.83118	2.625	0.44508	D	0.997452	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81172	-0.1054	10	0.87932	D	0	.	13.686	0.62517	0.0:0.0:1.0:0.0	.	704;697	Q9P218-2;Q9P218	.;COKA1_HUMAN	W	697;697;704;704	ENSP00000351767:G697W;ENSP00000323077:G697W;ENSP00000408690:G704W;ENSP00000414753:G704W	ENSP00000323077:G697W	G	+	1	0	COL20A1	61414926	0.995000	0.38212	0.873000	0.34254	0.381000	0.30169	2.844000	0.48246	1.884000	0.54569	0.306000	0.20318	GGG	.		0.672	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
COL6A6	131873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130282231	130282231	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:130282231G>T	ENST00000358511.6	+	2	415	c.384G>T	c.(382-384)aaG>aaT	p.K128N	COL6A6_ENST00000453409.2_Missense_Mutation_p.K128N	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	128	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GGAGAGACAAGAAACAGTTTC	0.498																																					p.K128N		.											.	COL6A6	76	0			c.G384T						.						42.0	42.0	42.0					3																	130282231		1886	4112	5998	SO:0001583	missense	131873	exon2			AGACAAGAAACAG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.384G>T	3.37:g.130282231G>T	ENSP00000351310:p.Lys128Asn	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	36.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	8.613	0.889623	0.17540	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.82984	-1.67;-1.67	5.21	3.29	0.37713	von Willebrand factor, type A (3);	0.460721	0.20698	N	0.087328	T	0.70456	0.3226	L	0.31476	0.935	0.22050	N	0.999394	B	0.06786	0.001	B	0.13407	0.009	T	0.57499	-0.7801	10	0.34782	T	0.22	.	6.782	0.23650	0.165:0.1489:0.6862:0.0	.	128	A6NMZ7	CO6A6_HUMAN	N	128	ENSP00000351310:K128N;ENSP00000399236:K128N	ENSP00000351310:K128N	K	+	3	2	COL6A6	131764921	0.047000	0.20315	0.873000	0.34254	0.315000	0.28087	0.440000	0.21592	1.334000	0.45468	0.561000	0.74099	AAG	.		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
CORO1B	57175	ucsc.edu;bcgsc.ca	37	11	67210047	67210047	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:67210047T>C	ENST00000341356.5	-	2	163	c.53A>G	c.(52-54)cAg>cGg	p.Q18R	CORO1B_ENST00000453768.2_Missense_Mutation_p.Q18R|CORO1B_ENST00000539724.1_5'Flank|CORO1B_ENST00000393893.1_Missense_Mutation_p.Q18R|CORO1B_ENST00000545016.1_Missense_Mutation_p.Q18R	NM_020441.2	NP_065174.1	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B	18					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|endothelial cell chemotaxis (GO:0035767)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|positive regulation of lamellipodium morphogenesis (GO:2000394)|protein localization to cell leading edge (GO:1902463)|ruffle organization (GO:0031529)|wound healing (GO:0042060)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|identical protein binding (GO:0042802)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			CTTGACCGGCTGCCCGAACAC	0.597																																					p.Q18R		.											.	CORO1B	108	0			c.A53G						.						119.0	87.0	98.0					11																	67210047		2200	4295	6495	SO:0001583	missense	57175	exon2			ACCGGCTGCCCGA	AK000860	CCDS8164.1	11q13.1	2013-01-10	2001-11-28		ENSG00000172725	ENSG00000172725		"""Coronins"", ""WD repeat domain containing"""	2253	protein-coding gene	gene with protein product		609849	"""coronin, actin-binding protein, 1B"""			9778037	Standard	NM_001018070		Approved	coronin-2	uc001olk.1	Q9BR76	OTTHUMG00000167775	ENST00000341356.5:c.53A>G	11.37:g.67210047T>C	ENSP00000340211:p.Gln18Arg	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_020441	B2RD45	Missense_Mutation	SNP	ENST00000341356.5	37	CCDS8164.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.625168	0.87560	.	.	ENSG00000172725	ENST00000393893;ENST00000341356;ENST00000393886;ENST00000453768;ENST00000545016	T;T;T;T	0.78595	0.02;0.02;-0.09;-1.19	4.21	4.21	0.49690	WD40/YVTN repeat-like-containing domain (1);Domain of unknown function DUF1899 (1);	0.352416	0.20950	N	0.082775	D	0.83092	0.5179	M	0.65320	2	0.58432	D	0.999998	B;P;P	0.50369	0.427;0.854;0.934	B;P;P	0.57620	0.34;0.667;0.824	D	0.83450	0.0048	10	0.46703	T	0.11	-34.8256	13.4234	0.61011	0.0:0.0:0.0:1.0	.	18;18;18	E7EW44;F5H0D2;Q9BR76	.;.;COR1B_HUMAN	R	18;18;45;18;18	ENSP00000377471:Q18R;ENSP00000340211:Q18R;ENSP00000416006:Q18R;ENSP00000438056:Q18R	ENSP00000340211:Q18R	Q	-	2	0	CORO1B	66966623	1.000000	0.71417	0.996000	0.52242	0.932000	0.56968	7.822000	0.86651	1.884000	0.54569	0.460000	0.39030	CAG	.		0.597	CORO1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396220.1	NM_020441	
CRLF1	9244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	18707746	18707746	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:18707746T>A	ENST00000392386.3	-	5	1004	c.811A>T	c.(811-813)Aaa>Taa	p.K271*	CRLF1_ENST00000594325.1_5'Flank	NM_004750.4	NP_004741.1	O75462	CRLF1_HUMAN	cytokine receptor-like factor 1	271	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of motor neuron apoptotic process (GO:2000672)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|ureteric bud development (GO:0001657)	CRLF-CLCF1 complex (GO:0097058)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	9						ATCTGGTATTTGGCTTGAAAG	0.672																																					p.K271X		.											.	CRLF1	514	0			c.A811T						.						78.0	63.0	68.0					19																	18707746		2203	4300	6503	SO:0001587	stop_gained	9244	exon5			GGTATTTGGCTTG	AF059293	CCDS32962.1	19p12	2013-02-11				ENSG00000006016		"""Fibronectin type III domain containing"""	2364	protein-coding gene	gene with protein product	"""cold-induced sweating syndrome"""	604237				9686600	Standard	NM_004750		Approved	CLF-1, CLF, CISS, CISS1	uc010ebt.2	O75462		ENST00000392386.3:c.811A>T	19.37:g.18707746T>A	ENSP00000376188:p.Lys271*	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	16.0	NM_004750	Q9UHH5	Nonsense_Mutation	SNP	ENST00000392386.3	37	CCDS32962.1	.	.	.	.	.	.	.	.	.	.	T	39	7.711627	0.98447	.	.	ENSG00000006016	ENST00000392386	.	.	.	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.6245	12.3848	0.55327	0.0:0.0:0.0:1.0	.	.	.	.	X	271	.	ENSP00000376188:K271X	K	-	1	0	CRLF1	18568746	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.235000	0.78143	1.894000	0.54839	0.402000	0.26972	AAA	.		0.672	CRLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465129.1		
CTTN	2017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	70260723	70260723	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:70260723G>A	ENST00000301843.8	+	6	573	c.367G>A	c.(367-369)Ggc>Agc	p.G123S	CTTN_ENST00000376561.3_Missense_Mutation_p.G123S|CTTN_ENST00000346329.3_Missense_Mutation_p.G123S	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	123					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		TGGCTTCGGAGGCAAGTTTGG	0.572																																					p.G123S		.											.	CTTN	227	0			c.G367A						.						143.0	128.0	133.0					11																	70260723		2200	4294	6494	SO:0001583	missense	2017	exon6			TTCGGAGGCAAGT	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.367G>A	11.37:g.70260723G>A	ENSP00000301843:p.Gly123Ser	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	34.0	NM_001184740	Q8N707|Q96H99	Missense_Mutation	SNP	ENST00000301843.8	37	CCDS41680.1	.	.	.	.	.	.	.	.	.	.	G	36	5.623738	0.96660	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561	T;T;T	0.53423	0.77;0.78;0.62	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.77850	0.4192	M	0.92691	3.335	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.82808	-0.0274	10	0.87932	D	0	-52.3417	19.812	0.96551	0.0:0.0:1.0:0.0	.	123;123;123	Q96H99;Q14247;Q8N707	.;SRC8_HUMAN;.	S	123	ENSP00000317189:G123S;ENSP00000301843:G123S;ENSP00000365745:G123S	ENSP00000301843:G123S	G	+	1	0	CTTN	69938371	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	9.434000	0.97515	2.685000	0.91497	0.655000	0.94253	GGC	.		0.572	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259233.2	NM_138565	
CXorf21	80231	ucsc.edu;bcgsc.ca	37	X	30578387	30578387	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:30578387C>A	ENST00000378962.3	-	3	408	c.86G>T	c.(85-87)gGg>gTg	p.G29V		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	29										kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						TTCCTTTTCCCCAGCCACCTG	0.458																																					p.G29V		.											.	CXorf21	131	0			c.G86T						.						85.0	71.0	76.0					X																	30578387		2202	4300	6502	SO:0001583	missense	80231	exon3			TTTTCCCCAGCCA	BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.86G>T	X.37:g.30578387C>A	ENSP00000368245:p.Gly29Val	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_025159		Missense_Mutation	SNP	ENST00000378962.3	37	CCDS14224.1	.	.	.	.	.	.	.	.	.	.	C	1.695	-0.503039	0.04261	.	.	ENSG00000120280	ENST00000378962	.	.	.	5.25	-2.43	0.06522	.	0.285709	0.29126	N	0.013071	T	0.26122	0.0637	N	0.22421	0.69	0.23416	N	0.997724	B	0.26258	0.145	B	0.30943	0.122	T	0.14392	-1.0474	9	0.56958	D	0.05	-0.0086	9.1966	0.37231	0.0:0.1727:0.1036:0.7237	.	29	Q9HAI6	CX021_HUMAN	V	29	.	ENSP00000368245:G29V	G	-	2	0	CXorf21	30488308	0.996000	0.38824	0.010000	0.14722	0.197000	0.23852	0.860000	0.27871	-0.972000	0.03559	-1.087000	0.02190	GGG	.		0.458	CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056164.1	NM_025159	
CYP4F3	4051	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	15758035	15758046	+	In_Frame_Del	DEL	AAAGTGGAGCCG	AAAGTGGAGCCG	-			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	AAAGTGGAGCCG	AAAGTGGAGCCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:15758035_15758046delAAAGTGGAGCCG	ENST00000221307.8	+	5	473_484	c.426_437delAAAGTGGAGCCG	c.(424-438)gaaaagtggagccgc>gac	p.142_146EKWSR>D	CYP4F3_ENST00000586182.2_In_Frame_Del_p.142_146EKWSR>D|CYP4F3_ENST00000585846.1_In_Frame_Del_p.142_146EKWSR>D|CYP4F3_ENST00000591058.1_In_Frame_Del_p.142_146EKWSR>D	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	142					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						GTGCTGGTGAAAAGTGGAGCCGCCACCGTCGG	0.566																																					p.142_146del		.											.	CYP4F3	93	0			c.426_437del						.																																			SO:0001651	inframe_deletion	4051	exon5			TGGTGAAAAGTGG	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.426_437delAAAGTGGAGCCG	19.37:g.15758035_15758046delAAAGTGGAGCCG	ENSP00000221307:p.Glu142_Arg146delinsAsp	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	12.0	NM_001199209	B7Z8Z3|O60634|Q5U740	In_Frame_Del	DEL	ENST00000221307.8	37	CCDS12332.1																																																																																			.		0.566	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
DDHD1	80821	ucsc.edu;bcgsc.ca	37	14	53618979	53618979	+	Splice_Site	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:53618979G>T	ENST00000323669.5	-	1	837	c.838C>A	c.(838-840)Cag>Aag	p.Q280K	DDHD1_ENST00000395606.1_Splice_Site_p.Q280K|AL356020.1_ENST00000584587.1_RNA|RP11-547D23.1_ENST00000554235.1_RNA|DDHD1_ENST00000357758.3_Splice_Site_p.Q280K	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	280					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					CGCTACTCACGGTTCCAGTAC	0.667																																					p.Q280K		.											.	DDHD1	92	0			c.C838A						.						34.0	32.0	33.0					14																	53618979		2203	4300	6503	SO:0001630	splice_region_variant	80821	exon1			ACTCACGGTTCCA	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.838+1C>A	14.37:g.53618979G>T		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_001160147	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353479	0.41700	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	3.63	3.63	0.41609	.	3.795850	0.00841	N	0.001753	T	0.69771	0.3148	M	0.64997	1.995	0.54753	D	0.999989	B;B;B	0.20164	0.04;0.042;0.022	B;B;B	0.20184	0.028;0.008;0.012	T	0.43442	-0.9391	8	.	.	.	-2.2246	15.0767	0.72082	0.0:0.0:1.0:0.0	.	280;280;280	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	K	280;280;280;151	.	.	Q	-	1	0	DDHD1	52688729	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	8.421000	0.90259	1.841000	0.53522	0.462000	0.41574	CAG	.		0.667	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1		Missense_Mutation
DGKE	8526	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	54912182	54912182	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:54912182C>T	ENST00000284061.3	+	2	206	c.26C>T	c.(25-27)cCg>cTg	p.P9L	DGKE_ENST00000572810.1_Missense_Mutation_p.P9L|C17orf67_ENST00000487705.1_Intron|C17orf67_ENST00000575658.1_5'Flank|DGKE_ENST00000576869.1_3'UTR|C17orf67_ENST00000397861.2_5'Flank	NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	9					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					CGGCCGGCGCCGGGCTCGCCC	0.652																																					p.P9L		.											.	DGKE	289	0			c.C26T						.						81.0	122.0	108.0					17																	54912182		2158	4242	6400	SO:0001583	missense	8526	exon2			CGGCGCCGGGCTC	U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.26C>T	17.37:g.54912182C>T	ENSP00000284061:p.Pro9Leu	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	13.0	NM_003647	Q8TBM4|Q9UKQ3	Missense_Mutation	SNP	ENST00000284061.3	37	CCDS11590.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550402	0.45383	.	.	ENSG00000153933	ENST00000284061	T	0.16196	2.36	3.3	1.1	0.20463	.	0.803457	0.11150	N	0.594184	T	0.07143	0.0181	N	0.03608	-0.345	0.18873	N	0.999989	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.32561	-0.9902	10	0.72032	D	0.01	.	5.3004	0.15776	0.0:0.7015:0.0:0.2985	.	9;9	A1L4Q0;P52429	.;DGKE_HUMAN	L	9	ENSP00000284061:P9L	ENSP00000284061:P9L	P	+	2	0	DGKE	52267181	0.001000	0.12720	0.933000	0.37362	0.133000	0.20885	-0.425000	0.07017	0.151000	0.19162	-0.367000	0.07326	CCG	.		0.652	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440601.1	NM_003647	
DIP2A	23181	ucsc.edu;bcgsc.ca	37	21	47966886	47966886	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr21:47966886G>T	ENST00000417564.2	+	21	2474	c.2453G>T	c.(2452-2454)aGa>aTa	p.R818I	DIP2A_ENST00000466639.1_Missense_Mutation_p.R775I|DIP2A_ENST00000318711.7_Missense_Mutation_p.R819I|DIP2A_ENST00000435722.3_Missense_Mutation_p.R818I|DIP2A_ENST00000457905.3_Missense_Mutation_p.R818I|DIP2A_ENST00000400274.1_Missense_Mutation_p.R814I|DIP2A_ENST00000427143.2_Missense_Mutation_p.R754I			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	818					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GGAGTTCGCAGACACAATGCA	0.607																																					p.R818I		.											.	DIP2A	24	0			c.G2453T						.						78.0	86.0	84.0					21																	47966886		2157	4271	6428	SO:0001583	missense	23181	exon21			TTCGCAGACACAA	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2453G>T	21.37:g.47966886G>T	ENSP00000392066:p.Arg818Ile	Somatic	55.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_206890	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.960338	0.53400	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.14893	2.47;2.47;2.47;2.47;2.47;2.47;2.47	4.58	3.67	0.42095	.	0.123645	0.50627	D	0.000119	T	0.36991	0.0987	M	0.76002	2.32	0.80722	D	1	D;B;D;D;D;P	0.69078	0.993;0.386;0.997;0.988;0.962;0.521	D;B;D;D;D;B	0.72075	0.976;0.126;0.939;0.945;0.962;0.248	T	0.09378	-1.0677	10	0.52906	T	0.07	-17.7546	9.3607	0.38195	0.1734:0.0:0.8266:0.0	.	819;754;775;754;818;818	E9PER1;E7EMA5;Q14689-3;B4E0F0;Q14689;Q14689-4	.;.;.;.;DIP2A_HUMAN;.	I	814;754;819;775;818;775;818;818	ENSP00000383133:R814I;ENSP00000400528:R754I;ENSP00000323633:R819I;ENSP00000393434:R818I;ENSP00000430249:R775I;ENSP00000415089:R818I;ENSP00000392066:R818I	ENSP00000323633:R819I	R	+	2	0	DIP2A	46791314	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	4.658000	0.61497	2.259000	0.74868	0.591000	0.81541	AGA	.		0.607	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
DLL1	28514	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	170592756	170592756	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:170592756C>T	ENST00000366756.3	-	9	1944	c.1611G>A	c.(1609-1611)gaG>gaA	p.E537E		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	537					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		CGCCCTGGCCCTCTAGCTTCT	0.701																																					p.E537E		.											.	DLL1	659	0			c.G1611A						.						17.0	17.0	17.0					6																	170592756		2189	4280	6469	SO:0001819	synonymous_variant	28514	exon9			CTGGCCCTCTAGC	AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.1611G>A	6.37:g.170592756C>T		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	11.0	NM_005618	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Silent	SNP	ENST00000366756.3	37	CCDS5313.1																																																																																			.		0.701	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1		
DMD	1756	ucsc.edu;bcgsc.ca	37	X	31462650	31462650	+	Missense_Mutation	SNP	G	G	T	rs143925896	byFrequency	TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:31462650G>T	ENST00000357033.4	-	60	9238	c.9032C>A	c.(9031-9033)cCg>cAg	p.P3011Q	DMD_ENST00000359836.1_Missense_Mutation_p.P551Q|DMD_ENST00000378707.3_Missense_Mutation_p.P551Q|DMD_ENST00000474231.1_Missense_Mutation_p.P551Q|DMD_ENST00000378677.2_Missense_Mutation_p.P3007Q|DMD_ENST00000541735.1_Missense_Mutation_p.P551Q|DMD_ENST00000343523.2_Missense_Mutation_p.P551Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3011					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GAGGTTATACGGTGAGAGCTG	0.463																																					p.P3011Q		.											.	DMD	265	0			c.C9032A						.						154.0	121.0	132.0					X																	31462650		2202	4300	6502	SO:0001583	missense	1756	exon60			TTATACGGTGAGA	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9032C>A	X.37:g.31462650G>T	ENSP00000354923:p.Pro3011Gln	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.719736	0.48728	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	T;T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.56	4.69	0.59074	.	0.000000	0.33610	U	0.004723	T	0.58380	0.2118	L	0.59436	1.845	0.43766	D	0.996285	D;P;D;P;P;B;B;B;B;B;B	0.65815	0.992;0.547;0.995;0.547;0.547;0.027;0.108;0.064;0.404;0.351;0.153	P;B;D;B;B;B;B;B;B;B;B	0.64776	0.868;0.255;0.929;0.255;0.255;0.026;0.044;0.044;0.184;0.066;0.086	T	0.54807	-0.8238	10	0.13108	T	0.6	.	12.3118	0.54933	0.0853:0.0:0.9147:0.0	.	3003;3011;3007;1670;1667;551;551;551;551;551;2888	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3	.;DMD_HUMAN;.;.;.;.;.;.;.;.;.	Q	3003;1670;1667;707;3007;3011;551;551;3011;2888;551;551;551	ENSP00000350765:P707Q;ENSP00000367948:P3007Q;ENSP00000354923:P3011Q;ENSP00000352894:P551Q;ENSP00000340057:P551Q;ENSP00000367979:P551Q;ENSP00000444119:P551Q;ENSP00000417123:P551Q	ENSP00000340057:P551Q	P	-	2	0	DMD	31372571	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	2.746000	0.47467	1.096000	0.41439	0.538000	0.68166	CCG	G|1.000;A|0.000		0.463	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DNAH10	196385	ucsc.edu;bcgsc.ca	37	12	124416000	124416000	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:124416000G>T	ENST00000409039.3	+	73	12568	c.12543G>T	c.(12541-12543)ctG>ctT	p.L4181L	CCDC92_ENST00000544798.1_Intron|DNAH10OS_ENST00000514254.2_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4181					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTCACCTGCTGGAGCTGCAGC	0.547																																					p.L4181L		.											.	DNAH10	95	0			c.G12543T						.						36.0	42.0	40.0					12																	124416000		2070	4210	6280	SO:0001819	synonymous_variant	196385	exon73			CCTGCTGGAGCTG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.12543G>T	12.37:g.124416000G>T		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	32.0	5.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																			.		0.547	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH17	8632	ucsc.edu;bcgsc.ca	37	17	76528759	76528759	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:76528759G>T	ENST00000585328.1	-	20	3034	c.2910C>A	c.(2908-2910)gtC>gtA	p.V970V	RN7SL454P_ENST00000492744.2_RNA|DNAH17_ENST00000389840.5_Silent_p.V973V	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	973	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGGCATTGATGACCAGGCTGG	0.512																																					p.V973V		.											.	DNAH17	142	0			c.C2919A						.						39.0	37.0	38.0					17																	76528759		1982	4157	6139	SO:0001819	synonymous_variant	8632	exon20			ATTGATGACCAGG	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.2910C>A	17.37:g.76528759G>T		Somatic	47.0	1.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	37																																																																																				.		0.512	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
DSCAML1	57453	ucsc.edu;bcgsc.ca	37	11	117389233	117389233	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:117389233T>C	ENST00000321322.6	-	7	1639	c.1638A>G	c.(1636-1638)acA>acG	p.T546T	DSCAML1_ENST00000527706.1_Silent_p.T276T	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	486	Ig-like C2-type 6.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AGTTCCGCGCTGTGCACCGGT	0.552																																					p.T546T		.											.	DSCAML1	159	0			c.A1638G						.						102.0	102.0	102.0					11																	117389233		2201	4296	6497	SO:0001819	synonymous_variant	57453	exon7			CCGCGCTGTGCAC		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1638A>G	11.37:g.117389233T>C		Somatic	71.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	37	CCDS8384.1																																																																																			.		0.552	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
EFHC2	80258	ucsc.edu;bcgsc.ca	37	X	44109452	44109452	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:44109452A>G	ENST00000420999.1	-	5	929	c.846T>C	c.(844-846)agT>agC	p.S282S		NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	282	DM10 2. {ECO:0000255|PROSITE- ProRule:PRU00665}.						calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						TGGGTAGCTTACTCCTCCGGA	0.413																																					p.S282S		.											.	EFHC2	135	0			c.T846C						.						59.0	51.0	54.0					X																	44109452		1942	4131	6073	SO:0001819	synonymous_variant	80258	exon5			TAGCTTACTCCTC	AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.846T>C	X.37:g.44109452A>G		Somatic	59.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_025184	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Silent	SNP	ENST00000420999.1	37	CCDS55405.1	.	.	.	.	.	.	.	.	.	.	A	5.503	0.277870	0.10403	.	.	ENSG00000183690	ENST00000441230	.	.	.	5.26	2.83	0.33086	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	0.1147	4.2057	0.10488	0.4057:0.1916:0.0:0.4027	.	.	.	.	Q	263	.	.	X	-	1	0	EFHC2	43994396	0.089000	0.21612	0.040000	0.18447	0.731000	0.41821	0.233000	0.17911	0.185000	0.20105	0.417000	0.27973	TAA	.		0.413	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184	
ELAVL3	1995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11577475	11577475	+	Silent	SNP	G	G	A	rs201270169	byFrequency	TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:11577475G>A	ENST00000359227.3	-	2	601	c.177C>T	c.(175-177)ttC>ttT	p.F59F	CTC-398G3.6_ENST00000585656.1_3'UTR|RN7SL669P_ENST00000581926.1_RNA|ELAVL3_ENST00000438662.2_Silent_p.F59F	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	59	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						CAATGCTGCCGAAGAGACTCT	0.547													g|||	3	0.000599042	0.0	0.0029	5008	,	,		20239	0.0		0.0	False		,,,				2504	0.001				p.F59F		.											.	ELAVL3	92	0			c.C177T						.	A	,	0,4406		0,0,2203	163.0	143.0	150.0		177,177	-2.6	1.0	19		150	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous,coding-synonymous	ELAVL3	NM_001420.3,NM_032281.2	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	59/368,59/361	11577475	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1995	exon2			GCTGCCGAAGAGA		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.177C>T	19.37:g.11577475G>A		Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	50.0	NM_032281	Q16135|Q96CL8|Q96QS9	Silent	SNP	ENST00000359227.3	37	CCDS32912.1																																																																																			G|0.999;A|0.001		0.547	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458827.2	NM_001420	
EP300	2033	ucsc.edu;bcgsc.ca	37	22	41545854	41545854	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr22:41545854T>C	ENST00000263253.7	+	14	3688	c.2469T>C	c.(2467-2469)ccT>ccC	p.P823P		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	823					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CCCAGCTTCCTCAACCAGCTC	0.542			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.P823P		.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	2011	0			c.T2469C						.						85.0	61.0	69.0					22																	41545854		2203	4300	6503	SO:0001819	synonymous_variant	2033	exon14	Familial Cancer Database	Broad Thumb-Hallux syndrome	GCTTCCTCAACCA	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.2469T>C	22.37:g.41545854T>C		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001429	B1AKC2	Silent	SNP	ENST00000263253.7	37	CCDS14010.1																																																																																			.		0.542	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
ETV2	2116	ucsc.edu;bcgsc.ca	37	19	36135135	36135135	+	Splice_Site	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:36135135A>G	ENST00000403402.1	+	5	1021		c.e5-1		ETV2_ENST00000379023.4_Splice_Site|ETV2_ENST00000379026.2_Splice_Site|ETV2_ENST00000402764.2_Splice_Site|ETV2_ENST00000479824.1_Splice_Site			O00321	ETV2_HUMAN	ets variant 2						blastocyst development (GO:0001824)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway involved in mesodermal cell fate specification (GO:0060803)|cell differentiation (GO:0030154)|erythrocyte differentiation (GO:0030218)|Notch signaling pathway (GO:0007219)|placenta development (GO:0001890)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of mesoderm development (GO:2000382)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			lung(2)	2	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TTCATCCCGCAGGTCCCATTC	0.627																																					.		.											.	ETV2	226	0			c.716-2A>G						.						27.0	26.0	27.0					19																	36135135		2185	4260	6445	SO:0001630	splice_region_variant	2116	exon6			TCCCGCAGGTCCC	AF000671	CCDS32995.2, CCDS74341.1	19q13.11	2008-09-12	2008-09-12		ENSG00000105672	ENSG00000105672			3491	protein-coding gene	gene with protein product		609358	"""ets variant gene 2"""			1340465	Standard	XM_005258654		Approved	ER71	uc002oar.2	O00321	OTTHUMG00000150545	ENST00000403402.1:c.716-1A>G	19.37:g.36135135A>G		Somatic	26.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_014209	A6NFN5|B3KUL0|B9EIN1|Q9UEA0	Splice_Site	SNP	ENST00000403402.1	37	CCDS32995.2	.	.	.	.	.	.	.	.	.	.	A	19.62	3.860863	0.71834	.	.	ENSG00000105672	ENST00000379026;ENST00000402764;ENST00000379023;ENST00000403402	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6297	0.51166	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ETV2	40826975	1.000000	0.71417	0.951000	0.38953	0.721000	0.41392	4.164000	0.58190	2.010000	0.58986	0.413000	0.27773	.	.		0.627	ETV2-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318848.2	XM_209182	Intron
EVPL	2125	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74015070	74015070	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:74015070G>T	ENST00000301607.3	-	11	1462	c.1209C>A	c.(1207-1209)gcC>gcA	p.A403A	EVPL_ENST00000586740.1_Silent_p.A403A	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	403	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						GTGGCAGAGGGGCCACATCCC	0.682																																					p.A403A		.											.	EVPL	93	0			c.C1209A						.						18.0	20.0	19.0					17																	74015070		2203	4298	6501	SO:0001819	synonymous_variant	2125	exon11			CAGAGGGGCCACA	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.1209C>A	17.37:g.74015070G>T		Somatic	69.0	1.0		WXS	Illumina HiSeq	Phase_I	108.0	21.0	NM_001988	A0AUV5	Silent	SNP	ENST00000301607.3	37	CCDS11737.1																																																																																			.		0.682	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
EXOC1	55763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	56744128	56744128	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:56744128A>G	ENST00000381295.2	+	9	1468	c.1120A>G	c.(1120-1122)Act>Gct	p.T374A	EXOC1_ENST00000349598.6_Missense_Mutation_p.T374A|EXOC1_ENST00000346134.7_Missense_Mutation_p.T374A	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	374					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					TGTTGAACTGACTTTACCCAA	0.373																																					p.T374A		.											.	EXOC1	950	0			c.A1120G						.						154.0	134.0	141.0					4																	56744128		2203	4300	6503	SO:0001583	missense	55763	exon9			GAACTGACTTTAC	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.1120A>G	4.37:g.56744128A>G	ENSP00000370695:p.Thr374Ala	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	24.0	NM_018261	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	37	CCDS3502.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096395	0.56075	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.65	4.46	0.54185	.	0.089605	0.85682	N	0.000000	T	0.45856	0.1363	L	0.41236	1.265	0.80722	D	1	B;B	0.22683	0.073;0.008	B;B	0.28305	0.088;0.042	T	0.22765	-1.0207	9	0.09843	T	0.71	.	10.8708	0.46883	0.9236:0.0:0.0764:0.0	.	374;374	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	A	374	.	ENSP00000326514:T374A	T	+	1	0	EXOC1	56438885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.867000	0.69597	0.962000	0.38057	0.455000	0.32223	ACT	.		0.373	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
ABHD17B	51104	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	74481719	74481719	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:74481719T>G	ENST00000333421.6	-	4	962	c.851A>C	c.(850-852)gAa>gCa	p.E284A	ABHD17B_ENST00000377041.2_Missense_Mutation_p.E284A	NM_001025780.1	NP_001020951.1	Q5VST6	AB17B_HUMAN	abhydrolase domain containing 17B	284						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										ATTTACCAGTTCCTGTGACAC	0.388																																					p.E284A		.											.	FAM108B1	90	0			c.A851C						.						55.0	52.0	53.0					9																	74481719		2203	4300	6503	SO:0001583	missense	51104	exon4			ACCAGTTCCTGTG	AF151825	CCDS35042.1, CCDS35043.1	9q21.2	2013-03-15	2013-03-15	2013-03-15	ENSG00000107362	ENSG00000107362		"""Abhydrolase domain containing"""	24278	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 77"", ""family with sequence similarity 108, member B1"""	C9orf77, FAM108B1		10810093	Standard	XM_006717134		Approved	CGI-67	uc004ail.3	Q5VST6	OTTHUMG00000020001	ENST00000333421.6:c.851A>C	9.37:g.74481719T>G	ENSP00000330222:p.Glu284Ala	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	12.0	NM_016014	A8KAJ5|Q5VST7|Q86YB6|Q8IY03|Q9Y377	Missense_Mutation	SNP	ENST00000333421.6	37	CCDS35043.1	.	.	.	.	.	.	.	.	.	.	T	19.47	3.833591	0.71258	.	.	ENSG00000107362	ENST00000377041;ENST00000333421	T;T	0.40476	1.03;1.4	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.65585	0.2705	M	0.77616	2.38	0.80722	D	1	D;D	0.65815	0.991;0.995	P;D	0.68621	0.881;0.959	T	0.70193	-0.4939	10	0.87932	D	0	-15.1162	16.07	0.80919	0.0:0.0:0.0:1.0	.	284;284	Q5VST6;Q5VST6-2	F108B_HUMAN;.	A	284	ENSP00000366240:E284A;ENSP00000330222:E284A	ENSP00000330222:E284A	E	-	2	0	FAM108B1	73671539	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.844000	0.86867	2.254000	0.74563	0.533000	0.62120	GAA	.		0.388	ABHD17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052625.1	NM_016014	
FAM129B	64855	ucsc.edu;bcgsc.ca	37	9	130286041	130286041	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:130286041T>C	ENST00000373312.3	-	5	719	c.506A>G	c.(505-507)cAc>cGc	p.H169R	FAM129B_ENST00000468379.1_Intron|FAM129B_ENST00000373314.3_Missense_Mutation_p.H156R	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	169	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GAAGTAGTAGTGACGCGCATA	0.597											OREG0019507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H169R		.											.	FAM129B	68	0			c.A506G						.						127.0	107.0	114.0					9																	130286041		2203	4300	6503	SO:0001583	missense	64855	exon5			TAGTAGTGACGCG	AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.506A>G	9.37:g.130286041T>C	ENSP00000362409:p.His169Arg	Somatic	42.0	0.0	1579	WXS	Illumina HiSeq	.	54.0	6.0	NM_022833	Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	ENST00000373312.3	37	CCDS35145.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.463850	0.84425	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.16196	2.36;2.36	5.24	5.24	0.73138	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.39545	0.1082	M	0.72118	2.19	0.54753	D	0.999983	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.12319	-1.0552	10	0.35671	T	0.21	-50.1028	13.1052	0.59244	0.0:0.0:0.0:1.0	.	156;169	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	R	156;169	ENSP00000362411:H156R;ENSP00000362409:H169R	ENSP00000362409:H169R	H	-	2	0	FAM129B	129325862	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	7.585000	0.82584	1.983000	0.57843	0.459000	0.35465	CAC	.		0.597	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054196.1	NM_022833	
FAM208B	54906	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5791794	5791794	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:5791794A>T	ENST00000328090.5	+	15	7035	c.6410A>T	c.(6409-6411)gAt>gTt	p.D2137V		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	2137																	GAGCTAAATGATGTTTCTGGA	0.408																																					p.D2137V		.											.	.	.	0			c.A6410T						.						68.0	67.0	67.0					10																	5791794		1919	4133	6052	SO:0001583	missense	54906	exon15			TAAATGATGTTTC	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.6410A>T	10.37:g.5791794A>T	ENSP00000328426:p.Asp2137Val	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	11.0	NM_017782	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.311511	0.00237	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.03607	3.87	5.66	-3.53	0.04667	.	0.786555	0.11335	N	0.574667	T	0.01061	0.0035	N	0.01188	-0.97	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45512	-0.9256	10	0.25751	T	0.34	.	2.2052	0.03934	0.1128:0.3255:0.2191:0.3426	.	2137	Q5VWN6	F208B_HUMAN	V	2137;1332	ENSP00000328426:D2137V	ENSP00000328426:D2137V	D	+	2	0	C10orf18	5831800	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.023000	0.01438	-0.473000	0.06871	-0.542000	0.04241	GAT	.		0.408	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
FAM220A	84792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	6370386	6370386	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:6370386C>T	ENST00000313324.4	-	2	867	c.400G>A	c.(400-402)Ggg>Agg	p.G134R	FAM220A_ENST00000533877.1_5'Flank	NM_001037163.1	NP_001032240.1	Q7Z4H9	F220A_HUMAN	family with sequence similarity 220, member A	134						nucleus (GO:0005634)											GCCCTGGGCCCTCCTCCCAGC	0.612																																					p.G134R		.											.	.	.	0			c.G400A						.						33.0	36.0	35.0					7																	6370386		2203	4300	6503	SO:0001583	missense	84792	exon2			TGGGCCCTCCTCC	BC006110	CCDS34599.1	7p22.1	2012-03-19	2012-03-19	2012-03-19	ENSG00000178397	ENSG00000178397			22422	protein-coding gene	gene with protein product	"""STAT3-interacting protein as a repressor"""		"""chromosome 7 open reading frame 70"""	C7orf70			Standard	NM_001037163		Approved	SIPAR, MGC12966	uc003spu.3	Q7Z4H9	OTTHUMG00000122091	ENST00000313324.4:c.400G>A	7.37:g.6370386C>T	ENSP00000317289:p.Gly134Arg	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	14.0	NM_001037163	Q75ML2|Q8NA52|Q9BRR7	Missense_Mutation	SNP	ENST00000313324.4	37	CCDS34599.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069454	0.36470	.	.	ENSG00000178397	ENST00000313324	T	0.08370	3.1	5.29	2.44	0.29823	.	1.072050	0.07395	U	0.889859	T	0.17577	0.0422	L	0.50333	1.59	0.09310	N	0.999999	D	0.59357	0.985	P	0.58820	0.846	T	0.17776	-1.0358	10	0.51188	T	0.08	-0.2748	5.3453	0.16006	0.1483:0.632:0.1429:0.0768	.	134	Q7Z4H9	SIPAR_HUMAN	R	134	ENSP00000317289:G134R	ENSP00000317289:G134R	G	-	1	0	C7orf70	6336911	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.603000	0.24149	0.216000	0.20781	-0.175000	0.13238	GGG	.		0.612	FAM220A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000242853.2	NM_001037163	
FAM92B	339145	ucsc.edu;bcgsc.ca	37	16	85133800	85133800	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:85133800C>T	ENST00000539556.1	-	8	853	c.698G>A	c.(697-699)cGg>cAg	p.R233Q		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	233										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						GGCAAGCAGCCGAGTGTCATA	0.567																																					p.R233Q		.											.	FAM92B	90	0			c.G698A						.						102.0	81.0	88.0					16																	85133800		2198	4300	6498	SO:0001583	missense	339145	exon7			AGCAGCCGAGTGT		CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.698G>A	16.37:g.85133800C>T	ENSP00000443411:p.Arg233Gln	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_198491		Missense_Mutation	SNP	ENST00000539556.1	37	CCDS32500.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606754	0.46527	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.38077	1.16	4.82	2.85	0.33270	.	0.124848	0.34580	N	0.003851	T	0.35566	0.0936	L	0.46157	1.445	0.09310	N	1	D	0.59357	0.985	P	0.47626	0.552	T	0.16630	-1.0396	10	0.52906	T	0.07	-44.6992	10.0544	0.42237	0.0:0.8154:0.0:0.1846	.	233	Q6ZTR7	FA92B_HUMAN	Q	233	ENSP00000443411:R233Q	ENSP00000376937:R233Q	R	-	2	0	FAM92B	83691301	0.456000	0.25744	0.001000	0.08648	0.000000	0.00434	0.614000	0.24314	0.119000	0.18210	-1.598000	0.00824	CGG	.		0.567	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_198491	
FAT3	120114	ucsc.edu;bcgsc.ca	37	11	92087171	92087171	+	Silent	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:92087171T>A	ENST00000298047.6	+	1	1910	c.1893T>A	c.(1891-1893)ggT>ggA	p.G631G	FAT3_ENST00000525166.1_Silent_p.G481G|FAT3_ENST00000541502.1_Silent_p.G631G|FAT3_ENST00000409404.2_Silent_p.G631G			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	631	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAGATTCTGGTGTTTTACAGC	0.373										TCGA Ovarian(4;0.039)																											p.G631G		.											.	FAT3	73	0			c.T1893A						.						36.0	35.0	35.0					11																	92087171		1821	4071	5892	SO:0001819	synonymous_variant	120114	exon1			TTCTGGTGTTTTA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1893T>A	11.37:g.92087171T>A		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.		0.373	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FATE1	89885	ucsc.edu;bcgsc.ca	37	X	150889963	150889963	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:150889963C>A	ENST00000370350.3	+	3	416	c.331C>A	c.(331-333)Cat>Aat	p.H111N		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	111						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CATACGTTTCCATTATGATCG	0.602																																					p.H111N		.											.	FATE1	131	0			c.C331A						.						89.0	71.0	77.0					X																	150889963		2203	4300	6503	SO:0001583	missense	89885	exon3			CGTTTCCATTATG	AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.331C>A	X.37:g.150889963C>A	ENSP00000359375:p.His111Asn	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	64.0	6.0	NM_033085		Missense_Mutation	SNP	ENST00000370350.3	37	CCDS14700.1	.	.	.	.	.	.	.	.	.	.	C	6.952	0.545434	0.13312	.	.	ENSG00000147378	ENST00000370350	T	0.44881	0.91	3.86	2.97	0.34412	.	1.121860	0.06723	N	0.775285	T	0.31888	0.0811	N	0.24115	0.695	0.09310	N	1	P	0.47841	0.901	B	0.43809	0.432	T	0.13575	-1.0504	10	0.27082	T	0.32	0.6508	7.7507	0.28896	0.2488:0.7512:0.0:0.0	.	111	Q969F0	FATE1_HUMAN	N	111	ENSP00000359375:H111N	ENSP00000359375:H111N	H	+	1	0	FATE1	150640619	0.001000	0.12720	0.002000	0.10522	0.028000	0.11728	0.812000	0.27211	0.968000	0.38212	0.483000	0.47432	CAT	.		0.602	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060885.1	NM_033085	
FBXL6	26233	ucsc.edu;bcgsc.ca	37	8	145579629	145579629	+	Splice_Site	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr8:145579629T>C	ENST00000331890.5	-	8	1535	c.1471A>G	c.(1471-1473)Agc>Ggc	p.S491G	FBXL6_ENST00000455319.2_Splice_Site_p.S485G|FBXL6_ENST00000526524.1_Intron|SLC52A2_ENST00000530047.1_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|SLC52A2_ENST00000532887.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	491					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GATGCTGACCTGACAGTGCTT	0.647																																					p.S491G		.											.	FBXL6	658	0			c.A1471G						.						69.0	66.0	67.0					8																	145579629		2203	4298	6501	SO:0001630	splice_region_variant	26233	exon8			CTGACCTGACAGT	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.1472+1A>G	8.37:g.145579629T>C		Somatic	53.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_012162	Q53G43|Q9H5W9|Q9UKC7	Missense_Mutation	SNP	ENST00000331890.5	37	CCDS6422.1	.	.	.	.	.	.	.	.	.	.	T	17.29	3.352093	0.61183	.	.	ENSG00000182325	ENST00000455319;ENST00000331890	T;T	0.81330	-1.48;-1.48	4.8	4.8	0.61643	.	0.059781	0.64402	D	0.000003	T	0.82051	0.4953	L	0.46157	1.445	0.41585	D	0.98876	D;D	0.61697	0.982;0.99	P;P	0.57911	0.679;0.829	T	0.80708	-0.1262	10	0.33940	T	0.23	-30.0369	10.7215	0.46042	0.0:0.0:0.0:1.0	.	491;485	Q8N531;Q8N531-2	FBXL6_HUMAN;.	G	485;491	ENSP00000403873:S485G;ENSP00000330098:S491G	ENSP00000330098:S491G	S	-	1	0	FBXL6	145550437	1.000000	0.71417	0.997000	0.53966	0.417000	0.31264	1.614000	0.36911	1.799000	0.52666	0.460000	0.39030	AGC	.		0.647	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	NM_024555	Missense_Mutation
FBXO11	80204	ucsc.edu;bcgsc.ca	37	2	48035495	48035495	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:48035495T>C	ENST00000403359.3	-	22	2699	c.2627A>G	c.(2626-2628)cAt>cGt	p.H876R	FBXO11_ENST00000402508.1_Missense_Mutation_p.H792R|FBXO11_ENST00000316377.4_Missense_Mutation_p.H792R|FBXO11_ENST00000405808.1_Missense_Mutation_p.H30R|FBXO11_ENST00000434523.2_Missense_Mutation_p.H300R|MSH6_ENST00000234420.5_3'UTR	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	876					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTCTACATCATGTCCCTGATG	0.348			"""Mis, F, D"""		DLBCL																																p.H876R		.		Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	FBXO11	659	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.A2627G						.						152.0	135.0	141.0					2																	48035495		2203	4300	6503	SO:0001583	missense	80204	exon22			ACATCATGTCCCT	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.2627A>G	2.37:g.48035495T>C	ENSP00000384823:p.His876Arg	Somatic	76.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_001190274	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	37	CCDS54357.1	.	.	.	.	.	.	.	.	.	.	T	15.92	2.975581	0.53720	.	.	ENSG00000138081	ENST00000405808;ENST00000402508;ENST00000403359;ENST00000316377;ENST00000434523	D;D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99;-2.99	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.95971	0.8688	H	0.94462	3.54	0.80722	D	1	P	0.38863	0.65	P	0.47102	0.537	D	0.96718	0.9530	10	0.87932	D	0	-12.7447	16.2962	0.82776	0.0:0.0:0.0:1.0	.	300	B3KUR1	.	R	30;792;876;792;300	ENSP00000385127:H30R;ENSP00000385398:H792R;ENSP00000384823:H876R;ENSP00000323822:H792R;ENSP00000397359:H300R	ENSP00000323822:H792R	H	-	2	0	FBXO11	47888999	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.970000	0.88000	2.304000	0.77564	0.528000	0.53228	CAT	.		0.348	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133	
FBXW11	23291	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	171296743	171296743	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:171296743C>T	ENST00000265094.5	-	11	1594	c.1457G>A	c.(1456-1458)cGc>cAc	p.R486H	FBXW11_ENST00000425623.2_Missense_Mutation_p.R454H|FBXW11_ENST00000296933.6_Missense_Mutation_p.R473H|FBXW11_ENST00000393802.2_Missense_Mutation_p.R452H	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	486					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CACCAATGTGCGCAAACACAA	0.468																																					p.R486H		.											.	FBXW11	272	0			c.G1457A						.						66.0	50.0	55.0					5																	171296743		2203	4300	6503	SO:0001583	missense	23291	exon11			AATGTGCGCAAAC	AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.1457G>A	5.37:g.171296743C>T	ENSP00000265094:p.Arg486His	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	22.0	NM_012300	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Missense_Mutation	SNP	ENST00000265094.5	37	CCDS34289.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478284	0.63849	.	.	ENSG00000072803	ENST00000296933;ENST00000265094;ENST00000393802;ENST00000425623	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	5.48	5.48	0.80851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.40570	0.1122	N	0.13198	0.31	0.80722	D	1	P;B;P;P	0.36392	0.551;0.346;0.551;0.496	B;B;B;B	0.26202	0.046;0.027;0.067;0.04	T	0.42413	-0.9453	10	0.48119	T	0.1	-10.3967	18.9821	0.92758	0.0:1.0:0.0:0.0	.	454;452;486;473	B4DH70;Q9UKB1-2;Q9UKB1;Q9UKB1-3	.;.;FBW1B_HUMAN;.	H	473;486;452;454	ENSP00000296933:R473H;ENSP00000265094:R486H;ENSP00000377391:R452H;ENSP00000444929:R454H	ENSP00000265094:R486H	R	-	2	0	FBXW11	171229348	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	7.770000	0.85390	2.572000	0.86782	0.655000	0.94253	CGC	.		0.468	FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300	
FGFR1OP	11116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	167438330	167438330	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:167438330A>G	ENST00000366847.4	+	9	1098	c.867A>G	c.(865-867)ttA>ttG	p.L289L	FGFR1OP_ENST00000349556.4_Silent_p.L269L|RP11-517H2.6_ENST00000609590.1_RNA	NM_007045.2	NP_008976.1	O95684	FR1OP_HUMAN	FGFR1 oncogene partner	289					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein tyrosine kinase activity (GO:0061099)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|protein tyrosine kinase inhibitor activity (GO:0030292)			large_intestine(2)|ovary(1)|stomach(1)	4		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		CACCCCCCTTAAAAAGTGGAC	0.483			T	FGFR1	"""MPD, NHL"""																																p.L289L		.		Dom	yes		6	6q27	11116	FGFR1 oncogene partner (FOP)		L	.	FGFR1OP	683	0			c.A867G						.						113.0	128.0	123.0					6																	167438330		2203	4300	6503	SO:0001819	synonymous_variant	11116	exon9			CCCCTTAAAAAGT	Y18046	CCDS5296.1, CCDS5297.1, CCDS75550.1	6q27	2008-02-05			ENSG00000213066	ENSG00000213066			17012	protein-coding gene	gene with protein product		605392				9949182, 10373756	Standard	NM_007045		Approved	FOP	uc003qvj.3	O95684	OTTHUMG00000016011	ENST00000366847.4:c.867A>G	6.37:g.167438330A>G		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	23.0	NM_007045	A8K1D1|B2R705|Q49AI0|Q5R3F6|Q96EW1	Silent	SNP	ENST00000366847.4	37	CCDS5296.1																																																																																			.		0.483	FGFR1OP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043099.2	NM_007045	
FLRT2	23768	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	86089513	86089513	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:86089513T>C	ENST00000330753.4	+	2	2422	c.1655T>C	c.(1654-1656)aTa>aCa	p.I552T	FLRT2_ENST00000554746.1_Missense_Mutation_p.I552T	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	552					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GGCGCGGTGATATTTGTGCTG	0.592																																					p.I552T		.											.	FLRT2	94	0			c.T1655C						.						76.0	81.0	79.0					14																	86089513		2203	4300	6503	SO:0001583	missense	23768	exon2			CGGTGATATTTGT	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1655T>C	14.37:g.86089513T>C	ENSP00000332879:p.Ile552Thr	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	25.0	NM_013231	A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	37	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	T	11.30	1.597853	0.28445	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.58060	0.36;0.36	6.17	6.17	0.99709	.	0.047672	0.85682	D	0.000000	T	0.39989	0.1099	N	0.19112	0.55	0.51482	D	0.999921	B	0.27498	0.18	B	0.22753	0.041	T	0.19257	-1.0311	10	0.34782	T	0.22	-17.0787	16.8222	0.85835	0.0:0.0:0.0:1.0	.	552	O43155	FLRT2_HUMAN	T	552;552;205	ENSP00000332879:I552T;ENSP00000451050:I552T	ENSP00000332879:I552T	I	+	2	0	FLRT2	85159266	1.000000	0.71417	0.997000	0.53966	0.926000	0.56050	6.295000	0.72744	2.371000	0.80710	0.533000	0.62120	ATA	.		0.592	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
GCKR	2646	ucsc.edu;bcgsc.ca	37	2	27728690	27728690	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:27728690G>T	ENST00000264717.2	+	10	919	c.856G>T	c.(856-858)Gca>Tca	p.A286S	GCKR_ENST00000424318.2_Missense_Mutation_p.A96S	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	286	SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					CCAGGGCATTGCAGCATCTCA	0.537																																					p.A286S		.											.	GCKR	92	0			c.G856T						.						113.0	102.0	106.0					2																	27728690		2203	4300	6503	SO:0001583	missense	2646	exon10			GGCATTGCAGCAT	Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.856G>T	2.37:g.27728690G>T	ENSP00000264717:p.Ala286Ser	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_001486	A1L4C2|B4DPQ2|Q53RY6|Q99522	Missense_Mutation	SNP	ENST00000264717.2	37	CCDS1757.1	.	.	.	.	.	.	.	.	.	.	G	0.075	-1.195123	0.01594	.	.	ENSG00000084734	ENST00000264717;ENST00000424318	T;T	0.41400	1.0;1.0	4.16	3.28	0.37604	Sugar isomerase (SIS) (1);	0.420235	0.23889	N	0.043563	T	0.28134	0.0694	L	0.38175	1.15	0.09310	N	1	B;B;B	0.23249	0.082;0.009;0.02	B;B;B	0.21708	0.036;0.014;0.014	T	0.12477	-1.0546	10	0.25106	T	0.35	0.2405	6.0208	0.19628	0.105:0.1924:0.7026:0.0	.	96;286;286	F5H1P6;A8K731;Q14397	.;.;GCKR_HUMAN	S	286;96	ENSP00000264717:A286S;ENSP00000409109:A96S	ENSP00000264717:A286S	A	+	1	0	GCKR	27582194	0.937000	0.31787	0.013000	0.15412	0.009000	0.06853	2.931000	0.48932	1.098000	0.41479	0.655000	0.94253	GCA	.		0.537	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250214.1	NM_001486	
GCKR	2646	ucsc.edu;bcgsc.ca	37	2	27741799	27741799	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:27741799C>A	ENST00000264717.2	+	17	1630	c.1567C>A	c.(1567-1569)Ctg>Atg	p.L523M	GCKR_ENST00000424318.2_Missense_Mutation_p.L333M	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	523					carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					GCTGGCCATGCTGCAGGTAGG	0.532																																					p.L523M		.											.	GCKR	92	0			c.C1567A						.						71.0	76.0	75.0					2																	27741799		2203	4300	6503	SO:0001583	missense	2646	exon17			GCCATGCTGCAGG	Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.1567C>A	2.37:g.27741799C>A	ENSP00000264717:p.Leu523Met	Somatic	55.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_001486	A1L4C2|B4DPQ2|Q53RY6|Q99522	Missense_Mutation	SNP	ENST00000264717.2	37	CCDS1757.1	.	.	.	.	.	.	.	.	.	.	C	17.92	3.507413	0.64410	.	.	ENSG00000084734	ENST00000264717;ENST00000424318	D;D	0.85013	-1.93;-1.93	4.04	1.63	0.23807	.	0.000000	0.53938	D	0.000045	D	0.89801	0.6820	M	0.79258	2.445	0.29331	N	0.866705	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.74023	0.982;0.965;0.956	D	0.83617	0.0137	10	0.72032	D	0.01	-5.5354	7.1384	0.25541	0.0:0.7115:0.0:0.2885	.	333;521;523	F5H1P6;A8K731;Q14397	.;.;GCKR_HUMAN	M	523;333	ENSP00000264717:L523M;ENSP00000409109:L333M	ENSP00000264717:L523M	L	+	1	2	GCKR	27595303	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	0.742000	0.26216	0.215000	0.20761	0.561000	0.74099	CTG	.		0.532	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250214.1	NM_001486	
FOSL2	2355	ucsc.edu;bcgsc.ca	37	2	28626982	28626982	+	Silent	SNP	G	G	T	rs200198308		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:28626982G>T	ENST00000264716.4	+	2	974	c.111G>T	c.(109-111)cgG>cgT	p.R37R	FOSL2_ENST00000545753.1_5'UTR|FOSL2_ENST00000460736.1_3'UTR|FOSL2_ENST00000379619.1_Silent_p.R12R	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	37					cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					AGAAATTCCGGGTAGATATGC	0.453																																					p.R37R		.											.	FOSL2	712	0			c.G111T						.						94.0	96.0	95.0					2																	28626982		2203	4300	6503	SO:0001819	synonymous_variant	2355	exon2			ATTCCGGGTAGAT		CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.111G>T	2.37:g.28626982G>T		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	46.0	5.0	NM_005253	B2RD58|B3KP27|B4DYV4|Q6FG46	Silent	SNP	ENST00000264716.4	37	CCDS1766.1																																																																																			G|0.999;T|0.001		0.453	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215116.2	NM_005253	
GLG1	2734	ucsc.edu;bcgsc.ca	37	16	74516980	74516980	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:74516980C>A	ENST00000422840.2	-	10	1613	c.1614G>T	c.(1612-1614)atG>atT	p.M538I	GLG1_ENST00000447066.2_Missense_Mutation_p.M527I|GLG1_ENST00000205061.5_Missense_Mutation_p.M538I	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	538					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						AGTCTTCTACCATCTTCTCTG	0.403																																					p.M538I		.											.	GLG1	136	0			c.G1614T						.						145.0	138.0	140.0					16																	74516980		2198	4300	6498	SO:0001583	missense	2734	exon10			TTCTACCATCTTC		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.1614G>T	16.37:g.74516980C>A	ENSP00000405984:p.Met538Ile	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	22.0	4.0	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	C	34	5.354804	0.95854	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.78214	0.4248	M	0.70595	2.14	0.80722	D	1	D;D;P	0.59357	0.985;0.958;0.826	P;P;B	0.60886	0.88;0.752;0.38	T	0.78127	-0.2325	9	0.66056	D	0.02	-6.8972	20.5666	0.99351	0.0:1.0:0.0:0.0	.	538;538;527	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	I	538;527;538	.	ENSP00000205061:M538I	M	-	3	0	GLG1	73074481	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.731000	0.84895	2.854000	0.98071	0.655000	0.94253	ATG	.		0.403	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
GPAM	57678	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	113928263	113928263	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:113928263C>A	ENST00000348367.4	-	11	1111	c.914G>T	c.(913-915)cGa>cTa	p.R305L	GPAM_ENST00000369425.1_Missense_Mutation_p.R305L|GPAM_ENST00000423155.1_Missense_Mutation_p.R305L			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	305					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		TTGCTGCTGTCGAAGTAATTC	0.388																																					p.R305L	Ovarian(161;1017 2606 18293 52943)	.											.	GPAM	92	0			c.G914T						.						88.0	84.0	85.0					10																	113928263		2203	4300	6503	SO:0001583	missense	57678	exon11			TGCTGTCGAAGTA	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.914G>T	10.37:g.113928263C>A	ENSP00000265276:p.Arg305Leu	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	10.0	NM_020918	Q5VW51|Q86TA3	Missense_Mutation	SNP	ENST00000348367.4	37	CCDS7570.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102327	0.76983	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	D;D;D	0.97665	-4.48;-4.48;-4.48	5.33	5.33	0.75918	Phospholipid/glycerol acyltransferase (2);	0.165129	0.38837	N	0.001556	D	0.95557	0.8556	L	0.58810	1.83	0.58432	D	0.99999	P;P	0.44521	0.837;0.8	B;B	0.39660	0.306;0.23	D	0.94688	0.7871	10	0.25106	T	0.35	-9.3812	19.0118	0.92875	0.0:1.0:0.0:0.0	.	305;305	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	L	305	ENSP00000265276:R305L;ENSP00000409242:R305L;ENSP00000358433:R305L	ENSP00000265276:R305L	R	-	2	0	GPAM	113918253	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	3.785000	0.55424	2.506000	0.84524	0.637000	0.83480	CGA	.		0.388	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
GPCPD1	56261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	5579378	5579378	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr20:5579378C>T	ENST00000379019.4	-	3	351	c.139G>A	c.(139-141)Ggt>Agt	p.G47S		NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	47	CBM20. {ECO:0000255|PROSITE- ProRule:PRU00594}.				glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						CACCTTTCACCTGTGTCATTC	0.378																																					p.G47S		.											.	GPCPD1	90	0			c.G139A						.						82.0	68.0	73.0					20																	5579378		2203	4300	6503	SO:0001583	missense	56261	exon3			TTTCACCTGTGTC		CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.139G>A	20.37:g.5579378C>T	ENSP00000368305:p.Gly47Ser	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	30.0	NM_019593	D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	ENST00000379019.4	37	CCDS13090.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.754585	0.31046	.	.	ENSG00000125772	ENST00000379019	D	0.92446	-3.04	5.09	4.04	0.47022	Carbohydrate-binding-like fold (1);Glycoside hydrolase, carbohydrate-binding (2);Immunoglobulin-like fold (1);	0.595328	0.17773	N	0.162505	T	0.79627	0.4478	N	0.05441	-0.05	0.34433	D	0.698748	B	0.12013	0.005	B	0.17979	0.02	T	0.74618	-0.3605	10	0.08381	T	0.77	-7.2896	8.1899	0.31361	0.0:0.8484:0.0:0.1516	.	47	Q9NPB8	GPCP1_HUMAN	S	47	ENSP00000368305:G47S	ENSP00000368305:G47S	G	-	1	0	GPCPD1	5527378	1.000000	0.71417	1.000000	0.80357	0.490000	0.33462	1.368000	0.34216	2.356000	0.79943	0.561000	0.74099	GGT	.		0.378	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593	
GPR113	165082	ucsc.edu;bcgsc.ca	37	2	26536706	26536706	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:26536706C>T	ENST00000311519.1	-	8	1197	c.1198G>A	c.(1198-1200)Gac>Aac	p.D400N	GPR113_ENST00000333478.6_Missense_Mutation_p.D201N|GPR113_ENST00000421160.2_Missense_Mutation_p.D331N|GPR113_ENST00000541401.1_Missense_Mutation_p.D3N|GPR113_ENST00000459892.1_5'UTR	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	400					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACGTGGTGTCAGCCATCGGG	0.602																																					p.D400N		.											.	GPR113	94	0			c.G1198A						.						93.0	90.0	91.0					2																	26536706		2203	4300	6503	SO:0001583	missense	165082	exon8			TGGTGTCAGCCAT	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1198G>A	2.37:g.26536706C>T	ENSP00000307831:p.Asp400Asn	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001145168	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	37	CCDS46239.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947653	0.34377	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.32515	1.45;3.07;3.07;3.07	5.8	-0.23	0.13090	.	.	.	.	.	T	0.19208	0.0461	L	0.34521	1.04	0.27121	N	0.96214	B;B;B;P	0.36354	0.005;0.016;0.002;0.549	B;B;B;B	0.34722	0.008;0.022;0.008;0.188	T	0.22521	-1.0214	9	0.17832	T	0.49	-10.8286	8.6934	0.34280	0.0:0.4879:0.0:0.5121	.	331;201;400;3	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	N	3;201;331;400	ENSP00000445729:D3N;ENSP00000327396:D201N;ENSP00000388537:D331N;ENSP00000307831:D400N	ENSP00000307831:D400N	D	-	1	0	GPR113	26390210	0.018000	0.18449	0.001000	0.08648	0.007000	0.05969	-0.092000	0.11129	-0.346000	0.08312	0.655000	0.94253	GAC	.		0.602	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
GPR137	56834	ucsc.edu;bcgsc.ca	37	11	64055319	64055319	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:64055319G>T	ENST00000313074.3	+	3	639	c.534G>T	c.(532-534)gtG>gtT	p.V178V	GPR137_ENST00000438980.2_Silent_p.V178V|GPR137_ENST00000411458.1_Silent_p.V236V|GPR137_ENST00000377702.4_Silent_p.V178V|GPR137_ENST00000539851.1_Silent_p.V178V	NM_020155.3	NP_064540.3	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	178						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(4)|skin(1)	10						GCGTCCTGGTGAGCGACTCCC	0.672																																					p.V236V		.											.	GPR137	68	0			c.G708T						.						53.0	52.0	52.0					11																	64055319		2201	4296	6497	SO:0001819	synonymous_variant	56834	exon5			CCTGGTGAGCGAC	AJ250392	CCDS8066.1, CCDS53655.1, CCDS53656.1, CCDS53657.1, CCDS53658.1	11q13.1	2014-02-12	2006-01-26		ENSG00000173264	ENSG00000173264		"""GPCR / Unclassified : 7TM orphan receptors"""	24300	protein-coding gene	gene with protein product						10873569, 12732197	Standard	NM_001170726		Approved	C11orf4, GPR137A, TM7SF1L1	uc010rni.2	Q96N19	OTTHUMG00000167817	ENST00000313074.3:c.534G>T	11.37:g.64055319G>T		Somatic	61.0	0.0		WXS	Illumina HiSeq	.	58.0	5.0	NM_001170726	B4DTG7|B7Z7M1|Q4G0Y9|Q8N4K6	Silent	SNP	ENST00000313074.3	37	CCDS8066.1																																																																																			.		0.672	GPR137-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396412.1	NM_020155	
GPR162	27239	ucsc.edu;bcgsc.ca	37	12	6934781	6934781	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:6934781G>A	ENST00000311268.3	+	3	1787	c.1000G>A	c.(1000-1002)Gtg>Atg	p.V334M	LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000251761.8_RNA|GPR162_ENST00000382315.3_Missense_Mutation_p.V30M|GPR162_ENST00000428545.2_Missense_Mutation_p.V50M|LEPREL2_ENST00000396725.2_RNA	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	334						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						CCGCGCCGACGTGCGCACAGT	0.637											OREG0021636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V334M		.											.	GPR162	92	0			c.G1000A						.						77.0	50.0	59.0					12																	6934781		2202	4299	6501	SO:0001583	missense	27239	exon3			GCCGACGTGCGCA	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.1000G>A	12.37:g.6934781G>A	ENSP00000311528:p.Val334Met	Somatic	45.0	0.0	637	WXS	Illumina HiSeq	.	46.0	4.0	NM_019858	Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	ENST00000311268.3	37	CCDS8563.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455490	0.84209	.	.	ENSG00000250510	ENST00000311268;ENST00000428545;ENST00000382315	T;T;T	0.52295	1.09;0.67;0.67	5.42	5.42	0.78866	.	.	.	.	.	T	0.47637	0.1456	L	0.34521	1.04	0.29380	N	0.86341	P;D;P	0.64830	0.917;0.994;0.935	B;P;B	0.50231	0.187;0.635;0.177	T	0.46978	-0.9152	9	0.51188	T	0.08	.	13.8203	0.63315	0.0:0.2784:0.7216:0.0	.	118;50;334	Q13513;Q16538-2;Q16538	.;.;GP162_HUMAN	M	334;50;30	ENSP00000311528:V334M;ENSP00000399670:V50M;ENSP00000371752:V30M	ENSP00000311528:V334M	V	+	1	0	GPR162	6805042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.768000	0.47645	2.538000	0.85594	0.462000	0.41574	GTG	.		0.637	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	NM_019858	
GRIK1	2897	ucsc.edu;bcgsc.ca	37	21	30968883	30968883	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr21:30968883C>A	ENST00000399907.1	-	9	1625	c.1214G>T	c.(1213-1215)gGc>gTc	p.G405V	GRIK1_ENST00000327783.4_Missense_Mutation_p.G405V|BACH1_ENST00000462262.1_3'UTR|GRIK1_ENST00000472429.1_5'Flank|GRIK1_ENST00000389125.3_Intron|GRIK1-AS2_ENST00000333765.4_3'UTR|GRIK1_ENST00000399914.1_Intron|GRIK1_ENST00000309434.7_Missense_Mutation_p.G407V|GRIK1_ENST00000399909.1_Intron|GRIK1_ENST00000389124.2_Missense_Mutation_p.G405V|GRIK1_ENST00000535441.1_Missense_Mutation_p.G407V|GRIK1_ENST00000399913.1_Missense_Mutation_p.G405V	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	405					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	AGACACTTCGCCAGCAGCCTT	0.423																																					p.G405V		.											.	GRIK1	137	0			c.G1214T						.						125.0	124.0	124.0					21																	30968883		1858	4096	5954	SO:0001583	missense	2897	exon9			ACTTCGCCAGCAG		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1214G>T	21.37:g.30968883C>A	ENSP00000382791:p.Gly405Val	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_000830	Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.623212	0.28889	.	.	ENSG00000171189	ENST00000327783;ENST00000399913;ENST00000535441;ENST00000389124;ENST00000399907;ENST00000309434	T;T;T;T;T;T	0.12361	2.7;2.75;2.74;2.69;2.75;2.74	4.37	3.49	0.39957	.	1.283360	0.05012	N	0.471053	T	0.09818	0.0241	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.07520	-1.0768	10	0.35671	T	0.21	.	12.7621	0.57370	0.0:0.9181:0.0:0.0819	.	405;405	E9PD61;P39086	.;GRIK1_HUMAN	V	405;405;407;405;405;407	ENSP00000327687:G405V;ENSP00000382797:G405V;ENSP00000446326:G407V;ENSP00000373776:G405V;ENSP00000382791:G405V;ENSP00000311646:G407V	ENSP00000311646:G407V	G	-	2	0	GRIK1	29890754	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.716000	0.54904	1.442000	0.47568	0.650000	0.86243	GGC	.		0.423	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
GRIN2A	2903	ucsc.edu;bcgsc.ca	37	16	9943615	9943615	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:9943615G>A	ENST00000396573.2	-	6	1635	c.1326C>T	c.(1324-1326)atC>atT	p.I442I	GRIN2A_ENST00000396575.2_Silent_p.I442I|GRIN2A_ENST00000562109.1_Silent_p.I442I|GRIN2A_ENST00000404927.2_Silent_p.I442I|GRIN2A_ENST00000330684.3_Silent_p.I442I|GRIN2A_ENST00000535259.1_Silent_p.I285I	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	442					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCACTCACTTGATTTTGACGA	0.493																																					p.I442I		.											.	GRIN2A	349	0			c.C1326T						.						138.0	109.0	118.0					16																	9943615		2197	4300	6497	SO:0001819	synonymous_variant	2903	exon6			TCACTTGATTTTG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1326C>T	16.37:g.9943615G>A		Somatic	66.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_000833	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																			.		0.493	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
GRM8	2918	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	126542649	126542650	+	Missense_Mutation	DNP	CC	CC	AA	rs78947184		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:126542649_126542650CC>AA	ENST00000339582.2	-	6	1910_1911	c.1102_1103GG>TT	c.(1102-1104)GGc>TTc	p.G368F	GRM8_ENST00000444921.2_Missense_Mutation_p.G368F|GRM8_ENST00000405249.1_Missense_Mutation_p.G368F|GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000358373.3_Missense_Mutation_p.G368F			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	368			G -> D. {ECO:0000269|Ref.6}.		adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TAACTTGCAGCCAAAATTCTCC	0.371										HNSCC(24;0.065)																											p.G368V|p.G368C		.											.	GRM8	581	0			c.G1103T|c.G1102T						.																																			SO:0001583	missense	2918	exon5			TTGCAGCCAAAAT|TGCAGCCAAAATT		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1102_1103delinsAA	7.37:g.126542649_126542650delinsAA	ENSP00000344173:p.Gly368Phe	Somatic	77.0|76.0	0.0|1.0		WXS	Illumina HiSeq	Phase_I	66.0	28.0|26.0	NM_000845	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	CCDS5794.1																																																																																			C|0.995;T|0.005|.		0.371	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		
GRPR	2925	ucsc.edu;bcgsc.ca	37	X	16142451	16142451	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:16142451G>T	ENST00000380289.2	+	1	773	c.375G>T	c.(373-375)ggG>ggT	p.G125G		NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	125					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					CCTCTGTTGGGGTGTCTGTCT	0.522											OREG0019682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G125G		.											.	GRPR	565	0			c.G375T						.						105.0	87.0	93.0					X																	16142451		2203	4300	6503	SO:0001819	synonymous_variant	2925	exon1			TGTTGGGGTGTCT		CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.375G>T	X.37:g.16142451G>T		Somatic	51.0	1.0	708	WXS	Illumina HiSeq	.	47.0	4.0	NM_005314	B2R910	Silent	SNP	ENST00000380289.2	37	CCDS14174.1																																																																																			.		0.522	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055901.1	NM_005314	
GSTO2	119391	ucsc.edu;bcgsc.ca	37	10	106035008	106035008	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:106035008C>A	ENST00000338595.2	+	3	379	c.59C>A	c.(58-60)cCg>cAg	p.P20Q	GSTO2_ENST00000477078.2_Intron|GSTO2_ENST00000369707.2_5'UTR|GSTO2_ENST00000429569.2_5'UTR|GSTO2_ENST00000450629.2_Missense_Mutation_p.P20Q|GSTO2_ENST00000401888.2_Missense_Mutation_p.P20Q	NM_183239.1	NP_899062.1	Q9H4Y5	GSTO2_HUMAN	glutathione S-transferase omega 2	20					cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)	p.P20L(1)		NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.178)		Epithelial(162;1.14e-09)|all cancers(201;3.89e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0155)	Glutathione(DB00143)	GGGCCAGTCCCGGAGGGGCTG	0.627											OREG0020515	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P20Q		.											.	GSTO2	91	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C59A						.						79.0	89.0	86.0					10																	106035008		2203	4300	6503	SO:0001583	missense	119391	exon3			CAGTCCCGGAGGG	AY191318	CCDS7556.1, CCDS53574.1, CCDS53575.1	10q25.1	2012-06-21			ENSG00000065621	ENSG00000065621	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	23064	protein-coding gene	gene with protein product		612314				12618591	Standard	NM_001191013		Approved		uc001kyb.3	Q9H4Y5	OTTHUMG00000019006	ENST00000338595.2:c.59C>A	10.37:g.106035008C>A	ENSP00000345023:p.Pro20Gln	Somatic	40.0	0.0	1393	WXS	Illumina HiSeq	.	37.0	4.0	NM_001191013	A8K771|B4DJW6|E7ESD6|Q49TW5|Q5GM70|Q5JU15|Q86WP3	Missense_Mutation	SNP	ENST00000338595.2	37	CCDS7556.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501395	0.64298	.	.	ENSG00000065621	ENST00000369708;ENST00000338595;ENST00000450629;ENST00000401888	T;T;T	0.09817	3.52;2.94;3.02	5.6	4.69	0.59074	Thioredoxin-like fold (1);	0.146845	0.64402	N	0.000006	T	0.31796	0.0808	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.83275	0.957;0.948;0.996	T	0.04678	-1.0934	10	0.66056	D	0.02	-9.4841	13.701	0.62608	0.1647:0.8353:0.0:0.0	.	20;20;20	B4DJW6;B4DU59;Q9H4Y5	.;.;GSTO2_HUMAN	Q	20	ENSP00000345023:P20Q;ENSP00000390986:P20Q;ENSP00000386011:P20Q	ENSP00000345023:P20Q	P	+	2	0	GSTO2	106024998	0.995000	0.38212	0.888000	0.34837	0.902000	0.53008	3.663000	0.54518	1.454000	0.47793	0.563000	0.77884	CCG	.		0.627	GSTO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050210.2	NM_183239	
HDC	3067	ucsc.edu;bcgsc.ca	37	15	50545863	50545863	+	Splice_Site	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:50545863C>T	ENST00000267845.3	-	7	1123	c.721G>A	c.(721-723)Gtc>Atc	p.V241I	HDC_ENST00000543581.1_Splice_Site_p.V241I	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		GTTGCACAGACCTAGGGGAAA	0.512																																					p.V241I	GBM(95;1627 1936 6910 9570)	.											.	HDC	156	0			c.G721A						.						88.0	79.0	82.0					15																	50545863		2196	4295	6491	SO:0001630	splice_region_variant	3067	exon7			CACAGACCTAGGG		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.721-1G>A	15.37:g.50545863C>T		Somatic	22.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_002112		Missense_Mutation	SNP	ENST00000267845.3	37	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.420101	0.83559	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.51574	0.7;0.7	5.18	5.18	0.71444	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.214204	0.39759	N	0.001264	T	0.64907	0.2641	M	0.62016	1.91	0.58432	D	0.999997	D;P	0.56035	0.974;0.922	P;P	0.60117	0.869;0.757	T	0.67444	-0.5669	10	0.87932	D	0	-38.5334	18.8826	0.92362	0.0:1.0:0.0:0.0	.	241;241	B7ZM01;P19113	.;DCHS_HUMAN	I	241	ENSP00000267845:V241I;ENSP00000440252:V241I	ENSP00000267845:V241I	V	-	1	0	HDC	48333155	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	2.352000	0.44080	2.698000	0.92095	0.655000	0.94253	GTC	.		0.512	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1		Missense_Mutation
HEG1	57493	ucsc.edu;bcgsc.ca	37	3	124724109	124724109	+	Splice_Site	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:124724109C>A	ENST00000311127.4	-	9	3364	c.3297G>T	c.(3295-3297)acG>acT	p.T1099T		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	1099					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						GGACACTTACCGTTTTGGTGA	0.408																																					p.T1099T		.											.	HEG1	70	0			c.G3297T						.						85.0	85.0	85.0					3																	124724109		1870	4090	5960	SO:0001630	splice_region_variant	57493	exon9			ACTTACCGTTTTG	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.3297+1G>T	3.37:g.124724109C>A		Somatic	34.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_020733	Q6NX66|Q8NC40|Q9BSV0	Silent	SNP	ENST00000311127.4	37	CCDS46898.1																																																																																			.		0.408	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	Silent
HERC2	8924	ucsc.edu;bcgsc.ca	37	15	28386583	28386583	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:28386583C>T	ENST00000261609.7	-	78	12118	c.12010G>A	c.(12010-12012)Ggg>Agg	p.G4004R		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTTACCTTCCCATCAGCCGTC	0.512																																					p.G4004R		.											.	HERC2	234	0			c.G12010A						.						75.0	68.0	70.0					15																	28386583		2203	4300	6503	SO:0001583	missense	8924	exon78			CCTTCCCATCAGC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12010G>A	15.37:g.28386583C>T	ENSP00000261609:p.Gly4004Arg	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	c	34	5.326007	0.95708	.	.	ENSG00000128731	ENST00000261609	D	0.98060	-4.69	5.54	5.54	0.83059	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.99124	0.9698	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99346	1.0913	10	0.87932	D	0	.	19.4772	0.94994	0.0:1.0:0.0:0.0	.	4004	O95714	HERC2_HUMAN	R	4004	ENSP00000261609:G4004R	ENSP00000261609:G4004R	G	-	1	0	HERC2	26060178	1.000000	0.71417	0.981000	0.43875	0.941000	0.58515	7.485000	0.81204	2.620000	0.88729	0.556000	0.70494	GGG	.		0.512	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HIF1AN	55662	ucsc.edu;bcgsc.ca	37	10	102306918	102306918	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:102306918A>G	ENST00000299163.6	+	7	1016	c.916A>G	c.(916-918)Att>Gtt	p.I306V		NM_017902.2	NP_060372.2	Q9NWT6	HIF1N_HUMAN	hypoxia inducible factor 1, alpha subunit inhibitor	306	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cellular response to hypoxia (GO:0071456)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|oxidation-reduction process (GO:0055114)|peptidyl-asparagine hydroxylation (GO:0042265)|peptidyl-aspartic acid hydroxylation (GO:0042264)|peptidyl-histidine hydroxylation (GO:0036138)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of vasculogenesis (GO:2001214)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ankyrin repeat binding (GO:0071532)|carboxylic acid binding (GO:0031406)|cofactor binding (GO:0048037)|iron ion binding (GO:0005506)|NF-kappaB binding (GO:0051059)|Notch binding (GO:0005112)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-asparagine 3-dioxygenase activity (GO:0036140)|peptidyl-histidine dioxygenase activity (GO:0036139)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	10		Colorectal(252;0.234)		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)		CCCTAAGAGAATTGAATATCC	0.488																																					p.I306V		.											.	HIF1AN	226	0			c.A916G						.						50.0	45.0	47.0					10																	102306918		2203	4300	6503	SO:0001583	missense	55662	exon7			AAGAGAATTGAAT	AK000622	CCDS7498.1	10q24	2008-12-18	2008-12-02		ENSG00000166135	ENSG00000166135	1.14.11.16		17113	protein-coding gene	gene with protein product	"""Peptide-aspartate beta-dioxygenase"""	606615				11641274	Standard	NM_017902		Approved	FLJ20615, DKFZp762F1811, FLJ22027, FIH1	uc001krj.4	Q9NWT6	OTTHUMG00000018911	ENST00000299163.6:c.916A>G	10.37:g.102306918A>G	ENSP00000299163:p.Ile306Val	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_017902	D3DR69|Q5W147|Q969Q7|Q9NPV5	Missense_Mutation	SNP	ENST00000299163.6	37	CCDS7498.1	.	.	.	.	.	.	.	.	.	.	A	15.79	2.937512	0.52972	.	.	ENSG00000166135	ENST00000299163;ENST00000442724	T	0.70516	-0.49	5.29	5.29	0.74685	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	T	0.66086	0.2754	L	0.55103	1.725	0.58432	D	0.999999	B	0.18610	0.029	B	0.16722	0.016	T	0.61695	-0.7010	9	.	.	.	-20.1633	15.2522	0.73556	1.0:0.0:0.0:0.0	.	306	Q9NWT6	HIF1N_HUMAN	V	306;339	ENSP00000299163:I306V	.	I	+	1	0	HIF1AN	102296908	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.007000	0.58848	0.459000	0.35465	ATT	.		0.488	HIF1AN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049865.5	NM_017902	
HK3	3101	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	176317835	176317835	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:176317835C>T	ENST00000292432.5	-	5	613	c.522G>A	c.(520-522)acG>acA	p.T174T		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	174	Glucose-binding. {ECO:0000255}.|Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGTCCAAGCCCGTCTGGTGAC	0.587																																					p.T174T		.											.	HK3	294	0			c.G522A						.						66.0	66.0	66.0					5																	176317835		2203	4300	6503	SO:0001819	synonymous_variant	3101	exon5			CAAGCCCGTCTGG		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.522G>A	5.37:g.176317835C>T		Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	7.0	NM_002115	Q8N1E7	Silent	SNP	ENST00000292432.5	37	CCDS4407.1																																																																																			.		0.587	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1		
HLA-B	3106	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31324160	31324161	+	Frame_Shift_Ins	INS	-	-	A	rs45532737|rs137854719		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:31324160_31324161insA	ENST00000412585.2	-	3	430_431	c.402_403insT	c.(400-405)ctccgcfs	p.R135fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	135	Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						TCATGCCCGCGGAGGAGGCGCC	0.718									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.R135fs		.											.	HLA-B	90	0			c.403_404insT						.																																			SO:0001589	frameshift_variant	3106	exon3	Familial Cancer Database	;Lichen Sclerosis, Familial	GCCCGCGGAGGAG	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.402_403insT	6.37:g.31324160_31324161insA	ENSP00000399168:p.Arg135fs	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	13.0	NM_005514	Q29764	Frame_Shift_Ins	INS	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.718	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
HMGN2P46	283651	ucsc.edu;mdanderson.org	37	15	45848235	45848235	+	lincRNA	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:45848235T>A	ENST00000557965.1	+	0	0				HMGN2P46_ENST00000409454.1_RNA																							TTTAGCTTTTTTTTTTTTTTT	0.318																																					.		.											.	.	.	0			.						.																																					283651	.			GCTTTTTTTTTTT																													15.37:g.45848235T>A		Somatic	55.0	0.0		WXS	Illumina HiSeq	.	62.0	17.0	.		RNA	SNP	ENST00000557965.1	37																																																																																				.		0.318	RP11-96O20.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000416553.1		
HSPA1L	3305	ucsc.edu;bcgsc.ca	37	6	31778553	31778553	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:31778553A>G	ENST00000375654.4	-	2	1386	c.1197T>C	c.(1195-1197)gcT>gcC	p.A399A	HSPA1L_ENST00000417199.3_Silent_p.A399A	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	399					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						GGGACAGGGGAGCCACGTCCA	0.602																																					p.A399A		.											.	HSPA1L	230	0			c.T1197C						.						78.0	71.0	73.0					6																	31778553		2203	4300	6503	SO:0001819	synonymous_variant	3305	exon2			CAGGGGAGCCACG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1197T>C	6.37:g.31778553A>G		Somatic	47.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Silent	SNP	ENST00000375654.4	37	CCDS34413.1																																																																																			.		0.602	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
HTR1A	3350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	63256420	63256420	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:63256420T>A	ENST00000323865.3	-	1	1360	c.1127A>T	c.(1126-1128)cAc>cTc	p.H376L	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	376					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GGTGGGCATGTGGCAGCTGCT	0.532																																					p.H376L		.											.	HTR1A	94	0			c.A1127T						.						139.0	145.0	143.0					5																	63256420		2203	4300	6503	SO:0001583	missense	3350	exon1			GGCATGTGGCAGC	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.1127A>T	5.37:g.63256420T>A	ENSP00000316244:p.His376Leu	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	24.0	NM_000524	Q6LAE7	Missense_Mutation	SNP	ENST00000323865.3	37	CCDS34168.1	.	.	.	.	.	.	.	.	.	.	T	8.267	0.812444	0.16537	.	.	ENSG00000178394	ENST00000323865	T	0.69435	-0.4	5.7	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	0.510690	0.22553	N	0.058571	T	0.44871	0.1314	N	0.21240	0.645	0.38590	D	0.950406	B	0.30146	0.27	B	0.28916	0.096	T	0.27971	-1.0058	10	0.09843	T	0.71	.	7.4116	0.27021	0.0:0.0747:0.1441:0.7812	.	376	P08908	5HT1A_HUMAN	L	376	ENSP00000316244:H376L	ENSP00000316244:H376L	H	-	2	0	HTR1A	63292176	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.751000	0.47508	0.998000	0.38996	0.533000	0.62120	CAC	.		0.532	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524	
HTR2C	3358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	114141874	114141874	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:114141874G>T	ENST00000276198.1	+	6	2001	c.1273G>T	c.(1273-1275)Gag>Tag	p.E425*	HTR2C_ENST00000371951.1_Nonsense_Mutation_p.E425*|HTR2C_ENST00000371950.3_3'UTR	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	425					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ACCGGTGATCGAGAAAGCCAG	0.468																																					p.E425X		.											.	HTR2C	133	0			c.G1273T						.						144.0	141.0	142.0					X																	114141874		2203	4300	6503	SO:0001587	stop_gained	3358	exon6			GTGATCGAGAAAG		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.1273G>T	X.37:g.114141874G>T	ENSP00000276198:p.Glu425*	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	74.0	NM_000868	B1AMW4|Q5VUF8|Q9NP28	Nonsense_Mutation	SNP	ENST00000276198.1	37	CCDS14564.1	.	.	.	.	.	.	.	.	.	.	G	33	5.200961	0.94997	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	.	.	.	4.89	-3.99	0.04069	.	0.580762	0.17675	N	0.165808	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	6.367	0.21461	0.2236:0.4318:0.3446:0.0	.	.	.	.	X	425	.	ENSP00000276198:E425X	E	+	1	0	HTR2C	114048130	0.766000	0.28496	0.001000	0.08648	0.001000	0.01503	1.423000	0.34837	-0.371000	0.08004	-2.142000	0.00338	GAG	.		0.468	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
IKZF3	22806	ucsc.edu;bcgsc.ca	37	17	37922281	37922281	+	Missense_Mutation	SNP	G	G	T	rs114183106		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:37922281G>T	ENST00000346872.3	-	8	1353	c.1292C>A	c.(1291-1293)cCg>cAg	p.P431Q	IKZF3_ENST00000583368.1_Missense_Mutation_p.P184Q|IKZF3_ENST00000439016.2_Missense_Mutation_p.P336Q|IKZF3_ENST00000535189.1_Missense_Mutation_p.P397Q|IKZF3_ENST00000377944.3_Missense_Mutation_p.P288Q|IKZF3_ENST00000377945.3_Missense_Mutation_p.P297Q|IKZF3_ENST00000394189.2_Missense_Mutation_p.P249Q|IKZF3_ENST00000467757.1_Missense_Mutation_p.P375Q|IKZF3_ENST00000351680.3_Missense_Mutation_p.P392Q|IKZF3_ENST00000377952.2_Missense_Mutation_p.P210Q|RP11-94L15.2_ENST00000488188.2_lincRNA|IKZF3_ENST00000350532.3_Missense_Mutation_p.P392Q|IKZF3_ENST00000377958.2_Missense_Mutation_p.P344Q|IKZF3_ENST00000439167.2_Missense_Mutation_p.P358Q|IKZF3_ENST00000346243.3_Missense_Mutation_p.P353Q	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	431					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GCAGATGGGCGGGGGCTTGAG	0.547																																					p.P431Q		.											.	IKZF3	971	0			c.C1292A						.						129.0	130.0	130.0					17																	37922281		2203	4300	6503	SO:0001583	missense	22806	exon8			ATGGGCGGGGGCT	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.1292C>A	17.37:g.37922281G>T	ENSP00000344544:p.Pro431Gln	Somatic	64.0	0.0		WXS	Illumina HiSeq	.	63.0	7.0	NM_012481	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Missense_Mutation	SNP	ENST00000346872.3	37	CCDS11346.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.95|16.95	3.263737|3.263737	0.59431|0.59431	.|.	.|.	ENSG00000161405|ENSG00000161405	ENST00000488188;ENST00000346872;ENST00000377945;ENST00000394189;ENST00000377944;ENST00000377958;ENST00000377952;ENST00000535189;ENST00000351680;ENST00000346243;ENST00000350532;ENST00000467757|ENST00000439167;ENST00000439016	T;T;T;T;T;T;T;T;T;T;T|.	0.14391|.	2.51;3.56;3.56;3.32;3.11;3.77;3.38;3.43;3.46;3.37;4.4|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.000000|.	0.64402|.	D|.	0.000016|.	T|T	0.69797|0.69797	0.3151|0.3151	L|L	0.46157|0.46157	1.445|1.445	0.43417|0.43417	D|D	0.99556|0.99556	D;D;D;D;D;P;D;D;P;D;D;D;D|.	0.89917|.	0.999;0.994;0.993;0.997;1.0;0.904;1.0;0.993;0.635;0.995;1.0;1.0;0.998|.	D;P;P;P;D;P;D;P;B;D;D;D;D|.	0.97110|.	0.977;0.85;0.85;0.85;0.988;0.748;0.993;0.887;0.373;0.931;0.993;1.0;0.935|.	T|T	0.64437|0.64437	-0.6408|-0.6408	10|5	0.41790|.	T|.	0.15|.	-8.615|-8.615	19.8646|19.8646	0.96799|0.96799	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	344;210;249;297;288;397;353;336;392;375;392;358;431|.	Q9UKT9-9;Q9UKT9-12;Q9UKT9-11;Q9UKT9-13;Q9UKT9-10;Q9UKT9-7;Q9UKT9-6;Q9UKT9-5;Q9UKT9-4;Q9UKT9-2;Q9UKT9-3;Q9UKT9-8;Q9UKT9|.	.;.;.;.;.;.;.;.;.;.;.;.;IKZF3_HUMAN|.	Q|S	431;336;297;249;288;344;210;397;392;353;392;375|346;385	ENSP00000344544:P336Q;ENSP00000367180:P297Q;ENSP00000377741:P249Q;ENSP00000367179:P288Q;ENSP00000367194:P344Q;ENSP00000367188:P210Q;ENSP00000438972:P397Q;ENSP00000345622:P392Q;ENSP00000341977:P353Q;ENSP00000344471:P392Q;ENSP00000420463:P375Q|.	ENSP00000341977:P353Q|.	P|R	-|-	2|1	0|0	IKZF3|IKZF3	35175807|35175807	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.522000|0.522000	0.34438|0.34438	6.368000|6.368000	0.73104|0.73104	2.702000|2.702000	0.92279|0.92279	0.655000|0.655000	0.94253|0.94253	CCG|CGC	G|0.995;A|0.005		0.547	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481	
IL18R1	8809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	102988510	102988510	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:102988510A>C	ENST00000409599.1	+	5	756	c.400A>C	c.(400-402)Aaa>Caa	p.K134Q	IL18R1_ENST00000334376.3_Missense_Mutation_p.K134Q|IL18R1_ENST00000233957.1_Missense_Mutation_p.K134Q			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	134	Ig-like C2-type 2.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						GGAAGTTAAAAAATTTTTTCA	0.279																																					p.K134Q		.											.	IL18R1	93	0			c.A400C						.						38.0	41.0	40.0					2																	102988510		2201	4295	6496	SO:0001583	missense	8809	exon3			GTTAAAAAATTTT	U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.400A>C	2.37:g.102988510A>C	ENSP00000387211:p.Lys134Gln	Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	65.0	NM_003855	B2R9Y5|Q52LC9	Missense_Mutation	SNP	ENST00000409599.1	37	CCDS2060.1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.309550	0.40895	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957;ENST00000334376	T;T;T	0.10573	2.86;2.86;2.86	5.15	4.0	0.46444	.	0.355112	0.25552	N	0.029887	T	0.18383	0.0441	L	0.49778	1.585	0.09310	N	1	P;D;P	0.57257	0.901;0.979;0.901	P;P;P	0.59546	0.692;0.859;0.692	T	0.07385	-1.0775	10	0.23891	T	0.37	.	7.5431	0.27751	0.9023:0.0:0.0977:0.0	.	134;134;134	B7ZKV7;Q86YL8;Q13478	.;.;IL18R_HUMAN	Q	134	ENSP00000386663:K134Q;ENSP00000387211:K134Q;ENSP00000233957:K134Q	ENSP00000233957:K134Q	K	+	1	0	IL18R1	102354942	0.037000	0.19845	0.001000	0.08648	0.003000	0.03518	2.614000	0.46359	0.932000	0.37266	0.459000	0.35465	AAA	.		0.279	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253294.2	NM_003855	
IL31RA	133396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	55202077	55202077	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:55202077G>C	ENST00000447346.2	+	9	1278	c.1213G>C	c.(1213-1215)Gaa>Caa	p.E405Q	IL31RA_ENST00000490985.1_Missense_Mutation_p.E263Q|IL31RA_ENST00000359040.5_Missense_Mutation_p.E405Q|IL31RA_ENST00000396836.2_Missense_Mutation_p.E405Q|IL31RA_ENST00000297015.3_Missense_Mutation_p.E263Q|IL31RA_ENST00000354961.4_Missense_Mutation_p.E386Q|IL31RA_ENST00000396834.1_Missense_Mutation_p.E386Q	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	373	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				CCTTTCCTGGGAATCTGTGTC	0.527																																					p.E405Q		.											.	IL31RA	91	0			c.G1213C						.						111.0	104.0	106.0					5																	55202077		2203	4300	6503	SO:0001583	missense	133396	exon9			TCCTGGGAATCTG	AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.1213G>C	5.37:g.55202077G>C	ENSP00000415900:p.Glu405Gln	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	25.0	NM_001242637	A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	ENST00000447346.2	37	CCDS3970.2	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014725	0.35511	.	.	ENSG00000164509	ENST00000396836;ENST00000396834;ENST00000447346;ENST00000359040;ENST00000297015;ENST00000490985;ENST00000354961	T;T;T;T;T;T;T	0.44083	1.52;1.17;1.14;1.16;1.33;0.93;1.17	4.95	4.95	0.65309	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.903970	0.09722	N	0.764265	T	0.42449	0.1203	L	0.42581	1.335	0.29837	N	0.829572	P;P;P;P;P	0.51537	0.911;0.884;0.884;0.946;0.607	P;P;B;P;B	0.49665	0.532;0.54;0.421;0.618;0.419	T	0.06285	-1.0835	10	0.10377	T	0.69	-7.9589	11.4193	0.49971	0.0:0.1821:0.8179:0.0	.	373;405;386;405;405	Q8NI17;Q8NI17-5;Q8NI17-3;Q8NI17-2;Q8NI17-8	IL31R_HUMAN;.;.;.;.	Q	405;386;405;405;263;263;386	ENSP00000380048:E405Q;ENSP00000380046:E386Q;ENSP00000415900:E405Q;ENSP00000351935:E405Q;ENSP00000297015:E263Q;ENSP00000427533:E263Q;ENSP00000347047:E386Q	ENSP00000297015:E263Q	E	+	1	0	IL31RA	55237834	1.000000	0.71417	0.997000	0.53966	0.813000	0.45954	3.262000	0.51538	2.586000	0.87340	0.655000	0.94253	GAA	.		0.527	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1	NM_139017	
INO80E	283899	ucsc.edu;bcgsc.ca	37	16	30012145	30012145	+	Missense_Mutation	SNP	C	C	A	rs376962416		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:30012145C>A	ENST00000563197.1	+	4	1289	c.272C>A	c.(271-273)cCg>cAg	p.P91Q	INO80E_ENST00000567254.1_Missense_Mutation_p.P91Q|INO80E_ENST00000567705.1_Missense_Mutation_p.P91Q|INO80E_ENST00000304516.7_Missense_Mutation_p.P91Q	NM_173618.1	NP_775889.1	Q8NBZ0	IN80E_HUMAN	INO80 complex subunit E	91	Pro-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	6						TCTGACACACCGGCCCCTAAG	0.597																																					p.P91Q		.											.	INO80E	91	0			c.C272A						.						67.0	59.0	62.0					16																	30012145		2197	4300	6497	SO:0001583	missense	283899	exon4			ACACACCGGCCCC	AK075133	CCDS10665.1	16p11.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000169592	ENSG00000169592		"""INO80 complex subunits"""	26905	protein-coding gene	gene with protein product			"""coiled-coil domain containing 95"""	CCDC95		16230350	Standard	NM_173618		Approved	FLJ90652	uc002dvg.1	Q8NBZ0	OTTHUMG00000132114	ENST00000563197.1:c.272C>A	16.37:g.30012145C>A	ENSP00000457016:p.Pro91Gln	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_173618	Q6Y2K3	Missense_Mutation	SNP	ENST00000563197.1	37	CCDS10665.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.358613	0.61403	.	.	ENSG00000169592	ENST00000304516;ENST00000380503;ENST00000540562	.	.	.	5.88	5.88	0.94601	.	0.181884	0.48767	D	0.000161	T	0.74496	0.3724	L	0.48642	1.525	0.44603	D	0.997575	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.985;0.997;0.997	T	0.72014	-0.4418	9	0.42905	T	0.14	-15.2323	17.7145	0.88332	0.0:1.0:0.0:0.0	.	115;91;91	Q8TEI7;Q6Y2K3;Q8NBZ0	.;.;IN80E_HUMAN	Q	91;115;91	.	ENSP00000303977:P91Q	P	+	2	0	INO80E	29919646	0.894000	0.30519	1.000000	0.80357	0.946000	0.59487	2.510000	0.45468	2.790000	0.95986	0.591000	0.81541	CCG	.		0.597	INO80E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255156.2	NM_173618	
ITGA1	3672	broad.mit.edu;mdanderson.org	37	5	52084218	52084218	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:52084218G>C	ENST00000282588.6	+	1	489	c.31G>C	c.(31-33)Gtc>Ctc	p.V11L	ITGA1_ENST00000504086.1_3'UTR|PELO_ENST00000506949.1_3'UTR|CTD-2288O8.1_ENST00000502995.1_RNA|PELO_ENST00000274311.2_5'UTR	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	11					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				CCGCCCAGGGGTCGCTGTCGC	0.741																																					p.V11L		.											.	ITGA1	228	0			c.G31C						.						5.0	5.0	5.0					5																	52084218		1947	3804	5751	SO:0001583	missense	3672	exon1			CCAGGGGTCGCTG	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.31G>C	5.37:g.52084218G>C	ENSP00000282588:p.Val11Leu	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	6.0	NM_181501	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	37	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364651	0.24684	.	.	ENSG00000213949	ENST00000282588	D	0.91351	-2.83	5.06	2.32	0.28847	.	0.669254	0.13905	N	0.354680	T	0.79873	0.4521	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.64356	-0.6427	10	0.11182	T	0.66	.	5.6849	0.17797	0.1683:0.3034:0.5283:0.0	.	11	P56199	ITA1_HUMAN	L	11	ENSP00000282588:V11L	ENSP00000282588:V11L	V	+	1	0	ITGA1	52119975	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.431000	0.21444	0.311000	0.23014	0.563000	0.77884	GTC	.		0.741	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
JAG2	3714	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	105611364	105611364	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:105611364C>T	ENST00000331782.3	-	24	3390	c.2987G>A	c.(2986-2988)cGc>cAc	p.R996H	JAG2_ENST00000347004.2_Missense_Mutation_p.R958H	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	996					auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TGGCAGGGAGCGGATCCCGGA	0.692																																					p.R996H		.											.	JAG2	846	0			c.G2987A						.						26.0	30.0	29.0					14																	105611364		2191	4288	6479	SO:0001583	missense	3714	exon24			AGGGAGCGGATCC	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.2987G>A	14.37:g.105611364C>T	ENSP00000328169:p.Arg996His	Somatic	55.0	1.0		WXS	Illumina HiSeq	Phase_I	49.0	21.0	NM_002226	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	ENST00000331782.3	37	CCDS9998.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801036	0.70567	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.91521	-2.84;-2.86	3.62	3.62	0.41486	.	0.061993	0.64402	U	0.000007	D	0.95040	0.8394	M	0.85197	2.74	0.50632	D	0.999884	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.98	D	0.95507	0.8582	10	0.87932	D	0	.	12.5899	0.56437	0.0:1.0:0.0:0.0	.	958;996	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	H	996;958	ENSP00000328169:R996H;ENSP00000328566:R958H	ENSP00000328169:R996H	R	-	2	0	JAG2	104682409	0.995000	0.38212	0.885000	0.34714	0.536000	0.34869	2.603000	0.46266	1.866000	0.54105	0.460000	0.39030	CGC	.		0.692	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		
JAK2	3717	ucsc.edu;bcgsc.ca	37	9	5064935	5064935	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:5064935A>G	ENST00000381652.3	+	9	1603	c.1109A>G	c.(1108-1110)gAt>gGt	p.D370G	JAK2_ENST00000544510.1_Missense_Mutation_p.D221G|JAK2_ENST00000539801.1_Missense_Mutation_p.D370G	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	370	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TCATTAATTGATGGATATTAT	0.373		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.D370G		.		Dom	yes		9	9p24	3717	Janus kinase 2		L	.	JAK2	75307	0			c.A1109G						.						100.0	98.0	98.0					9																	5064935		2203	4300	6503	SO:0001583	missense	3717	exon9	Familial Cancer Database		TAATTGATGGATA		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.1109A>G	9.37:g.5064935A>G	ENSP00000371067:p.Asp370Gly	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_004972	O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	A	17.56	3.420924	0.62622	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	T;T;T	0.67698	-0.28;-0.28;-0.28	5.15	5.15	0.70609	FERM domain (1);	0.000000	0.85682	D	0.000000	T	0.72374	0.3452	M	0.86502	2.82	0.80722	D	1	P	0.44627	0.839	B	0.40636	0.335	T	0.79722	-0.1684	10	0.87932	D	0	-18.9647	14.9691	0.71220	1.0:0.0:0.0:0.0	.	370	O60674	JAK2_HUMAN	G	370;370;221	ENSP00000440387:D370G;ENSP00000371067:D370G;ENSP00000443103:D221G	ENSP00000371067:D370G	D	+	2	0	JAK2	5054935	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.946000	0.92992	1.953000	0.56701	0.260000	0.18958	GAT	.		0.373	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
KAZALD1	81621	ucsc.edu;bcgsc.ca	37	10	102824163	102824163	+	Silent	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:102824163C>A	ENST00000370200.5	+	3	983	c.657C>A	c.(655-657)ccC>ccA	p.P219P		NM_030929.4	NP_112191.2	Q96I82	KAZD1_HUMAN	Kazal-type serine peptidase inhibitor domain 1	219	Ig-like C2-type.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|regulation of cell growth (GO:0001558)	interstitial matrix (GO:0005614)				endometrium(1)|ovary(1)|prostate(2)	4				Epithelial(162;6.21e-09)|all cancers(201;3.14e-07)		GGGATGACCCCCACATCTCTG	0.597																																					p.P219P		.											.	KAZALD1	90	0			c.C657A						.						65.0	57.0	59.0					10																	102824163		2203	4300	6503	SO:0001819	synonymous_variant	81621	exon3			TGACCCCCACATC	AF333487	CCDS7509.1	10q24.32	2013-01-11	2005-08-17		ENSG00000107821	ENSG00000107821		"""Immunoglobulin superfamily / I-set domain containing"""	25460	protein-coding gene	gene with protein product		609208	"""Kazal-type serine protease inhibitor domain 1"""			12975309	Standard	NM_030929		Approved	FKSG40, FKSG28	uc001ksr.3	Q96I82	OTTHUMG00000018918	ENST00000370200.5:c.657C>A	10.37:g.102824163C>A		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_030929	D3DR74|Q6ZMB1|Q9BQ73	Silent	SNP	ENST00000370200.5	37	CCDS7509.1																																																																																			.		0.597	KAZALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049891.2	NM_030929	
KCNS1	3787	ucsc.edu;bcgsc.ca	37	20	43723974	43723974	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr20:43723974T>C	ENST00000306117.1	-	5	1514	c.1118A>G	c.(1117-1119)tAc>tGc	p.Y373C	KCNS1_ENST00000537075.1_Missense_Mutation_p.Y373C	NM_002251.3	NP_002242.2	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1	373					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(1)|lung(3)|ovary(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				CACCTCACGGTAGCTGTGCTG	0.517																																					p.Y373C		.											.	KCNS1	90	0			c.A1118G						.						35.0	33.0	34.0					20																	43723974		2203	4300	6503	SO:0001583	missense	3787	exon5			TCACGGTAGCTGT	AF043473	CCDS13342.1	20q12	2011-07-05			ENSG00000124134	ENSG00000124134		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6300	protein-coding gene	gene with protein product		602905				9305895, 16382104	Standard	NM_002251		Approved	Kv9.1	uc002xnc.3	Q96KK3	OTTHUMG00000033079	ENST00000306117.1:c.1118A>G	20.37:g.43723974T>C	ENSP00000307694:p.Tyr373Cys	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_002251	A2RUL9|B7ZM31|O43652|Q6DJU6	Missense_Mutation	SNP	ENST00000306117.1	37	CCDS13342.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.264670	0.80358	.	.	ENSG00000124134	ENST00000306117;ENST00000537075	D;D	0.98419	-4.92;-4.92	5.81	5.81	0.92471	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99023	0.9666	M	0.87328	2.875	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.99741	1.1015	10	0.87932	D	0	.	15.8314	0.78757	0.0:0.0:0.0:1.0	.	373	Q96KK3	KCNS1_HUMAN	C	373	ENSP00000307694:Y373C;ENSP00000445595:Y373C	ENSP00000307694:Y373C	Y	-	2	0	KCNS1	43157388	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.217000	0.71921	0.533000	0.62120	TAC	.		0.517	KCNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080507.3	NM_002251	
KDM2B	84678	ucsc.edu;bcgsc.ca	37	12	121878722	121878722	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:121878722G>T	ENST00000377071.4	-	21	3579	c.3507C>A	c.(3505-3507)agC>agA	p.S1169R	KDM2B_ENST00000542973.1_Missense_Mutation_p.S537R|KDM2B_ENST00000377069.4_Missense_Mutation_p.S1100R|KDM2B_ENST00000536437.1_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	1169					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GACAACTGGAGCTGCAAAGGG	0.627																																					p.S1169R		.											.	KDM2B	638	0			c.C3507A						.						34.0	42.0	40.0					12																	121878722		2129	4248	6377	SO:0001583	missense	84678	exon21			ACTGGAGCTGCAA	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.3507C>A	12.37:g.121878722G>T	ENSP00000366271:p.Ser1169Arg	Somatic	52.0	1.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932836	0.73442	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377069;ENST00000377071;ENST00000540043;ENST00000261824	T;T;T	0.39406	1.08;1.08;1.08	6.07	-1.32	0.09201	.	0.279903	0.30383	N	0.009752	T	0.50034	0.1592	M	0.75615	2.305	0.80722	D	1	B;B;D;B	0.60575	0.18;0.437;0.988;0.062	B;B;P;B	0.51657	0.091;0.143;0.676;0.015	T	0.60606	-0.7230	10	0.87932	D	0	-26.3777	12.8523	0.57864	0.5751:0.0:0.4249:0.0	.	609;1169;1100;612	B7ZB05;Q8NHM5;A8MRS1;B4DSN4	.;KDM2B_HUMAN;.;.	R	1157;537;1100;1169;612;1172	ENSP00000437821:S537R;ENSP00000366269:S1100R;ENSP00000366271:S1169R	ENSP00000261824:S1172R	S	-	3	2	KDM2B	120363105	1.000000	0.71417	0.916000	0.36221	0.952000	0.60782	1.633000	0.37113	-0.065000	0.13021	-0.136000	0.14681	AGC	.		0.627	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
SPIDR	23514	ucsc.edu;bcgsc.ca	37	8	48625238	48625238	+	Silent	SNP	G	G	A	rs547240956		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr8:48625238G>A	ENST00000297423.4	+	15	2376	c.1992G>A	c.(1990-1992)ctG>ctA	p.L664L	SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Silent_p.L594L|SPIDR_ENST00000517693.1_Silent_p.L139L|SPIDR_ENST00000518074.1_Silent_p.L604L	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	664					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											AGAGTCTGCTGCTTCTGGAGC	0.408																																					p.L664L		.											.	KIAA0146	68	0			c.G1992A						.						70.0	75.0	73.0					8																	48625238		1885	4131	6016	SO:0001819	synonymous_variant	23514	exon15			TCTGCTGCTTCTG	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1992G>A	8.37:g.48625238G>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	.	56.0	5.0	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Silent	SNP	ENST00000297423.4	37	CCDS43737.1	.	.	.	.	.	.	.	.	.	.	T	11.11	1.543516	0.27563	.	.	ENSG00000164808	ENST00000519401	.	.	.	4.94	2.47	0.30058	.	.	.	.	.	T	0.31796	0.0808	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22103	-1.0226	4	.	.	.	.	6.1785	0.20457	0.0:0.1484:0.3995:0.4521	.	.	.	.	Y	346	.	.	C	+	2	0	KIAA0146	48787791	0.005000	0.15991	0.022000	0.16811	0.691000	0.40173	0.192000	0.17096	-0.052000	0.13311	-0.256000	0.11100	TGC	.		0.408	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
KIAA1755	85449	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36874514	36874514	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr20:36874514G>A	ENST00000279024.4	-	2	289	c.18C>T	c.(16-18)ctC>ctT	p.L6L		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	6										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				TGGCTGTGTCGAGGGATGGAG	0.607																																					p.L6L		.											.	KIAA1755	95	0			c.C18T						.						39.0	34.0	36.0					20																	36874514		2203	4300	6503	SO:0001819	synonymous_variant	85449	exon2			TGTGTCGAGGGAT	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.18C>T	20.37:g.36874514G>A		Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	10.0	NM_001029864	Q9C0A8	Silent	SNP	ENST00000279024.4	37	CCDS33467.1																																																																																			.		0.607	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
KRT36	8689	ucsc.edu;bcgsc.ca	37	17	39646095	39646095	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:39646095G>T	ENST00000328119.6	-	1	21	c.22C>A	c.(22-24)Cct>Act	p.P8T	KRT36_ENST00000393986.2_Intron	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	8	Head.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				GAGAAGGTAGGGGTGCAGGTC	0.587																																					p.P8T		.											.	KRT36	90	0			c.C22A						.						33.0	32.0	32.0					17																	39646095		2194	4292	6486	SO:0001583	missense	8689	exon1			AGGTAGGGGTGCA	Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.22C>A	17.37:g.39646095G>T	ENSP00000329165:p.Pro8Thr	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_003771	Q86XG4	Missense_Mutation	SNP	ENST00000328119.6	37	CCDS11395.1	.	.	.	.	.	.	.	.	.	.	G	0.029	-1.349620	0.01266	.	.	ENSG00000126337	ENST00000328119	T	0.79454	-1.27	5.56	1.39	0.22231	.	0.327118	0.21982	N	0.066285	T	0.64907	0.2641	L	0.40543	1.245	0.18873	N	0.999983	B	0.17038	0.02	B	0.16722	0.016	T	0.49899	-0.8890	9	.	.	.	.	8.5054	0.33184	0.3627:0.0:0.6373:0.0	.	8	O76013	KRT36_HUMAN	T	8	ENSP00000329165:P8T	.	P	-	1	0	KRT36	36899621	0.000000	0.05858	0.185000	0.23176	0.769000	0.43574	0.191000	0.17076	0.305000	0.22832	0.655000	0.94253	CCT	.		0.587	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259508.1	NM_003771	
KIF18B	146909	ucsc.edu;bcgsc.ca	37	17	43013645	43013645	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:43013645T>C	ENST00000593135.1	-	2	165	c.68A>G	c.(67-69)gAc>gGc	p.D23G	KIF18B_ENST00000339151.4_Missense_Mutation_p.D23G|KIF18B_ENST00000587309.1_Missense_Mutation_p.D23G|KIF18B_ENST00000590129.1_Missense_Mutation_p.D32G|KIF18B_ENST00000438933.2_Missense_Mutation_p.D23G	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	32	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				CCGCTGACTGTCCAGCTCCCG	0.647																																					p.D23G		.											.	KIF18B	70	0			c.A68G						.						13.0	17.0	16.0					17																	43013645		2147	4241	6388	SO:0001583	missense	146909	exon2			TGACTGTCCAGCT		CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.68A>G	17.37:g.43013645T>C	ENSP00000465992:p.Asp23Gly	Somatic	23.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_001264573	A6NJI2|B7ZM49|B9EGM8|D5L6I1	Missense_Mutation	SNP	ENST00000593135.1	37	CCDS45709.2	.	.	.	.	.	.	.	.	.	.	T	13.63	2.294379	0.40594	.	.	ENSG00000186185	ENST00000438933;ENST00000339151;ENST00000376982	T;T	0.75050	-0.9;-0.9	5.61	5.61	0.85477	Kinesin, motor domain (4);	0.432853	0.17091	N	0.187378	T	0.70509	0.3232	L	0.35593	1.075	0.35359	D	0.78801	B;B;B	0.29671	0.254;0.214;0.214	B;B;B	0.37550	0.215;0.253;0.173	T	0.75741	-0.3211	10	0.48119	T	0.1	.	15.4653	0.75394	0.0:0.0:0.0:1.0	.	32;32;32	Q86Y91;Q86Y91-3;Q86Y91-2	KI18B_HUMAN;.;.	G	23	ENSP00000412798:D23G;ENSP00000341466:D23G	ENSP00000341466:D23G	D	-	2	0	KIF18B	40369171	0.998000	0.40836	0.991000	0.47740	0.351000	0.29236	4.546000	0.60705	2.151000	0.67156	0.454000	0.30748	GAC	.		0.647	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000448724.1	NM_001080443	
KRT6A	3853	ucsc.edu;bcgsc.ca	37	12	52881662	52881662	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:52881662T>C	ENST00000330722.6	-	9	1605	c.1537A>G	c.(1537-1539)Agc>Ggc	p.S513G		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	513	Tail.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		GAGTAGCTGCTTCCTCCACCC	0.627																																					p.S513G		.											.	KRT6A	27	0			c.A1537G						.						73.0	82.0	79.0					12																	52881662		2203	4300	6503	SO:0001583	missense	3853	exon9			AGCTGCTTCCTCC	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1537A>G	12.37:g.52881662T>C	ENSP00000369317:p.Ser513Gly	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	t	12.27	1.888775	0.33348	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	T	0.81415	-1.49	5.06	5.06	0.68205	.	0.224065	0.32068	N	0.006628	T	0.64778	0.2629	N	0.25992	0.78	0.38021	D	0.934838	P	0.41673	0.759	B	0.31686	0.134	T	0.68198	-0.5472	10	0.22109	T	0.4	.	13.1169	0.59305	0.0:0.0:0.0:1.0	.	513	P02538	K2C6A_HUMAN	G	513;469	ENSP00000369317:S513G	ENSP00000369317:S513G	S	-	1	0	KRT6A	51167929	0.001000	0.12720	0.994000	0.49952	0.755000	0.42902	-0.002000	0.12924	2.038000	0.60285	0.477000	0.44152	AGC	.		0.627	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
LAMC3	10319	ucsc.edu;bcgsc.ca	37	9	133954597	133954597	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:133954597C>A	ENST00000361069.4	+	23	3972	c.3839C>A	c.(3838-3840)gCa>gAa	p.A1280E	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1280	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AAGACAGTTGCATCATGGCAG	0.617																																					p.A1280E		.											.	LAMC3	93	0			c.C3839A						.						54.0	45.0	48.0					9																	133954597		2203	4300	6503	SO:0001583	missense	10319	exon23			CAGTTGCATCATG	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3839C>A	9.37:g.133954597C>A	ENSP00000354360:p.Ala1280Glu	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_006059	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	C	0.684	-0.797254	0.02862	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.27256	1.68	4.24	2.29	0.28610	.	1.146790	0.06426	N	0.723217	T	0.12774	0.0310	N	0.16478	0.41	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.30238	-0.9985	10	0.02654	T	1	.	4.8645	0.13602	0.2196:0.6674:0.0:0.113	.	1280	Q9Y6N6	LAMC3_HUMAN	E	1280	ENSP00000354360:A1280E	ENSP00000347156:A1280E	A	+	2	0	LAMC3	132944418	0.002000	0.14202	0.000000	0.03702	0.080000	0.17528	1.509000	0.35780	0.500000	0.27991	0.561000	0.74099	GCA	.		0.617	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
LCMT1	51451	ucsc.edu;bcgsc.ca	37	16	25139863	25139863	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:25139863A>G	ENST00000399069.3	+	2	336	c.181A>G	c.(181-183)Agg>Ggg	p.R61G	LCMT1_ENST00000380966.4_Missense_Mutation_p.R61G	NM_016309.2	NP_057393.2	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1	61					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|negative regulation of protein complex assembly (GO:0031333)|protein methylation (GO:0006479)|regulation of apoptotic process (GO:0042981)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	cytosol (GO:0005829)	protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)								GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	GTCTAAAGAGAGGAAAGCCCC	0.483																																					p.R61G	Colon(200;565 2072 24396 47922 50898)	.											.	LCMT1	22	0			c.A181G						.						57.0	54.0	55.0					16																	25139863		1937	4143	6080	SO:0001583	missense	51451	exon2			AAAGAGAGGAAAG	AF037601	CCDS45445.1, CCDS45446.1	16p12.1	2014-08-01			ENSG00000205629	ENSG00000205629			17557	protein-coding gene	gene with protein product	"""protein phosphatase methyltransferase 1"""	610286				10810093	Standard	XM_005255354		Approved	CGI-68, PPMT1	uc002dnx.1	Q9UIC8	OTTHUMG00000177182	ENST00000399069.3:c.181A>G	16.37:g.25139863A>G	ENSP00000382021:p.Arg61Gly	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	32.0	5.0	NM_016309	A6NL89|A8K770|Q53FC5|Q96CI5|Q9H6I9|Q9NTG4|Q9Y378	Missense_Mutation	SNP	ENST00000399069.3	37	CCDS45445.1	.	.	.	.	.	.	.	.	.	.	A	17.20	3.328840	0.60743	.	.	ENSG00000205629	ENST00000399069;ENST00000380966;ENST00000380962	T;T	0.25414	1.8;1.8	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.56630	0.1998	M	0.92923	3.36	0.53005	D	0.999961	P;D	0.89917	0.908;1.0	P;D	0.85130	0.786;0.997	T	0.64672	-0.6352	10	0.87932	D	0	-14.726	8.6514	0.34038	0.8067:0.1933:0.0:0.0	.	61;61	Q9UIC8-3;Q9UIC8	.;LCMT1_HUMAN	G	61;61;78	ENSP00000382021:R61G;ENSP00000370353:R61G	ENSP00000370349:R78G	R	+	1	2	LCMT1	25047364	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.160000	0.42348	1.778000	0.52293	0.459000	0.35465	AGG	.		0.483	LCMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435747.4	NM_016309	
LIPI	149998	ucsc.edu;bcgsc.ca	37	21	15558358	15558358	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr21:15558358G>T	ENST00000536861.1	-	3	464	c.465C>A	c.(463-465)ttC>ttA	p.F155L	LIPI_ENST00000344577.2_Missense_Mutation_p.F176L			Q6XZB0	LIPI_HUMAN	lipase, member I	155					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TCACACCTATGAAATGAAAAT	0.328																																					p.F176L		.											.	LIPI	70	0			c.C528A						.						108.0	106.0	107.0					21																	15558358		2203	4300	6503	SO:0001583	missense	149998	exon3			ACCTATGAAATGA	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.465C>A	21.37:g.15558358G>T	ENSP00000440381:p.Phe155Leu	Somatic	74.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_198996	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.28|13.28	2.190909|2.190909	0.38707|0.38707	.|.	.|.	ENSG00000188992|ENSG00000188992	ENST00000344577;ENST00000536861;ENST00000382981|ENST00000400211	D;D|.	0.84944|.	-1.92;-1.92|.	5.37|5.37	2.41|2.41	0.29592|0.29592	.|.	0.128328|.	0.64402|.	D|.	0.000002|.	T|T	0.09905|0.09905	0.0243|0.0243	N|N	0.02158|0.02158	-0.66|-0.66	0.24883|0.24883	N|N	0.992217|0.992217	B;B|.	0.10296|.	0.003;0.003|.	B;B|.	0.13407|.	0.006;0.009|.	T|T	0.25606|0.25606	-1.0127|-1.0127	10|5	0.02654|.	T|.	1|.	.|.	6.316|6.316	0.21190|0.21190	0.182:0.3174:0.5007:0.0|0.182:0.3174:0.5007:0.0	.|.	155;176|.	G1JSG6;Q6XZB0-2|.	.;.|.	L|N	176;155;50|35	ENSP00000343331:F176L;ENSP00000440381:F155L|.	ENSP00000343331:F176L|.	F|H	-|-	3|1	2|0	LIPI|LIPI	14480229|14480229	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	1.551000|1.551000	0.36233|0.36233	1.421000|1.421000	0.47157|0.47157	-0.145000|-0.145000	0.13849|0.13849	TTC|CAT	.		0.328	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996	
LRIF1	55791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	111494007	111494007	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:111494007T>C	ENST00000369763.4	-	2	1889	c.1499A>G	c.(1498-1500)aAa>aGa	p.K500R	RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000485275.2_Intron|LRIF1_ENST00000494675.1_Intron	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						GACACTTCCTTTTCTAGCATA	0.393																																					p.K500R		.											.	LRIF1	93	0			c.A1499G						.						166.0	156.0	160.0					1																	111494007		2203	4300	6503	SO:0001583	missense	55791	exon2			CTTCCTTTTCTAG	AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1499A>G	1.37:g.111494007T>C	ENSP00000358778:p.Lys500Arg	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	44.0	NM_018372	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	ENST00000369763.4	37	CCDS30800.1	.	.	.	.	.	.	.	.	.	.	T	1.571	-0.534080	0.04082	.	.	ENSG00000121931	ENST00000369763	T	0.39406	1.08	1.06	1.06	0.20224	.	.	.	.	.	T	0.14356	0.0347	L	0.51422	1.61	0.09310	N	1	B	0.30281	0.275	B	0.25405	0.06	T	0.21861	-1.0233	9	0.66056	D	0.02	-4.0474	4.0121	0.09627	0.0:0.0:0.0:1.0	.	500	Q5T3J3	LRIF1_HUMAN	R	500	ENSP00000358778:K500R	ENSP00000358778:K500R	K	-	2	0	LRIF1	111295530	0.935000	0.31712	0.697000	0.30258	0.646000	0.38490	0.147000	0.16202	0.115000	0.18071	0.113000	0.15668	AAA	.		0.393	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2	NM_018372	
LRP4	4038	ucsc.edu;bcgsc.ca	37	11	46897041	46897041	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:46897041C>T	ENST00000378623.1	-	27	4133	c.3891G>A	c.(3889-3891)atG>atA	p.M1297I	LRP4-AS1_ENST00000502049.2_RNA|LRP4-AS1_ENST00000531719.1_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1297					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		CCTGCATGTCCATGAGGCCTG	0.587																																					p.M1297I		.											.	LRP4	94	0			c.G3891A						.						53.0	47.0	49.0					11																	46897041		2201	4299	6500	SO:0001583	missense	4038	exon27			CATGTCCATGAGG	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.3891G>A	11.37:g.46897041C>T	ENSP00000367888:p.Met1297Ile	Somatic	26.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795747	0.90453	.	.	ENSG00000134569	ENST00000378623	D	0.91124	-2.79	5.78	5.78	0.91487	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.94601	0.8260	M	0.71206	2.165	0.80722	D	1	D	0.54964	0.969	P	0.62885	0.908	D	0.93084	0.6494	10	0.37606	T	0.19	.	20.005	0.97433	0.0:1.0:0.0:0.0	.	1297	O75096	LRP4_HUMAN	I	1297	ENSP00000367888:M1297I	ENSP00000367888:M1297I	M	-	3	0	LRP4	46853617	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.680000	0.84062	2.745000	0.94114	0.555000	0.69702	ATG	.		0.587	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
LRRC4	64101	ucsc.edu;bcgsc.ca	37	7	127669957	127669957	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:127669957T>C	ENST00000249363.3	-	2	994	c.737A>G	c.(736-738)aAg>aGg	p.K246R	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	246					postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		GACCCAGAGCTTCTTGAGGGA	0.562																																					p.K246R		.											.	LRRC4	154	0			c.A737G						.						46.0	41.0	42.0					7																	127669957		2202	4300	6502	SO:0001583	missense	64101	exon2			CAGAGCTTCTTGA	AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.737A>G	7.37:g.127669957T>C	ENSP00000249363:p.Lys246Arg	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_022143	A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Missense_Mutation	SNP	ENST00000249363.3	37	CCDS5799.1	.	.	.	.	.	.	.	.	.	.	T	15.55	2.866324	0.51588	.	.	ENSG00000128594	ENST00000249363	T	0.58797	0.31	4.7	4.7	0.59300	.	0.000000	0.64402	U	0.000001	T	0.43188	0.1236	N	0.01482	-0.84	0.58432	D	0.999997	P	0.47253	0.892	P	0.55824	0.785	T	0.54180	-0.8332	10	0.34782	T	0.22	.	12.1761	0.54186	0.0:0.0:0.0:1.0	.	246	Q9HBW1	LRRC4_HUMAN	R	246	ENSP00000249363:K246R	ENSP00000249363:K246R	K	-	2	0	LRRC4	127457193	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.868000	0.87116	1.951000	0.56629	0.533000	0.62120	AAG	.		0.562	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349170.1	NM_022143	
MATR3	9782	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	138643894	138643894	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:138643894T>C	ENST00000394805.3	+	2	1125	c.790T>C	c.(790-792)Tct>Cct	p.S264P	MATR3_ENST00000502929.1_Missense_Mutation_p.S264P|MATR3_ENST00000504203.1_Intron|MATR3_ENST00000361059.2_Missense_Mutation_p.S264P|MATR3_ENST00000510056.1_Missense_Mutation_p.S264P|MATR3_ENST00000394800.2_Missense_Mutation_p.S264P|MATR3_ENST00000503811.1_Intron|MATR3_ENST00000502499.1_Intron|MATR3_ENST00000509990.1_Missense_Mutation_p.S264P	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3	264					cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ACAAGAGAGATCTCTCTTTGA	0.438																																					p.S264P		.											.	MATR3	91	0			c.T790C						.						81.0	85.0	83.0					5																	138643894		2203	4300	6503	SO:0001583	missense	9782	exon2			GAGAGATCTCTCT	M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.790T>C	5.37:g.138643894T>C	ENSP00000378284:p.Ser264Pro	Somatic	52.0	1.0		WXS	Illumina HiSeq	Phase_I	79.0	35.0	NM_018834	B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Missense_Mutation	SNP	ENST00000394805.3	37	CCDS4210.1	.	.	.	.	.	.	.	.	.	.	T	11.58	1.680960	0.29872	.	.	ENSG00000015479	ENST00000509990;ENST00000361059;ENST00000502929;ENST00000394800;ENST00000394805;ENST00000504045;ENST00000510056	T;T;T;T;T;T;T	0.78924	-0.86;-0.86;-0.88;-0.88;-0.86;-1.22;-0.82	5.4	5.4	0.78164	.	0.374210	0.33834	N	0.004507	T	0.77896	0.4199	N	0.14661	0.345	0.38162	D	0.939058	D;P;D	0.65815	0.995;0.86;0.995	D;P;D	0.67900	0.954;0.773;0.954	T	0.80511	-0.1350	10	0.36615	T	0.2	-8.4151	15.7064	0.77583	0.0:0.0:0.0:1.0	.	264;264;264	D6REM6;A8MXP9;P43243	.;.;MATR3_HUMAN	P	264	ENSP00000423533:S264P;ENSP00000354346:S264P;ENSP00000422319:S264P;ENSP00000378279:S264P;ENSP00000378284:S264P;ENSP00000423290:S264P;ENSP00000426743:S264P	ENSP00000354346:S264P	S	+	1	0	MATR3	138671793	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.015000	0.49599	2.171000	0.68590	0.459000	0.35465	TCT	.		0.438	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251324.2	NM_018834	
ME3	10873	ucsc.edu;bcgsc.ca	37	11	86161034	86161034	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:86161034C>T	ENST00000393324.3	-	9	1281	c.1028G>A	c.(1027-1029)gGc>gAc	p.G343D	ME3_ENST00000359636.2_Missense_Mutation_p.G343D|ME3_ENST00000543262.1_Missense_Mutation_p.G343D|RP11-317J19.1_ENST00000524610.1_RNA	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	343					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GTGGGCAATGCCCATAGCTGC	0.502																																					p.G343D		.											.	ME3	515	0			c.G1028A						.						116.0	106.0	109.0					11																	86161034		2202	4299	6501	SO:0001583	missense	10873	exon10			GCAATGCCCATAG	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1028G>A	11.37:g.86161034C>T	ENSP00000376998:p.Gly343Asp	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_006680	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	33	5.268719	0.95429	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.68	5.68	0.88126	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.78855	0.4349	H	0.97732	4.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86109	0.1561	9	.	.	.	.	19.7987	0.96497	0.0:1.0:0.0:0.0	.	343	Q16798	MAON_HUMAN	D	343	ENSP00000352657:G343D;ENSP00000440246:G343D;ENSP00000376998:G343D;ENSP00000431182:G343D	.	G	-	2	0	ME3	85838682	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.726000	0.84824	2.696000	0.92011	0.555000	0.69702	GGC	.		0.502	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
MEI1	150365	ucsc.edu;bcgsc.ca	37	22	42128267	42128267	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr22:42128267G>A	ENST00000401548.3	+	10	1155	c.1115G>A	c.(1114-1116)aGg>aAg	p.R372K	MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000540833.1_Missense_Mutation_p.R112K|MEI1_ENST00000400107.1_5'UTR	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GCAGTGGTGAGGAGCCTGCAG	0.562																																					p.R372K		.											.	MEI1	70	0			c.G1115A						.						53.0	58.0	57.0					22																	42128267		2079	4208	6287	SO:0001583	missense	150365	exon10			TGGTGAGGAGCCT	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.1115G>A	22.37:g.42128267G>A	ENSP00000384115:p.Arg372Lys	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_152513		Missense_Mutation	SNP	ENST00000401548.3	37	CCDS46718.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425137	0.83667	.	.	ENSG00000167077	ENST00000401548;ENST00000540833	T;T	0.22539	1.95;1.95	5.74	4.72	0.59763	Armadillo-like helical (1);Armadillo-type fold (1);	0.136634	0.46758	D	0.000263	T	0.31888	0.0811	M	0.61703	1.905	0.80722	D	1	P;P	0.45594	0.862;0.717	P;B	0.49332	0.607;0.352	T	0.04509	-1.0946	10	0.51188	T	0.08	-5.1805	12.47	0.55781	0.0779:0.0:0.9221:0.0	.	372;372	Q5TIA1;Q5TIA1-4	MEI1_HUMAN;.	K	372;112	ENSP00000384115:R372K;ENSP00000444225:R112K	ENSP00000384115:R372K	R	+	2	0	MEI1	40458213	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.063000	0.64332	1.427000	0.47276	0.563000	0.77884	AGG	.		0.562	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000074937.3	NM_152513	
MFI2	4241	ucsc.edu;bcgsc.ca	37	3	196743126	196743126	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:196743126T>C	ENST00000296350.5	-	8	1128	c.1015A>G	c.(1015-1017)Acc>Gcc	p.T339A		NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	339	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		GCCTCATAGGTCTGTGTGGCG	0.587																																					p.T339A		.											.	MFI2	90	0			c.A1015G						.						98.0	88.0	91.0					3																	196743126		2203	4300	6503	SO:0001583	missense	4241	exon8			CATAGGTCTGTGT		CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.1015A>G	3.37:g.196743126T>C	ENSP00000296350:p.Thr339Ala	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_005929	Q9BQE2	Missense_Mutation	SNP	ENST00000296350.5	37	CCDS3325.1	.	.	.	.	.	.	.	.	.	.	T	17.09	3.300261	0.60195	.	.	ENSG00000163975	ENST00000296350	T	0.33438	1.41	5.39	5.39	0.77823	.	0.260925	0.44285	D	0.000469	T	0.41971	0.1182	M	0.87682	2.9	0.80722	D	1	B	0.33448	0.412	B	0.37731	0.257	T	0.39840	-0.9594	10	0.12766	T	0.61	-32.0879	14.5742	0.68235	0.0:0.0:0.0:1.0	.	339	P08582	TRFM_HUMAN	A	339	ENSP00000296350:T339A	ENSP00000296350:T339A	T	-	1	0	MFI2	198227523	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	2.882000	0.48546	2.041000	0.60428	0.379000	0.24179	ACC	.		0.587	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340458.1		
MFNG	4242	ucsc.edu;bcgsc.ca	37	22	37875474	37875474	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr22:37875474C>A	ENST00000356998.3	-	4	693	c.470G>T	c.(469-471)aGa>aTa	p.R157I	MFNG_ENST00000416983.3_Missense_Mutation_p.R143I	NM_002405.3	NP_002396.2	O00587	MFNG_HUMAN	MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	157					pattern specification process (GO:0007389)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)	extracellular space (GO:0005615)|integral component of Golgi membrane (GO:0030173)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			large_intestine(2)|lung(2)|skin(1)	5	Melanoma(58;0.0574)					CGGGAAGGCTCTCAGAAGCTG	0.622																																					p.R157I		.											.	MFNG	658	0			c.G470T						.						86.0	75.0	79.0					22																	37875474		2203	4300	6503	SO:0001583	missense	4242	exon4			AAGGCTCTCAGAA	BC094814	CCDS13947.1, CCDS54525.1	22q13.1	2013-02-19	2006-11-13		ENSG00000100060	ENSG00000100060	2.4.1.222	"""Beta 3-glycosyltransferases"""	7038	protein-coding gene	gene with protein product		602577	"""manic fringe (Drosophila) homolog"", ""manic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_002405		Approved		uc003ass.2	O00587	OTTHUMG00000150560	ENST00000356998.3:c.470G>T	22.37:g.37875474C>A	ENSP00000349490:p.Arg157Ile	Somatic	60.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_002405	B4DLT6|O43730|Q504S9	Missense_Mutation	SNP	ENST00000356998.3	37	CCDS13947.1	.	.	.	.	.	.	.	.	.	.	c	10.71	1.428104	0.25726	.	.	ENSG00000100060	ENST00000416983;ENST00000356998;ENST00000436341;ENST00000442496	T;T;T;T	0.77489	-1.1;-1.1;-1.1;-0.06	5.18	-8.25	0.01025	.	1.696110	0.03261	N	0.183213	T	0.69351	0.3101	L	0.46157	1.445	0.09310	N	1	B;B	0.30021	0.22;0.265	B;B	0.27887	0.062;0.084	T	0.61671	-0.7015	10	0.59425	D	0.04	14.5753	12.3149	0.54951	0.0:0.1137:0.5499:0.3364	.	143;157	B4DLT6;O00587	.;MFNG_HUMAN	I	143;157;35;35	ENSP00000413855:R143I;ENSP00000349490:R157I;ENSP00000394081:R35I;ENSP00000389274:R35I	ENSP00000349490:R157I	R	-	2	0	MFNG	36205420	0.050000	0.20438	0.000000	0.03702	0.019000	0.09904	0.844000	0.27654	-1.863000	0.01150	-0.336000	0.08194	AGA	.		0.622	MFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318902.1	NM_002405	
MORN1	79906	ucsc.edu;bcgsc.ca	37	1	2317315	2317315	+	Missense_Mutation	SNP	C	C	A	rs558330061		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:2317315C>A	ENST00000378531.3	-	5	553	c.380G>T	c.(379-381)cGg>cTg	p.R127L	MORN1_ENST00000606372.1_5'UTR|MORN1_ENST00000378529.3_Missense_Mutation_p.R127L	NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1	127										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		TTGTCCATCCCGGTCCACCAG	0.582																																					p.R127L		.											.	MORN1	92	0			c.G380T						.						147.0	136.0	140.0					1																	2317315		2203	4300	6503	SO:0001583	missense	79906	exon5			CCATCCCGGTCCA	AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.380G>T	1.37:g.2317315C>A	ENSP00000367792:p.Arg127Leu	Somatic	78.0	1.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_024848	A6NKZ6|Q8WW30|Q9H852	Missense_Mutation	SNP	ENST00000378531.3	37	CCDS40.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.731|1.731	-0.494032|-0.494032	0.04322|0.04322	.|.	.|.	ENSG00000116151|ENSG00000116151	ENST00000449373|ENST00000378531;ENST00000378529;ENST00000378525	.|T;T;T	.|0.55413	.|0.52;0.52;0.52	4.41|4.41	-8.82|-8.82	0.00810|0.00810	.|.	.|1.630500	.|0.03949	.|N	.|0.288198	T|T	0.32010|0.32010	0.0815|0.0815	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B|P;B;P	0.14438|0.35844	0.01|0.506;0.321;0.524	B|B;B;B	0.14023|0.38296	0.01|0.27;0.066;0.153	T|T	0.29305|0.29305	-1.0016|-1.0016	8|10	0.87932|0.29301	D|T	0|0.29	.|.	3.7282|3.7282	0.08482|0.08482	0.1122:0.1692:0.4838:0.2347|0.1122:0.1692:0.4838:0.2347	.|.	78|103;127;127	Q5T088|B4DRE3;Q5T089-2;Q5T089	.|.;.;MORN1_HUMAN	W|L	78|127;127;103	.|ENSP00000367792:R127L;ENSP00000367790:R127L;ENSP00000367786:R103L	ENSP00000390261:G78W|ENSP00000367786:R103L	G|R	-|-	1|2	0|0	MORN1|MORN1	2307175|2307175	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.014000|0.014000	0.08584|0.08584	-2.279000|-2.279000	0.01159|0.01159	-2.120000|-2.120000	0.00826|0.00826	0.460000|0.460000	0.39030|0.39030	GGG|CGG	.		0.582	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004055.1	NM_024848	
APEH	327	ucsc.edu;bcgsc.ca	37	3	49722242	49722242	+	IGR	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:49722242T>A	ENST00000296456.5	+	0	3220				MST1_ENST00000449682.2_Silent_p.L566L|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'Flank	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGACCCGCTGTAGGCTTGGCT	0.592																																					p.L566L		.											.	MST1	278	0			c.A1698T						.						49.0	47.0	48.0					3																	49722242		2203	4300	6503	SO:0001628	intergenic_variant	4485	exon15			CCGCTGTAGGCTT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49722242T>A		Somatic	70.0	0.0		WXS	Illumina HiSeq	.	56.0	5.0	NM_020998	Q9BQ33|Q9P0Y2	Silent	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	T	12.07	1.828051	0.32329	.	.	ENSG00000173531	ENST00000448220	.	.	.	5.81	2.24	0.28232	.	.	.	.	.	T	0.56292	0.1975	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49652	-0.8917	4	.	.	.	.	8.4371	0.32793	0.0:0.6852:0.128:0.1868	.	.	.	.	S	36	.	.	T	-	1	0	MST1	49697246	0.867000	0.29959	1.000000	0.80357	0.767000	0.43475	-0.029000	0.12329	0.620000	0.30215	-0.408000	0.06270	ACA	.		0.592	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
MTMR4	9110	ucsc.edu;mdanderson.org	37	17	56573314	56573314	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:56573314C>T	ENST00000323456.5	-	16	2313	c.2189G>A	c.(2188-2190)gGa>gAa	p.G730E	MTMR4_ENST00000579925.1_Missense_Mutation_p.G673E	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	730					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGGAGCTGGTCCCTTAGTCTC	0.502																																					p.G730E		.											.	MTMR4	91	0			c.G2189A						.						191.0	199.0	197.0					17																	56573314		2203	4300	6503	SO:0001583	missense	9110	exon16			GCTGGTCCCTTAG	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.2189G>A	17.37:g.56573314C>T	ENSP00000325285:p.Gly730Glu	Somatic	15.0	0.0		WXS	Illumina HiSeq	.	19.0	9.0	NM_004687	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	37	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.133708	0.00338	.	.	ENSG00000108389	ENST00000323456	D	0.92446	-3.04	4.81	-9.61	0.00550	.	2.453890	0.01305	N	0.010406	T	0.73281	0.3567	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.71695	-0.4515	10	0.02654	T	1	.	4.3607	0.11201	0.5757:0.0834:0.138:0.2029	.	730	Q9NYA4	MTMR4_HUMAN	E	730	ENSP00000325285:G730E	ENSP00000325285:G730E	G	-	2	0	MTMR4	53928313	0.000000	0.05858	0.000000	0.03702	0.223000	0.24884	-1.254000	0.02874	-2.376000	0.00598	-0.867000	0.03001	GGA	.		0.502	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687	
MTX3	345778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79287047	79287047	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:79287047C>A	ENST00000512528.1	-	1	35	c.15G>T	c.(13-15)ttG>ttT	p.L5F	MTX3_ENST00000512560.1_5'UTR|MTX3_ENST00000509852.1_Missense_Mutation_p.L5F			Q5HYI7	MTX3_HUMAN	metaxin 3	5					protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane (GO:0005741)				endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(1)	7		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		AACTGAGTTCCAAGGGGGCCG	0.652																																					p.L5F		.											.	.	.	0			c.G15T						.						5.0	7.0	6.0					5																	79287047		1640	3567	5207	SO:0001583	missense	345778	exon1			GAGTTCCAAGGGG	BX538064	CCDS47239.1, CCDS47239.2, CCDS54872.1	5q14.1	2004-08-18				ENSG00000177034			24812	protein-coding gene	gene with protein product						15087125	Standard	NM_001010891		Approved		uc010jah.3	Q5HYI7		ENST00000512528.1:c.15G>T	5.37:g.79287047C>A	ENSP00000424798:p.Leu5Phe	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	14.0	NM_001010891	B4DL65|E9PB57|Q7Z380|Q8NB92	Missense_Mutation	SNP	ENST00000512528.1	37		.	.	.	.	.	.	.	.	.	.	C	15.99	2.996853	0.54147	.	.	ENSG00000177034	ENST00000328496;ENST00000509852;ENST00000512528;ENST00000418095	T;T	0.54675	0.56;0.59	5.1	3.32	0.38043	.	0.167153	0.48286	D	0.000187	T	0.45816	0.1361	L	0.49126	1.545	0.28350	N	0.920937	B;B	0.31859	0.343;0.006	B;B	0.33799	0.17;0.011	T	0.46775	-0.9167	10	0.44086	T	0.13	-0.8557	10.5593	0.45135	0.0:0.8425:0.0:0.1575	.	5;5	Q5HYI7-4;Q5HYI7	.;MTX3_HUMAN	F	5	ENSP00000423302:L5F;ENSP00000424798:L5F	ENSP00000331672:L5F	L	-	3	2	MTX3	79322803	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.687000	0.46976	1.511000	0.48818	0.655000	0.94253	TTG	.		0.652	MTX3-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372567.1	XM_293971	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9057886	9057886	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:9057886C>G	ENST00000397910.4	-	3	29763	c.29560G>C	c.(29560-29562)Gtt>Ctt	p.V9854L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9856	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GATGTGAAAACAGTGGTATCG	0.468																																					p.V9854L		.											.	MUC16	566	0			c.G29560C						.						154.0	145.0	148.0					19																	9057886		2010	4183	6193	SO:0001583	missense	94025	exon3			TGAAAACAGTGGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29560G>C	19.37:g.9057886C>G	ENSP00000381008:p.Val9854Leu	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	40.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	5.579	0.291676	0.10567	.	.	ENSG00000181143	ENST00000397910	T	0.35605	1.3	2.43	-4.75	0.03239	.	.	.	.	.	T	0.18551	0.0445	N	0.19112	0.55	.	.	.	B	0.02656	0.0	B	0.06405	0.002	T	0.23261	-1.0193	8	0.87932	D	0	.	4.0956	0.09990	0.0:0.2634:0.3471:0.3895	.	9854	B5ME49	.	L	9854	ENSP00000381008:V9854L	ENSP00000381008:V9854L	V	-	1	0	MUC16	8918886	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-5.919000	0.00090	-1.056000	0.03205	-0.232000	0.12228	GTT	.		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUTYH	4595	ucsc.edu;bcgsc.ca	37	1	45798502	45798502	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:45798502A>G	ENST00000372098.3	-	7	633	c.500T>C	c.(499-501)gTg>gCg	p.V167A	MUTYH_ENST00000448481.1_Missense_Mutation_p.V153A|MUTYH_ENST00000372104.1_Missense_Mutation_p.V142A|MUTYH_ENST00000528332.2_Silent_p.G54G|MUTYH_ENST00000456914.2_Missense_Mutation_p.V142A|MUTYH_ENST00000531105.1_Intron|MUTYH_ENST00000528013.2_Missense_Mutation_p.V156A|MUTYH_ENST00000488731.2_Silent_p.G40G|MUTYH_ENST00000372100.5_Missense_Mutation_p.V153A|MUTYH_ENST00000355498.2_Missense_Mutation_p.V142A|MUTYH_ENST00000372115.3_Missense_Mutation_p.V156A|MUTYH_ENST00000372110.3_Missense_Mutation_p.V157A|MUTYH_ENST00000354383.6_Missense_Mutation_p.V143A|MUTYH_ENST00000450313.1_Missense_Mutation_p.V170A|MUTYH_ENST00000529984.1_Silent_p.G40G			Q9UIF7	MUTYH_HUMAN	mutY homolog	167					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA repair (GO:0006281)|mismatch repair (GO:0006298)	mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|metal ion binding (GO:0046872)|MutSalpha complex binding (GO:0032407)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					GAGTTGATTCACCTCCTGTGG	0.587			Mis			colorectal		Base excision repair (BER), DNA glycosylases	MUTYH-associated polyposis																												p.V170A		.	yes	Rec		Adenomatous polyposis coli	1	1p34.3-1p32.1	4595	mutY homolog (E. coli)		E	.	MUTYH	1083	0			c.T509C						.						103.0	116.0	112.0					1																	45798502		2203	4300	6503	SO:0001583	missense	4595	exon7	Familial Cancer Database	MAP, MYH-associated polyposis	TGATTCACCTCCT	U63329	CCDS520.1, CCDS41320.1, CCDS41321.1, CCDS41322.1, CCDS72776.1, CCDS72777.1	1p34.1	2014-09-17	2013-09-12		ENSG00000132781	ENSG00000132781			7527	protein-coding gene	gene with protein product		604933	"""mutY (E. coli) homolog"", ""mutY homolog (E. coli)"""			7823963, 10684930	Standard	NM_012222		Approved	MYH	uc009vxp.3	Q9UIF7	OTTHUMG00000007682	ENST00000372098.3:c.500T>C	1.37:g.45798502A>G	ENSP00000361170:p.Val167Ala	Somatic	91.0	1.0		WXS	Illumina HiSeq	.	50.0	5.0	NM_001128425	D3DPZ4|Q15830|Q9UBP2|Q9UBS7|Q9UIF4|Q9UIF5|Q9UIF6	Missense_Mutation	SNP	ENST00000372098.3	37	CCDS520.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.143026	0.77888	.	.	ENSG00000132781	ENST00000372104;ENST00000448481;ENST00000456914;ENST00000354383;ENST00000355498;ENST00000372098;ENST00000372110;ENST00000372115;ENST00000450313;ENST00000372100;ENST00000525481;ENST00000412971;ENST00000435155;ENST00000528013	D;D;D;D;D;D;D;D;D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28;-2.28	5.01	5.01	0.66863	HhH-GPD domain (2);DNA glycosylase (2);	0.000000	0.85682	D	0.000000	D	0.93575	0.7949	M	0.83692	2.655	0.58432	D	0.999999	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D	0.87578	0.998;0.996;0.994;0.998;0.998;0.998	D	0.94549	0.7752	10	0.87932	D	0	-15.6717	15.0138	0.71567	1.0:0.0:0.0:0.0	.	170;157;167;156;50;143	E5KP25;Q9UIF7-2;Q9UIF7;E5KP27;D3DPZ6;E5KP28	.;.;MUTYH_HUMAN;.;.;.	A	142;153;142;143;142;167;157;156;170;153;14;14;153;156	ENSP00000361176:V142A;ENSP00000409718:V153A;ENSP00000407590:V142A;ENSP00000346354:V143A;ENSP00000347685:V142A;ENSP00000361170:V167A;ENSP00000361182:V157A;ENSP00000361187:V156A;ENSP00000408176:V170A;ENSP00000361172:V153A;ENSP00000410263:V14A;ENSP00000403655:V153A;ENSP00000433130:V156A	ENSP00000346354:V143A	V	-	2	0	MUTYH	45571089	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	8.505000	0.90515	1.997000	0.58415	0.459000	0.35465	GTG	.		0.587	MUTYH-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020529.1	NM_012222	
MYH4	4622	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	10353951	10353951	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:10353951delC	ENST00000255381.2	-	30	4110	c.4000delG	c.(4000-4002)gccfs	p.A1334fs	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1334					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						AGGGCATGGGCCAGAGTGCTC	0.483																																					p.A1334fs		.											.	MYH4	102	0			c.4000delG						.						84.0	74.0	77.0					17																	10353951		2203	4300	6503	SO:0001589	frameshift_variant	4622	exon30			CATGGGCCAGAGT		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.4000delG	17.37:g.10353951delC	ENSP00000255381:p.Ala1334fs	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	18.0	NM_017533		Frame_Shift_Del	DEL	ENST00000255381.2	37	CCDS11154.1																																																																																			.		0.483	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
MYH1	4619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	10404676	10404676	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:10404676G>T	ENST00000226207.5	-	27	3583	c.3489C>A	c.(3487-3489)gcC>gcA	p.A1163A	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1163				A -> T (in Ref. 4; CAA27380). {ECO:0000305}.	muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCTCAATCTGGGCTGAGGTGG	0.632																																					p.A1163A		.											.	MYH1	171	0			c.C3489A						.						89.0	98.0	95.0					17																	10404676		2203	4300	6503	SO:0001819	synonymous_variant	4619	exon27			AATCTGGGCTGAG		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3489C>A	17.37:g.10404676G>T		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	26.0	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	CCDS11155.1																																																																																			.		0.632	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
MXRA7	439921	ucsc.edu;bcgsc.ca	37	17	74684251	74684251	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:74684251T>C	ENST00000355797.3	-	2	358	c.350A>G	c.(349-351)gAg>gGg	p.E117G	MXRA7_ENST00000589082.1_5'UTR|MXRA7_ENST00000375036.2_Missense_Mutation_p.E117G|MXRA7_ENST00000592148.1_Missense_Mutation_p.E160G|MXRA7_ENST00000588114.1_5'UTR|MXRA7_ENST00000585519.1_5'UTR|MXRA7_ENST00000449428.2_Missense_Mutation_p.E117G	NM_001008528.1	NP_001008528.1	P84157	MXRA7_HUMAN	matrix-remodelling associated 7	117						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						CAAGTCCTGCTCCTCTTCCTG	0.627																																					p.E117G		.											.	MXRA7	90	0			c.A350G						.						143.0	94.0	110.0					17																	74684251		2203	4300	6503	SO:0001583	missense	439921	exon2			TCCTGCTCCTCTT	BC053983	CCDS32745.1, CCDS32746.1, CCDS45786.1	17q25.1	2007-08-01				ENSG00000182534			7541	protein-coding gene	gene with protein product							Standard	XM_005257382		Approved	FLJ46603, TMAP1, PS1TP1	uc002jsk.1	P84157		ENST00000355797.3:c.350A>G	17.37:g.74684251T>C	ENSP00000348050:p.Glu117Gly	Somatic	50.0	1.0		WXS	Illumina HiSeq	.	44.0	5.0	NM_001008529	Q0P5W3	Missense_Mutation	SNP	ENST00000355797.3	37	CCDS32745.1	.	.	.	.	.	.	.	.	.	.	T	9.753	1.167997	0.21621	.	.	ENSG00000182534	ENST00000355797;ENST00000449428;ENST00000375036;ENST00000392488	T;T;T	0.51817	0.69;0.69;0.69	3.93	3.93	0.45458	.	1.037320	0.07624	N	0.927543	T	0.51907	0.1702	N	0.19112	0.55	0.80722	D	1	D;D;D	0.64830	0.994;0.994;0.982	D;P;P	0.62955	0.909;0.87;0.82	T	0.36915	-0.9728	10	0.42905	T	0.14	-16.8827	10.8484	0.46757	0.0:0.0:0.0:1.0	.	117;117;117	P84157-2;P84157-3;P84157	.;.;MXRA7_HUMAN	G	117	ENSP00000348050:E117G;ENSP00000391466:E117G;ENSP00000364176:E117G	ENSP00000348050:E117G	E	-	2	0	MXRA7	72195846	0.889000	0.30405	0.985000	0.45067	0.497000	0.33675	1.812000	0.38952	1.742000	0.51746	0.460000	0.39030	GAG	.		0.627	MXRA7-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450983.1	NM_001008529	
MYL6	4637	ucsc.edu;bcgsc.ca	37	12	56553889	56553889	+	Silent	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:56553889C>A	ENST00000550697.1	+	4	547	c.306C>A	c.(304-306)ggC>ggA	p.G102G	RP11-603J24.14_ENST00000548731.1_RNA|MYL6_ENST00000549566.1_Silent_p.G147G|MYL6_ENST00000348108.4_Silent_p.G103G|MYL6_ENST00000547408.1_Silent_p.G102G|MYL6_ENST00000551589.1_Silent_p.G102G|MYL6_ENST00000548400.1_Silent_p.G66G|MYL6_ENST00000548293.1_Silent_p.G102G|MYL6_ENST00000547649.1_Silent_p.G102G|MYL6_ENST00000293422.5_Silent_p.G103G|MYL6_ENST00000548580.1_Silent_p.G54G|MYL6_ENST00000536128.1_Silent_p.G195G|MYL6_ENST00000549017.1_5'UTR|RP11-977G19.5_ENST00000553176.1_RNA	NM_021019.4	NP_066299.2	P60660	MYL6_HUMAN	myosin, light chain 6, alkali, smooth muscle and non-muscle	102	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)|vesicle (GO:0031982)	actin-dependent ATPase activity (GO:0030898)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			large_intestine(1)|lung(1)|ovary(1)|prostate(3)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			AAGGAAATGGCACCGTCATGG	0.522																																					p.G102G		.											.	MYL6	91	0			c.C306A						.						81.0	78.0	79.0					12																	56553889		2203	4300	6503	SO:0001819	synonymous_variant	4637	exon4			AAATGGCACCGTC	AB046613	CCDS8906.1, CCDS31834.1	12q13.13	2013-01-10	2006-09-29			ENSG00000092841		"""Myosins / Light chain"", ""EF-hand domain containing"""	7587	protein-coding gene	gene with protein product		609931	"""myosin, light polypeptide 6, alkali, smooth muscle and non-muscle"""			8188229, 2304459, 2722814	Standard	NM_021019		Approved	ESMLC, MLC3NM, MLC1SM	uc001sjx.2	P60660		ENST00000550697.1:c.306C>A	12.37:g.56553889C>A		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	35.0	5.0	NM_079423	P16475|P24572|P24573|Q12790|Q561V9|Q6IAZ0|Q6IPY5	Silent	SNP	ENST00000550697.1	37	CCDS8906.1																																																																																			.		0.522	MYL6-003	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407928.3		
MYO1A	4640	ucsc.edu;bcgsc.ca	37	12	57441109	57441109	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:57441109T>C	ENST00000442789.2	-	6	695	c.408A>G	c.(406-408)ctA>ctG	p.L136L	MYO1A_ENST00000544473.1_5'UTR|MYO1A_ENST00000300119.3_Silent_p.L136L	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	136	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						GGTTAGACTGTAGCAGCTGCT	0.562																																					p.L136L		.											.	MYO1A	231	0			c.A408G						.						103.0	94.0	97.0					12																	57441109		2203	4300	6503	SO:0001819	synonymous_variant	4640	exon5			AGACTGTAGCAGC	L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.408A>G	12.37:g.57441109T>C		Somatic	40.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_005379	Q9UQD7	Silent	SNP	ENST00000442789.2	37	CCDS8929.1																																																																																			.		0.562	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2	NM_005379	
MYOM2	9172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	2024362	2024362	+	Splice_Site	SNP	G	G	A	rs536708249		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr8:2024362G>A	ENST00000262113.4	+	11	1403	c.1262G>A	c.(1261-1263)cGa>cAa	p.R421Q	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	421	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TTTGTGGACCGGTGAGCGTCT	0.552																																					p.R421Q		.											.	MYOM2	95	0			c.G1262A						.						43.0	41.0	42.0					8																	2024362		2203	4300	6503	SO:0001630	splice_region_variant	9172	exon11			TGGACCGGTGAGC		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1262+1G>A	8.37:g.2024362G>A		Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	17.0	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922412	0.52653	.	.	ENSG00000036448	ENST00000262113	T	0.57273	0.41	5.19	4.3	0.51218	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.216802	0.36034	N	0.002837	T	0.59500	0.2198	M	0.80028	2.48	0.80722	D	1	P	0.43826	0.818	P	0.46026	0.501	T	0.64188	-0.6466	10	0.72032	D	0.01	.	9.9125	0.41415	0.1817:0.0:0.8183:0.0	.	421	P54296	MYOM2_HUMAN	Q	421	ENSP00000262113:R421Q	ENSP00000262113:R421Q	R	+	2	0	MYOM2	2011769	1.000000	0.71417	0.956000	0.39512	0.092000	0.18411	3.832000	0.55783	1.142000	0.42291	0.655000	0.94253	CGA	.		0.552	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	Missense_Mutation
NDST3	9348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	118975959	118975959	+	Silent	SNP	A	A	G	rs372361471		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:118975959A>G	ENST00000296499.5	+	2	1297	c.894A>G	c.(892-894)acA>acG	p.T298T	NDST3_ENST00000433996.2_Silent_p.T298T	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	298	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						AGAGGCTGACATTGTCCTTGG	0.398																																					p.T298T		.											.	NDST3	153	0			c.A894G						.	A		0,4406		0,0,2203	155.0	144.0	148.0		894	-10.5	0.0	4		148	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	NDST3	NM_004784.2		0,1,6501	GG,GA,AA		0.0116,0.0,0.0077		298/874	118975959	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	9348	exon2			GCTGACATTGTCC	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.894A>G	4.37:g.118975959A>G		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	23.0	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Silent	SNP	ENST00000296499.5	37	CCDS3708.1																																																																																			.		0.398	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
NEURL4	84461	ucsc.edu;bcgsc.ca	37	17	7232370	7232370	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:7232370T>C	ENST00000399464.2	-	1	277	c.262A>G	c.(262-264)Acc>Gcc	p.T88A	NEURL4_ENST00000570460.1_Missense_Mutation_p.T88A|NEURL4_ENST00000315614.7_Missense_Mutation_p.T88A	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	88	NHR 1. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ATGCGGACGGTGAAGACGCGT	0.677																																					p.T88A		.											.	NEURL4	46	0			c.A262G						.						24.0	29.0	27.0					17																	7232370		2009	4169	6178	SO:0001583	missense	84461	exon1			GGACGGTGAAGAC		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.262A>G	17.37:g.7232370T>C	ENSP00000382390:p.Thr88Ala	Somatic	19.0	0.0		WXS	Illumina HiSeq	.	11.0	4.0	NM_001005408	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.717095	0.68844	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.73258	-0.73;-0.73	5.11	4.01	0.46588	Concanavalin A-like lectin/glucanase (1);NEUZ (3);	0.064020	0.64402	D	0.000012	T	0.53206	0.1782	N	0.14661	0.345	0.36913	D	0.891003	B;B	0.25563	0.106;0.129	B;B	0.29267	0.06;0.1	T	0.54655	-0.8261	10	0.41790	T	0.15	-20.7058	10.0551	0.42239	0.0:0.0:0.1697:0.8303	.	88;88	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	A	88	ENSP00000319826:T88A;ENSP00000382390:T88A	ENSP00000319826:T88A	T	-	1	0	NEURL4	7173094	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.991000	0.56973	0.860000	0.35481	0.379000	0.24179	ACC	.		0.677	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	
NFKB1	4790	ucsc.edu;bcgsc.ca	37	4	103528881	103528881	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:103528881A>G	ENST00000505458.1	+	19	2474	c.2197A>G	c.(2197-2199)Agg>Ggg	p.R733G	NFKB1_ENST00000226574.4_Missense_Mutation_p.R734G|NFKB1_ENST00000600343.1_Missense_Mutation_p.R553G|NFKB1_ENST00000394820.4_Missense_Mutation_p.R733G			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	733	Interaction with CFLAR.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	AGGGTCCACCAGGCTGGCAGC	0.502																																					p.R734G		.											.	NFKB1	912	0			c.A2200G						.						123.0	119.0	121.0					4																	103528881		2203	4300	6503	SO:0001583	missense	4790	exon19			TCCACCAGGCTGG	M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.2197A>G	4.37:g.103528881A>G	ENSP00000424790:p.Arg733Gly	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	22.0	4.0	NM_003998	A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	ENST00000505458.1	37	CCDS54783.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.924604	0.52653	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000505458	T;T;T	0.64991	-0.13;-0.13;-0.13	5.15	2.62	0.31277	Ankyrin repeat-containing domain (3);	0.118294	0.53938	D	0.000044	T	0.45696	0.1355	N	0.16602	0.42	0.39234	D	0.963729	P;P;P	0.40970	0.734;0.734;0.682	B;B;B	0.39531	0.258;0.24;0.302	T	0.48885	-0.8995	10	0.62326	D	0.03	.	11.9761	0.53091	0.7252:0.2748:0.0:0.0	.	553;733;734	B3KVE8;P19838;P19838-2	.;NFKB1_HUMAN;.	G	734;733;733	ENSP00000226574:R734G;ENSP00000378297:R733G;ENSP00000424790:R733G	ENSP00000226574:R734G	R	+	1	2	NFKB1	103747919	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.694000	0.47035	0.265000	0.21872	0.533000	0.62120	AGG	.		0.502	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363411.1		
NHSL1	57224	ucsc.edu;bcgsc.ca	37	6	138754407	138754407	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:138754407C>T	ENST00000427025.2	-	5	1715	c.1087G>A	c.(1087-1089)Ggt>Agt	p.G363S	MIR3145_ENST00000580727.1_RNA|NHSL1_ENST00000343505.5_Missense_Mutation_p.G359S	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	363										breast(2)|endometrium(4)|kidney(1)	7						TGTGGGTGACCTCTCTGGTAG	0.547																																					p.G363S		.											.	NHSL1	68	0			c.G1087A						.						109.0	104.0	105.0					6																	138754407		692	1591	2283	SO:0001583	missense	57224	exon5			GGTGACCTCTCTG	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.1087G>A	6.37:g.138754407C>T	ENSP00000394546:p.Gly363Ser	Somatic	64.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_020464	Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	ENST00000427025.2	37	CCDS55063.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612926	0.28712	.	.	ENSG00000135540	ENST00000427025;ENST00000343505	T;T	0.35236	1.32;1.79	4.75	-0.47	0.12131	.	0.736937	0.13545	N	0.379872	T	0.11153	0.0272	L	0.54323	1.7	0.09310	N	1	B;B	0.20052	0.041;0.041	B;B	0.14578	0.011;0.011	T	0.40021	-0.9585	10	0.13853	T	0.58	0.0469	9.5189	0.39122	0.0:0.2737:0.0:0.7263	.	359;363	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	S	363;359	ENSP00000394546:G363S;ENSP00000344672:G359S	ENSP00000344672:G359S	G	-	1	0	NHSL1	138796100	0.077000	0.21312	0.000000	0.03702	0.015000	0.08874	0.724000	0.25954	-0.101000	0.12219	-0.345000	0.07892	GGT	.		0.547	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2	XM_050421	
NRXN1	9378	ucsc.edu;bcgsc.ca	37	2	50847255	50847255	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:50847255C>T	ENST00000406316.2	-	8	2701	c.1225G>A	c.(1225-1227)Ggg>Agg	p.G409R	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000405472.3_Missense_Mutation_p.G401R|NRXN1_ENST00000402717.3_Missense_Mutation_p.G401R|NRXN1_ENST00000401669.2_Missense_Mutation_p.G409R|NRXN1_ENST00000404971.1_Missense_Mutation_p.G449R|NRXN1_ENST00000406859.3_Missense_Mutation_p.G409R	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	409	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.G449W(1)|p.G450W(1)|p.G409W(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TCATCAGACCCCAGCATGGTA	0.473																																					p.G449R		.											.	NRXN1	92	3	Substitution - Missense(3)	lung(3)	c.G1345A						.						67.0	68.0	67.0					2																	50847255		2043	4222	6265	SO:0001583	missense	9378	exon9			CAGACCCCAGCAT	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1225G>A	2.37:g.50847255C>T	ENSP00000384311:p.Gly409Arg	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962394	0.74016	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.79554	-1.28;-1.28;-1.08;-1.28;-1.08;-1.28	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.87892	0.6292	L	0.47716	1.5	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.987;1.0	D	0.86547	0.1832	10	0.54805	T	0.06	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	449;409;401	Q9ULB1-3;F8WB18;A7E294	.;.;.	R	449;409;401;409;450;401;409	ENSP00000385142:G449R;ENSP00000384311:G409R;ENSP00000434015:G401R;ENSP00000385017:G409R;ENSP00000385434:G401R;ENSP00000385681:G409R	ENSP00000385017:G409R	G	-	1	0	NRXN1	50700759	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GGG	.		0.473	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
NTRK3	4916	ucsc.edu;bcgsc.ca	37	15	88727470	88727470	+	Silent	SNP	G	G	T	rs201222990	byFrequency	TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:88727470G>T	ENST00000360948.2	-	3	470	c.309C>A	c.(307-309)acC>acA	p.T103T	NTRK3_ENST00000558676.1_Silent_p.T103T|NTRK3_ENST00000357724.2_Silent_p.T103T|NTRK3_ENST00000542733.2_Silent_p.T5T|NTRK3_ENST00000394480.2_Silent_p.T103T|NTRK3_ENST00000557856.1_Silent_p.T103T|NTRK3_ENST00000317501.3_Silent_p.T103T|NTRK3_ENST00000355254.2_Silent_p.T103T|NTRK3_ENST00000540489.2_Silent_p.T103T	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	103					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TTTGAAGTCCGGTGTAGAGCT	0.592			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.T103T		.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	3538	0			c.C309A						.						105.0	77.0	86.0					15																	88727470		2201	4299	6500	SO:0001819	synonymous_variant	4916	exon4			AAGTCCGGTGTAG	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.309C>A	15.37:g.88727470G>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	CCDS32322.1																																																																																			G|0.999;A|0.001		0.592	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
NTSR2	23620	ucsc.edu;bcgsc.ca	37	2	11798785	11798785	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:11798785T>C	ENST00000306928.5	-	4	1087	c.1053A>G	c.(1051-1053)tcA>tcG	p.S351S		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	351					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	GAGTCACAGCTGAGCTGACGT	0.532																																					p.S351S		.											.	NTSR2	946	0			c.A1053G						.						106.0	105.0	105.0					2																	11798785		2203	4300	6503	SO:0001819	synonymous_variant	23620	exon4			CACAGCTGAGCTG	Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.1053A>G	2.37:g.11798785T>C		Somatic	60.0	1.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_012344	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Silent	SNP	ENST00000306928.5	37	CCDS1681.1																																																																																			.		0.532	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1		
NUP210L	91181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154042865	154042865	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:154042865A>G	ENST00000368559.3	-	17	2509	c.2438T>C	c.(2437-2439)tTc>tCc	p.F813S	NUP210L_ENST00000271854.3_Missense_Mutation_p.F813S	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	813					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TAGTGAACTGAAATTATCAAA	0.368																																					p.F813S		.											.	NUP210L	77	0			c.T2438C						.						119.0	107.0	111.0					1																	154042865		1862	4089	5951	SO:0001583	missense	91181	exon17			GAACTGAAATTAT	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2438T>C	1.37:g.154042865A>G	ENSP00000357547:p.Phe813Ser	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	47.0	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.985650	0.74589	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.24151	1.87;1.87	5.0	5.0	0.66597	.	0.109676	0.40908	D	0.000981	T	0.22085	0.0532	M	0.69358	2.11	0.31685	N	0.64267	D;D	0.57899	0.981;0.981	P;P	0.52109	0.69;0.69	T	0.08472	-1.0720	10	0.20046	T	0.44	-29.4441	12.3464	0.55124	1.0:0.0:0.0:0.0	.	813;813	E7EP56;Q5VU65	.;P210L_HUMAN	S	813	ENSP00000357547:F813S;ENSP00000271854:F813S	ENSP00000271854:F813S	F	-	2	0	NUP210L	152309489	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.731000	0.74785	1.910000	0.55303	0.321000	0.21382	TTC	.		0.368	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
NUF2	83540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	163325198	163325198	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:163325198A>G	ENST00000271452.3	+	14	1613	c.1334A>G	c.(1333-1335)tAt>tGt	p.Y445C	NUF2_ENST00000367900.3_Missense_Mutation_p.Y445C|NUF2_ENST00000524800.1_Missense_Mutation_p.Y398C	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	445	Interaction with the C-terminus of NDC80 and the SPBC24-SPBC25 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					GAGGACTCCTATGCTAAGATA	0.348																																					p.Y445C		.											.	NUF2	231	0			c.A1334G						.						84.0	88.0	86.0					1																	163325198		2203	4300	6503	SO:0001583	missense	83540	exon14			ACTCCTATGCTAA	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1334A>G	1.37:g.163325198A>G	ENSP00000271452:p.Tyr445Cys	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	272.0	65.0	NM_145697	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	37	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	A	15.05	2.717779	0.48622	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.29655	1.56;1.56;1.56	5.11	-10.2	0.00374	.	2.319440	0.01322	N	0.010962	T	0.03305	0.0096	N	0.02011	-0.69	0.22961	N	0.998509	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25117	-1.0141	9	0.45353	T	0.12	8.6129	10.061	0.42275	0.2144:0.3045:0.4811:0.0	.	398;445	E9PQC4;Q9BZD4	.;NUF2_HUMAN	C	398;445;445	ENSP00000436888:Y398C;ENSP00000356875:Y445C;ENSP00000271452:Y445C	ENSP00000271452:Y445C	Y	+	2	0	NUF2	161591822	0.000000	0.05858	0.000000	0.03702	0.962000	0.63368	-0.478000	0.06575	-1.513000	0.01789	0.482000	0.46254	TAT	.		0.348	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697	
OPLAH	26873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	145112593	145112593	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr8:145112593C>T	ENST00000426825.1	-	10	1261	c.1180G>A	c.(1180-1182)Gct>Act	p.A394T	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	394					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACCAGATTAGCATCCGTCACT	0.647																																					p.A394T		.											.	OPLAH	68	0			c.G1180A						.						18.0	22.0	21.0					8																	145112593		2015	4154	6169	SO:0001583	missense	26873	exon10			GATTAGCATCCGT	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.1180G>A	8.37:g.145112593C>T	ENSP00000475943:p.Ala394Thr	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	22.0	NM_017570	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37		.	.	.	.	.	.	.	.	.	.	C	14.55	2.567423	0.45694	.	.	ENSG00000178814	ENST00000426825	.	.	.	4.31	4.31	0.51392	.	0.054782	0.64402	D	0.000001	T	0.77922	0.4203	.	.	.	0.44908	D	0.997921	D	0.69078	0.997	D	0.69654	0.965	D	0.84442	0.0583	7	0.87932	D	0	.	14.6309	0.68655	0.0:1.0:0.0:0.0	.	394	O14841	OPLA_HUMAN	T	394	.	ENSP00000412071:A394T	A	-	1	0	OPLAH	145184581	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	3.592000	0.53993	2.103000	0.63969	0.467000	0.42956	GCT	.		0.647	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
OPN4	94233	ucsc.edu;bcgsc.ca	37	10	88419195	88419195	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:88419195T>C	ENST00000241891.5	+	5	937	c.770T>C	c.(769-771)tTc>tCc	p.F257S	OPN4_ENST00000372071.2_Missense_Mutation_p.F268S	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	257					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						TGCTACATCTTCATCTTCAGG	0.622																																					p.F268S		.											.	OPN4	69	0			c.T803C						.						210.0	154.0	173.0					10																	88419195		2203	4300	6503	SO:0001583	missense	94233	exon6			ACATCTTCATCTT	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.770T>C	10.37:g.88419195T>C	ENSP00000241891:p.Phe257Ser	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_001030015	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	37	CCDS7376.1	.	.	.	.	.	.	.	.	.	.	T	15.15	2.747293	0.49257	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.37411	1.2;1.2;1.2	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.123002	0.53938	D	0.000048	T	0.38904	0.1058	M	0.66939	2.045	0.54753	D	0.99998	B;B;B	0.22003	0.037;0.037;0.063	B;B;B	0.28305	0.088;0.05;0.023	T	0.29488	-1.0010	10	0.48119	T	0.1	.	11.0014	0.47607	0.0:0.0754:0.0:0.9246	.	268;257;268	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	S	268;257;268	ENSP00000361141:F268S;ENSP00000241891:F257S;ENSP00000393132:F268S	ENSP00000241891:F257S	F	+	2	0	OPN4	88409175	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.713000	0.47194	1.942000	0.56320	0.533000	0.62120	TTC	.		0.622	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
OR13H1	347468	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	130678192	130678192	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:130678192A>G	ENST00000338616.3	+	1	243	c.145A>G	c.(145-147)Att>Gtt	p.I49V		NM_001004486.1	NP_001004486.1	Q8NG92	O13H1_HUMAN	olfactory receptor, family 13, subfamily H, member 1	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15	Acute lymphoblastic leukemia(192;0.000636)					GATCTTTCTTATTCACTTTGA	0.408																																					p.I49V		.											.	OR13H1	108	0			c.A145G						.						206.0	170.0	182.0					X																	130678192		2203	4300	6503	SO:0001583	missense	347468	exon1			TTTCTTATTCACT		CCDS35396.1	Xq26.2	2012-08-23			ENSG00000171054	ENSG00000171054		"""GPCR / Class A : Olfactory receptors"""	14755	protein-coding gene	gene with protein product							Standard	NM_001004486		Approved		uc011muw.2	Q8NG92	OTTHUMG00000022411	ENST00000338616.3:c.145A>G	X.37:g.130678192A>G	ENSP00000340748:p.Ile49Val	Somatic	210.0	1.0		WXS	Illumina HiSeq	Phase_I	243.0	89.0	NM_001004486	B2RNQ3|Q6IET8|Q96R12	Missense_Mutation	SNP	ENST00000338616.3	37	CCDS35396.1	.	.	.	.	.	.	.	.	.	.	A	0.067	-1.211588	0.01555	.	.	ENSG00000171054	ENST00000338616	T	0.06687	3.27	4.79	-0.705	0.11252	GPCR, rhodopsin-like superfamily (1);	0.178877	0.26334	N	0.024978	T	0.03434	0.0099	N	0.11892	0.195	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.37798	-0.9690	10	0.27785	T	0.31	.	3.2749	0.06894	0.5501:0.0:0.2004:0.2495	.	49	Q8NG92	O13H1_HUMAN	V	49	ENSP00000340748:I49V	ENSP00000340748:I49V	I	+	1	0	OR13H1	130505873	0.037000	0.19845	0.001000	0.08648	0.001000	0.01503	0.581000	0.23819	-0.422000	0.07405	0.486000	0.48141	ATT	.		0.408	OR13H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058297.1		
OR1N1	138883	ucsc.edu;bcgsc.ca	37	9	125288752	125288752	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:125288752G>T	ENST00000304880.2	-	1	820	c.821C>A	c.(820-822)gCa>gAa	p.A274E		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						GGTGTACATTGCAGCTGCTGC	0.507																																					p.A274E		.											.	OR1N1	133	0			c.C821A						.						109.0	100.0	103.0					9																	125288752		2203	4300	6503	SO:0001583	missense	138883	exon1			TACATTGCAGCTG	U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.821C>A	9.37:g.125288752G>T	ENSP00000306974:p.Ala274Glu	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_012363	A3KFM1|O43870|Q6IF16|Q96R93	Missense_Mutation	SNP	ENST00000304880.2	37	CCDS6844.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.304174	0.81136	.	.	ENSG00000171505	ENST00000304880	T	0.00130	8.69	3.62	-3.48	0.04739	GPCR, rhodopsin-like superfamily (1);	0.287198	0.18461	U	0.140529	T	0.00178	0.0005	L	0.37697	1.125	0.09310	N	1	P	0.48998	0.918	P	0.52514	0.701	T	0.44651	-0.9314	10	0.87932	D	0	.	11.0812	0.48062	0.7919:0.0:0.2081:0.0	.	274	Q8NGS0	OR1N1_HUMAN	E	274	ENSP00000306974:A274E	ENSP00000306974:A274E	A	-	2	0	OR1N1	124328573	0.000000	0.05858	0.000000	0.03702	0.955000	0.61496	0.064000	0.14437	-0.634000	0.05538	0.447000	0.29281	GCA	.		0.507	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053938.1		
OR8H1	219469	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	56057883	56057883	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:56057883G>T	ENST00000313022.2	-	1	683	c.656C>A	c.(655-657)tCc>tAc	p.S219Y		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	219						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					AGAGAGAATGGACACATAGGA	0.423																																					p.S219Y		.											.	OR8H1	71	0			c.C656A						.						147.0	134.0	139.0					11																	56057883		2201	4293	6494	SO:0001583	missense	219469	exon1			AGAATGGACACAT	AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.656C>A	11.37:g.56057883G>T	ENSP00000323595:p.Ser219Tyr	Somatic	79.0	1.0		WXS	Illumina HiSeq	Phase_I	98.0	39.0	NM_001005199	B2RNI7|Q6IFC5	Missense_Mutation	SNP	ENST00000313022.2	37	CCDS31526.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.616632	0.00118	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.00069	8.77	3.81	-6.88	0.01665	GPCR, rhodopsin-like superfamily (1);	0.527880	0.17730	N	0.163933	T	0.00073	0.0002	N	0.11560	0.145	0.09310	N	1	B	0.09022	0.002	B	0.18263	0.021	T	0.38802	-0.9644	10	0.36615	T	0.2	.	2.4203	0.04447	0.2028:0.0936:0.5039:0.1997	.	219	Q8NGG4	OR8H1_HUMAN	Y	219;215	ENSP00000323595:S219Y	ENSP00000323595:S219Y	S	-	2	0	OR8H1	55814459	0.000000	0.05858	0.015000	0.15790	0.006000	0.05464	-3.777000	0.00369	-0.927000	0.03766	-2.014000	0.00435	TCC	.		0.423	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370019.1	NM_001005199	
PABPC3	5042	ucsc.edu;bcgsc.ca	37	13	25671638	25671638	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr13:25671638G>T	ENST00000281589.3	+	1	1339	c.1302G>T	c.(1300-1302)caG>caT	p.Q434H		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	434					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GGACTGCTCAGGGTGCCAGAC	0.502																																					p.Q434H		.											.	PABPC3	72	0			c.G1302T						.						160.0	155.0	156.0					13																	25671638		2203	4300	6503	SO:0001583	missense	5042	exon1			TGCTCAGGGTGCC	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1302G>T	13.37:g.25671638G>T	ENSP00000281589:p.Gln434His	Somatic	65.0	0.0		WXS	Illumina HiSeq	.	53.0	5.0	NM_030979	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	G	7.347	0.622144	0.14193	.	.	ENSG00000151846	ENST00000281589	T	0.33865	1.39	0.875	0.875	0.19130	.	0.000000	0.45126	U	0.000389	T	0.29684	0.0741	M	0.65498	2.005	0.40157	D	0.97701	B	0.15719	0.014	B	0.15484	0.013	T	0.21930	-1.0231	10	0.56958	D	0.05	.	3.1832	0.06592	0.3106:0.0:0.6894:0.0	.	434	Q9H361	PABP3_HUMAN	H	434	ENSP00000281589:Q434H	ENSP00000281589:Q434H	Q	+	3	2	PABPC3	24569638	1.000000	0.71417	0.973000	0.42090	0.035000	0.12851	1.071000	0.30666	0.759000	0.33084	0.313000	0.20887	CAG	.		0.502	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
PAN2	9924	ucsc.edu;bcgsc.ca	37	12	56713721	56713721	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:56713721G>A	ENST00000425394.2	-	21	3261	c.2885C>T	c.(2884-2886)cCa>cTa	p.P962L	PAN2_ENST00000549090.1_5'Flank|PAN2_ENST00000440411.3_Missense_Mutation_p.P958L|PAN2_ENST00000548043.1_Missense_Mutation_p.P962L|PAN2_ENST00000257931.5_Missense_Mutation_p.P961L	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	CAGCATCAGTGGAATAAAGGT	0.507																																					p.P962L		.											.	PAN2	702	0			c.C2885T						.						155.0	127.0	136.0					12																	56713721		2203	4300	6503	SO:0001583	missense	9924	exon21			ATCAGTGGAATAA	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.2885C>T	12.37:g.56713721G>A	ENSP00000401721:p.Pro962Leu	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001127460		Missense_Mutation	SNP	ENST00000425394.2	37	CCDS44922.1	.	.	.	.	.	.	.	.	.	.	G	31	5.090033	0.94149	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	5.66	5.66	0.87406	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.50069	0.1594	M	0.81942	2.565	0.80722	D	1	P;P;P	0.49862	0.926;0.929;0.879	P;P;P	0.58210	0.835;0.771;0.766	T	0.33803	-0.9854	10	0.27785	T	0.31	-11.0945	18.9159	0.92506	0.0:0.0:1.0:0.0	.	961;958;962	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	L	962;958;961;962	ENSP00000401721:P962L;ENSP00000388231:P958L;ENSP00000257931:P961L;ENSP00000449861:P962L	ENSP00000257931:P961L	P	-	2	0	PAN2	54999988	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.704000	0.98716	2.840000	0.97914	0.655000	0.94253	CCA	.		0.507	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
PAPL	390928	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	39591841	39591841	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:39591841A>G	ENST00000331256.5	+	9	1241	c.967A>G	c.(967-969)Aaa>Gaa	p.K323E	PAPL_ENST00000594229.1_Silent_p.T281T	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		323						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)										TCTTTTCTACAAATATGGTGA	0.592																																					p.K323E		.											.	.	.	0			c.A967G						.						57.0	51.0	53.0					19																	39591841		2203	4300	6503	SO:0001583	missense	0	exon9			TTCTACAAATATG																												ENST00000331256.5:c.967A>G	19.37:g.39591841A>G	ENSP00000327557:p.Lys323Glu	Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	19.0	NM_001004318	B2RN68	Missense_Mutation	SNP	ENST00000331256.5	37	CCDS33018.1	.	.	.	.	.	.	.	.	.	.	A	10.58	1.391181	0.25118	.	.	ENSG00000183760	ENST00000331256	D	0.85339	-1.97	5.71	4.69	0.59074	Metallophosphoesterase domain (1);	0.362254	0.32518	N	0.005987	T	0.78470	0.4288	L	0.31420	0.93	0.29535	N	0.852517	B	0.30563	0.285	B	0.36719	0.231	T	0.70085	-0.4969	10	0.24483	T	0.36	-9.5651	11.2709	0.49138	0.8468:0.1532:0.0:0.0	.	323	Q6ZNF0	PAPL_HUMAN	E	323	ENSP00000327557:K323E	ENSP00000327557:K323E	K	+	1	0	AC011443.1	44283681	1.000000	0.71417	0.845000	0.33349	0.625000	0.37756	4.564000	0.60830	0.964000	0.38108	0.533000	0.62120	AAA	.		0.592	PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463810.1		
PC	5091	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66618382	66618382	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:66618382G>A	ENST00000393958.2	-	17	2329	c.2236C>T	c.(2236-2238)Ctg>Ttg	p.L746L	PC_ENST00000393960.1_Silent_p.L746L|PC_ENST00000529047.1_5'Flank|PC_ENST00000528224.1_5'Flank|PC_ENST00000393955.2_Silent_p.L746L	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	746	Carboxyltransferase.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GGCTTCAGCAGCCCGGCCATG	0.667																																					p.L746L		.											.	PC	228	0			c.C2236T						.						32.0	37.0	36.0					11																	66618382		2200	4293	6493	SO:0001819	synonymous_variant	5091	exon17			TCAGCAGCCCGGC	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.2236C>T	11.37:g.66618382G>A		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	17.0	NM_000920	B4DN00|Q16705	Silent	SNP	ENST00000393958.2	37	CCDS8152.1																																																																																			.		0.667	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
PATE1	160065	ucsc.edu;bcgsc.ca	37	11	125616219	125616219	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:125616219T>C	ENST00000305738.5	+	1	32	c.20T>C	c.(19-21)cTg>cCg	p.L7P	PATE1_ENST00000437148.2_Missense_Mutation_p.L7P	NM_138294.2	NP_612151.1	Q8WXA2	PATE1_HUMAN	prostate and testis expressed 1	7						extracellular region (GO:0005576)				large_intestine(1)|lung(5)	6						tccctcttgctggaactcccc	0.532																																					p.L7P		.											.	PATE1	90	0			c.T20C						.						175.0	155.0	162.0					11																	125616219		2201	4299	6500	SO:0001583	missense	160065	exon1			TCTTGCTGGAACT	AF462605	CCDS8464.1	11q24.2	2008-12-17				ENSG00000171053		"""PATE family"""	24664	protein-coding gene	gene with protein product	"""expressed in prostate and testis"""	606861				11880645, 15798027	Standard	NM_138294		Approved	PATE	uc001qct.3	Q8WXA2		ENST00000305738.5:c.20T>C	11.37:g.125616219T>C	ENSP00000307164:p.Leu7Pro	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	54.0	5.0	NM_138294	Q3KNX2	Missense_Mutation	SNP	ENST00000305738.5	37	CCDS8464.1	.	.	.	.	.	.	.	.	.	.	T	3.773	-0.047316	0.07407	.	.	ENSG00000171053	ENST00000305738;ENST00000437148	T;T	0.37058	1.22;1.22	3.94	1.58	0.23477	.	0.641613	0.11989	N	0.509977	T	0.23289	0.0563	N	0.24115	0.695	0.19300	N	0.999979	B;B	0.27498	0.18;0.18	B;B	0.31442	0.13;0.13	T	0.28267	-1.0049	10	0.87932	D	0	0.3379	3.9771	0.09479	0.0:0.1119:0.2157:0.6724	.	7;7	Q8WXA2-2;Q8WXA2	.;PATE1_HUMAN	P	7	ENSP00000307164:L7P;ENSP00000396056:L7P	ENSP00000307164:L7P	L	+	2	0	PATE1	125121429	0.000000	0.05858	0.002000	0.10522	0.079000	0.17450	0.043000	0.13971	0.319000	0.23209	0.533000	0.62120	CTG	.		0.532	PATE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386726.2	NM_138294	
PDCD11	22984	ucsc.edu;bcgsc.ca	37	10	105178381	105178381	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:105178381A>G	ENST00000369797.3	+	15	2190	c.2096A>G	c.(2095-2097)gAg>gGg	p.E699G		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	699	S1 motif 7. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		AGCCAGAGCGAGGGGCGTGTT	0.542																																					p.E699G		.											.	PDCD11	275	0			c.A2096G						.						67.0	52.0	57.0					10																	105178381		2203	4300	6503	SO:0001583	missense	22984	exon15			AGAGCGAGGGGCG	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.2096A>G	10.37:g.105178381A>G	ENSP00000358812:p.Glu699Gly	Somatic	40.0	1.0		WXS	Illumina HiSeq	.	31.0	5.0	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	A	5.806	0.333090	0.11013	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.10382	2.88	5.92	4.8	0.61643	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	0.432766	0.29087	N	0.013181	T	0.06781	0.0173	N	0.25647	0.755	0.09310	N	0.999997	B	0.06786	0.001	B	0.04013	0.001	T	0.35699	-0.9778	10	0.15952	T	0.53	-26.9282	7.1889	0.25814	0.8401:0.0:0.1599:0.0	.	699	Q14690	RRP5_HUMAN	G	699	ENSP00000358812:E699G	ENSP00000358812:E699G	E	+	2	0	PDCD11	105168371	1.000000	0.71417	0.155000	0.22561	0.030000	0.12068	5.583000	0.67484	2.268000	0.75426	0.454000	0.30748	GAG	.		0.542	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
PF4V1	5197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74719566	74719566	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:74719566G>A	ENST00000226524.3	+	2	341	c.167G>A	c.(166-168)aGg>aAg	p.R56K		NM_002620.2	NP_002611.1	P10720	PF4V_HUMAN	platelet factor 4 variant 1	56					cell chemotaxis (GO:0060326)|immune response (GO:0006955)	extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|liver(2)	3	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			GTCCGTCCCAGGCACATCACC	0.607																																					p.R56K		.											.	PF4V1	90	0			c.G167A						.						56.0	60.0	59.0					4																	74719566		2202	4296	6498	SO:0001583	missense	5197	exon2			GTCCCAGGCACAT	M26167	CCDS3561.1	4q12-q21	2008-08-15			ENSG00000109272	ENSG00000109272			8862	protein-coding gene	gene with protein product		173461				2725510	Standard	NM_002620		Approved	SCYB4V1, CXCL4V1, CXCL4L1	uc003hhg.1	P10720	OTTHUMG00000130177	ENST00000226524.3:c.167G>A	4.37:g.74719566G>A	ENSP00000226524:p.Arg56Lys	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	23.0	NM_002620	A1L4S0	Missense_Mutation	SNP	ENST00000226524.3	37	CCDS3561.1	.	.	.	.	.	.	.	.	.	.	G	0.799	-0.756074	0.03019	.	.	ENSG00000109272	ENST00000226524	T	0.04862	3.54	4.12	-4.36	0.03645	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.802256	0.11866	N	0.521853	T	0.02418	0.0074	N	0.04132	-0.27	0.09310	N	1	B	0.24651	0.108	B	0.28991	0.097	T	0.42515	-0.9447	10	0.02654	T	1	.	11.6031	0.51015	0.348:0.0:0.652:0.0	.	56	P10720	PF4V_HUMAN	K	56	ENSP00000226524:R56K	ENSP00000226524:R56K	R	+	2	0	PF4V1	74938430	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	0.038000	0.13862	-0.820000	0.04318	-0.768000	0.03414	AGG	.		0.607	PF4V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252495.1		
PIK3R4	30849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130427320	130427320	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:130427320T>A	ENST00000356763.3	-	10	2905	c.2348A>T	c.(2347-2349)gAg>gTg	p.E783V		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	783	Poly-Glu.				innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						TTTGTCTTCCTCTTCCTCTGT	0.358																																					p.E783V		.											.	PIK3R4	1471	0			c.A2348T						.						158.0	146.0	150.0					3																	130427320		2202	4300	6502	SO:0001583	missense	30849	exon10			TCTTCCTCTTCCT	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.2348A>T	3.37:g.130427320T>A	ENSP00000349205:p.Glu783Val	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	200.0	78.0	NM_014602	Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	37	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	T	12.99	2.103191	0.37145	.	.	ENSG00000196455	ENST00000356763;ENST00000508273	T;T	0.46451	0.87;0.89	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.38665	0.1049	L	0.51422	1.61	0.80722	D	1	B	0.19331	0.035	B	0.11329	0.006	T	0.15235	-1.0444	10	0.25751	T	0.34	-30.3496	15.4838	0.75548	0.0:0.0:0.0:1.0	.	783	Q99570	PI3R4_HUMAN	V	783;142	ENSP00000349205:E783V;ENSP00000427302:E142V	ENSP00000349205:E783V	E	-	2	0	PIK3R4	131910010	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.615000	0.83006	2.058000	0.61347	0.460000	0.39030	GAG	.		0.358	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
PIK3R5	23533	ucsc.edu;bcgsc.ca	37	17	8790506	8790506	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:8790506G>T	ENST00000447110.1	-	12	1936	c.1812C>A	c.(1810-1812)acC>acA	p.T604T	PIK3R5_ENST00000581552.1_Silent_p.T604T|PIK3R5_ENST00000584803.1_Silent_p.T604T	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	604					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						AGATGTCATTGGTGCTCTCCT	0.607																																					p.T604T	NSCLC(18;589 615 7696 20311 50332)	.											.	PIK3R5	1146	0			c.C1812A						.						150.0	108.0	122.0					17																	8790506		2203	4300	6503	SO:0001819	synonymous_variant	23533	exon12			GTCATTGGTGCTC	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.1812C>A	17.37:g.8790506G>T		Somatic	70.0	0.0		WXS	Illumina HiSeq	.	30.0	5.0	NM_001142633	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Silent	SNP	ENST00000447110.1	37	CCDS11147.1																																																																																			.		0.607	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	NM_014308	
PLCL1	5334	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	198950752	198950752	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:198950752G>A	ENST00000428675.1	+	2	2909	c.2511G>A	c.(2509-2511)gaG>gaA	p.E837E	PLCL1_ENST00000437704.2_Silent_p.E739E	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	837					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	ACATCATGGAGCACGTAACCC	0.463																																					p.E837E		.											.	PLCL1	228	0			c.G2511A						.						179.0	150.0	160.0					2																	198950752		2203	4300	6503	SO:0001819	synonymous_variant	5334	exon2			CATGGAGCACGTA	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2511G>A	2.37:g.198950752G>A		Somatic	127.0	1.0		WXS	Illumina HiSeq	Phase_I	112.0	47.0	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Silent	SNP	ENST00000428675.1	37	CCDS2326.2																																																																																			.		0.463	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
PLEKHG1	57480	ucsc.edu;bcgsc.ca	37	6	151152713	151152713	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:151152713G>A	ENST00000358517.2	+	15	2677	c.2466G>A	c.(2464-2466)atG>atA	p.M822I	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.M822I			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	822							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ACTTGTCTATGCCTCATAAGC	0.463																																					p.M822I		.											.	PLEKHG1	92	0			c.G2466A						.						133.0	135.0	134.0					6																	151152713		2203	4300	6503	SO:0001583	missense	57480	exon16			GTCTATGCCTCAT	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.2466G>A	6.37:g.151152713G>A	ENSP00000351318:p.Met822Ile	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-2.945327	0.00052	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.56776	0.44;0.44	3.74	-7.49	0.01355	.	1.732920	0.02692	N	0.110817	T	0.03263	0.0095	N	0.00538	-1.39	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.04386	-1.0955	10	0.07990	T	0.79	.	3.4856	0.07618	0.1631:0.3668:0.353:0.1172	.	629;822;822	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	I	822	ENSP00000356297:M822I;ENSP00000351318:M822I	ENSP00000351318:M822I	M	+	3	0	PLEKHG1	151194406	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.076000	0.00300	-2.239000	0.00711	-1.081000	0.02215	ATG	.		0.463	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
PLIN2	123	ucsc.edu;bcgsc.ca	37	9	19126218	19126218	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:19126218A>G	ENST00000276914.2	-	3	299	c.120T>C	c.(118-120)taT>taC	p.Y40Y	PLIN2_ENST00000380465.3_Silent_p.Y40Y|PLIN2_ENST00000411567.1_Silent_p.Y40Y|PLIN2_ENST00000380464.3_Silent_p.Y40Y	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	40					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						TCAGGTAGGGATACTGGTCCT	0.537																																					p.Y40Y		.											.	PLIN2	92	0			c.T120C						.						179.0	133.0	149.0					9																	19126218		2203	4300	6503	SO:0001819	synonymous_variant	123	exon3			GTAGGGATACTGG	X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.120T>C	9.37:g.19126218A>G		Somatic	37.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001122	Q9BSC3	Silent	SNP	ENST00000276914.2	37	CCDS6490.1																																																																																			.		0.537	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051835.1	NM_001122	
PLOD1	5351	ucsc.edu;bcgsc.ca	37	1	12027091	12027091	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:12027091T>C	ENST00000196061.4	+	16	1725	c.1698T>C	c.(1696-1698)tgT>tgC	p.C566C	PLOD1_ENST00000376369.3_Silent_p.C613C	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	566					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	AGGTGGCCTGTGATGAGCTGG	0.632																																					p.C566C		.											.	PLOD1	155	0			c.T1698C						.						151.0	137.0	142.0					1																	12027091		2203	4300	6503	SO:0001819	synonymous_variant	5351	exon16			GGCCTGTGATGAG	BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1698T>C	1.37:g.12027091T>C		Somatic	99.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_000302	B4DR87|Q96AV9|Q9H132	Silent	SNP	ENST00000196061.4	37	CCDS142.1																																																																																			.		0.632	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	NM_000302	
PLXDC1	57125	ucsc.edu;bcgsc.ca	37	17	37263727	37263727	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:37263727T>C	ENST00000315392.4	-	6	855	c.644A>G	c.(643-645)gAc>gGc	p.D215G	PLXDC1_ENST00000444911.2_Missense_Mutation_p.D175G|PLXDC1_ENST00000394316.2_Missense_Mutation_p.D215G|PLXDC1_ENST00000493200.1_5'UTR|PLXDC1_ENST00000539608.1_Missense_Mutation_p.D142G	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	215					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						ACTGCCCTTGTCTTCCCAGCC	0.572																																					p.D215G		.											.	PLXDC1	93	0			c.A644G						.						88.0	75.0	79.0					17																	37263727		2203	4300	6503	SO:0001583	missense	57125	exon6			CCCTTGTCTTCCC	AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.644A>G	17.37:g.37263727T>C	ENSP00000323927:p.Asp215Gly	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_020405	B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	ENST00000315392.4	37	CCDS11333.1	.	.	.	.	.	.	.	.	.	.	T	14.98	2.696581	0.48202	.	.	ENSG00000161381	ENST00000315392;ENST00000394318;ENST00000539608;ENST00000444911;ENST00000394316;ENST00000441877	T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99	5.25	4.16	0.48862	.	0.382752	0.27068	N	0.021086	T	0.63827	0.2544	L	0.42245	1.32	0.48762	D	0.9997	P	0.42456	0.78	B	0.38106	0.265	T	0.64402	-0.6416	10	0.37606	T	0.19	-37.1607	10.2094	0.43132	0.0:0.081:0.0:0.919	.	215	Q8IUK5	PXDC1_HUMAN	G	215;142;142;175;215;142	ENSP00000323927:D215G;ENSP00000441881:D142G;ENSP00000409687:D175G;ENSP00000377851:D215G;ENSP00000393227:D142G	ENSP00000323927:D215G	D	-	2	0	PLXDC1	34517253	0.440000	0.25618	1.000000	0.80357	0.866000	0.49608	2.147000	0.42226	1.988000	0.58038	0.459000	0.35465	GAC	.		0.572	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256892.2	NM_020405	
PPM1H	57460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	63083509	63083509	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:63083509G>A	ENST00000228705.6	-	8	1515	c.1215C>T	c.(1213-1215)taC>taT	p.Y405Y	PPM1H_ENST00000551214.1_5'UTR	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	405	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		ATGGTTTAATGTAGATGTTGG	0.463																																					p.Y405Y		.											.	PPM1H	637	0			c.C1215T						.						97.0	96.0	96.0					12																	63083509		1898	4149	6047	SO:0001819	synonymous_variant	57460	exon8			TTTAATGTAGATG	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.1215C>T	12.37:g.63083509G>A		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	15.0	NM_020700	B1Q2A9|B2RXG4|Q6PI86	Silent	SNP	ENST00000228705.6	37	CCDS44934.1																																																																																			.		0.463	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700	
PRMT6	55170	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	107599362	107599362	+	Missense_Mutation	SNP	C	C	T	rs539124873	byFrequency	TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:107599362C>T	ENST00000370078.1	+	1	62	c.25C>T	c.(25-27)Ctt>Ttt	p.L9F	PRMT6_ENST00000361318.5_5'UTR			Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	9					base-excision repair (GO:0006284)|histone H3-R2 methylation (GO:0034970)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	histone binding (GO:0042393)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H2A-R3 specific) (GO:0070612)|histone methyltransferase activity (H3-R2 specific) (GO:0070611)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)			biliary_tract(1)|breast(2)|kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	14		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		GAAAAGAAAGCTTGAGTCGGG	0.706																																					p.L9F		.											.	PRMT6	90	0			c.C25T						.						8.0	12.0	11.0					1																	107599362		683	1578	2261	SO:0001583	missense	55170	exon1			AGAAAGCTTGAGT	AK001421	CCDS41360.1, CCDS41360.2	1p13.2	2008-02-05	2006-02-16	2006-02-16	ENSG00000198890	ENSG00000198890		"""Protein arginine methyltransferases"""	18241	protein-coding gene	gene with protein product		608274	"""HMT1 hnRNP methyltransferase-like 6 (S. cerevisiae)"""	HRMT1L6		11724789	Standard	NM_018137		Approved	FLJ10559	uc010ous.2	Q96LA8	OTTHUMG00000010964	ENST00000370078.1:c.25C>T	1.37:g.107599362C>T	ENSP00000359095:p.Leu9Phe	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	14.0	NM_018137	A3KME1|B4DID8|Q5T5Y5|Q6DKI4|Q9NVR8	Missense_Mutation	SNP	ENST00000370078.1	37	CCDS41360.2	.	.	.	.	.	.	.	.	.	.	C	15.87	2.961994	0.53400	.	.	ENSG00000198890	ENST00000370078	T	0.26810	1.71	4.85	0.326	0.15908	.	3.494140	0.01036	N	0.004231	T	0.03739	0.0106	N	0.08118	0	0.80722	D	1	B	0.34015	0.435	B	0.24269	0.052	T	0.35226	-0.9797	10	0.38643	T	0.18	-9.5259	2.4087	0.04419	0.3624:0.3819:0.1583:0.0973	.	9	Q96LA8	ANM6_HUMAN	F	9	ENSP00000359095:L9F	ENSP00000359095:L9F	L	+	1	0	PRMT6	107400885	0.999000	0.42202	0.992000	0.48379	0.871000	0.50021	0.653000	0.24902	0.214000	0.20742	-0.332000	0.08345	CTT	.		0.706	PRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030185.1	NM_018137	
PRPF38B	55119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109242492	109242492	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:109242492T>C	ENST00000370025.4	+	6	1760	c.1491T>C	c.(1489-1491)tcT>tcC	p.S497S	PRPF38B_ENST00000370021.1_Silent_p.S386S	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	497					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		AAGAAAAATCTAGAAAGCGTA	0.398																																					p.S497S		.											.	PRPF38B	90	0			c.T1491C						.						115.0	115.0	115.0					1																	109242492		2203	4300	6503	SO:0001819	synonymous_variant	55119	exon6			AAAATCTAGAAAG	AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.1491T>C	1.37:g.109242492T>C		Somatic	183.0	0.0		WXS	Illumina HiSeq	Phase_I	206.0	75.0	NM_018061	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Silent	SNP	ENST00000370025.4	37	CCDS788.1																																																																																			.		0.398	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030231.1	NM_018061	
PRPF8	10594	ucsc.edu;bcgsc.ca	37	17	1561917	1561917	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:1561917T>A	ENST00000572621.1	-	32	5544	c.5279A>T	c.(5278-5280)gAg>gTg	p.E1760V	PRPF8_ENST00000304992.6_Missense_Mutation_p.E1760V			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1760	Involved in interaction with pre-mRNA 5' splice site.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CAAATAAGGCTCAGTGGGTTC	0.483																																					p.E1760V		.											.	PRPF8	525	0			c.A5279T						.						138.0	125.0	130.0					17																	1561917		2203	4300	6503	SO:0001583	missense	10594	exon33			TAAGGCTCAGTGG	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.5279A>T	17.37:g.1561917T>A	ENSP00000460348:p.Glu1760Val	Somatic	77.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	t	18.20	3.570538	0.65765	.	.	ENSG00000174231	ENST00000304992;ENST00000540177	D	0.83163	-1.69	5.91	5.91	0.95273	PRP8 domain IV core (1);	0.000000	0.85682	D	0.000000	D	0.92496	0.7617	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93648	0.6970	10	0.72032	D	0.01	.	16.3426	0.83092	0.0:0.0:0.0:1.0	.	1760	Q6P2Q9	PRP8_HUMAN	V	1760;285	ENSP00000304350:E1760V	ENSP00000304350:E1760V	E	-	2	0	PRPF8	1508667	1.000000	0.71417	1.000000	0.80357	0.022000	0.10575	8.040000	0.89188	2.263000	0.75096	0.379000	0.24179	GAG	.		0.483	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
DIP2C	22982	ucsc.edu;bcgsc.ca	37	10	708851	708851	+	Intron	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:708851C>A	ENST00000280886.6	-	1	173				RP11-809C18.5_ENST00000443662.1_RNA|PRR26_ENST00000381489.5_Silent_p.L182L	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)							nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TGAACACTCTCGGGAGAGGTG	0.532																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	414235	.			CACTCTCGGGAGA	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.85+26582G>T	10.37:g.708851C>A		Somatic	112.0	0.0		WXS	Illumina HiSeq	.	73.0	7.0	.	B4DPI5|Q5SS78	RNA	SNP	ENST00000280886.6	37	CCDS7054.1																																																																																			.		0.532	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
PSMD11	5717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	30806343	30806343	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:30806343C>T	ENST00000261712.3	+	10	1250	c.987C>T	c.(985-987)aaC>aaT	p.N329N	PSMD11_ENST00000457654.2_Silent_p.N329N	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	329	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TGTATGATAACTTACTAGAAC	0.498																																					p.N329N	Ovarian(130;1038 1716 9294 11987 19279)	.											.	PSMD11	91	0			c.C987T						.						151.0	143.0	146.0					17																	30806343		2203	4300	6503	SO:0001819	synonymous_variant	5717	exon10			TGATAACTTACTA	AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.987C>T	17.37:g.30806343C>T		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	20.0	NM_002815	A8K3I7|E1P663|O00495|Q53FT5	Silent	SNP	ENST00000261712.3	37	CCDS11272.1	.	.	.	.	.	.	.	.	.	.	C	9.790	1.177547	0.21787	.	.	ENSG00000108671	ENST00000457654	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	T	0.72447	0.3461	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69822	-0.5041	4	.	.	.	-12.4301	16.7464	0.85473	0.0:1.0:0.0:0.0	.	.	.	.	F	67	.	.	L	+	1	0	PSMD11	27830456	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.803000	0.55560	2.826000	0.97356	0.561000	0.74099	CTT	.		0.498	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256252.2	NM_002815	
PSTPIP1	9051	ucsc.edu;bcgsc.ca	37	15	77310573	77310573	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:77310573G>A	ENST00000558012.1	+	2	610	c.121G>A	c.(121-123)Gag>Aag	p.E41K	PSTPIP1_ENST00000559295.1_Missense_Mutation_p.E41K|PSTPIP1_ENST00000267939.5_Missense_Mutation_p.E40K|PSTPIP1_ENST00000379595.3_Missense_Mutation_p.E41K	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	41	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						AGACATGGAGGAGCTACTGAG	0.642																																					p.E41K		.											.	PSTPIP1	23	0			c.G121A						.						31.0	38.0	35.0					15																	77310573		2155	4237	6392	SO:0001583	missense	9051	exon2			ATGGAGGAGCTAC	U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.121G>A	15.37:g.77310573G>A	ENSP00000452746:p.Glu41Lys	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_003978	B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	ENST00000558012.1	37	CCDS45312.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787754	0.70337	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.15952	2.38;2.38	4.35	4.35	0.52113	Fps/Fes/Fer/CIP4 homology (3);Prismane-like (1);	0.127420	0.52532	D	0.000070	T	0.34454	0.0898	L	0.58428	1.81	0.53005	D	0.999966	P;D;D;D	0.67145	0.952;0.996;0.989;0.986	P;D;P;D	0.63703	0.839;0.917;0.829;0.911	T	0.03852	-1.0998	10	0.28530	T	0.3	-18.5289	16.0206	0.80486	0.0:0.0:1.0:0.0	.	41;40;41;41	O43586-2;C9K004;B4E1Z9;O43586	.;.;.;PPIP1_HUMAN	K	41;40	ENSP00000368914:E41K;ENSP00000267939:E40K	ENSP00000267939:E40K	E	+	1	0	PSTPIP1	75097628	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.511000	0.81718	2.137000	0.66172	0.491000	0.48974	GAG	.		0.642	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978	
PTPDC1	138639	ucsc.edu;bcgsc.ca	37	9	96860152	96860152	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:96860152T>C	ENST00000375360.3	+	7	1482	c.1142T>C	c.(1141-1143)cTt>cCt	p.L381P	PTPDC1_ENST00000288976.3_Missense_Mutation_p.L433P	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	381					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						GTTGAGTGCCTTCAACCCCTG	0.507																																					p.L435P		.											.	PTPDC1	227	0			c.T1304C						.						62.0	66.0	65.0					9																	96860152		2203	4300	6503	SO:0001583	missense	138639	exon6			AGTGCCTTCAACC	BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.1142T>C	9.37:g.96860152T>C	ENSP00000364509:p.Leu381Pro	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_001253829	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	37	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	.	17.30	3.355021	0.61293	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.14766	2.48;2.5	5.52	5.52	0.82312	.	0.213871	0.40469	N	0.001088	T	0.39200	0.1069	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.78314	0.98;0.991;0.957;0.98	T	0.28427	-1.0044	10	0.72032	D	0.01	-13.5184	14.8375	0.70194	0.0:0.0:0.0:1.0	.	435;433;435;381	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	P	381;433	ENSP00000364509:L381P;ENSP00000288976:L433P	ENSP00000288976:L433P	L	+	2	0	PTPDC1	95899973	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.787000	0.62432	2.100000	0.63781	0.533000	0.62120	CTT	.		0.507	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422	
PTPN13	5783	ucsc.edu;bcgsc.ca	37	4	87684048	87684048	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:87684048A>G	ENST00000411767.2	+	24	3785	c.3722A>G	c.(3721-3723)gAa>gGa	p.E1241G	PTPN13_ENST00000427191.2_Missense_Mutation_p.E1222G|PTPN13_ENST00000511467.1_Missense_Mutation_p.E1241G|PTPN13_ENST00000316707.6_Missense_Mutation_p.E1050G|PTPN13_ENST00000436978.1_Missense_Mutation_p.E1241G			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1241					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GGCCTGCGGGAAGGAAGCCTG	0.532																																					p.E1241G		.											.	PTPN13	230	0			c.A3722G						.						81.0	83.0	82.0					4																	87684048		1894	4116	6010	SO:0001583	missense	5783	exon24			TGCGGGAAGGAAG		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.3722A>G	4.37:g.87684048A>G	ENSP00000407249:p.Glu1241Gly	Somatic	55.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_080683	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.458306	0.84317	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.54479	0.57;0.57;0.69;0.57;0.57	5.47	5.47	0.80525	.	0.117372	0.37857	N	0.001918	T	0.52549	0.1741	L	0.59436	1.845	0.41991	D	0.990843	P;P;P;P	0.46142	0.873;0.481;0.745;0.835	B;B;B;B	0.42361	0.385;0.228;0.164;0.311	T	0.55347	-0.8155	10	0.38643	T	0.18	.	15.5586	0.76219	1.0:0.0:0.0:0.0	.	1050;1222;1241;1241	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	G	1222;1241;1050;1241;1241;1190	ENSP00000408368:E1222G;ENSP00000394794:E1241G;ENSP00000322675:E1050G;ENSP00000407249:E1241G;ENSP00000426626:E1241G	ENSP00000322675:E1050G	E	+	2	0	PTPN13	87903072	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.896000	0.63222	2.062000	0.61559	0.528000	0.53228	GAA	.		0.532	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
RAB12	201475	broad.mit.edu;bcgsc.ca	37	18	8633188	8633188	+	Splice_Site	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr18:8633188G>T	ENST00000329286.6	+	3	572	c.289G>T	c.(289-291)Gac>Tac	p.D97Y	RP11-661O13.1_ENST00000580267.1_RNA	NM_001025300.2	NP_001020471.2	Q6IQ22	RAB12_HUMAN	RAB12, member RAS oncogene family	97					autophagy (GO:0006914)|cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|recycling endosome membrane (GO:0055038)|secretory granule (GO:0030141)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			breast(1)|lung(4)|prostate(1)|urinary_tract(1)	7						TTTTCTTAGGGACACAGCAGG	0.408																																					p.D97Y		.											.	RAB12	68	0			c.G289T						.						132.0	128.0	130.0					18																	8633188		1942	4155	6097	SO:0001630	splice_region_variant	201475	exon3			CTTAGGGACACAG		CCDS42410.1	18p11.22	2006-12-18				ENSG00000206418		"""RAB, member RAS oncogene"""	31332	protein-coding gene	gene with protein product							Standard	NM_001025300		Approved		uc002knp.3	Q6IQ22		ENST00000329286.6:c.288-1G>T	18.37:g.8633188G>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	6.0	NM_001025300	A6NEF5|Q4KMQ3	Missense_Mutation	SNP	ENST00000329286.6	37	CCDS42410.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.896147	0.91962	.	.	ENSG00000206418	ENST00000329286	D	0.93859	-3.3	5.41	5.41	0.78517	Small GTP-binding protein domain (1);	0.000000	0.85682	U	0.000000	D	0.98614	0.9536	H	0.99842	4.835	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99222	1.0879	10	0.87932	D	0	.	19.3887	0.94570	0.0:0.0:1.0:0.0	.	97	Q6IQ22	RAB12_HUMAN	Y	97	ENSP00000331748:D97Y	ENSP00000331748:D97Y	D	+	1	0	RAB12	8623188	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.595000	0.98260	2.826000	0.97356	0.655000	0.94253	GAC	.		0.408	RAB12-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444080.1	XM_113967	Missense_Mutation
RAB25	57111	ucsc.edu;bcgsc.ca	37	1	156035736	156035736	+	Silent	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:156035736C>A	ENST00000361084.5	+	2	319	c.78C>A	c.(76-78)acC>acA	p.T26T	RAB25_ENST00000487325.1_Intron	NM_020387.2	NP_065120.2	P57735	RAB25_HUMAN	RAB25, member RAS oncogene family	26					positive regulation of cell proliferation (GO:0008284)|protein transport (GO:0015031)|pseudopodium organization (GO:0031268)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	Hepatocellular(266;0.158)|all_neural(408;0.195)					TGGGGAAGACCAATCTACTCT	0.587																																					p.T26T		.											.	RAB25	227	0			c.C78A						.						80.0	84.0	82.0					1																	156035736		2150	4258	6408	SO:0001819	synonymous_variant	57111	exon2			GAAGACCAATCTA	AF083124	CCDS41413.1	1q22	2008-07-03			ENSG00000132698	ENSG00000132698		"""RAB, member RAS oncogene"""	18238	protein-coding gene	gene with protein product		612942				11697911	Standard	NM_020387		Approved	CATX-8	uc001fnc.3	P57735	OTTHUMG00000017457	ENST00000361084.5:c.78C>A	1.37:g.156035736C>A		Somatic	37.0	0.0		WXS	Illumina HiSeq	.	44.0	5.0	NM_020387	Q5VYA2|Q8NG24|Q96GB1|Q9BT12	Silent	SNP	ENST00000361084.5	37	CCDS41413.1																																																																																			.		0.587	RAB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046185.1		
RAPSN	5913	ucsc.edu;bcgsc.ca	37	11	47463162	47463162	+	Splice_Site	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:47463162C>A	ENST00000298854.2	-	5	1126		c.e5+1		RAPSN_ENST00000524487.1_Missense_Mutation_p.V252L|RAPSN_ENST00000528356.1_Splice_Site|RAPSN_ENST00000352508.3_Intron|RAPSN_ENST00000529341.1_Intron|RNU6-1302P_ENST00000516518.1_RNA	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse						positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						CCCGACCTCACCTTGTCCAGC	0.647																																					.		.											.	RAPSN	91	0			c.912+1G>T						.						30.0	31.0	31.0					11																	47463162		2200	4297	6497	SO:0001630	splice_region_variant	5913	exon6			ACCTCACCTTGTC		CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.912+1G>T	11.37:g.47463162C>A		Somatic	63.0	0.0		WXS	Illumina HiSeq	.	57.0	5.0	NM_005055	Q8TDF3|Q9BTD9	Splice_Site	SNP	ENST00000298854.2	37	CCDS7936.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.6|22.6	4.317759|4.317759	0.81469|0.81469	.|.	.|.	ENSG00000165917|ENSG00000165917	ENST00000298854|ENST00000524487	.|D	.|0.93076	.|-3.16	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	.|.	.|.	.|.	.|.	.|D	.|0.96466	.|0.8847	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|D	.|0.96850	.|0.9624	.|6	.|0.72032	.|D	.|0.01	.|.	18.9204|18.9204	0.92523|0.92523	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|L	-1|252	.|ENSP00000435551:V252L	.|ENSP00000435551:V252L	.|V	-|-	.|1	.|0	RAPSN|RAPSN	47419738|47419738	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.919000|0.919000	0.55068|0.55068	7.484000|7.484000	0.81180|0.81180	2.445000|2.445000	0.82738|0.82738	0.563000|0.563000	0.77884|0.77884	.|GTG	.		0.647	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391726.1		Intron
RASGRF1	5923	ucsc.edu;bcgsc.ca	37	15	79339094	79339094	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:79339094A>G	ENST00000419573.3	-	5	1146	c.872T>C	c.(871-873)cTg>cCg	p.L291P	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.L291P	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	291	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TCACCTGTTCAGGAAGATGCT	0.577																																					p.L291P		.											.	RASGRF1	662	0			c.T872C						.						179.0	142.0	155.0					15																	79339094		2196	4293	6489	SO:0001583	missense	5923	exon5			CTGTTCAGGAAGA	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.872T>C	15.37:g.79339094A>G	ENSP00000405963:p.Leu291Pro	Somatic	81.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001145648	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.950663	0.73787	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.68181	-0.31	4.15	4.15	0.48705	Dbl homology (DH) domain (5);	0.323391	0.25546	N	0.029936	T	0.77068	0.4076	M	0.68317	2.08	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.992;0.989;0.982	T	0.75130	-0.3426	10	0.31617	T	0.26	.	11.1688	0.48558	1.0:0.0:0.0:0.0	.	291;291;291;291	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	P	291	ENSP00000405963:L291P	ENSP00000378224:L291P	L	-	2	0	RASGRF1	77126149	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	8.873000	0.92357	1.733000	0.51620	0.533000	0.62120	CTG	.		0.577	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
RBM48	84060	ucsc.edu;bcgsc.ca	37	7	92163819	92163819	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:92163819G>T	ENST00000265732.5	+	4	593	c.552G>T	c.(550-552)ttG>ttT	p.L184F	RBM48_ENST00000481551.1_Missense_Mutation_p.L184F	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48	184						nucleus (GO:0005634)	RNA binding (GO:0003723)										AAGCTGCTTTGAACACTTCTG	0.398																																					p.L184F		.											.	.	.	0			c.G552T						.						138.0	120.0	126.0					7																	92163819		1857	4098	5955	SO:0001583	missense	84060	exon4			TGCTTTGAACACT	AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.552G>T	7.37:g.92163819G>T	ENSP00000265732:p.Leu184Phe	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_032120	B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Missense_Mutation	SNP	ENST00000265732.5	37	CCDS43615.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315589	0.23908	.	.	ENSG00000127993	ENST00000265732;ENST00000481551;ENST00000450580	.	.	.	5.1	2.21	0.28008	.	1.170500	0.06147	N	0.673489	T	0.26629	0.0651	L	0.40543	1.245	0.09310	N	1	P;B	0.38582	0.638;0.306	B;B	0.31191	0.125;0.125	T	0.20107	-1.0285	9	0.39692	T	0.17	.	6.8369	0.23941	0.306:0.0:0.694:0.0	.	184;184	B7Z2K5;Q5RL73	.;CG064_HUMAN	F	184	.	ENSP00000265732:L184F	L	+	3	2	C7orf64	92001755	0.280000	0.24249	0.003000	0.11579	0.015000	0.08874	0.520000	0.22878	0.711000	0.32018	0.591000	0.81541	TTG	.		0.398	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356076.1	NM_032120	
RC3H1	149041	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	173912722	173912722	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:173912722T>C	ENST00000367696.2	-	18	3344	c.2993A>G	c.(2992-2994)gAg>gGg	p.E998G	RC3H1_ENST00000367694.2_Missense_Mutation_p.E989G|RC3H1_ENST00000258349.4_Missense_Mutation_p.E998G			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	998					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						GGTGTTTGCCTCCCTCTGCAA	0.537																																					p.E998G		.											.	RC3H1	92	0			c.A2993G						.						96.0	83.0	87.0					1																	173912722		2203	4300	6503	SO:0001583	missense	149041	exon17			TTTGCCTCCCTCT	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2993A>G	1.37:g.173912722T>C	ENSP00000356669:p.Glu998Gly	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	6.0	NM_172071	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.687593	0.88639	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.55760	0.5;0.5;0.64	5.58	5.58	0.84498	.	0.045518	0.85682	D	0.000000	T	0.50429	0.1615	L	0.58101	1.795	0.80722	D	1	P;P;P;P	0.49559	0.877;0.877;0.925;0.877	B;B;P;B	0.49752	0.417;0.417;0.621;0.417	T	0.58216	-0.7675	10	0.87932	D	0	-9.1298	15.756	0.78025	0.0:0.0:0.0:1.0	.	998;989;989;998	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	G	998;998;989	ENSP00000356669:E998G;ENSP00000258349:E998G;ENSP00000356667:E989G	ENSP00000258349:E998G	E	-	2	0	RC3H1	172179345	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.685000	0.84117	2.131000	0.65755	0.533000	0.62120	GAG	.		0.537	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071	
RELB	5971	ucsc.edu;bcgsc.ca	37	19	45525332	45525332	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:45525332C>T	ENST00000221452.8	+	5	676	c.526C>T	c.(526-528)Cgg>Tgg	p.R176W	RELB_ENST00000540120.1_Missense_Mutation_p.R176W|RELB_ENST00000505236.1_Missense_Mutation_p.R173W	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	176	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		TGGAGGGCTGCGGGAGGTGGA	0.637																																					.		.											.	RELB	847	0			.						.						33.0	42.0	39.0					19																	45525332		2018	4181	6199	SO:0001583	missense	5971	.			GGGCTGCGGGAGG	M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.526C>T	19.37:g.45525332C>T	ENSP00000221452:p.Arg176Trp	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	.	Q6GTX7|Q9UEI7	Missense_Mutation	SNP	ENST00000221452.8	37	CCDS46110.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665025	0.67700	.	.	ENSG00000104856	ENST00000221452;ENST00000540120;ENST00000505236	T;T;T	0.47869	0.84;0.84;0.83	4.59	3.52	0.40303	.	0.081322	0.49305	D	0.000143	T	0.53642	0.1809	L	0.38175	1.15	0.38712	D	0.953243	D	0.89917	1.0	D	0.75484	0.986	T	0.57728	-0.7761	10	0.72032	D	0.01	-0.2104	7.5121	0.27579	0.1905:0.6251:0.1844:0.0	.	173	D6R992	.	W	176;176;173	ENSP00000221452:R176W;ENSP00000445542:R176W;ENSP00000423287:R173W	ENSP00000221452:R176W	R	+	1	2	RELB	50217172	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.002000	0.29796	1.097000	0.41459	0.462000	0.41574	CGG	.		0.637	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000367361.2		
RGS9	8787	ucsc.edu;bcgsc.ca	37	17	63193341	63193341	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:63193341C>T	ENST00000262406.9	+	13	1025	c.958C>T	c.(958-960)Ctc>Ttc	p.L320F	RGS9_ENST00000449996.3_Missense_Mutation_p.L317F|RGS9_ENST00000443584.3_Missense_Mutation_p.L317F	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	320	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						CCAGTACTTCCTCAAGAAAGA	0.428																																					p.L320F		.											.	RGS9	94	0			c.C958T						.						52.0	49.0	50.0					17																	63193341		1838	4087	5925	SO:0001583	missense	8787	exon13			TACTTCCTCAAGA	AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.958C>T	17.37:g.63193341C>T	ENSP00000262406:p.Leu320Phe	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	45.0	6.0	NM_003835	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369376	0.42003	.	.	ENSG00000108370	ENST00000262406;ENST00000449996;ENST00000443584	T;T	0.55930	0.49;0.49	5.4	5.4	0.78164	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.81847	0.4909	H	0.98487	4.245	0.80722	D	1	P;D;D	0.60575	0.788;0.988;0.986	B;P;P	0.58077	0.299;0.832;0.741	D	0.89386	0.3685	10	0.87932	D	0	.	19.1919	0.93671	0.0:1.0:0.0:0.0	.	320;320;317	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	F	320;317;320	ENSP00000262406:L320F;ENSP00000396329:L317F	ENSP00000262406:L320F	L	+	1	0	RGS9	60623803	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.586000	0.46119	2.537000	0.85549	0.655000	0.94253	CTC	.		0.428	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445885.1	NM_003835	
ROS1	6098	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	117718163	117718163	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:117718163G>A	ENST00000368508.3	-	7	892	c.694C>T	c.(694-696)Ctg>Ttg	p.L232L	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Silent_p.L241L	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	232	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TTGCTGATCAGCCTTAAGTTA	0.403			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.L232L		.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	1353	0			c.C694T						.						129.0	134.0	132.0					6																	117718163		2203	4300	6503	SO:0001819	synonymous_variant	6098	exon7			TGATCAGCCTTAA	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.694C>T	6.37:g.117718163G>A		Somatic	113.0	1.0		WXS	Illumina HiSeq	Phase_I	51.0	39.0	NM_002944	Q15368|Q5TDB5	Silent	SNP	ENST00000368508.3	37	CCDS5116.1																																																																																			.		0.403	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
RPS6KA3	6197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	20206011	20206011	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:20206011G>A	ENST00000379565.3	-	9	916	c.709C>T	c.(709-711)Cca>Tca	p.P237S	RPS6KA3_ENST00000540702.1_Missense_Mutation_p.P209S|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.P209S|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.P208S	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	237	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	ACTACTTCTGGAGCCATATAC	0.388																																					p.P237S		.											.	RPS6KA3	1504	0			c.C709T						.						159.0	143.0	148.0					X																	20206011		2203	4300	6503	SO:0001583	missense	6197	exon9			CTTCTGGAGCCAT	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.709C>T	X.37:g.20206011G>A	ENSP00000368884:p.Pro237Ser	Somatic	202.0	0.0		WXS	Illumina HiSeq	Phase_I	177.0	71.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	37	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958932	0.92726	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702;ENST00000457145	T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91	5.08	5.08	0.68730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91673	0.7368	H	0.98133	4.155	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95028	0.8166	10	0.87932	D	0	.	17.5586	0.87900	0.0:0.0:1.0:0.0	.	209;208;209;237	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	S	237;209;208;209;208	ENSP00000368884:P237S;ENSP00000440220:P209S;ENSP00000368865:P208S;ENSP00000444837:P209S;ENSP00000407655:P208S	ENSP00000368865:P208S	P	-	1	0	RPS6KA3	20115932	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.813000	0.99286	2.074000	0.62210	0.513000	0.50165	CCA	.		0.388	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
RUNDC1	146923	ucsc.edu;bcgsc.ca	37	17	41143436	41143436	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:41143436C>A	ENST00000361677.1	+	5	1557	c.1545C>A	c.(1543-1545)agC>agA	p.S515R		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	515	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		CCAAACAGAGCCTACTGACAG	0.557																																					p.S515R		.											.	RUNDC1	90	0			c.C1545A						.						79.0	73.0	75.0					17																	41143436		2203	4300	6503	SO:0001583	missense	146923	exon5			ACAGAGCCTACTG	AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.1545C>A	17.37:g.41143436C>A	ENSP00000354622:p.Ser515Arg	Somatic	26.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_173079	Q6Y2K8|Q8IXT9|Q8N3W1	Missense_Mutation	SNP	ENST00000361677.1	37	CCDS11448.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.775104	0.49786	.	.	ENSG00000198863	ENST00000361677	T	0.33654	1.4	5.02	1.99	0.26369	RUN (2);	0.109289	0.64402	D	0.000003	T	0.53126	0.1777	M	0.72118	2.19	0.52099	D	0.999942	D	0.76494	0.999	D	0.77557	0.99	T	0.48019	-0.9071	10	0.46703	T	0.11	-19.6006	8.934	0.35688	0.0:0.7:0.0:0.3	.	515	Q96C34	RUND1_HUMAN	R	515	ENSP00000354622:S515R	ENSP00000354622:S515R	S	+	3	2	RUNDC1	38396962	0.981000	0.34729	0.982000	0.44146	0.779000	0.44077	0.226000	0.17776	0.306000	0.22856	0.655000	0.94253	AGC	.		0.557	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452464.1	NM_173079	
RUSC2	9853	ucsc.edu;bcgsc.ca	37	9	35555121	35555121	+	Silent	SNP	C	C	T	rs149030772		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:35555121C>T	ENST00000455600.1	+	3	2648	c.2079C>T	c.(2077-2079)ccC>ccT	p.P693P		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	693						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CCACACTGCCCATCCAGCCCT	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18978	0.0		0.0	False		,,,				2504	0.0				p.P693P		.											.	RUSC2	91	0			c.C2079T						.	C	,	2,4404	4.2+/-10.8	0,2,2201	93.0	93.0	93.0		2079,2079	2.8	1.0	9	dbSNP_134	93	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RUSC2	NM_001135999.1,NM_014806.2	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	693/1517,693/1517	35555121	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	9853	exon3			ACTGCCCATCCAG	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.2079C>T	9.37:g.35555121C>T		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_014806	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Silent	SNP	ENST00000455600.1	37	CCDS35008.1																																																																																			C|1.000;T|0.000		0.612	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
RYR1	6261	ucsc.edu;bcgsc.ca	37	19	38939397	38939397	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:38939397C>A	ENST00000359596.3	+	11	1066	c.1066C>A	c.(1066-1068)Ctc>Atc	p.L356I	RYR1_ENST00000360985.3_Missense_Mutation_p.L356I|RYR1_ENST00000355481.4_Missense_Mutation_p.L356I			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	356	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGGACTGTGGCTCACCTATGC	0.622																																					p.L356I		.											.	RYR1	100	0			c.C1066A						.						78.0	70.0	73.0					19																	38939397		2203	4300	6503	SO:0001583	missense	6261	exon11			CTGTGGCTCACCT	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1066C>A	19.37:g.38939397C>A	ENSP00000352608:p.Leu356Ile	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	36.0	5.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.073817	0.55646	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.95205	-3.64;-3.64;-3.64	4.59	4.59	0.56863	MIR motif (2);MIR (2);	0.000000	0.64402	U	0.000014	D	0.96756	0.8941	M	0.80183	2.485	0.43330	D	0.995364	D;D	0.69078	0.997;0.997	D;D	0.70716	0.946;0.97	D	0.96928	0.9679	10	0.72032	D	0.01	.	12.7568	0.57339	0.0:0.8333:0.1666:0.0	.	356;356	P21817-2;P21817	.;RYR1_HUMAN	I	356	ENSP00000352608:L356I;ENSP00000347667:L356I;ENSP00000354254:L356I	ENSP00000347667:L356I	L	+	1	0	RYR1	43631237	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	2.947000	0.49058	2.375000	0.81037	0.561000	0.74099	CTC	.		0.622	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
SCN2B	6327	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118037718	118037718	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:118037718T>C	ENST00000278947.5	-	4	773	c.532A>G	c.(532-534)Atg>Gtg	p.M178V		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	178				MV -> TA (in Ref. 1; AAC26013). {ECO:0000305}.	cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGACCACCATCAGCACCAAG	0.597																																					p.M178V		.											.	SCN2B	90	0			c.A532G						.						174.0	142.0	153.0					11																	118037718		2200	4296	6496	SO:0001583	missense	6327	exon4			CCACCATCAGCAC	AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.532A>G	11.37:g.118037718T>C	ENSP00000278947:p.Met178Val	Somatic	65.0	1.0		WXS	Illumina HiSeq	Phase_I	59.0	20.0	NM_004588	O75302|Q9UNN3	Missense_Mutation	SNP	ENST00000278947.5	37	CCDS8390.1	.	.	.	.	.	.	.	.	.	.	T	6.108	0.388147	0.11581	.	.	ENSG00000149575	ENST00000278947	D	0.96967	-4.19	5.04	2.72	0.32119	Cytochrome c1, transmembrane anchor, C-terminal (1);	0.150806	0.64402	N	0.000012	D	0.86703	0.5996	N	0.04880	-0.145	0.39954	D	0.974574	B	0.02656	0.0	B	0.01281	0.0	T	0.77167	-0.2687	10	0.06365	T	0.9	-39.266	7.8881	0.29661	0.0:0.3138:0.0:0.6862	.	178	O60939	SCN2B_HUMAN	V	178	ENSP00000278947:M178V	ENSP00000278947:M178V	M	-	1	0	SCN2B	117542928	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.825000	0.39081	0.404000	0.25506	-1.151000	0.01829	ATG	.		0.597	SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109748.2	NM_004588	
SCNN1B	6338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	23366664	23366664	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:23366664T>C	ENST00000343070.2	+	4	806	c.630T>C	c.(628-630)agT>agC	p.S210S	SCNN1B_ENST00000307331.5_Silent_p.S255S|SCNN1B_ENST00000568085.1_Silent_p.S210S|SCNN1B_ENST00000568923.1_Intron	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	210					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	ACTTCACCAGTGCTACCCAGG	0.587																																					p.S210S		.											.	SCNN1B	157	0			c.T630C						.						146.0	105.0	119.0					16																	23366664		2197	4300	6497	SO:0001819	synonymous_variant	6338	exon4			CACCAGTGCTACC	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.630T>C	16.37:g.23366664T>C		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	29.0	NM_000336	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Silent	SNP	ENST00000343070.2	37	CCDS10609.1																																																																																			.		0.587	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
SEMA6D	80031	ucsc.edu;bcgsc.ca	37	15	48063850	48063850	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:48063850C>A	ENST00000316364.5	+	19	3529	c.3090C>A	c.(3088-3090)agC>agA	p.S1030R	SEMA6D_ENST00000389428.3_Missense_Mutation_p.S955R|SEMA6D_ENST00000389432.2_Missense_Mutation_p.S987R|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000536845.2_Missense_Mutation_p.S1030R|SEMA6D_ENST00000537942.1_Missense_Mutation_p.S968R|SEMA6D_ENST00000389433.2_Missense_Mutation_p.S1011R|SEMA6D_ENST00000354744.4_Missense_Mutation_p.S974R|SEMA6D_ENST00000358066.4_Missense_Mutation_p.S968R|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000558014.1_Missense_Mutation_p.S968R	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	1030					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GACAGAGCAGCTACACCAGTA	0.537																																					p.S1030R		.											.	SEMA6D	138	0			c.C3090A						.						153.0	149.0	151.0					15																	48063850		2198	4297	6495	SO:0001583	missense	80031	exon19			GAGCAGCTACACC	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.3090C>A	15.37:g.48063850C>A	ENSP00000324857:p.Ser1030Arg	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	59.0	5.0	NM_153618	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.517380	0.44763	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.36520	1.25;1.41;1.41;1.4;1.26;1.26;1.25;1.29	5.59	2.2	0.27929	.	0.136669	0.64402	D	0.000003	T	0.49389	0.1554	L	0.53249	1.67	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.997;1.0	D;D;P;D	0.69824	0.966;0.966;0.885;0.966	T	0.46190	-0.9209	10	0.59425	D	0.04	.	9.5281	0.39175	0.0:0.5987:0.0:0.4013	.	955;974;1030;968	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	R	968;1030;1030;1011;987;974;968;955	ENSP00000442040:S968R;ENSP00000446152:S1030R;ENSP00000324857:S1030R;ENSP00000374084:S1011R;ENSP00000374083:S987R;ENSP00000346786:S974R;ENSP00000350770:S968R;ENSP00000374079:S955R	ENSP00000324857:S1030R	S	+	3	2	SEMA6D	45851142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.292000	0.33342	0.717000	0.32145	0.563000	0.77884	AGC	.		0.537	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
SENP6	26054	ucsc.edu;bcgsc.ca	37	6	76376473	76376473	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:76376473G>T	ENST00000447266.2	+	10	1518	c.1040G>T	c.(1039-1041)aGa>aTa	p.R347I	SENP6_ENST00000541192.1_5'Flank|SENP6_ENST00000370010.2_Missense_Mutation_p.R340I|SENP6_ENST00000327284.8_Missense_Mutation_p.R340I|SENP6_ENST00000370014.3_Missense_Mutation_p.R347I	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	347					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				AGAACTAACAGAAGAGAAAGC	0.333																																					p.R347I		.											.	SENP6	660	0			c.G1040T						.						93.0	89.0	90.0					6																	76376473		1921	4161	6082	SO:0001583	missense	26054	exon10			CTAACAGAAGAGA		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.1040G>T	6.37:g.76376473G>T	ENSP00000402527:p.Arg347Ile	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	37	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.373795	0.42105	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000538088;ENST00000327284;ENST00000447266;ENST00000424947	T;T;T;T;T	0.39997	2.14;2.17;1.05;2.15;1.06	5.32	3.41	0.39046	.	0.098517	0.64402	D	0.000002	T	0.42108	0.1188	M	0.66939	2.045	0.80722	D	1	D;D;D	0.65815	0.987;0.978;0.995	P;P;P	0.58266	0.744;0.559;0.836	T	0.33033	-0.9884	10	0.37606	T	0.19	-15.0965	10.1079	0.42544	0.0717:0.0:0.7919:0.1365	.	340;347;340	Q9GZR1-2;Q9GZR1;F8W6D9	.;SENP6_HUMAN;.	I	340;347;196;340;347;237	ENSP00000359027:R340I;ENSP00000359031:R347I;ENSP00000321820:R340I;ENSP00000402527:R347I;ENSP00000391426:R237I	ENSP00000321820:R340I	R	+	2	0	SENP6	76433193	1.000000	0.71417	0.998000	0.56505	0.025000	0.11179	4.494000	0.60347	1.381000	0.46364	0.650000	0.86243	AGA	.		0.333	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
SESN2	83667	ucsc.edu;bcgsc.ca	37	1	28599950	28599950	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:28599950A>G	ENST00000253063.3	+	6	1153	c.832A>G	c.(832-834)Acg>Gcg	p.T278A		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	278					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		GGATGAGGGGACGTCCCAGGA	0.657																																					p.T278A		.											.	SESN2	230	0			c.A832G						.						33.0	39.0	37.0					1																	28599950		2202	4300	6502	SO:0001583	missense	83667	exon6			GAGGGGACGTCCC	AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.832A>G	1.37:g.28599950A>G	ENSP00000253063:p.Thr278Ala	Somatic	59.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_031459	Q5T7D0|Q96SI5	Missense_Mutation	SNP	ENST00000253063.3	37	CCDS321.1	.	.	.	.	.	.	.	.	.	.	A	1.325	-0.598457	0.03744	.	.	ENSG00000130766	ENST00000253063	T	0.17854	2.25	5.23	2.21	0.28008	.	0.573676	0.19867	N	0.104285	T	0.03871	0.0109	N	0.00793	-1.18	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43845	-0.9366	10	0.02654	T	1	-4.985	8.3486	0.32288	0.3125:0.0:0.6875:0.0	.	278	P58004	SESN2_HUMAN	A	278	ENSP00000253063:T278A	ENSP00000253063:T278A	T	+	1	0	SESN2	28472537	1.000000	0.71417	0.003000	0.11579	0.796000	0.44982	4.475000	0.60210	0.218000	0.20820	-0.608000	0.04076	ACG	.		0.657	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009840.1		
SETDB2	83852	ucsc.edu;bcgsc.ca	37	13	50051084	50051084	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr13:50051084A>G	ENST00000317257.8	+	7	1639	c.814A>G	c.(814-816)Aga>Gga	p.R272G	SETDB2_ENST00000354234.4_Missense_Mutation_p.R260G|SETDB2_ENST00000258672.5_Missense_Mutation_p.R260G	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	272					chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		GTTTAAGTACAGAAAGACTGT	0.413																																					p.R272G		.											.	SETDB2	91	0			c.A814G						.						90.0	91.0	90.0					13																	50051084		2203	4300	6503	SO:0001583	missense	83852	exon7			AAGTACAGAAAGA	AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.814A>G	13.37:g.50051084A>G	ENSP00000326477:p.Arg272Gly	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	38.0	5.0	NM_031915	Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	ENST00000317257.8	37	CCDS9417.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.527726	0.44969	.	.	ENSG00000136169	ENST00000354234;ENST00000317257;ENST00000258672	T;T;T	0.76448	-1.02;-1.02;-1.02	5.96	3.39	0.38822	Pre-SET domain (1);	0.000000	0.85682	D	0.000000	D	0.86777	0.6014	M	0.79805	2.47	0.49915	D	0.999836	D;D;D	0.89917	0.977;1.0;1.0	P;D;D	0.97110	0.621;0.999;1.0	D	0.85364	0.1109	10	0.26408	T	0.33	.	13.9851	0.64328	0.6892:0.3108:0.0:0.0	.	272;260;272	Q96T68-3;Q96T68-2;Q96T68	.;.;SETB2_HUMAN	G	260;272;260	ENSP00000346175:R260G;ENSP00000326477:R272G;ENSP00000258672:R260G	ENSP00000258672:R260G	R	+	1	2	SETDB2	48949085	1.000000	0.71417	1.000000	0.80357	0.377000	0.30045	4.335000	0.59298	1.062000	0.40625	0.533000	0.62120	AGA	.		0.413	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044925.1	NM_031915	
SFI1	9814	ucsc.edu;bcgsc.ca	37	22	32009157	32009157	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr22:32009157G>T	ENST00000400288.2	+	25	2625	c.2520G>T	c.(2518-2520)gcG>gcT	p.A840A	SFI1_ENST00000540643.1_Silent_p.A785A|SFI1_ENST00000414585.1_Silent_p.A687A|SFI1_ENST00000443011.1_Silent_p.A687A|SFI1_ENST00000443326.1_Silent_p.A758A|SFI1_ENST00000400289.1_Silent_p.A758A|SFI1_ENST00000432498.1_Silent_p.A809A	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	840					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						AGCAGCGGGCGACAGTGCGGG	0.632																																					p.A840A		.											.	SFI1	90	0			c.G2520T						.						37.0	47.0	44.0					22																	32009157		2123	4256	6379	SO:0001819	synonymous_variant	9814	exon25			GCGGGCGACAGTG	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2520G>T	22.37:g.32009157G>T		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	24.0	5.0	NM_001007467	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Silent	SNP	ENST00000400288.2	37	CCDS43004.1																																																																																			.		0.632	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
SIX2	10736	ucsc.edu;bcgsc.ca	37	2	45235966	45235966	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:45235966G>T	ENST00000303077.6	-	1	603	c.284C>A	c.(283-285)gCg>gAg	p.A95E		NM_016932.4	NP_058628.3	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	95					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|kidney development (GO:0001822)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesenchymal stem cell proliferation (GO:0097168)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|middle ear morphogenesis (GO:0042474)|nephron development (GO:0072006)|nephron morphogenesis (GO:0072028)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus (GO:0006606)|regulation of branching involved in ureteric bud morphogenesis (GO:0090189)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|large_intestine(3)|lung(8)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	22		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CAGCTTCTCCGCCTCGATGTA	0.657																																					p.A95E		.											.	SIX2	91	0			c.C284A						.						53.0	54.0	54.0					2																	45235966		2203	4300	6503	SO:0001583	missense	10736	exon1			TTCTCCGCCTCGA	AF136939	CCDS1822.1	2p21	2011-06-20	2007-07-13		ENSG00000170577	ENSG00000170577		"""Homeoboxes / SINE class"""	10888	protein-coding gene	gene with protein product		604994	"""sine oculis homeobox (Drosophila) homolog 2"", ""sine oculis homeobox homolog 2 (Drosophila)"""				Standard	NM_016932		Approved		uc002ruo.3	Q9NPC8	OTTHUMG00000152421	ENST00000303077.6:c.284C>A	2.37:g.45235966G>T	ENSP00000304502:p.Ala95Glu	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_016932	Q9BXH7	Missense_Mutation	SNP	ENST00000303077.6	37	CCDS1822.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196157	0.78902	.	.	ENSG00000170577	ENST00000303077	D	0.89810	-2.57	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	D	0.90933	0.7150	M	0.77820	2.39	0.80722	D	1	B;P	0.44429	0.345;0.835	B;P	0.45946	0.239;0.498	D	0.91978	0.5592	10	0.52906	T	0.07	-29.2823	16.9715	0.86301	0.0:0.0:1.0:0.0	.	95;95	Q8TBA2;Q9NPC8	.;SIX2_HUMAN	E	95	ENSP00000304502:A95E	ENSP00000304502:A95E	A	-	2	0	SIX2	45089470	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.869000	0.99810	2.081000	0.62600	0.462000	0.41574	GCG	.		0.657	SIX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326188.2		
SLC26A4	5172	broad.mit.edu;bcgsc.ca	37	7	107315422	107315422	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:107315422A>G	ENST00000265715.3	+	6	857	c.633A>G	c.(631-633)atA>atG	p.I211M		NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	211					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TTGGATTCATAGTGAGGTACT	0.413									Pendred syndrome																												p.I211M		.											.	SLC26A4	96	0			c.A633G						.						271.0	248.0	256.0					7																	107315422		2203	4300	6503	SO:0001583	missense	5172	exon6	Familial Cancer Database	Goiter-Deafness syndrome	ATTCATAGTGAGG	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.633A>G	7.37:g.107315422A>G	ENSP00000265715:p.Ile211Met	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	7.0	NM_000441	B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	37	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	A	17.69	3.451129	0.63290	.	.	ENSG00000091137	ENST00000265715	D	0.93906	-3.31	5.61	-5.97	0.02227	Sulphate transporter (1);	0.063417	0.64402	D	0.000009	D	0.93592	0.7954	M	0.80183	2.485	0.80722	D	1	D	0.59767	0.986	D	0.64877	0.93	D	0.88896	0.3349	10	0.56958	D	0.05	.	3.6583	0.08229	0.1458:0.3087:0.0693:0.4762	.	211	O43511	S26A4_HUMAN	M	211	ENSP00000265715:I211M	ENSP00000265715:I211M	I	+	3	3	SLC26A4	107102658	0.190000	0.23276	0.967000	0.41034	0.995000	0.86356	-0.444000	0.06854	-0.841000	0.04200	-0.341000	0.08007	ATA	.		0.413	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441	
SLC30A1	7779	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	211751520	211751520	+	Silent	SNP	G	G	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:211751520G>C	ENST00000367001.4	-	1	564	c.435C>G	c.(433-435)ggC>ggG	p.G145G		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	145					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		AGTGGCCGTGGCCGGAGTCCT	0.716																																					p.G145G		.											.	SLC30A1	93	0			c.C435G						.						13.0	16.0	15.0					1																	211751520		2193	4291	6484	SO:0001819	synonymous_variant	7779	exon1			GCCGTGGCCGGAG	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.435C>G	1.37:g.211751520G>C		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	9.0	NM_021194	Q0VAK9|Q9BZF6	Silent	SNP	ENST00000367001.4	37	CCDS1499.1																																																																																			.		0.716	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		
SLC35C1	55343	ucsc.edu;bcgsc.ca	37	11	45827722	45827722	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:45827722T>C	ENST00000314134.3	+	1	1766	c.370T>C	c.(370-372)Ttc>Ctc	p.F124L	SLC35C1_ENST00000442528.2_Missense_Mutation_p.F111L|SLC35C1_ENST00000456334.1_Missense_Mutation_p.F111L	NM_018389.4	NP_060859.4	Q96A29	FUCT1_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C1	124					carbohydrate transport (GO:0008643)|lipid glycosylation (GO:0030259)|negative regulation of Notch signaling pathway (GO:0045746)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10				GBM - Glioblastoma multiforme(35;0.227)		GTCGGTGGTCTTCATCGGCAT	0.632																																					p.F124L		.											.	SLC35C1	90	0			c.T370C						.						126.0	96.0	106.0					11																	45827722		2203	4299	6502	SO:0001583	missense	55343	exon1			GTGGTCTTCATCG		CCDS7914.1, CCDS44575.1	11p11.2	2014-09-17	2013-07-17			ENSG00000181830		"""Solute carriers"""	20197	protein-coding gene	gene with protein product		605881	"""solute carrier family 35, member C1"""			11326279, 11326280	Standard	NM_018389		Approved	FUCT1, FLJ11320	uc010rgm.2	Q96A29		ENST00000314134.3:c.370T>C	11.37:g.45827722T>C	ENSP00000313318:p.Phe124Leu	Somatic	22.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_018389	B2RDB2|Q9BV76|Q9NUJ8	Missense_Mutation	SNP	ENST00000314134.3	37	CCDS7914.1	.	.	.	.	.	.	.	.	.	.	T	31	5.081346	0.94050	.	.	ENSG00000181830	ENST00000442528;ENST00000456334;ENST00000530670;ENST00000314134;ENST00000530471;ENST00000540685	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	4.98	3.83	0.44106	Drug/metabolite transporter (1);	0.000000	0.85682	D	0.000000	T	0.57770	0.2076	M	0.61703	1.905	0.80722	D	1	D	0.65815	0.995	P	0.58013	0.831	T	0.56312	-0.8000	10	0.45353	T	0.12	-33.4455	10.815	0.46571	0.0:0.0755:0.0:0.9245	.	124	Q96A29	FUCT1_HUMAN	L	111;111;45;124;111;124	ENSP00000412408:F111L;ENSP00000399779:F111L;ENSP00000313318:F124L;ENSP00000432669:F111L	ENSP00000313318:F124L	F	+	1	0	SLC35C1	45784298	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	8.013000	0.88655	0.732000	0.32470	0.460000	0.39030	TTC	.		0.632	SLC35C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390139.1	NM_018389	
SLC4A4	8671	broad.mit.edu;bcgsc.ca	37	4	72423587	72423587	+	Silent	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:72423587C>A	ENST00000264485.5	+	22	3039	c.2922C>A	c.(2920-2922)atC>atA	p.I974I	SLC4A4_ENST00000340595.3_Silent_p.I930I|SLC4A4_ENST00000425175.1_Silent_p.I974I|SLC4A4_ENST00000351898.6_Silent_p.I890I	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	974					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TGGCTGCTATCATTTTTCCAG	0.443																																					p.I974I		.											.	SLC4A4	95	0			c.C2922A						.						119.0	95.0	103.0					4																	72423587		2203	4300	6503	SO:0001819	synonymous_variant	8671	exon22			TGCTATCATTTTT	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2922C>A	4.37:g.72423587C>A		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	7.0	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	37	CCDS43236.1																																																																																			.		0.443	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
SLC39A8	64116	ucsc.edu;bcgsc.ca	37	4	103180632	103180632	+	IGR	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:103180632G>A	ENST00000394833.2	-	0	3238				SLC39A8_ENST00000424970.2_Missense_Mutation_p.H436Y	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8						transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		CAAAGTAAATGAAGTTGAGAT	0.333																																					p.H436Y		.											.	SLC39A8	90	0			c.C1306T						.						207.0	172.0	182.0					4																	103180632		692	1591	2283	SO:0001628	intergenic_variant	64116	exon10			GTAAATGAAGTTG		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120		4.37:g.103180632G>A		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	56.0	5.0	NM_001135147	B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	ENST00000394833.2	37	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	G	8.340	0.828593	0.16749	.	.	ENSG00000138821	ENST00000424970	T	0.69040	-0.37	2.29	0.517	0.17025	.	.	.	.	.	T	0.34164	0.0888	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.28396	-1.0045	8	0.02654	T	1	.	4.3623	0.11208	0.3419:0.0:0.6581:0.0	.	436	B4E2H3	.	Y	436	ENSP00000394548:H436Y	ENSP00000394548:H436Y	H	-	1	0	SLC39A8	103399655	0.001000	0.12720	0.000000	0.03702	0.072000	0.16883	0.140000	0.16056	0.101000	0.17610	0.313000	0.20887	CAT	.		0.333	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	
SMC5	23137	ucsc.edu;bcgsc.ca	37	9	72912940	72912940	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:72912940G>T	ENST00000361138.5	+	9	1170	c.1112G>T	c.(1111-1113)aGg>aTg	p.R371M		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	371					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						GACCGACAGAGGAGAATAGGT	0.388																																					p.R371M		.											.	SMC5	229	0			c.G1112T						.						103.0	101.0	102.0					9																	72912940		2203	4300	6503	SO:0001583	missense	23137	exon9			GACAGAGGAGAAT	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.1112G>T	9.37:g.72912940G>T	ENSP00000354957:p.Arg371Met	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	37	CCDS6632.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671177	0.67814	.	.	ENSG00000198887	ENST00000361138	T	0.19938	2.11	5.92	0.264	0.15607	RecF/RecN/SMC (1);	0.382752	0.30930	N	0.008584	T	0.16214	0.0390	N	0.24115	0.695	0.26503	N	0.974736	P	0.46656	0.882	P	0.47346	0.544	T	0.10405	-1.0631	10	0.72032	D	0.01	-4.7822	8.5334	0.33349	0.7103:0.0:0.2897:0.0	.	371	Q8IY18	SMC5_HUMAN	M	371	ENSP00000354957:R371M	ENSP00000354957:R371M	R	+	2	0	SMC5	72102760	0.999000	0.42202	0.993000	0.49108	0.994000	0.84299	0.636000	0.24644	0.119000	0.18210	-0.194000	0.12790	AGG	.		0.388	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
SORCS2	57537	ucsc.edu;bcgsc.ca	37	4	7730138	7730138	+	Silent	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:7730138C>A	ENST00000507866.2	+	22	3040	c.2931C>A	c.(2929-2931)acC>acA	p.T977T	SORCS2_ENST00000329016.9_Silent_p.T805T	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	977					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						ACCCCAACACCCCTGAGTGGA	0.592																																					p.T977T		.											.	SORCS2	91	0			c.C2931A						.						59.0	65.0	63.0					4																	7730138		1944	4145	6089	SO:0001819	synonymous_variant	57537	exon22			CAACACCCCTGAG	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2931C>A	4.37:g.7730138C>A		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_020777	Q9P2L7	Silent	SNP	ENST00000507866.2	37	CCDS47008.1																																																																																			.		0.592	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777	
SP1	6667	ucsc.edu;bcgsc.ca	37	12	53775988	53775988	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:53775988A>G	ENST00000327443.4	+	3	355	c.257A>G	c.(256-258)cAg>cGg	p.Q86R	SP1_ENST00000426431.2_Missense_Mutation_p.Q79R	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	86	Ser/Thr-rich.				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GGCCCGAGTCAGTCAGGGGGA	0.582																																					p.Q86R		.											.	SP1	228	0			c.A257G						.						69.0	67.0	68.0					12																	53775988		2203	4300	6503	SO:0001583	missense	6667	exon3			CGAGTCAGTCAGG	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.257A>G	12.37:g.53775988A>G	ENSP00000329357:p.Gln86Arg	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_138473	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	ENST00000327443.4	37	CCDS8857.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.463719	0.43736	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.10668	2.88;2.85	4.13	4.13	0.48395	.	0.000000	0.52532	D	0.000073	T	0.12944	0.0314	M	0.62723	1.935	0.48762	D	0.999704	B	0.25007	0.116	B	0.24701	0.055	T	0.03641	-1.1017	10	0.36615	T	0.2	.	11.0634	0.47961	1.0:0.0:0.0:0.0	.	86	P08047	SP1_HUMAN	R	86;79	ENSP00000329357:Q86R;ENSP00000404263:Q79R	ENSP00000329357:Q86R	Q	+	2	0	SP1	52062255	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.981000	0.56902	1.870000	0.54199	0.383000	0.25322	CAG	.		0.582	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1		
STAB2	55576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104118857	104118857	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:104118857C>T	ENST00000388887.2	+	45	4992	c.4788C>T	c.(4786-4788)cgC>cgT	p.R1596R		NM_017564.9	NP_060034.9			stabilin 2									p.R1596R(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TTACCTGCCGCGGCAGCATTT	0.448																																					p.R1596R		.											STAB2,NS,carcinoma,0	STAB2	104	1	Substitution - coding silent(1)	ovary(1)	c.C4788T						.						120.0	116.0	118.0					12																	104118857		2203	4300	6503	SO:0001819	synonymous_variant	55576	exon45			CTGCCGCGGCAGC	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4788C>T	12.37:g.104118857C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	18.0	NM_017564		Silent	SNP	ENST00000388887.2	37	CCDS31888.1																																																																																			.		0.448	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
STAT5A	6776	ucsc.edu;bcgsc.ca	37	17	40461433	40461433	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:40461433C>A	ENST00000345506.4	+	19	2795	c.2153C>A	c.(2152-2154)gCc>gAc	p.A718D	STAT5A_ENST00000452307.2_Missense_Mutation_p.A715D|STAT5A_ENST00000588868.1_Missense_Mutation_p.A687D|STAT5A_ENST00000546010.2_Missense_Mutation_p.A688D|STAT5A_ENST00000590949.1_Missense_Mutation_p.A718D|STAT5A_ENST00000587646.1_Missense_Mutation_p.A206D	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	718					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		GGCAGCAGCGCCACGTACATG	0.617																																					p.A718D		.											.	STAT5A	846	0			c.C2153A						.						45.0	41.0	42.0					17																	40461433		2203	4300	6503	SO:0001583	missense	6776	exon19			GCAGCGCCACGTA	U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.2153C>A	17.37:g.40461433C>A	ENSP00000341208:p.Ala718Asp	Somatic	60.0	1.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_003152	Q1KLZ6	Missense_Mutation	SNP	ENST00000345506.4	37	CCDS11424.1	.	.	.	.	.	.	.	.	.	.	C	7.577	0.667927	0.14710	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	D;D;D	0.86164	-2.08;-2.06;-2.08	5.17	4.21	0.49690	.	0.660669	0.15285	N	0.270461	T	0.77301	0.4110	L	0.29908	0.895	0.30241	N	0.795036	P;P;B;B	0.41597	0.756;0.756;0.411;0.282	B;B;B;B	0.38803	0.157;0.282;0.051;0.075	T	0.69461	-0.5139	10	0.12766	T	0.61	-18.7878	9.1771	0.37118	0.0:0.7754:0.1455:0.079	.	718;688;689;718	A8K6I5;Q1KLZ6;Q59GY7;P42229	.;.;.;STA5A_HUMAN	D	718;688;689;715	ENSP00000341208:A718D;ENSP00000443107:A688D;ENSP00000400320:A715D	ENSP00000341208:A718D	A	+	2	0	STAT5A	37714959	1.000000	0.71417	0.121000	0.21740	0.220000	0.24768	1.313000	0.33585	1.189000	0.43028	0.591000	0.81541	GCC	.		0.617	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152	
STK32C	282974	ucsc.edu;bcgsc.ca	37	10	134036201	134036201	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:134036201T>C	ENST00000368622.1	-	10	1225	c.844A>G	c.(844-846)Aag>Gag	p.K282E	STK32C_ENST00000368625.4_Missense_Mutation_p.K412E					serine/threonine kinase 32C											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		AGACGCTTCTTCTTCTTGTGC	0.642																																					p.K399E		.											.	STK32C	1083	0			c.A1195G						.						70.0	64.0	66.0					10																	134036201		2201	4299	6500	SO:0001583	missense	282974	exon10			GCTTCTTCTTCTT	AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368622.1:c.844A>G	10.37:g.134036201T>C	ENSP00000357611:p.Lys282Glu	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_173575		Missense_Mutation	SNP	ENST00000368622.1	37		.	.	.	.	.	.	.	.	.	.	T	24.5	4.540067	0.85917	.	.	ENSG00000165752	ENST00000368622;ENST00000298630;ENST00000368625	T;T;T	0.23950	1.88;1.88;1.88	3.53	3.53	0.40419	.	0.000000	0.64402	U	0.000005	T	0.52853	0.1760	M	0.84433	2.695	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.87578	0.998;0.985;0.991	T	0.60712	-0.7209	10	0.66056	D	0.02	.	12.262	0.54655	0.0:0.0:0.0:1.0	.	412;399;282	B7Z7J1;Q86UX6;Q86UX6-2	.;ST32C_HUMAN;.	E	282;399;412	ENSP00000357611:K282E;ENSP00000298630:K399E;ENSP00000357614:K412E	ENSP00000298630:K399E	K	-	1	0	STK32C	133886191	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.927000	0.75840	1.487000	0.48415	0.393000	0.25936	AAG	.		0.642	STK32C-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051068.2	NM_173575	
STRIP2	57464	ucsc.edu;bcgsc.ca	37	7	129122681	129122681	+	Splice_Site	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:129122681A>G	ENST00000249344.2	+	20	2089		c.e20-1		RNU1-72P_ENST00000362976.1_RNA|STRIP2_ENST00000435494.2_Splice_Site	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2						cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											TTCAATGAACAGATGCTGGTA	0.428																																					.		.											.	.	.	0			c.2050-2A>G						.						76.0	80.0	79.0					7																	129122681		2203	4300	6503	SO:0001630	splice_region_variant	57464	exon20			ATGAACAGATGCT	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.2050-1A>G	7.37:g.129122681A>G		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	59.0	5.0	NM_001134336	Q8WUZ4	Splice_Site	SNP	ENST00000249344.2	37	CCDS34752.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.201621	0.79015	.	.	ENSG00000128578	ENST00000249344;ENST00000435494	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.752	0.69533	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAM40B	128909917	1.000000	0.71417	0.992000	0.48379	0.836000	0.47400	8.781000	0.91805	2.151000	0.67156	0.533000	0.62120	.	.		0.428	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336	Intron
STXBP5L	9515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	120876465	120876465	+	Missense_Mutation	SNP	A	A	G	rs371884493		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:120876465A>G	ENST00000273666.6	+	9	1139	c.868A>G	c.(868-870)Att>Gtt	p.I290V	STXBP5L_ENST00000471454.1_Missense_Mutation_p.I290V|STXBP5L_ENST00000497029.1_Missense_Mutation_p.I290V|STXBP5L_ENST00000472879.1_Missense_Mutation_p.I290V|STXBP5L_ENST00000492541.1_Missense_Mutation_p.I290V	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	290					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CCAGACCACAATTCCACATGG	0.418																																					p.I290V		.											.	STXBP5L	77	0			c.A868G						.	A	VAL/ILE	2,3800		0,2,1899	97.0	88.0	91.0		868	-1.1	1.0	3		91	0,8226		0,0,4113	no	missense	STXBP5L	NM_014980.2	29	0,2,6012	GG,GA,AA		0.0,0.0526,0.0166	benign	290/1187	120876465	2,12026	1901	4113	6014	SO:0001583	missense	9515	exon9			ACCACAATTCCAC	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.868A>G	3.37:g.120876465A>G	ENSP00000273666:p.Ile290Val	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	12.0	NM_014980	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	37	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	A	7.892	0.732435	0.15507	5.26E-4	0.0	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.54071	0.59;1.63;0.59;0.59;1.63;1.63	5.26	-1.14	0.09741	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.344395	0.34314	N	0.004078	T	0.19208	0.0461	N	0.02539	-0.55	0.26059	N	0.981373	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.34403	-0.9830	10	0.02654	T	1	-31.9659	11.0024	0.47614	0.4002:0.0:0.5998:0.0	.	290;290	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	V	290	ENSP00000273666:I290V;ENSP00000420019:I290V;ENSP00000419627:I290V;ENSP00000420287:I290V;ENSP00000420666:I290V;ENSP00000420167:I290V	ENSP00000273666:I290V	I	+	1	0	STXBP5L	122359155	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	0.923000	0.28757	-0.119000	0.11830	-0.385000	0.06624	ATT	.		0.418	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
SUV420H1	51111	ucsc.edu;bcgsc.ca	37	11	67942644	67942644	+	Silent	SNP	C	C	T	rs140940573	byFrequency	TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:67942644C>T	ENST00000304363.4	-	5	737	c.384G>A	c.(382-384)agG>agA	p.R128R	SUV420H1_ENST00000401547.2_Silent_p.R128R|SUV420H1_ENST00000405515.1_Silent_p.R128R|SUV420H1_ENST00000402789.1_Silent_p.R128R|SUV420H1_ENST00000402185.2_Silent_p.R105R	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	128					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						CTTTAATAGGCCTAAATCTGA	0.378													C|||	6	0.00119808	0.0045	0.0	5008	,	,		17430	0.0		0.0	False		,,,				2504	0.0				p.R128R		.											.	SUV420H1	228	0			c.G384A						.	C	,	11,4389	17.9+/-39.9	0,11,2189	88.0	79.0	82.0		384,384	0.9	1.0	11	dbSNP_134	82	0,8588		0,0,4294	no	coding-synonymous,coding-synonymous	SUV420H1	NM_016028.4,NM_017635.3	,	0,11,6483	TT,TC,CC		0.0,0.25,0.0847	,	128/394,128/886	67942644	11,12977	2200	4294	6494	SO:0001819	synonymous_variant	51111	exon5			AATAGGCCTAAAT	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.384G>A	11.37:g.67942644C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_017635	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Silent	SNP	ENST00000304363.4	37	CCDS31623.1																																																																																			C|0.999;T|0.001		0.378	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635	
SYNE1	23345	ucsc.edu;bcgsc.ca	37	6	152697950	152697950	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:152697950T>A	ENST00000367255.5	-	57	9708	c.9107A>T	c.(9106-9108)tAc>tTc	p.Y3036F	SYNE1_ENST00000341594.5_Missense_Mutation_p.Y3075F|SYNE1_ENST00000265368.4_Missense_Mutation_p.Y3036F|SYNE1_ENST00000423061.1_Missense_Mutation_p.Y3043F|SYNE1_ENST00000448038.1_Missense_Mutation_p.Y3043F	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3036					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTTCCACTGTAGGTACTCAG	0.378										HNSCC(10;0.0054)																											p.Y3043F		.											.	SYNE1	607	0			c.A9128T						.						73.0	73.0	73.0					6																	152697950		2203	4300	6503	SO:0001583	missense	23345	exon57			CCACTGTAGGTAC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.9107A>T	6.37:g.152697950T>A	ENSP00000356224:p.Tyr3036Phe	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.1|24.1	4.496939|4.496939	0.85069|0.85069	.|.	.|.	ENSG00000131018|ENSG00000131018	ENST00000454018|ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	.|T;T;T;T;T	.|0.51817	.|1.37;0.69;1.37;0.7;1.37	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.111574	.|0.40385	.|N	.|0.001105	T|T	0.32526|0.32526	0.0832|0.0832	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|P;P;P;P;P	.|0.51791	.|0.791;0.913;0.932;0.913;0.948	.|B;B;B;B;P	.|0.47430	.|0.343;0.345;0.373;0.345;0.547	T|T	0.18650|0.18650	-1.0330|-1.0330	5|10	.|0.09590	.|T	.|0.72	.|.	15.5675|15.5675	0.76306|0.76306	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|3019;3036;153;3036;3043	.|B3W695;Q8NF91;B7ZBC4;E7EQI5;Q8NF91-4	.|.;SYNE1_HUMAN;.;.;.	S|F	153|3036;3043;3036;3043;3075	.|ENSP00000356224:Y3036F;ENSP00000396024:Y3043F;ENSP00000265368:Y3036F;ENSP00000390975:Y3043F;ENSP00000341887:Y3075F	.|ENSP00000265368:Y3036F	T|Y	-|-	1|2	0|0	SYNE1|SYNE1	152739643|152739643	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.969000|0.969000	0.65631|0.65631	5.815000|5.815000	0.69215|0.69215	2.089000|2.089000	0.63090|0.63090	0.528000|0.528000	0.53228|0.53228	ACA|TAC	.		0.378	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYT16	83851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	62550927	62550927	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:62550927C>T	ENST00000430451.2	+	5	1645	c.1448C>T	c.(1447-1449)cCg>cTg	p.P483L		NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	483					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GGAGGGTCTCCGCTCAGCCCA	0.517																																					p.P483L		.											.	SYT16	23	0			c.C1448T						.						99.0	97.0	97.0					14																	62550927		1982	4148	6130	SO:0001583	missense	83851	exon5			GGTCTCCGCTCAG	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1448C>T	14.37:g.62550927C>T	ENSP00000394700:p.Pro483Leu	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	27.0	NM_031914	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	ENST00000430451.2	37	CCDS45121.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.365415	0.24684	.	.	ENSG00000139973	ENST00000430451	T	0.04083	3.71	5.44	2.45	0.29901	.	0.438877	0.25948	N	0.027265	T	0.02230	0.0069	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42682	-0.9437	10	0.06099	T	0.92	-3.8934	5.2381	0.15458	0.4366:0.3745:0.0:0.1889	.	483	Q17RD7	SYT16_HUMAN	L	483	ENSP00000394700:P483L	ENSP00000394700:P483L	P	+	2	0	SYT16	61620680	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.294000	0.43567	0.381000	0.24851	0.643000	0.83706	CCG	.		0.517	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
TACC2	10579	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	123846141	123846141	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:123846141A>G	ENST00000369005.1	+	4	4466	c.4126A>G	c.(4126-4128)Agg>Ggg	p.R1376G	TACC2_ENST00000515273.1_Missense_Mutation_p.R1376G|TACC2_ENST00000453444.2_Missense_Mutation_p.R1376G|TACC2_ENST00000515603.1_Missense_Mutation_p.R1376G|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000334433.3_Missense_Mutation_p.R1376G|TACC2_ENST00000513429.1_Intron	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1376					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CAGCATGGAGAGGATGGGAGA	0.602																																					p.R1376G		.											.	TACC2	296	0			c.A4126G						.						119.0	86.0	97.0					10																	123846141		2203	4300	6503	SO:0001583	missense	10579	exon4			ATGGAGAGGATGG	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.4126A>G	10.37:g.123846141A>G	ENSP00000358001:p.Arg1376Gly	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	7.0	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	A	12.31	1.899721	0.33535	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.04551	3.68;3.6;3.66;3.68;3.6	4.82	-0.337	0.12654	.	0.438735	0.17088	N	0.187514	T	0.03520	0.0101	L	0.29908	0.895	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.003;0.003	T	0.36529	-0.9744	10	0.87932	D	0	-2.0946	4.8478	0.13523	0.6243:0.1531:0.2226:0.0	.	1376;1376;1376	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	G	1376;1376;1376;1376;1376;1366	ENSP00000358001:R1376G;ENSP00000424467:R1376G;ENSP00000427618:R1376G;ENSP00000334280:R1376G;ENSP00000395048:R1376G	ENSP00000334280:R1376G	R	+	1	2	TACC2	123836131	0.036000	0.19791	0.000000	0.03702	0.117000	0.20001	0.705000	0.25675	-0.331000	0.08501	0.368000	0.22195	AGG	.		0.602	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
TCEANC2	127428	ucsc.edu;bcgsc.ca	37	1	54561960	54561960	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:54561960G>T	ENST00000234827.1	+	5	641	c.441G>T	c.(439-441)atG>atT	p.M147I	TCEANC2_ENST00000498272.1_3'UTR|TCEANC2_ENST00000371331.1_Missense_Mutation_p.M177I	NM_153035.1	NP_694580.1	Q96MN5	TEAN2_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing 2	147	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|lung(3)|pancreas(1)	5						TTTTTTAGATGGATCACCTAC	0.463																																					p.M147I		.											.	TCEANC2	91	0			c.G441T						.						74.0	88.0	83.0					1																	54561960		2203	4300	6503	SO:0001583	missense	127428	exon5			TTAGATGGATCAC	AK056674	CCDS587.1	1p32.3	2011-01-25	2011-01-25	2011-01-25	ENSG00000116205	ENSG00000116205			26494	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 83"""	C1orf83		12477932	Standard	NM_153035		Approved	FLJ32112	uc001cwt.1	Q96MN5	OTTHUMG00000008434	ENST00000234827.1:c.441G>T	1.37:g.54561960G>T	ENSP00000234827:p.Met147Ile	Somatic	73.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_153035	Q5T702|Q8N8N2	Missense_Mutation	SNP	ENST00000234827.1	37	CCDS587.1	.	.	.	.	.	.	.	.	.	.	G	9.603	1.129269	0.21041	.	.	ENSG00000116205	ENST00000234827;ENST00000371331	T;T	0.39787	1.06;1.06	5.34	4.42	0.53409	Transcription elongation factor S-II, central domain (3);	0.319208	0.38778	N	0.001580	T	0.15955	0.0384	N	0.02011	-0.69	0.37617	D	0.921157	B	0.02656	0.0	B	0.08055	0.003	T	0.09952	-1.0651	10	0.35671	T	0.21	-8.1519	6.6048	0.22720	0.0881:0.0:0.5997:0.3122	.	147	Q96MN5	TEAN2_HUMAN	I	147;177	ENSP00000234827:M147I;ENSP00000360382:M177I	ENSP00000234827:M147I	M	+	3	0	TCEANC2	54334548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.521000	0.53472	2.522000	0.85027	0.563000	0.77884	ATG	.		0.463	TCEANC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023245.1	NM_153035	
TECTA	7007	ucsc.edu;bcgsc.ca	37	11	121008141	121008141	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:121008141C>A	ENST00000392793.1	+	11	3224	c.2953C>A	c.(2953-2955)Cca>Aca	p.P985T	TECTA_ENST00000264037.2_Missense_Mutation_p.P985T			O75443	TECTA_HUMAN	tectorin alpha	985	TIL 2.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ACTGGAGTGCCCAGAGAACAG	0.527																																					p.P985T		.											.	TECTA	225	0			c.C2953A						.						121.0	111.0	114.0					11																	121008141		2203	4299	6502	SO:0001583	missense	7007	exon10			GAGTGCCCAGAGA	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2953C>A	11.37:g.121008141C>A	ENSP00000376543:p.Pro985Thr	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.021028	0.54576	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.81247	-1.47;-1.47	5.13	5.13	0.70059	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	0.058784	0.64402	D	0.000001	D	0.90947	0.7154	M	0.84846	2.72	0.50813	D	0.999896	D	0.89917	1.0	D	0.91635	0.999	D	0.92291	0.5841	10	0.72032	D	0.01	.	18.6067	0.91268	0.0:1.0:0.0:0.0	.	985	O75443	TECTA_HUMAN	T	985	ENSP00000376543:P985T;ENSP00000264037:P985T	ENSP00000264037:P985T	P	+	1	0	TECTA	120513351	1.000000	0.71417	0.999000	0.59377	0.122000	0.20287	7.752000	0.85141	2.383000	0.81215	0.655000	0.94253	CCA	.		0.527	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
TET3	200424	ucsc.edu;bcgsc.ca	37	2	74317138	74317138	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:74317138T>C	ENST00000409262.3	+	5	2598	c.2598T>C	c.(2596-2598)ccT>ccC	p.P866P		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	866					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCAAGACACCTCGCAAGTTCC	0.592																																					p.P866P		.											.	.	.	0			c.T2598C						.						106.0	117.0	113.0					2																	74317138		2068	4197	6265	SO:0001819	synonymous_variant	200424	exon5			GACACCTCGCAAG		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.2598T>C	2.37:g.74317138T>C		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_144993	A6NEI3|Q86Z24|Q8TBM9	Silent	SNP	ENST00000409262.3	37	CCDS46339.1																																																																																			.		0.592	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
TJP2	9414	ucsc.edu;bcgsc.ca	37	9	71864355	71864355	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:71864355T>C	ENST00000377245.4	+	20	3153	c.2945T>C	c.(2944-2946)cTt>cCt	p.L982P	TJP2_ENST00000348208.4_Intron|TJP2_ENST00000535702.1_Intron|TJP2_ENST00000539225.1_Missense_Mutation_p.L1013P|TJP2_ENST00000453658.2_Intron	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	982					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						AGCGATCAACTTAGGGACAAT	0.542																																					p.L1013P		.											.	TJP2	115	0			c.T3038C						.						41.0	33.0	36.0					9																	71864355		2203	4299	6502	SO:0001583	missense	9414	exon20			ATCAACTTAGGGA	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.2945T>C	9.37:g.71864355T>C	ENSP00000366453:p.Leu982Pro	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001170416	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	ENST00000377245.4	37	CCDS6627.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.083799	0.76642	.	.	ENSG00000119139	ENST00000377245;ENST00000539225	T;T	0.10382	2.88;2.93	5.82	5.82	0.92795	.	0.087248	0.46145	D	0.000315	T	0.25680	0.0625	L	0.44542	1.39	0.80722	D	1	D;P	0.89917	1.0;0.82	D;B	0.91635	0.999;0.149	T	0.01021	-1.1478	10	0.28530	T	0.3	.	16.19	0.81981	0.0:0.0:0.0:1.0	.	1013;982	F5H301;Q9UDY2	.;ZO2_HUMAN	P	982;1013	ENSP00000366453:L982P;ENSP00000438262:L1013P	ENSP00000366453:L982P	L	+	2	0	TJP2	71054175	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.418000	0.73341	2.225000	0.72522	0.460000	0.39030	CTT	.		0.542	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	NM_201629	
TMPRSS15	5651	ucsc.edu;bcgsc.ca	37	21	19670135	19670135	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr21:19670135G>A	ENST00000284885.3	-	19	2210	c.2177C>T	c.(2176-2178)tCa>tTa	p.S726L		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	726	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TGGCTTTGATGAGTTTCCACT	0.393																																					p.S726L		.											.	TMPRSS15	160	0			c.C2177T						.						91.0	78.0	83.0					21																	19670135		2203	4300	6503	SO:0001583	missense	5651	exon19			TTTGATGAGTTTC		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2177C>T	21.37:g.19670135G>A	ENSP00000284885:p.Ser726Leu	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_002772	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	G	9.365	1.068990	0.20147	.	.	ENSG00000154646	ENST00000284885	T	0.50548	0.74	5.67	4.79	0.61399	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.508000	0.18672	N	0.134419	T	0.42131	0.1189	L	0.50919	1.6	0.32368	N	0.556234	B	0.25667	0.131	B	0.28709	0.093	T	0.50171	-0.8859	9	.	.	.	.	10.7659	0.46292	0.0876:0.0:0.9124:0.0	.	726	P98073	ENTK_HUMAN	L	726	ENSP00000284885:S726L	.	S	-	2	0	TMPRSS15	18592006	1.000000	0.71417	1.000000	0.80357	0.035000	0.12851	2.799000	0.47892	1.395000	0.46643	-0.163000	0.13421	TCA	.		0.393	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
TNFAIP8L2	79626	ucsc.edu;bcgsc.ca	37	1	151131649	151131649	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:151131649T>C	ENST00000368910.3	+	2	602	c.476T>C	c.(475-477)cTc>cCc	p.L159P		NM_024575.4	NP_078851.2	Q6P589	TP8L2_HUMAN	tumor necrosis factor, alpha-induced protein 8-like 2	159					innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)				lung(1)|skin(2)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTCACGGCCCTCTATGGGCCT	0.572																																					p.L159P		.											.	TNFAIP8L2	90	0			c.T476C						.						44.0	42.0	43.0					1																	151131649		2203	4300	6503	SO:0001583	missense	79626	exon2			CGGCCCTCTATGG	BC063014	CCDS985.1	1q21.2	2008-02-05			ENSG00000163154	ENSG00000163154			26277	protein-coding gene	gene with protein product		612112					Standard	NM_024575		Approved	FLJ23467	uc001ewx.2	Q6P589	OTTHUMG00000012259	ENST00000368910.3:c.476T>C	1.37:g.151131649T>C	ENSP00000357906:p.Leu159Pro	Somatic	23.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_024575	Q6I9Y0|Q9H2H7|Q9H5G2	Missense_Mutation	SNP	ENST00000368910.3	37	CCDS985.1	.	.	.	.	.	.	.	.	.	.	T	19.18	3.777255	0.70107	.	.	ENSG00000163154	ENST00000368910	T	0.39787	1.06	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.56949	0.2020	M	0.82193	2.58	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.65643	-0.6118	10	0.87932	D	0	-3.6435	9.9283	0.41505	0.0:0.0794:0.0:0.9206	.	159	Q6P589	TP8L2_HUMAN	P	159	ENSP00000357906:L159P	ENSP00000357906:L159P	L	+	2	0	TNFAIP8L2	149398273	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	6.289000	0.72696	2.159000	0.67721	0.533000	0.62120	CTC	.		0.572	TNFAIP8L2-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034069.2	NM_024575	
TNRC18	84629	ucsc.edu;bcgsc.ca	37	7	5364783	5364783	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:5364783G>T	ENST00000430969.1	-	20	6592	c.6244C>A	c.(6244-6246)Ctg>Atg	p.L2082M	TNRC18_ENST00000399537.4_Missense_Mutation_p.L2082M	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2082							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCAGCGGTCAGGGAGCTGGCG	0.662																																					p.L2082M		.											.	TNRC18	46	0			c.C6244A						.						20.0	20.0	20.0					7																	5364783		1523	3482	5005	SO:0001583	missense	84629	exon20			CGGTCAGGGAGCT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.6244C>A	7.37:g.5364783G>T	ENSP00000395538:p.Leu2082Met	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	.	11.12	1.543994	0.27563	.	.	ENSG00000182095	ENST00000399537;ENST00000430969	T;T	0.13089	2.62;2.62	4.26	2.11	0.27256	.	.	.	.	.	T	0.08223	0.0205	N	0.19112	0.55	0.19300	N	0.999976	B	0.20052	0.041	B	0.12837	0.008	T	0.30060	-0.9991	9	0.45353	T	0.12	.	5.535	0.17005	0.0896:0.1277:0.6357:0.147	.	2082	O15417	TNC18_HUMAN	M	2082	ENSP00000382452:L2082M;ENSP00000395538:L2082M	ENSP00000382452:L2082M	L	-	1	2	TNRC18	5331309	1.000000	0.71417	0.088000	0.20740	0.637000	0.38172	1.402000	0.34600	0.783000	0.33636	0.290000	0.19541	CTG	.		0.662	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TNRC6A	27327	ucsc.edu;bcgsc.ca	37	16	24816374	24816374	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:24816374G>T	ENST00000395799.3	+	14	4153	c.4024G>T	c.(4024-4026)Gca>Tca	p.A1342S	CTD-2515A14.1_ENST00000568895.1_RNA|TNRC6A_ENST00000315183.7_Missense_Mutation_p.A1293S	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1342	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		AAACACAGCAGCACAACCCCG	0.483																																					p.A1342S		.											.	TNRC6A	92	0			c.G4024T						.						136.0	133.0	134.0					16																	24816374		2197	4300	6497	SO:0001583	missense	27327	exon14			ACAGCAGCACAAC	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4024G>T	16.37:g.24816374G>T	ENSP00000379144:p.Ala1342Ser	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	22.0	4.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.8|28.8	4.953838|4.953838	0.92660|0.92660	.|.	.|.	ENSG00000090905|ENSG00000090905	ENST00000315183;ENST00000395799|ENST00000450465	T;T|.	0.14516|.	2.5;2.5|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74253|0.74253	0.3692|0.3692	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.999;0.999|.	D;D;D|.	0.83275|.	0.996;0.996;0.991|.	T|T	0.69049|0.69049	-0.5248|-0.5248	10|5	0.39692|.	T|.	0.17|.	-11.3215|-11.3215	20.5373|20.5373	0.99239|0.99239	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	9;1293;1342|.	B3KSX2;Q8NDV7-6;Q8NDV7|.	.;.;TNR6A_HUMAN|.	S|I	1293;1342|232	ENSP00000326900:A1293S;ENSP00000379144:A1342S|.	ENSP00000326900:A1293S|.	A|S	+|+	1|2	0|0	TNRC6A|TNRC6A	24723875|24723875	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.354000|7.354000	0.79424|0.79424	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	GCA|AGC	.		0.483	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
TOX3	27324	ucsc.edu;bcgsc.ca	37	16	52497937	52497937	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:52497937A>G	ENST00000219746.9	-	3	601	c.317T>C	c.(316-318)tTt>tCt	p.F106S	TOX3_ENST00000407228.3_Missense_Mutation_p.F101S	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	106					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						TTGAGGGGGAAACTGGGGTGT	0.537																																					p.F106S		.											.	TOX3	68	0			c.T317C						.						84.0	91.0	88.0					16																	52497937		1977	4153	6130	SO:0001583	missense	27324	exon3			GGGGGAAACTGGG	U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.317T>C	16.37:g.52497937A>G	ENSP00000219746:p.Phe106Ser	Somatic	73.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001080430	B4DRD0|B5MCW4	Missense_Mutation	SNP	ENST00000219746.9	37	CCDS54009.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.417656	0.83449	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.45276	0.9;0.9	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.65698	0.2716	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.986	T	0.69113	-0.5231	10	0.72032	D	0.01	.	16.3317	0.83023	1.0:0.0:0.0:0.0	.	101;106	B4DRD0;O15405	.;TOX3_HUMAN	S	106;101	ENSP00000219746:F106S;ENSP00000385705:F101S	ENSP00000219746:F106S	F	-	2	0	TOX3	51055438	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.264000	0.75181	0.533000	0.62120	TTT	.		0.537	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000422534.1	XM_049037	
TRPC4	7223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	38248410	38248410	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr13:38248410G>A	ENST00000379705.3	-	5	2186	c.1329C>T	c.(1327-1329)tcC>tcT	p.S443S	TRPC4_ENST00000426868.2_Silent_p.S443S|TRPC4_ENST00000338947.5_Silent_p.S270S|TRPC4_ENST00000358477.2_Silent_p.S443S|TRPC4_ENST00000355779.2_Silent_p.S443S|TRPC4_ENST00000379681.3_Silent_p.S443S|TRPC4_ENST00000379673.2_Silent_p.S443S|TRPC4_ENST00000494529.1_5'UTR|TRPC4_ENST00000379679.1_Silent_p.S270S|TRPC4_ENST00000447043.1_Silent_p.S443S			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	443					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CTAAATATAAGGAGTTCATTA	0.343																																					p.S443S		.											.	TRPC4	159	0			c.C1329T						.						74.0	72.0	73.0					13																	38248410		2203	4300	6503	SO:0001819	synonymous_variant	7223	exon5			ATATAAGGAGTTC	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1329C>T	13.37:g.38248410G>A		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	40.0	NM_003306	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	ENST00000379705.3	37	CCDS9365.1																																																																																			.		0.343	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
TRPM2	7226	ucsc.edu;bcgsc.ca	37	21	45859038	45859038	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr21:45859038A>G	ENST00000397928.1	+	30	4701	c.4256A>G	c.(4255-4257)aAg>aGg	p.K1419R	TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300482.5_Missense_Mutation_p.K1419R|TRPM2_ENST00000300481.9_Missense_Mutation_p.K1365R|TRPM2_ENST00000397932.2_Missense_Mutation_p.K1469R|snoZ6_ENST00000583496.1_RNA|snoZ6_ENST00000581669.1_RNA	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	1419	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						AACTTGCTGAAGTGCGGCATG	0.602																																					p.K1419R		.											.	TRPM2	92	0			c.A4256G						.						141.0	91.0	108.0					21																	45859038		2203	4300	6503	SO:0001583	missense	7226	exon30			TGCTGAAGTGCGG	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.4256A>G	21.37:g.45859038A>G	ENSP00000381023:p.Lys1419Arg	Somatic	64.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	A	3.533	-0.095385	0.07010	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932;ENST00000540347	T;T;T;T	0.55760	0.62;0.62;0.66;0.5	4.33	-8.66	0.00866	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	1.443380	0.04527	N	0.385650	T	0.26882	0.0658	N	0.20357	0.565	0.09310	N	1	B;B;B;B	0.11235	0.004;0.001;0.001;0.001	B;B;B;B	0.06405	0.002;0.001;0.001;0.001	T	0.14924	-1.0455	10	0.19147	T	0.46	1.4021	1.2451	0.01971	0.474:0.1968:0.0971:0.232	.	100;1469;1205;1419	B4DVI8;E9PGK7;Q5KTC1;O94759	.;.;.;TRPM2_HUMAN	R	1419;1419;1365;1469;163	ENSP00000300482:K1419R;ENSP00000381023:K1419R;ENSP00000300481:K1365R;ENSP00000381026:K1469R	ENSP00000300481:K1365R	K	+	2	0	TRPM2	44683466	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.846000	0.01676	-3.498000	0.00152	-2.295000	0.00263	AAG	.		0.602	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
TSPAN14	81619	ucsc.edu;bcgsc.ca	37	10	82276005	82276005	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:82276005C>A	ENST00000429989.3	+	8	890	c.667C>A	c.(667-669)Cag>Aag	p.Q223K	TSPAN14_ENST00000341863.6_Missense_Mutation_p.Q166K|TSPAN14_ENST00000481124.1_Missense_Mutation_p.Q100K|TSPAN14_ENST00000372158.1_Missense_Mutation_p.Q223K|TSPAN14_ENST00000265450.5_3'UTR|TSPAN14_ENST00000372156.1_Missense_Mutation_p.Q223K|TSPAN14_ENST00000372164.3_Missense_Mutation_p.Q206K	NM_030927.2	NP_112189.2	Q8NG11	TSN14_HUMAN	tetraspanin 14	223					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7			Colorectal(32;0.229)			AGGCTGCATCCAGGCGCTGGA	0.562																																					p.Q223K		.											.	TSPAN14	91	0			c.C667A						.						139.0	127.0	131.0					10																	82276005		2203	4300	6503	SO:0001583	missense	81619	exon8			TGCATCCAGGCGC	AF311903	CCDS7369.1, CCDS44448.1	10q23.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000108219	ENSG00000108219		"""Tetraspanins"""	23303	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 14"""	TM4SF14		11230166	Standard	NM_030927		Approved	DC-TM4F2, MGC11352	uc001kcj.4	Q8NG11	OTTHUMG00000018615	ENST00000429989.3:c.667C>A	10.37:g.82276005C>A	ENSP00000396270:p.Gln223Lys	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_030927	A6NHE1|B4DHY6|D3DWD7|D3DWD8|Q567U7|Q9BU34|Q9H0U1	Missense_Mutation	SNP	ENST00000429989.3	37	CCDS7369.1	.	.	.	.	.	.	.	.	.	.	C	11.14	1.551394	0.27739	.	.	ENSG00000108219	ENST00000429989;ENST00000481124;ENST00000372157;ENST00000372164;ENST00000372158;ENST00000341863;ENST00000372156	T;T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	5.57	5.57	0.84162	Tetraspanin, EC2 domain (1);	0.744753	0.13257	N	0.401591	T	0.62865	0.2463	N	0.14661	0.345	0.30263	N	0.793007	B;B;B	0.12013	0.005;0.0;0.004	B;B;B	0.22601	0.04;0.01;0.016	T	0.56786	-0.7921	10	0.27082	T	0.32	-5.8195	10.4742	0.44655	0.0:0.912:0.0:0.088	.	100;223;206	B4DHY6;Q8NG11;Q8NG11-2	.;TSN14_HUMAN;.	K	223;100;193;206;223;166;223	ENSP00000396270:Q223K;ENSP00000418195:Q100K;ENSP00000361230:Q193K;ENSP00000361237:Q206K;ENSP00000361231:Q223K;ENSP00000344076:Q166K;ENSP00000361229:Q223K	ENSP00000344076:Q166K	Q	+	1	0	TSPAN14	82265985	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	1.499000	0.35671	2.643000	0.89663	0.591000	0.81541	CAG	.		0.562	TSPAN14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049081.2	NM_030927	
TSPAN3	10099	ucsc.edu;bcgsc.ca	37	15	77339189	77339189	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:77339189T>C	ENST00000267970.4	-	7	1023	c.750A>G	c.(748-750)ggA>ggG	p.G250G	TSPAN3_ENST00000346495.2_Silent_p.G225G|TSPAN3_ENST00000558745.1_Silent_p.G42G|RP11-797A18.3_ENST00000560446.1_lincRNA|TSPAN3_ENST00000424443.3_Silent_p.G186G|TSPAN3_ENST00000561277.1_Silent_p.G42G|TSPAN3_ENST00000559494.1_Silent_p.G161G	NM_001168412.1|NM_005724.5|NM_198902.2	NP_001161884.1|NP_005715.1|NP_944492.1	O60637	TSN3_HUMAN	tetraspanin 3	250						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	10				all cancers(203;1.14e-19)		ATGCATAGGTTCCGCCAGTGA	0.483																																					p.G250G		.											.	TSPAN3	90	0			c.A750G						.						77.0	59.0	65.0					15																	77339189		2196	4294	6490	SO:0001819	synonymous_variant	10099	exon7			ATAGGTTCCGCCA		CCDS10292.1, CCDS10293.1, CCDS53963.1	15q23	2013-02-14	2005-03-21	2005-03-21	ENSG00000140391	ENSG00000140391		"""Tetraspanins"""	17752	protein-coding gene	gene with protein product		613134	"""transmembrane 4 superfamily member 8"""	TM4SF8			Standard	NM_005724		Approved	TM4-A, TSPAN-3	uc002bcj.3	O60637	OTTHUMG00000143728	ENST00000267970.4:c.750A>G	15.37:g.77339189T>C		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_005724	A6NEH4|B3KQQ2|B4DP19|Q9BW22|Q9NVX9	Silent	SNP	ENST00000267970.4	37	CCDS10292.1																																																																																			.		0.483	TSPAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289792.3	NM_005724	
TSPAN7	7102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	38525510	38525510	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:38525510G>C	ENST00000378482.2	+	2	394	c.217G>C	c.(217-219)Ggc>Cgc	p.G73R	TSPAN7_ENST00000545599.1_Missense_Mutation_p.G47R|TSPAN7_ENST00000422612.2_Missense_Mutation_p.G99R|TM4SF2_ENST00000465127.1_Missense_Mutation_p.G103R|TSPAN7_ENST00000286824.6_Missense_Mutation_p.G90R|TSPAN7_ENST00000488893.1_3'UTR	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7	73					viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						TGTTGTCTTTGGCCTGTTTGG	0.448																																					p.G73R		.											.	TSPAN7	63	0			c.G217C						.						245.0	165.0	192.0					X																	38525510		2202	4300	6502	SO:0001583	missense	7102	exon2			GTCTTTGGCCTGT	D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.217G>C	X.37:g.38525510G>C	ENSP00000367743:p.Gly73Arg	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	43.0	NM_004615	B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Missense_Mutation	SNP	ENST00000378482.2	37	CCDS14248.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582598	0.86748	.	.	ENSG00000250349;ENSG00000156298;ENSG00000156298;ENSG00000156298;ENSG00000156298	ENST00000465127;ENST00000378482;ENST00000422612;ENST00000286824;ENST00000545599	D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55	5.96	5.1	0.69264	Tetraspanin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.93360	0.7883	M	0.94142	3.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.94750	0.7926	9	.	.	.	.	14.4266	0.67220	0.0722:0.0:0.9278:0.0	.	90;99;73	B4DDG0;B4DEA5;P41732	.;.;TSN7_HUMAN	R	103;73;99;90;47	ENSP00000417050:G103R;ENSP00000367743:G73R;ENSP00000388954:G99R;ENSP00000286824:G90R;ENSP00000441540:G47R	.	G	+	1	0	RP5-972B16.2;TSPAN7	38410454	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.476000	0.97823	1.274000	0.44362	0.594000	0.82650	GGC	.		0.448	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356412.1		
UBA1	7317	ucsc.edu;bcgsc.ca	37	X	47065756	47065756	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:47065756G>A	ENST00000335972.6	+	16	2034	c.1851G>A	c.(1849-1851)tcG>tcA	p.S617S	UBA1_ENST00000377269.3_5'Flank|INE1_ENST00000456273.1_RNA|UBA1_ENST00000377351.4_Silent_p.S617S|UBA1_ENST00000490869.1_3'UTR	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	617					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGACAGAGTCGTACAGTTCCA	0.572																																					p.S617S		.											.	UBA1	227	0			c.G1851A						.						97.0	65.0	76.0					X																	47065756		2203	4300	6503	SO:0001819	synonymous_variant	7317	exon16			AGAGTCGTACAGT	AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.1851G>A	X.37:g.47065756G>A		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_153280	Q5JRR8|Q96E13	Silent	SNP	ENST00000335972.6	37	CCDS14275.1																																																																																			.		0.572	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1	NM_003334	
UGGT1	56886	ucsc.edu;bcgsc.ca	37	2	128918817	128918817	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:128918817C>A	ENST00000259253.6	+	25	2847	c.2800C>A	c.(2800-2802)Caa>Aaa	p.Q934K	UGGT1_ENST00000375990.3_Missense_Mutation_p.Q910K	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	934					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ATCTCATATTCAACAGCTTCG	0.373																																					p.Q934K		.											.	UGGT1	91	0			c.C2800A						.						91.0	95.0	93.0					2																	128918817		2203	4300	6503	SO:0001583	missense	56886	exon25			CATATTCAACAGC	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.2800C>A	2.37:g.128918817C>A	ENSP00000259253:p.Gln934Lys	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_020120	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	C	5.766	0.325800	0.10900	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.06687	3.27;3.27	5.86	5.86	0.93980	.	0.053406	0.85682	D	0.000000	T	0.07279	0.0184	N	0.20574	0.59	0.53005	D	0.999968	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	T	0.41197	-0.9522	9	.	.	.	.	18.3607	0.90374	0.0:1.0:0.0:0.0	.	910;934	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	K	910;934	ENSP00000365158:Q910K;ENSP00000259253:Q934K	.	Q	+	1	0	UGGT1	128635287	1.000000	0.71417	0.998000	0.56505	0.847000	0.48162	3.339000	0.52135	2.777000	0.95525	0.655000	0.94253	CAA	.		0.373	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
UNC13A	23025	ucsc.edu;bcgsc.ca	37	19	17753723	17753723	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:17753723G>A	ENST00000519716.2	-	20	2402	c.2403C>T	c.(2401-2403)caC>caT	p.H801H	UNC13A_ENST00000552293.1_Silent_p.H801H|UNC13A_ENST00000551649.1_Silent_p.H801H|UNC13A_ENST00000252773.7_Silent_p.H801H|UNC13A_ENST00000550896.1_Silent_p.H799H|UNC13A_ENST00000428389.2_Silent_p.H889H	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	801					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CCACACTGATGTGGAGCCGGA	0.567																																					p.H801H		.											.	UNC13A	25	0			c.C2403T						.						61.0	62.0	61.0					19																	17753723		1991	4161	6152	SO:0001819	synonymous_variant	23025	exon19			ACTGATGTGGAGC	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2403C>T	19.37:g.17753723G>A		Somatic	34.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_001080421	E5RHY9	Silent	SNP	ENST00000519716.2	37	CCDS46013.2																																																																																			.		0.567	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
VPS13D	55187	ucsc.edu;bcgsc.ca	37	1	12379555	12379555	+	Splice_Site	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:12379555T>C	ENST00000358136.3	+	32	7546	c.7416T>C	c.(7414-7416)ggT>ggC	p.G2472G	VPS13D_ENST00000356315.4_Splice_Site_p.G2472G	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CCTTTCCAGGTACGGAGTTTG	0.507																																					p.G2472G		.											.	VPS13D	95	0			c.T7416C						.						200.0	179.0	186.0					1																	12379555		2203	4300	6503	SO:0001630	splice_region_variant	55187	exon32			TCCAGGTACGGAG	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7415-1T>C	1.37:g.12379555T>C		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	41.0	5.0	NM_015378		Silent	SNP	ENST00000358136.3	37	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	T	5.993	0.367198	0.11352	.	.	ENSG00000048707	ENST00000011700	.	.	.	5.61	0.542	0.17174	.	.	.	.	.	T	0.42630	0.1211	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23583	-1.0184	4	.	.	.	.	1.9783	0.03421	0.1362:0.3106:0.1188:0.4344	.	.	.	.	A	1295	.	.	V	+	2	0	VPS13D	12302142	0.653000	0.27358	0.996000	0.52242	0.440000	0.31957	-0.145000	0.10265	0.129000	0.18514	-0.132000	0.14878	GTA	.		0.507	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	Silent
WDFY3	23001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	85663040	85663040	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:85663040T>C	ENST00000295888.4	-	38	6515	c.6108A>G	c.(6106-6108)ggA>ggG	p.G2036G	WDFY3_ENST00000322366.6_Silent_p.G2036G	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2036					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCTGGTAGCTTCCTCCACTGG	0.403																																					p.G2036G		.											.	WDFY3	93	0			c.A6108G						.						73.0	72.0	73.0					4																	85663040		2203	4300	6503	SO:0001819	synonymous_variant	23001	exon38			GTAGCTTCCTCCA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.6108A>G	4.37:g.85663040T>C		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	38.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	CCDS3609.1																																																																																			.		0.403	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
XKR5	389610	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	6681084	6681084	+	RNA	SNP	A	A	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr8:6681084A>T	ENST00000518724.1	-	0	746							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		TTTGTAGAACAGAACCAGACT	0.532																																					p.L199Q		.											.	XKR5	90	0			c.T596A						.						42.0	48.0	46.0					8																	6681084		2009	4167	6176			389610	exon4			TAGAACAGAACCA	AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6681084A>T		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	35.0	NM_207411	Q5GH74	Missense_Mutation	SNP	ENST00000518724.1	37																																																																																				.		0.532	XKR5-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000331969.2	NM_207411	
XPNPEP1	7511	ucsc.edu;bcgsc.ca	37	10	111642310	111642310	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:111642310C>A	ENST00000502935.1	-	10	1040	c.921G>T	c.(919-921)caG>caT	p.Q307H	XPNPEP1_ENST00000369683.1_Missense_Mutation_p.Q193H|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.Q307H|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.Q264H|XPNPEP1_ENST00000430337.1_5'UTR					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		AGGGATGCACCTGGATCCTGT	0.572																																					p.Q307H		.											.	XPNPEP1	94	0			c.G921T						.						146.0	128.0	134.0					10																	111642310		2203	4300	6503	SO:0001583	missense	7511	exon10			ATGCACCTGGATC		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.921G>T	10.37:g.111642310C>A	ENSP00000421566:p.Gln307His	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_001167604		Missense_Mutation	SNP	ENST00000502935.1	37	CCDS7560.2	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301091	0.40694	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680;ENST00000403138;ENST00000423625	.	.	.	5.82	1.95	0.26073	.	0.122936	0.56097	D	0.000029	T	0.56920	0.2018	L	0.50919	1.6	0.41524	D	0.988417	B;P;P	0.40619	0.335;0.724;0.603	B;P;B	0.48141	0.077;0.568;0.364	T	0.52866	-0.8518	9	0.46703	T	0.11	-16.1108	9.4642	0.38802	0.0:0.582:0.0:0.418	.	307;307;264	B4E2P4;G5E9Y2;Q9NQW7	.;.;XPP1_HUMAN	H	307;193;307;264;264;232	.	ENSP00000324011:Q307H	Q	-	3	2	XPNPEP1	111632300	0.998000	0.40836	0.999000	0.59377	0.996000	0.88848	0.599000	0.24089	0.105000	0.17753	0.655000	0.94253	CAG	.		0.572	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2		
XRCC2	7516	ucsc.edu;bcgsc.ca	37	7	152346389	152346389	+	Missense_Mutation	SNP	G	G	T	rs569810249		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:152346389G>T	ENST00000359321.1	-	3	266	c.181C>A	c.(181-183)Cta>Ata	p.L61I	XRCC2_ENST00000495707.1_5'UTR	NM_005431.1	NP_005422.1	O43543	XRCC2_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 2	61					centrosome organization (GO:0051297)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of neurogenesis (GO:0050769)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|strand invasion (GO:0042148)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			NS(1)|breast(1)|large_intestine(5)|liver(1)|lung(1)|prostate(2)	11		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)		CGTGCTGTTAGGTGATAAAGC	0.378								Homologous recombination					G|||	1	0.000199681	0.0	0.0	5008	,	,		18967	0.001		0.0	False		,,,				2504	0.0				p.L61I		.											.	XRCC2	1084	0			c.C181A						.						106.0	92.0	97.0					7																	152346389		2203	4300	6503	SO:0001583	missense	7516	exon3			CTGTTAGGTGATA	Y08837	CCDS5933.1	7q36	2006-05-04			ENSG00000196584	ENSG00000196584			12829	protein-coding gene	gene with protein product	"""RAD51-like"""	600375				7607692, 10422536	Standard	NM_005431		Approved		uc003wld.3	O43543	OTTHUMG00000151470	ENST00000359321.1:c.181C>A	7.37:g.152346389G>T	ENSP00000352271:p.Leu61Ile	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_005431	B2R925	Missense_Mutation	SNP	ENST00000359321.1	37	CCDS5933.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.345067	0.61073	.	.	ENSG00000196584	ENST00000359321	T	0.54071	0.59	5.5	1.65	0.23941	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);DNA recombination and repair protein Rad51, C-terminal (1);	0.075540	0.56097	D	0.000039	T	0.52451	0.1735	L	0.55481	1.735	0.53005	D	0.999969	P	0.37663	0.604	P	0.47430	0.547	T	0.50759	-0.8790	10	0.66056	D	0.02	-18.6559	6.3761	0.21509	0.4494:0.0:0.5506:0.0	.	61	O43543	XRCC2_HUMAN	I	61	ENSP00000352271:L61I	ENSP00000352271:L61I	L	-	1	2	XRCC2	151977322	1.000000	0.71417	0.932000	0.37286	0.897000	0.52465	1.764000	0.38471	0.391000	0.25143	-0.423000	0.05987	CTA	.		0.378	XRCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322783.1	NM_005431	
ZCCHC6	79670	ucsc.edu;bcgsc.ca	37	9	88958022	88958022	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:88958022C>A	ENST00000375963.3	-	6	1226	c.1054G>T	c.(1054-1056)Gat>Tat	p.D352Y	ZCCHC6_ENST00000375948.1_5'UTR|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.D352Y|ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.D352Y	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	352					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						ATGTTTACATCCGAATTTTTG	0.308																																					p.D352Y		.											.	ZCCHC6	92	0			c.G1054T						.						78.0	83.0	81.0					9																	88958022		2203	4300	6503	SO:0001583	missense	79670	exon6			TTACATCCGAATT	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.1054G>T	9.37:g.88958022C>A	ENSP00000365130:p.Asp352Tyr	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423897	0.83667	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963	T;T;T	0.38560	1.13;1.13;1.13	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.65729	0.2719	M	0.71036	2.16	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	T	0.68953	-0.5273	10	0.87932	D	0	-24.7378	18.6626	0.91477	0.0:1.0:0.0:0.0	.	352;352;352;352	Q5VYS8-5;Q5VYS8-2;Q5VYS8-4;Q5VYS8	.;.;.;TUT7_HUMAN	Y	352	ENSP00000365127:D352Y;ENSP00000365128:D352Y;ENSP00000365130:D352Y	ENSP00000365127:D352Y	D	-	1	0	ZCCHC6	88147842	1.000000	0.71417	0.954000	0.39281	0.926000	0.56050	6.870000	0.75526	2.629000	0.89072	0.650000	0.86243	GAT	.		0.308	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
ZDHHC13	54503	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	19172329	19172329	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:19172329A>G	ENST00000446113.2	+	6	696	c.575A>G	c.(574-576)aAa>aGa	p.K192R	ZDHHC13_ENST00000399351.3_Missense_Mutation_p.K62R|ZDHHC13_ENST00000532812.1_3'UTR	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13	192					metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						TCAGCTCACAAAGTAATTGGG	0.333																																					p.K192R		.											.	ZDHHC13	90	0			c.A575G						.						187.0	184.0	185.0					11																	19172329		1871	4095	5966	SO:0001583	missense	54503	exon6			CTCACAAAGTAAT	AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.575A>G	11.37:g.19172329A>G	ENSP00000400113:p.Lys192Arg	Somatic	147.0	1.0		WXS	Illumina HiSeq	Phase_I	149.0	51.0	NM_019028	Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	Missense_Mutation	SNP	ENST00000446113.2	37	CCDS44550.1	.	.	.	.	.	.	.	.	.	.	A	7.759	0.705054	0.15172	.	.	ENSG00000177054	ENST00000446113;ENST00000399351	T;T	0.52754	0.65;0.65	5.58	5.58	0.84498	Ankyrin repeat-containing domain (3);	0.044409	0.85682	D	0.000000	T	0.31513	0.0799	N	0.17564	0.495	0.58432	D	0.999994	B	0.31817	0.341	B	0.35971	0.215	T	0.16453	-1.0402	10	0.18710	T	0.47	0.0237	9.8731	0.41187	0.9227:0.0:0.0773:0.0	.	192	Q8IUH4	ZDH13_HUMAN	R	192;62	ENSP00000400113:K192R;ENSP00000382288:K62R	ENSP00000382288:K62R	K	+	2	0	ZDHHC13	19128905	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.485000	0.66850	2.118000	0.64928	0.482000	0.46254	AAA	.		0.333	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387821.1	NM_019028	
ZEB1	6935	ucsc.edu;bcgsc.ca	37	10	31810468	31810468	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr10:31810468T>C	ENST00000320985.10	+	7	2315	c.2205T>C	c.(2203-2205)ctT>ctC	p.L735L	ZEB1_ENST00000446923.2_Silent_p.L719L|ZEB1_ENST00000542815.3_Silent_p.L668L|ZEB1_ENST00000560721.2_Silent_p.L715L|ZEB1_ENST00000361642.5_Silent_p.L736L|ZEB1_ENST00000559858.1_3'UTR			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	735					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				TAGAACCTCTTGATCTTTCAC	0.433																																					p.L736L	Ovarian(40;423 959 14296 36701 49589)	.											.	ZEB1	518	0			c.T2208C						.						91.0	87.0	88.0					10																	31810468		2203	4300	6503	SO:0001819	synonymous_variant	6935	exon7			ACCTCTTGATCTT	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2205T>C	10.37:g.31810468T>C		Somatic	45.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_001174096	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Silent	SNP	ENST00000320985.10	37	CCDS7169.1																																																																																			.		0.433	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
ZKSCAN7	55888	ucsc.edu;bcgsc.ca	37	3	44612400	44612400	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:44612400A>G	ENST00000273320.3	+	6	2227	c.1798A>G	c.(1798-1800)Att>Gtt	p.I600V	ZKSCAN7_ENST00000426540.1_Missense_Mutation_p.I600V|ZKSCAN7_ENST00000341840.3_Intron|ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.5_ENST00000419137.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	600					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCATGAGCGAATTCATACTGG	0.428																																					p.I600V		.											.	.	.	0			c.A1798G						.						96.0	99.0	98.0					3																	44612400		2203	4300	6503	SO:0001583	missense	55888	exon6			GAGCGAATTCATA	L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1798A>G	3.37:g.44612400A>G	ENSP00000273320:p.Ile600Val	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_018651	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Missense_Mutation	SNP	ENST00000273320.3	37	CCDS2715.1	.	.	.	.	.	.	.	.	.	.	.	6.335	0.429921	0.11987	.	.	ENSG00000196345	ENST00000426540;ENST00000273320;ENST00000315777	T;T	0.16324	2.35;2.35	4.2	2.98	0.34508	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.777029	0.10543	N	0.662410	T	0.09158	0.0226	N	0.05534	-0.03	0.80722	D	1	B	0.18461	0.028	B	0.17722	0.019	T	0.12344	-1.0551	10	0.46703	T	0.11	-1.9358	7.208	0.25917	0.8093:0.0:0.1907:0.0	.	600	Q9P0L1	ZN167_HUMAN	V	600;600;38	ENSP00000395524:I600V;ENSP00000273320:I600V	ENSP00000273320:I600V	I	+	1	0	ZNF167	44587404	0.000000	0.05858	0.924000	0.36721	0.980000	0.70556	0.515000	0.22801	0.619000	0.30197	0.533000	0.62120	ATT	.		0.428	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651	
ZNF134	7693	hgsc.bcm.edu;broad.mit.edu	37	19	58132394	58132399	+	In_Frame_Del	DEL	CTTGTT	CTTGTT	-			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	CTTGTT	CTTGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:58132394_58132399delCTTGTT	ENST00000396161.5	+	3	1217_1222	c.907_912delCTTGTT	c.(907-912)cttgttdel	p.LV303del		NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		CAAATCTACACTTGTTCAGCATGAGA	0.413																																					p.303_304del		.											.	ZNF134	226	0			c.907_912del						.																																			SO:0001651	inframe_deletion	7693	exon3			TCTACACTTGTTC	U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.907_912delCTTGTT	19.37:g.58132394_58132399delCTTGTT	ENSP00000379464:p.Leu303_Val304del	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	10.0	NM_003435	Q9Y4B2	In_Frame_Del	DEL	ENST00000396161.5	37	CCDS42638.1																																																																																			.		0.413	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466808.1	NM_003435	
ZNF185	7739	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152101462	152101462	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:152101462G>A	ENST00000370268.4	+	14	1102	c.1065G>A	c.(1063-1065)acG>acA	p.T355T	ZNF185_ENST00000449285.2_Silent_p.T356T|ZNF185_ENST00000318504.7_Silent_p.T296T|ZNF185_ENST00000318529.8_Silent_p.T134T|ZNF185_ENST00000324823.6_Intron|ZNF185_ENST00000539731.1_Silent_p.T326T|ZNF185_ENST00000535861.1_Silent_p.T355T|ZNF185_ENST00000370270.2_Silent_p.T355T			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	355						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CCGGAGCCACGGGCTCCCGGC	0.557																																					p.T356T		.											.	ZNF185	133	0			c.G1068A						.						52.0	52.0	52.0					X																	152101462		2011	4153	6164	SO:0001819	synonymous_variant	7739	exon14			AGCCACGGGCTCC	AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.1065G>A	X.37:g.152101462G>A		Somatic	102.0	1.0		WXS	Illumina HiSeq	Phase_I	89.0	41.0	NM_001178108	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Silent	SNP	ENST00000370268.4	37	CCDS48184.1	.	.	.	.	.	.	.	.	.	.	G	2.675	-0.276650	0.05679	.	.	ENSG00000147394	ENST00000426821;ENST00000447088	.	.	.	2.82	-5.63	0.02474	.	.	.	.	.	T	0.16769	0.0403	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.18304	-1.0341	4	.	.	.	1.5386	1.4415	0.02355	0.4302:0.265:0.1703:0.1345	.	.	.	.	R	141;173	.	.	G	+	1	0	ZNF185	151852118	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-2.061000	0.01391	-2.095000	0.00853	-1.418000	0.01112	GGG	.		0.557	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150	
ZNF234	10780	ucsc.edu;bcgsc.ca	37	19	44661469	44661469	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:44661469G>A	ENST00000426739.2	+	6	1558	c.1300G>A	c.(1300-1302)Ggt>Agt	p.G434S	ZNF234_ENST00000592437.1_Missense_Mutation_p.G434S	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	434					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				TGAAGTATGTGGTAAAGCCTT	0.403																																					p.G434S		.											.	.	.	0			c.G1300A						.						56.0	59.0	58.0					19																	44661469		2093	4246	6339	SO:0001583	missense	10780	exon6			GTATGTGGTAAAG	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1300G>A	19.37:g.44661469G>A	ENSP00000400878:p.Gly434Ser	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_006630	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	ENST00000426739.2	37	CCDS46101.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773327	0.90108	.	.	ENSG00000167380	ENST00000426739	T	0.07216	3.21	4.04	4.04	0.47022	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21761	0.0524	L	0.42008	1.315	0.37980	D	0.933571	D	0.89917	1.0	D	0.91635	0.999	T	0.04103	-1.0977	9	0.66056	D	0.02	.	15.4742	0.75465	0.0:0.0:1.0:0.0	.	434	Q14588	ZN234_HUMAN	S	434	ENSP00000400878:G434S	ENSP00000400878:G434S	G	+	1	0	ZNF226	49353309	1.000000	0.71417	0.981000	0.43875	0.979000	0.70002	5.546000	0.67243	2.240000	0.73641	0.591000	0.81541	GGT	.		0.403	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2		
ZNF333	84449	ucsc.edu;bcgsc.ca	37	19	14817512	14817512	+	Silent	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:14817512T>A	ENST00000292530.6	+	7	529	c.438T>A	c.(436-438)gcT>gcA	p.A146A	ZNF333_ENST00000536363.1_Silent_p.A37A|ZNF333_ENST00000601134.1_Missense_Mutation_p.Y87N|ZNF333_ENST00000540689.2_Silent_p.A146A	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						TGAAGGCCGCTATGCAGATTC	0.572																																					p.A146A	NSCLC(60;75 1281 16985 25154 29885)	.											.	ZNF333	92	0			c.T438A						.						95.0	89.0	91.0					19																	14817512		2203	4300	6503	SO:0001819	synonymous_variant	84449	exon7			GGCCGCTATGCAG		CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.438T>A	19.37:g.14817512T>A		Somatic	23.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_032433	Q6P2E6|Q86WS6|Q8TDL0	Silent	SNP	ENST00000292530.6	37	CCDS12316.1																																																																																			.		0.572	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466496.1	NM_032433	
ZNF419	79744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58004285	58004285	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:58004285C>T	ENST00000221735.7	+	5	546	c.360C>T	c.(358-360)ctC>ctT	p.L120L	AC003005.4_ENST00000601674.1_Intron|ZNF419_ENST00000426954.2_Silent_p.L108L|ZNF419_ENST00000354197.4_Silent_p.L108L|ZNF419_ENST00000347466.6_Silent_p.L88L|ZNF419_ENST00000442920.2_Silent_p.L107L|ZNF419_ENST00000424930.2_Silent_p.L121L|ZNF419_ENST00000415379.2_Silent_p.L74L			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		TAGGACTGCTCAGTTCAAACA	0.473																																					p.L121L		.											.	ZNF419	90	0			c.C363T						.						75.0	76.0	76.0					19																	58004285		2203	4300	6503	SO:0001819	synonymous_variant	79744	exon5			ACTGCTCAGTTCA	AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.360C>T	19.37:g.58004285C>T		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	41.0	NM_001098491	B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Silent	SNP	ENST00000221735.7	37	CCDS54326.1	.	.	.	.	.	.	.	.	.	.	C	1.470	-0.560106	0.03967	.	.	ENSG00000105136	ENST00000427558	.	.	.	1.45	-1.07	0.09968	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.6393	0.04966	0.4876:0.3333:0.0:0.1791	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF419	62696097	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.061000	0.03472	-0.229000	0.09854	0.205000	0.17691	.	.		0.473	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378506.1	NM_024691	
ZNF256	10172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58453498	58453498	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:58453498A>G	ENST00000282308.3	-	3	874	c.678T>C	c.(676-678)cgT>cgC	p.R226R	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	226					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		GGTGCTGAACACGTACATGTT	0.428																																					p.R226R	NSCLC(55;1313 1552 8040 11996)	.											.	ZNF256	92	0			c.T678C						.						198.0	176.0	184.0					19																	58453498		2203	4300	6503	SO:0001819	synonymous_variant	10172	exon3			CTGAACACGTACA	AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.678T>C	19.37:g.58453498A>G		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	35.0	NM_005773	B2RA92|Q53Y85|Q9BV71	Silent	SNP	ENST00000282308.3	37	CCDS12966.1																																																																																			.		0.428	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1		
ZNF596	169270	ucsc.edu;bcgsc.ca	37	8	192905	192905	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr8:192905G>T	ENST00000398612.1	+	3	414	c.31G>T	c.(31-33)Gat>Tat	p.D11Y	ZNF596_ENST00000308811.4_Missense_Mutation_p.D11Y|ZNF596_ENST00000320552.2_Missense_Mutation_p.D11Y	NM_001042415.1|NM_001042416.1	NP_001035880.1|NP_001035881.1	Q8TC21	ZN596_HUMAN	zinc finger protein 596	11	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(5)	14		all_cancers(2;4.81e-29)|all_epithelial(2;5.03e-19)|Lung NSC(2;8.68e-08)|all_lung(2;1.52e-07)|Ovarian(12;0.00965)|Colorectal(14;0.0367)|all_neural(12;0.0837)|Myeloproliferative disorder(644;0.116)|all_hematologic(2;0.138)|Acute lymphoblastic leukemia(644;0.242)		Epithelial(5;3.77e-18)|all cancers(2;5.2e-17)|OV - Ovarian serous cystadenocarcinoma(5;5.37e-09)|BRCA - Breast invasive adenocarcinoma(11;1.7e-06)|Colorectal(2;6.51e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0702)		GACCTTCGAGGATATCATTGT	0.438																																					p.D11Y		.											.	ZNF596	90	0			c.G31T						.						147.0	128.0	135.0					8																	192905		2203	4300	6503	SO:0001583	missense	169270	exon3			TTCGAGGATATCA	BC026190	CCDS5951.2	8p23.3	2013-01-08			ENSG00000172748	ENSG00000172748		"""Zinc fingers, C2H2-type"", ""-"""	27268	protein-coding gene	gene with protein product						12477932	Standard	NM_001287256		Approved		uc003wot.3	Q8TC21	OTTHUMG00000086931	ENST00000398612.1:c.31G>T	8.37:g.192905G>T	ENSP00000381613:p.Asp11Tyr	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_173539	B2R8P4|O95015|Q8N9X0	Missense_Mutation	SNP	ENST00000398612.1	37	CCDS5951.2	.	.	.	.	.	.	.	.	.	.	.	9.189	1.025595	0.19512	.	.	ENSG00000172748	ENST00000521145;ENST00000308811;ENST00000320552;ENST00000522866;ENST00000398612;ENST00000518414;ENST00000521270	T;T;T;T;T;T	0.12039	2.72;2.72;2.72;2.72;2.72;2.72	2.38	2.38	0.29361	Krueppel-associated box (4);	.	.	.	.	T	0.52092	0.1713	H	0.98407	4.225	0.21473	N	0.999671	D	0.89917	1.0	D	0.91635	0.999	T	0.50197	-0.8856	9	0.87932	D	0	.	10.9038	0.47067	0.0:0.0:1.0:0.0	.	11	Q8TC21	ZN596_HUMAN	Y	11	ENSP00000429671:D11Y;ENSP00000310033:D11Y;ENSP00000318719:D11Y;ENSP00000381613:D11Y;ENSP00000430552:D11Y;ENSP00000429386:D11Y	ENSP00000310033:D11Y	D	+	1	0	ZNF596	182905	1.000000	0.71417	0.049000	0.19019	0.034000	0.12701	3.916000	0.56416	1.669000	0.50854	0.585000	0.79938	GAT	.		0.438	ZNF596-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195858.4	NM_173539	
ZNF804A	91752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	185800964	185800964	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:185800964C>T	ENST00000302277.6	+	4	1435	c.841C>T	c.(841-843)Cca>Tca	p.P281S		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	281							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TTTTCATCCACCAGAGGCAAT	0.368																																					p.P281S		.											.	ZNF804A	163	0			c.C841T						.						62.0	59.0	60.0					2																	185800964		2203	4299	6502	SO:0001583	missense	91752	exon4			CATCCACCAGAGG	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.841C>T	2.37:g.185800964C>T	ENSP00000303252:p.Pro281Ser	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	16.0	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	1.718	-0.497322	0.04291	.	.	ENSG00000170396	ENST00000302277	T	0.65364	-0.15	5.57	0.304	0.15796	.	0.359593	0.24083	N	0.041715	T	0.36220	0.0959	N	0.22421	0.69	0.09310	N	1	B	0.26195	0.144	B	0.15870	0.014	T	0.20672	-1.0268	10	0.08599	T	0.76	-0.3547	6.7364	0.23411	0.1192:0.4811:0.3323:0.0675	.	281	Q7Z570	Z804A_HUMAN	S	281	ENSP00000303252:P281S	ENSP00000303252:P281S	P	+	1	0	ZNF804A	185509209	0.282000	0.24268	0.345000	0.25642	0.849000	0.48306	1.301000	0.33447	-0.017000	0.14103	0.591000	0.81541	CCA	.		0.368	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
ZNF878	729747	ucsc.edu;bcgsc.ca	37	19	12155990	12155990	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:12155990C>T	ENST00000547628.1	-	4	363	c.226G>A	c.(226-228)Gaa>Aaa	p.E76K	CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.2_ENST00000591898.1_RNA|CTD-2006C1.2_ENST00000591838.1_RNA|CTD-2006C1.10_ENST00000547473.1_Intron|ZNF878_ENST00000602107.1_Missense_Mutation_p.E123K	NM_001080404.2	NP_001073873.2	C9JN71	ZN878_HUMAN	zinc finger protein 878	76	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						TGATGACTTTCTTTACTTTCA	0.373																																					p.E76K		.											.	.	.	0			c.G226A						.						42.0	39.0	40.0					19																	12155990		1992	4187	6179	SO:0001583	missense	729747	exon4			GACTTTCTTTACT		CCDS45984.1, CCDS45984.2	19p13.2	2013-01-08				ENSG00000257446		"""Zinc fingers, C2H2-type"", ""-"""	37246	protein-coding gene	gene with protein product							Standard	NM_001080404		Approved		uc021upl.1	C9JN71		ENST00000547628.1:c.226G>A	19.37:g.12155990C>T	ENSP00000447931:p.Glu76Lys	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_001080404		Missense_Mutation	SNP	ENST00000547628.1	37	CCDS45984.2	.	.	.	.	.	.	.	.	.	.	C	11.36	1.616059	0.28801	.	.	ENSG00000257446;ENSG00000232371	ENST00000547628;ENST00000440730	T	0.06687	3.27	1.3	1.3	0.21679	Krueppel-associated box (1);	.	.	.	.	T	0.03095	0.0091	N	0.05031	-0.125	0.09310	N	1	P	0.35507	0.506	B	0.24155	0.051	T	0.41822	-0.9487	9	0.38643	T	0.18	.	5.9026	0.18976	0.0:1.0:0.0:0.0	.	76	C9JN71	ZN878_HUMAN	K	76;123	ENSP00000447931:E76K	ENSP00000447931:E76K	E	-	1	0	AC022415.4;ZNF878	12016990	0.572000	0.26668	0.005000	0.12908	0.139000	0.21198	1.932000	0.40143	0.675000	0.31264	0.313000	0.20887	GAA	.		0.373	ZNF878-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403723.1	NM_001080404	
LMNA	4000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156106182	156106183	+	Missense_Mutation	DNP	GG	GG	TA			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:156106182_156106183GG>TA	ENST00000368300.4	+	7	1547_1548	c.1335_1336GG>TA	c.(1333-1338)gtGGat>gtTAat	p.D446N	LMNA_ENST00000448611.2_Missense_Mutation_p.D334N|LMNA_ENST00000368299.3_Missense_Mutation_p.D446N|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000473598.2_Missense_Mutation_p.D347N|LMNA_ENST00000347559.2_Missense_Mutation_p.D446N|LMNA_ENST00000368301.2_Missense_Mutation_p.D446N|LMNA_ENST00000368297.1_Missense_Mutation_p.D365N|LMNA_ENST00000392353.3_Missense_Mutation_p.D365N|LMNA_ENST00000361308.4_Missense_Mutation_p.D446N	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	446	LTD.|Tail.		D -> V (in EDMD2). {ECO:0000269|PubMed:14684700}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					TGGAGGAGGTGGATGAGGAGGG	0.609									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																												p.D446N		.											.	.	.	0			.						.																																			SO:0001583	missense	4000	.	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	GGAGGTGGATGAG	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	Exception_encountered	1.37:g.156106182_156106183delinsTA	ENSP00000357283:p.Asp446Asn	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	35.0	.	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Missense_Mutation	DNP	ENST00000368300.4	37	CCDS1129.1																																																																																			.		0.609	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
