#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADGB	79747	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	147109747	147109747	+	Splice_Site	SNP	G	G	A	rs370591540		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:147109747G>A	ENST00000397944.3	+	33	4613		c.e33+1		ADGB_ENST00000367488.1_Splice_Site|ADGB_ENST00000367493.3_Splice_Site	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin						oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						GAAAACATTCGTAAGTATTGC	0.413																																					.		.											.	.	.	0			c.4537+1G>A						.	G		0,1384		0,0,692	129.0	129.0	129.0			3.2	0.4	6		129	1,3181		0,1,1590	no	splice-5	C6orf103	NM_024694.3		0,1,2282	AA,AG,GG		0.0314,0.0,0.0219			147109747	1,4565	692	1591	2283	SO:0001630	splice_region_variant	79747	exon33			ACATTCGTAAGTA	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4537+1G>A	6.37:g.147109747G>A		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	22.0	NM_024694	Q5T402|Q5T904|Q5T905	Splice_Site	SNP	ENST00000397944.3	37		.	.	.	.	.	.	.	.	.	.	G	10.42	1.345631	0.24426	0.0	3.14E-4	ENSG00000118492	ENST00000397944;ENST00000367490;ENST00000326916	.	.	.	3.2	3.2	0.36748	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.172	0.42915	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C6orf103	147151440	0.931000	0.31567	0.390000	0.26220	0.027000	0.11550	1.752000	0.38349	2.099000	0.63709	0.655000	0.94253	.	.		0.413	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	Intron
ANKHD1	54882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	139889380	139889380	+	Silent	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:139889380T>C	ENST00000360839.2	+	21	4078	c.3924T>C	c.(3922-3924)tgT>tgC	p.C1308C	ANKHD1_ENST00000297183.6_Silent_p.C1308C|ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.C1308C	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1308						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAAATTTTGTGAACTCCTGA	0.353																																					p.C1308C		.											.	ANKHD1	185	0			c.T3924C						.						71.0	68.0	69.0					5																	139889380		2203	4300	6503	SO:0001819	synonymous_variant	54882	exon21			ATTTTGTGAACTC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.3924T>C	5.37:g.139889380T>C		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	56.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	T	8.191	0.795937	0.16327	.	.	ENSG00000131503	ENST00000246149	.	.	.	5.49	4.31	0.51392	.	.	.	.	.	T	0.61362	0.2341	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59532	-0.7437	4	.	.	.	.	11.0534	0.47903	0.0:0.1264:0.0:0.8736	.	.	.	.	A	534	.	.	V	+	2	0	ANKHD1	139869564	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.373000	0.52394	2.213000	0.71641	0.477000	0.44152	GTG	.		0.353	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
ANKHD1	54882	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	139917173	139917173	+	Splice_Site	SNP	A	A	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:139917173A>T	ENST00000360839.2	+	31	7381	c.7227A>T	c.(7225-7227)tcA>tcT	p.S2409S	ANKHD1_ENST00000297183.6_Splice_Site_p.S2409S|ANKHD1-EIF4EBP3_ENST00000532219.1_Splice_Site_p.S2409S|ANKHD1_ENST00000544120.1_Splice_Site_p.S733S	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	2409						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGCTGTGTCAGGTACAATTG	0.458																																					p.S2409S		.											.	ANKHD1	185	0			c.A7227T						.						98.0	84.0	89.0					5																	139917173		2203	4300	6503	SO:0001630	splice_region_variant	54882	exon31			TGTGTCAGGTACA	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.7228+1A>T	5.37:g.139917173A>T		Somatic	121.0	1.0		WXS	Illumina HiSeq	Phase_I	130.0	37.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	37	CCDS4225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.93|13.93	2.383603|2.383603	0.42207|0.42207	.|.	.|.	ENSG00000131503|ENSG00000131503	ENST00000421706|ENST00000435794;ENST00000432301	.|.	.|.	.|.	5.78|5.78	4.62|4.62	0.57501|0.57501	.|.	.|.	.|.	.|.	.|.	T|.	0.57227|.	0.2039|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.55289|.	-0.8164|.	4|.	.|.	.|.	.|.	.|.	7.3782|7.3782	0.26841|0.26841	0.7906:0.0:0.0719:0.1375|0.7906:0.0:0.0719:0.1375	.|.	.|.	.|.	.|.	L|X	67|900;801	.|.	.|.	Q|R	+|+	2|1	0|2	ANKHD1|ANKHD1	139897357|139897357	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	0.793000|0.793000	0.26944|0.26944	2.333000|2.333000	0.79357|0.79357	0.482000|0.482000	0.46254|0.46254	CAG|AGA	.		0.458	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	Silent
APAF1	317	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	99060130	99060130	+	Missense_Mutation	SNP	C	C	A	rs371633206		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr12:99060130C>A	ENST00000551964.1	+	9	2093	c.1357C>A	c.(1357-1359)Ctt>Att	p.L453I	APAF1_ENST00000333991.1_Intron|APAF1_ENST00000357310.1_Missense_Mutation_p.L453I|APAF1_ENST00000550527.1_Missense_Mutation_p.L442I|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000359972.2_Missense_Mutation_p.L442I|APAF1_ENST00000549007.1_Missense_Mutation_p.L453I|APAF1_ENST00000547045.1_Missense_Mutation_p.L453I|APAF1_ENST00000339433.3_Missense_Mutation_p.L453I	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	453					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	TTGCAGCCAGCTTCAGGTACT	0.294																																					p.L453I		.											.	APAF1	229	0			c.C1357A						.						88.0	94.0	92.0					12																	99060130		2203	4300	6503	SO:0001583	missense	317	exon9			AGCCAGCTTCAGG	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.1357C>A	12.37:g.99060130C>A	ENSP00000448165:p.Leu453Ile	Somatic	161.0	1.0		WXS	Illumina HiSeq	Phase_I	183.0	61.0	NM_181868	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	37	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719896	0.68844	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.63417	-0.03;0.09;0.06;0.17;-0.04;0.06;0.17	5.77	4.88	0.63580	.	0.058799	0.64402	D	0.000002	T	0.70587	0.3241	L	0.52364	1.645	0.80722	D	1	P;B;B;D	0.56287	0.552;0.308;0.16;0.975	P;B;B;D	0.73708	0.716;0.434;0.25;0.981	T	0.66424	-0.5927	10	0.20519	T	0.43	-2.3957	11.6066	0.51035	0.0:0.8576:0.0:0.1424	.	453;442;453;442	O14727-4;O14727-3;O14727;O14727-2	.;.;APAF_HUMAN;.	I	453;442;453;453;442;453;453	ENSP00000448165:L453I;ENSP00000353059:L442I;ENSP00000349862:L453I;ENSP00000341830:L453I;ENSP00000448449:L442I;ENSP00000449791:L453I;ENSP00000448161:L453I	ENSP00000341830:L453I	L	+	1	0	APAF1	97584261	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.558000	0.36309	1.441000	0.47550	0.585000	0.79938	CTT	.		0.294	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1	
APBA2	321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	29398965	29398965	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr15:29398965C>T	ENST00000558402.1	+	13	2459	c.1860C>T	c.(1858-1860)tcC>tcT	p.S620S	APBA2_ENST00000411764.1_Silent_p.S608S|APBA2_ENST00000561069.1_Silent_p.S620S|APBA2_ENST00000558259.1_Silent_p.S620S|APBA2_ENST00000558330.1_Silent_p.S608S			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	620	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		AGATCATGTCCATCAATGGCA	0.657																																					p.S620S		.											.	APBA2	90	0			c.C1860T						.						64.0	60.0	61.0					15																	29398965		2203	4300	6503	SO:0001819	synonymous_variant	321	exon11			CATGTCCATCAAT	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.1860C>T	15.37:g.29398965C>T		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	40.0	NM_005503	E9PGI4|O60571|Q5XKC0	Silent	SNP	ENST00000558402.1	37	CCDS10022.1																																																																																			.		0.657	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
ATXN1	6310	broad.mit.edu;mdanderson.org	37	6	16327891	16327891	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:16327891C>A	ENST00000244769.4	-	8	1587	c.651G>T	c.(649-651)caG>caT	p.Q217H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q217H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	217	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.Q217H(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgctgct	0.657																																					p.Q217H		.											.	ATXN1	93	1	Substitution - Missense(1)	lung(1)	c.G651T						.																																			SO:0001583	missense	6310	exon7			CTGCTGCTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.651G>T	6.37:g.16327891C>A	ENSP00000244769:p.Gln217His	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	6.0	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	-	6.133	0.392825	0.11638	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.63913	-0.07;-0.07	0.753	-0.262	0.12958	.	.	.	.	.	T	0.14657	0.0354	N	0.08118	0	0.09310	N	1	B	0.28713	0.22	B	0.17979	0.02	T	0.12344	-1.0551	9	0.54805	T	0.06	.	3.1001	0.06323	0.0:0.6446:0.0:0.3554	.	217	P54253	ATX1_HUMAN	H	217	ENSP00000244769:Q217H;ENSP00000416360:Q217H	ENSP00000244769:Q217H	Q	-	3	2	ATXN1	16435870	0.069000	0.21087	0.004000	0.12327	0.137000	0.21094	0.232000	0.17891	-0.113000	0.11958	0.121000	0.15741	CAG	.		0.657	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
BBX	56987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	107510138	107510138	+	Missense_Mutation	SNP	C	C	T	rs138504832		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:107510138C>T	ENST00000325805.8	+	15	2632	c.2345C>T	c.(2344-2346)cCt>cTt	p.P782L	BBX_ENST00000416476.2_Silent_p.L446L|BBX_ENST00000402543.1_Intron|BBX_ENST00000406780.1_Missense_Mutation_p.P752L|BBX_ENST00000415149.2_Missense_Mutation_p.P752L|BBX_ENST00000473542.1_3'UTR			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	782					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			GCCATTCACCCTACAGAAGGT	0.338																																					p.P782L		.											.	BBX	94	0			c.C2345T						.						97.0	93.0	94.0					3																	107510138		2203	4300	6503	SO:0001583	missense	56987	exon15			TTCACCCTACAGA	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.2345C>T	3.37:g.107510138C>T	ENSP00000319974:p.Pro782Leu	Somatic	215.0	0.0		WXS	Illumina HiSeq	Phase_I	230.0	53.0	NM_001142568	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	37	CCDS46881.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872662	0.51695	.	.	ENSG00000114439	ENST00000415149;ENST00000325805;ENST00000406780	T;T;T	0.30448	1.53;1.81;1.53	5.11	4.16	0.48862	.	0.577026	0.19862	N	0.104420	T	0.16171	0.0389	N	0.19112	0.55	0.36056	D	0.841114	P;B	0.36222	0.544;0.4	B;B	0.27170	0.072;0.077	T	0.14783	-1.0460	10	0.87932	D	0	-8.2148	7.6738	0.28473	0.0:0.8847:0.0:0.1153	.	782;752	Q8WY36;Q8WY36-2	BBX_HUMAN;.	L	752;782;752	ENSP00000408358:P752L;ENSP00000319974:P782L;ENSP00000385530:P752L	ENSP00000319974:P782L	P	+	2	0	BBX	108992828	0.999000	0.42202	1.000000	0.80357	0.982000	0.71751	1.992000	0.40737	2.656000	0.90262	0.557000	0.71058	CCT	C|1.000;A|0.000		0.338	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235	
C9orf64	84267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	86571114	86571114	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr9:86571114G>A	ENST00000376344.3	-	1	518	c.302C>T	c.(301-303)tCc>tTc	p.S101F	C9orf64_ENST00000314700.1_5'UTR|C9orf64_ENST00000376340.2_5'UTR	NM_032307.3	NP_115683.3	Q5T6V5	CI064_HUMAN	chromosome 9 open reading frame 64	101										central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						GGCGCACAGGGACCAGTACCC	0.547																																					p.S101F		.											.	C9orf64	90	0			c.C302T						.						133.0	132.0	133.0					9																	86571114		2074	4207	6281	SO:0001583	missense	84267	exon1			CACAGGGACCAGT	AK090882	CCDS6666.2	9q22.1	2014-06-11			ENSG00000165118	ENSG00000165118			28144	protein-coding gene	gene with protein product		611342				24911101	Standard	NM_032307		Approved	MGC10999	uc004anb.3	Q5T6V5	OTTHUMG00000020111	ENST00000376344.3:c.302C>T	9.37:g.86571114G>A	ENSP00000365522:p.Ser101Phe	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	10.0	NM_032307	B2RPI6|Q8N2B1|Q9BT18	Missense_Mutation	SNP	ENST00000376344.3	37	CCDS6666.2	.	.	.	.	.	.	.	.	.	.	G	35	5.542036	0.96474	.	.	ENSG00000165118	ENST00000376344	.	.	.	5.3	5.3	0.74995	.	0.353084	0.29389	N	0.012286	T	0.81654	0.4868	M	0.86805	2.84	0.80722	D	1	P	0.47484	0.896	P	0.54210	0.745	D	0.84544	0.0640	9	0.66056	D	0.02	-5.9596	19.3129	0.94198	0.0:0.0:1.0:0.0	.	101	Q5T6V5	CI064_HUMAN	F	101	.	ENSP00000365522:S101F	S	-	2	0	C9orf64	85760934	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.447000	0.97595	2.645000	0.89757	0.563000	0.77884	TCC	.		0.547	C9orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052865.1	NM_032307	
CACNG7	59284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54417766	54417766	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr19:54417766G>T	ENST00000391767.1	+	3	421	c.209G>T	c.(208-210)gGt>gTt	p.G70V	CACNG7_ENST00000391766.1_Missense_Mutation_p.G70V|CACNG7_ENST00000222212.2_Missense_Mutation_p.G70V|CACNG7_ENST00000468076.1_Intron			P62955	CCG7_HUMAN	calcium channel, voltage-dependent, gamma subunit 7	70					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		CGGGAGAAAGGTCGCTGTGTG	0.557																																					p.G70V		.											.	CACNG7	91	0			c.G209T						.						68.0	60.0	63.0					19																	54417766		2203	4300	6503	SO:0001583	missense	59284	exon2			AGAAAGGTCGCTG	AF288387	CCDS12868.1	19q13.4	2008-05-02			ENSG00000105605	ENSG00000105605		"""Calcium channel subunits"""	13626	protein-coding gene	gene with protein product		606899				11170751	Standard	NM_031896		Approved		uc002qcr.2	P62955	OTTHUMG00000064852	ENST00000391767.1:c.209G>T	19.37:g.54417766G>T	ENSP00000375647:p.Gly70Val	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	31.0	NM_031896	Q52LL8|Q8VBX3|Q8WXS6|Q9BXT1	Missense_Mutation	SNP	ENST00000391767.1	37	CCDS12868.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688098	0.68271	.	.	ENSG00000105605	ENST00000391767;ENST00000222212;ENST00000391766	D;D;D	0.88431	-2.38;-2.38;-2.38	3.14	3.14	0.36123	.	0.000000	0.85682	D	0.000000	D	0.93158	0.7821	M	0.82193	2.58	0.80722	D	1	D	0.61697	0.99	D	0.63033	0.91	D	0.92969	0.6396	10	0.46703	T	0.11	-8.4437	12.5577	0.56263	0.0:0.0:1.0:0.0	.	70	P62955	CCG7_HUMAN	V	70	ENSP00000375647:G70V;ENSP00000222212:G70V;ENSP00000375646:G70V	ENSP00000222212:G70V	G	+	2	0	CACNG7	59109578	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.208000	0.89748	2.084000	0.62774	0.561000	0.74099	GGT	.		0.557	CACNG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139240.2		
CDHR1	92211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	85971460	85971460	+	Silent	SNP	T	T	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr10:85971460T>A	ENST00000372117.3	+	14	1645	c.1542T>A	c.(1540-1542)acT>acA	p.T514T	CDHR1_ENST00000440770.2_Silent_p.T218T|CDHR1_ENST00000332904.3_Silent_p.T514T	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	514	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CCTATGGGACTGGGGCAGACC	0.587																																					p.T514T		.											.	CDHR1	91	0			c.T1542A						.						112.0	111.0	112.0					10																	85971460		2203	4300	6503	SO:0001819	synonymous_variant	92211	exon14			TGGGACTGGGGCA	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1542T>A	10.37:g.85971460T>A		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	24.0	NM_001171971	Q69YZ8|Q8IXY5	Silent	SNP	ENST00000372117.3	37	CCDS7372.1																																																																																			.		0.587	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	180062616	180062617	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:180062616_180062617insT	ENST00000367607.3	+	34	7794_7795	c.7376_7377insT	c.(7375-7380)aagtccfs	p.KS2459fs	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2459					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TTGGAACTCAAGTCCCCTACTG	0.465																																					p.K2459fs		.											.	CEP350	26	0			c.7376_7377insT						.																																			SO:0001589	frameshift_variant	9857	exon34			AACTCAAGTCCCC	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	Exception_encountered	1.37:g.180062616_180062617insT	ENSP00000356579:p.Lys2459fs	Somatic	252.0	0.0		WXS	Illumina HiSeq	Phase_I	325.0	154.0	NM_014810	O75068|Q8TDK3|Q8WY20	Frame_Shift_Ins	INS	ENST00000367607.3	37	CCDS1336.1																																																																																			.		0.465	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
COPG1	22820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	128973580	128973580	+	Silent	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:128973580C>A	ENST00000314797.6	+	6	497	c.393C>A	c.(391-393)atC>atA	p.I131I		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	131					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										TCTGCCAGATCACTGATGTGA	0.562																																					p.I131I		.											.	.	.	0			c.C393A						.						54.0	57.0	56.0					3																	128973580		2203	4300	6503	SO:0001819	synonymous_variant	22820	exon6			CCAGATCACTGAT	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.393C>A	3.37:g.128973580C>A		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	11.0	NM_016128	A8K6M8|B3KMF6|Q54AC4	Silent	SNP	ENST00000314797.6	37	CCDS33851.1																																																																																			.		0.562	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355456.1	NM_016128	
CYP4A22	284541	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	47609480	47609481	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:47609480_47609481insT	ENST00000371891.3	+	6	713_714	c.682_683insT	c.(682-684)gttfs	p.V228fs	CYP4A22_ENST00000371890.3_Intron|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000294337.3_Frame_Shift_Ins_p.V228fs|CYP4A22_ENST00000485117.1_3'UTR	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	228						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAACAGCCTGGTTTTTTGCTGT	0.55																																					p.V228fs	Pancreas(88;1240 1470 2099 14214 37557)	.											.	CYP4A22	139	0			c.682_683insT						.																																			SO:0001589	frameshift_variant	284541	exon6			AGCCTGGTTTTTT		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.688dupT	1.37:g.47609486_47609486dupT	ENSP00000360958:p.Val228fs	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	47.0	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Frame_Shift_Ins	INS	ENST00000371891.3	37	CCDS30707.1																																																																																			.		0.550	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
DEPDC1	55635	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	68944871	68944874	+	Frame_Shift_Del	DEL	GTAA	GTAA	-	rs534583672		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	GTAA	GTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:68944871_68944874delGTAA	ENST00000456315.2	-	10	2179_2182	c.2065_2068delTTAC	c.(2065-2070)ttacagfs	p.LQ689fs	RP4-694A7.2_ENST00000425820.1_RNA|DEPDC1_ENST00000370966.5_Frame_Shift_Del_p.LQ405fs	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	689					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		ACTGCAGTCTGTAAGTAAGAGGGT	0.377																																					p.689_690del		.											.	DEPDC1	90	0			c.2065_2068del						.																																			SO:0001589	frameshift_variant	55635	exon10			CAGTCTGTAAGTA	AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.2065_2068delTTAC	1.37:g.68944875_68944878delGTAA	ENSP00000412292:p.Leu689fs	Somatic	209.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	51.0	NM_001114120	A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Frame_Shift_Del	DEL	ENST00000456315.2	37	CCDS44159.1																																																																																			.		0.377	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025514.2	NM_017779	
DFNA5	1687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	24758722	24758722	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr7:24758722T>C	ENST00000342947.3	-	4	945	c.520A>G	c.(520-522)Atg>Gtg	p.M174V	DFNA5_ENST00000419307.1_Missense_Mutation_p.M10V|DFNA5_ENST00000409970.1_Missense_Mutation_p.M10V|DFNA5_ENST00000409775.3_Missense_Mutation_p.M174V|DFNA5_ENST00000559637.1_5'UTR|DFNA5_ENST00000545231.1_Missense_Mutation_p.M10V	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	174			M -> T (in dbSNP:rs876306).		apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TCGACCTGCATGTGCTCAGAG	0.572																																					p.M174V	GBM(78;184 1250 20134 20900 23600)	.											.	DFNA5	91	0			c.A520G						.						244.0	191.0	209.0					7																	24758722		2203	4300	6503	SO:0001583	missense	1687	exon4			CCTGCATGTGCTC	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.520A>G	7.37:g.24758722T>C	ENSP00000339587:p.Met174Val	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	15.0	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	37	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.425193	0.00186	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775;ENST00000414428	T;T;T;T;T;T	0.38077	2.07;2.07;2.07;2.07;2.07;1.16	5.17	-2.25	0.06888	.	0.789923	0.11854	N	0.523022	T	0.07999	0.0200	N	0.00170	-1.935	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41142	-0.9525	10	0.23302	T	0.38	-3.339	11.0721	0.48010	0.0:0.3196:0.0:0.6804	.	174;174	A4FTY0;O60443	.;DFNA5_HUMAN	V	174;10;10;10;174;10	ENSP00000339587:M174V;ENSP00000401332:M10V;ENSP00000442661:M10V;ENSP00000387119:M10V;ENSP00000386670:M174V;ENSP00000413963:M10V	ENSP00000339587:M174V	M	-	1	0	DFNA5	24725247	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-1.261000	0.02855	-0.268000	0.09312	-0.242000	0.12053	ATG	.		0.572	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
DNAH10	196385	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124414218	124414218	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr12:124414218T>C	ENST00000409039.3	+	71	12195	c.12170T>C	c.(12169-12171)aTg>aCg	p.M4057T	CCDC92_ENST00000544798.1_Intron|DNAH10OS_ENST00000514254.2_3'UTR	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4057	AAA 6. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AAGGTCTGCATGGAAATTCTG	0.493																																					p.M4057T		.											.	DNAH10	95	0			c.T12170C						.						51.0	48.0	49.0					12																	124414218		1896	4119	6015	SO:0001583	missense	196385	exon71			TCTGCATGGAAAT	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.12170T>C	12.37:g.124414218T>C	ENSP00000386770:p.Met4057Thr	Somatic	114.0	1.0		WXS	Illumina HiSeq	Phase_I	111.0	38.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	T	9.809	1.182751	0.21870	.	.	ENSG00000197653	ENST00000409039	T	0.08193	3.12	5.06	5.06	0.68205	Dynein heavy chain (1);	0.043119	0.85682	D	0.000000	T	0.08758	0.0217	L	0.33485	1.01	0.80722	D	1	B	0.28470	0.213	B	0.30401	0.115	T	0.28586	-1.0039	10	0.30078	T	0.28	.	15.1038	0.72303	0.0:0.0:0.0:1.0	.	4057	Q8IVF4	DYH10_HUMAN	T	4057	ENSP00000386770:M4057T	ENSP00000386770:M4057T	M	+	2	0	DNAH10	122980171	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	6.100000	0.71473	2.038000	0.60285	0.533000	0.62120	ATG	.		0.493	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH12	201625	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57454649	57454649	+	Silent	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:57454649T>C	ENST00000351747.2	-	17	2343	c.2163A>G	c.(2161-2163)gaA>gaG	p.E721E	DNAH12_ENST00000389536.4_Silent_p.E721E|snoU13_ENST00000459308.1_RNA	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	721	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GGGAAAACTCTTCCACATCAG	0.368																																					p.E721E		.											.	DNAH12	47	0			c.A2163G						.						82.0	63.0	69.0					3																	57454649		692	1591	2283	SO:0001819	synonymous_variant	201625	exon17			AAACTCTTCCACA	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.2163A>G	3.37:g.57454649T>C		Somatic	114.0	1.0		WXS	Illumina HiSeq	Phase_I	131.0	50.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	ENST00000351747.2	37																																																																																				.		0.368	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
DPYD	1806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	98164998	98164998	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:98164998G>A	ENST00000370192.3	-	6	689	c.589C>T	c.(589-591)Cct>Tct	p.P197S	DPYD_ENST00000474241.1_5'UTR|DPYD_ENST00000423006.2_3'UTR	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	197					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	ATACTTGCAGGCCCAGCACCA	0.423																																					p.P197S		.											.	DPYD	278	0			c.C589T						.						161.0	159.0	160.0					1																	98164998		2203	4300	6503	SO:0001583	missense	1806	exon6			TTGCAGGCCCAGC	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.589C>T	1.37:g.98164998G>A	ENSP00000359211:p.Pro197Ser	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	51.0	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.776208	0.90195	.	.	ENSG00000188641	ENST00000370192	D	0.96774	-4.12	5.5	5.5	0.81552	Alpha-helical ferredoxin (1);	0.000000	0.85682	D	0.000000	D	0.98356	0.9454	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99177	1.0866	10	0.87932	D	0	-15.1612	19.3869	0.94560	0.0:0.0:1.0:0.0	.	197	Q12882	DPYD_HUMAN	S	197	ENSP00000359211:P197S	ENSP00000359211:P197S	P	-	1	0	DPYD	97937586	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	9.431000	0.97494	2.591000	0.87537	0.585000	0.79938	CCT	.		0.423	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
EDIL3	10085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	83680126	83680126	+	Splice_Site	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:83680126C>T	ENST00000296591.5	-	1	485	c.67G>A	c.(67-69)Ggt>Agt	p.G23S	CTD-2269F5.1_ENST00000502253.1_RNA|EDIL3_ENST00000380138.3_Splice_Site_p.G23S|CTD-2269F5.1_ENST00000507060.1_RNA|CTD-2269F5.1_ENST00000515688.1_RNA|CTD-2269F5.1_ENST00000509406.1_RNA|CTD-2269F5.1_ENST00000514696.1_RNA	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	23					cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		GACGCCTTACCTTTGCCGAAC	0.697																																					p.G23S		.											.	EDIL3	131	0			c.G67A						.						64.0	69.0	68.0					5																	83680126		2203	4300	6503	SO:0001630	splice_region_variant	10085	exon1			CCTTACCTTTGCC	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.67+1G>A	5.37:g.83680126C>T		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	15.0	NM_005711	B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.849616	0.51270	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.92752	-3.09;-3.1	4.26	4.26	0.50523	Epidermal growth factor-like, type 3 (1);	0.317991	0.22874	N	0.054593	D	0.85557	0.5724	N	0.21508	0.67	0.42244	D	0.991945	B;B	0.30021	0.004;0.265	B;B	0.33454	0.001;0.164	T	0.82086	-0.0631	9	.	.	.	-7.018	12.3834	0.55320	0.0:1.0:0.0:0.0	.	23;23	O43854-2;O43854	.;EDIL3_HUMAN	S	23	ENSP00000296591:G23S;ENSP00000369483:G23S	.	G	-	1	0	EDIL3	83715882	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	4.017000	0.57167	2.389000	0.81357	0.491000	0.48974	GGT	.		0.697	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711	Missense_Mutation
EPHA1	2041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	143095957	143095957	+	Missense_Mutation	SNP	G	G	T	rs370810516		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr7:143095957G>T	ENST00000275815.3	-	6	1159	c.1073C>A	c.(1072-1074)aCg>aAg	p.T358K		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	358	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GCGTCCCCCCGTATCTGCTGG	0.667																																					p.T358K		.											.	EPHA1	1436	0			c.C1073A						.						32.0	29.0	30.0					7																	143095957		2203	4300	6503	SO:0001583	missense	2041	exon6			CCCCCCGTATCTG	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1073C>A	7.37:g.143095957G>T	ENSP00000275815:p.Thr358Lys	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	23.0	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	37	CCDS5884.1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.473010	0.26423	.	.	ENSG00000146904	ENST00000275815	T	0.57752	0.38	5.09	-6.72	0.01755	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.799430	0.02200	N	0.062196	T	0.53318	0.1789	L	0.52905	1.665	0.09310	N	1	B	0.22480	0.07	B	0.32211	0.142	T	0.55829	-0.8079	10	0.62326	D	0.03	.	15.5735	0.76356	0.1555:0.0:0.7204:0.1241	.	358	P21709	EPHA1_HUMAN	K	358	ENSP00000275815:T358K	ENSP00000275815:T358K	T	-	2	0	EPHA1	142806079	0.000000	0.05858	0.000000	0.03702	0.518000	0.34316	-0.376000	0.07465	-1.224000	0.02581	-1.021000	0.02439	ACG	.		0.667	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
EPHA1	2041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	143095959	143095959	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr7:143095959A>T	ENST00000275815.3	-	6	1157	c.1071T>A	c.(1069-1071)gaT>gaA	p.D357E		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	357	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GTCCCCCCGTATCTGCTGGGG	0.662																																					p.D357E		.											.	EPHA1	1436	0			c.T1071A						.						31.0	28.0	29.0					7																	143095959		2203	4300	6503	SO:0001583	missense	2041	exon6			CCCCGTATCTGCT	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1071T>A	7.37:g.143095959A>T	ENSP00000275815:p.Asp357Glu	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	22.0	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	37	CCDS5884.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.429602	0.43122	.	.	ENSG00000146904	ENST00000275815	T	0.56103	0.48	5.09	-3.69	0.04450	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000006	T	0.43255	0.1239	L	0.58428	1.81	0.21064	N	0.999799	B	0.25390	0.125	B	0.18263	0.021	T	0.31024	-0.9958	10	0.42905	T	0.14	.	13.8412	0.63439	0.466:0.0:0.534:0.0	.	357	P21709	EPHA1_HUMAN	E	357	ENSP00000275815:D357E	ENSP00000275815:D357E	D	-	3	2	EPHA1	142806081	0.001000	0.12720	0.001000	0.08648	0.505000	0.33919	-0.171000	0.09883	-0.851000	0.04147	-0.263000	0.10527	GAT	.		0.662	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
EXOSC3	51010	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	37784995	37784995	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr9:37784995C>T	ENST00000327304.5	-	1	59	c.47G>A	c.(46-48)aGg>aAg	p.R16K	RP11-613M10.9_ENST00000540557.1_Intron|EXOSC3_ENST00000396521.3_Missense_Mutation_p.R16K|EXOSC3_ENST00000490516.1_5'Flank	NM_016042.3	NP_057126.2	Q9NQT5	EXOS3_HUMAN	exosome component 3	16					CUT catabolic process (GO:0071034)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|isotype switching (GO:0045190)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of isotype switching (GO:0045830)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(1)	4				GBM - Glioblastoma multiforme(29;0.00771)|Lung(182;0.221)		AGCGCGCGCCCTGCTGCCCGC	0.687																																					p.R16K		.											.	EXOSC3	135	0			c.G47A						.						23.0	23.0	23.0					9																	37784995		2200	4299	6499	SO:0001583	missense	51010	exon1			CGCGCCCTGCTGC	BC002437	CCDS35016.1, CCDS43805.1	9p11	2009-01-20			ENSG00000107371	ENSG00000107371			17944	protein-coding gene	gene with protein product	"""exosome component Rrp40"", ""CGI-102 protein"""	606489				10810093, 11110791	Standard	NM_016042		Approved	hRrp40p, Rrp40p, RRP40, CGI-102, p10, hRrp-40	uc004aal.3	Q9NQT5	OTTHUMG00000019932	ENST00000327304.5:c.47G>A	9.37:g.37784995C>T	ENSP00000323046:p.Arg16Lys	Somatic	63.0	1.0		WXS	Illumina HiSeq	Phase_I	42.0	18.0	NM_016042	A8K0K6|Q5QP85|Q9Y3A8	Missense_Mutation	SNP	ENST00000327304.5	37	CCDS35016.1	.	.	.	.	.	.	.	.	.	.	C	6.480	0.456796	0.12283	.	.	ENSG00000107371	ENST00000327304;ENST00000396521	T;D	0.86164	-1.37;-2.08	5.27	0.00181	0.14048	.	0.625964	0.17478	N	0.172846	T	0.71375	0.3332	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.53995	-0.8359	10	0.05959	T	0.93	4.622	7.4979	0.27500	0.0:0.4805:0.0:0.5195	.	16;16	A8K0K6;Q9NQT5	.;EXOS3_HUMAN	K	16	ENSP00000323046:R16K;ENSP00000379775:R16K	ENSP00000323046:R16K	R	-	2	0	EXOSC3	37774995	0.001000	0.12720	0.033000	0.17914	0.101000	0.19017	-0.327000	0.07955	0.021000	0.15133	0.561000	0.74099	AGG	.		0.687	EXOSC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052478.3	NM_016042	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	66044982	66044982	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:66044982G>T	ENST00000370621.3	-	11	2183	c.1657C>A	c.(1657-1659)Cta>Ata	p.L553I	EYS_ENST00000393380.2_Missense_Mutation_p.L553I|EYS_ENST00000342421.5_Missense_Mutation_p.L553I|EYS_ENST00000370616.2_Missense_Mutation_p.L553I|EYS_ENST00000370618.3_Missense_Mutation_p.L553I|EYS_ENST00000503581.1_Missense_Mutation_p.L553I			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	553					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AGAAAACATAGATACCGATAT	0.353																																					p.L553I		.											.	EYS	660	0			c.C1657A						.						178.0	162.0	167.0					6																	66044982		2203	4300	6503	SO:0001583	missense	346007	exon11			AACATAGATACCG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1657C>A	6.37:g.66044982G>T	ENSP00000359655:p.Leu553Ile	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	53.0	NM_001142801	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	g	8.908	0.957920	0.18507	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54;-1.54	3.8	0.572	0.17357	.	.	.	.	.	T	0.42017	0.1184	N	0.24115	0.695	0.09310	N	1	B;B;B	0.27997	0.015;0.129;0.197	B;B;B	0.20767	0.031;0.031;0.014	T	0.17806	-1.0357	9	0.33940	T	0.23	.	3.6042	0.08037	0.1284:0.0:0.4253:0.4463	.	553;553;553	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	I	553	ENSP00000424243:L553I;ENSP00000359655:L553I;ENSP00000359650:L553I;ENSP00000377042:L553I;ENSP00000341818:L553I;ENSP00000359652:L553I	ENSP00000341818:L553I	L	-	1	2	EYS	66101703	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.527000	0.22987	0.671000	0.31185	0.491000	0.48974	CTA	.		0.353	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FAM127C	441518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	134156305	134156305	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:134156305G>A	ENST00000391440.1	-	1	254	c.185C>T	c.(184-186)gCc>gTc	p.A62V		NM_001078173.1	NP_001071641.1	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	62										breast(1)|endometrium(2)|large_intestine(1)|lung(2)	6	Acute lymphoblastic leukemia(192;0.000127)					CACCTTCAGGGCGTCGTTGGA	0.602																																					p.A62V		.											.	FAM127C	62	0			c.C185T						.						63.0	68.0	67.0					X																	134156305		2097	4207	6304	SO:0001583	missense	441518	exon1			TTCAGGGCGTCGT	BC048268	CCDS43996.1	Xq26.3	2014-05-16			ENSG00000212747	ENSG00000212747			33156	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078173		Approved	MAR8B, CXX1c	uc004eyc.1	Q17RB0	OTTHUMG00000022464	ENST00000391440.1:c.185C>T	X.37:g.134156305G>A	ENSP00000375268:p.Ala62Val	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	54.0	NM_001078173		Missense_Mutation	SNP	ENST00000391440.1	37	CCDS43996.1	.	.	.	.	.	.	.	.	.	.	g	14.44	2.535163	0.45176	.	.	ENSG00000212747	ENST00000391440	T	0.30448	1.53	2.35	1.38	0.22167	.	1.095140	0.07417	U	0.893459	T	0.30792	0.0776	M	0.66939	2.045	0.21627	N	0.999616	B	0.31949	0.348	B	0.32980	0.156	T	0.30475	-0.9977	10	0.34782	T	0.22	.	5.3275	0.15915	0.0:0.0:0.6638:0.3362	.	62	Q17RB0	F127C_HUMAN	V	62	ENSP00000375268:A62V	ENSP00000375268:A62V	A	-	2	0	FAM127C	133983971	0.747000	0.28283	0.967000	0.41034	0.955000	0.61496	0.112000	0.15479	0.360000	0.24265	0.436000	0.28706	GCC	.		0.602	FAM127C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058389.2	NM_001078173	
FAM184A	79632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	119345814	119345814	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:119345814A>C	ENST00000338891.7	-	2	767	c.324T>G	c.(322-324)atT>atG	p.I108M	FAM184A_ENST00000521531.1_Missense_Mutation_p.I108M|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000352896.5_De_novo_Start_InFrame|FAM184A_ENST00000522284.1_De_novo_Start_InFrame|FAM184A_ENST00000368475.4_De_novo_Start_InFrame	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	108						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						CTAAAACTTGAATCTTTCTTC	0.333																																					p.I108M		.											.	FAM184A	519	0			c.T324G						.						98.0	88.0	91.0					6																	119345814		1836	4090	5926	SO:0001583	missense	79632	exon2			AACTTGAATCTTT	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.324T>G	6.37:g.119345814A>C	ENSP00000342604:p.Ile108Met	Somatic	206.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	73.0	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	A	13.01	2.110681	0.37242	.	.	ENSG00000111879	ENST00000338891;ENST00000521531	T;T	0.31769	1.48;1.48	5.82	-1.67	0.08238	.	0.060841	0.64402	D	0.000004	T	0.34774	0.0909	M	0.68317	2.08	0.80722	D	1	D	0.69078	0.997	D	0.63703	0.917	T	0.45308	-0.9270	10	0.62326	D	0.03	-12.4391	12.8401	0.57797	0.514:0.0:0.486:0.0	.	108	Q8NB25	F184A_HUMAN	M	108	ENSP00000342604:I108M;ENSP00000430442:I108M	ENSP00000342604:I108M	I	-	3	3	FAM184A	119387513	0.998000	0.40836	0.998000	0.56505	0.371000	0.29859	0.745000	0.26259	-0.061000	0.13110	-0.250000	0.11733	ATT	.		0.333	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
FAM47A	158724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	34149524	34149524	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:34149524G>C	ENST00000346193.3	-	1	923	c.872C>G	c.(871-873)aCa>aGa	p.T291R		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	291										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ACCAGGCTCTGTGGGTTCGTC	0.572																																					p.T291R		.											.	FAM47A	134	0			c.C872G						.						24.0	26.0	25.0					X																	34149524		2202	4300	6502	SO:0001583	missense	158724	exon1			GGCTCTGTGGGTT	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.872C>G	X.37:g.34149524G>C	ENSP00000345029:p.Thr291Arg	Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	43.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	g	1.507	-0.550591	0.03996	.	.	ENSG00000185448	ENST00000346193	T	0.19105	2.17	0.13	0.13	0.14746	.	.	.	.	.	T	0.21186	0.0510	L	0.38175	1.15	0.09310	N	0.999999	P	0.47106	0.89	P	0.52554	0.702	T	0.21381	-1.0247	8	0.18276	T	0.48	.	.	.	.	.	291	Q5JRC9	FA47A_HUMAN	R	291	ENSP00000345029:T291R	ENSP00000345029:T291R	T	-	2	0	FAM47A	34059445	0.848000	0.29623	0.032000	0.17829	0.032000	0.12392	0.110000	0.15437	0.171000	0.19730	0.173000	0.16961	ACA	.		0.572	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
GPR157	80045	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	9188904	9188904	+	Silent	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:9188904G>A	ENST00000377411.4	-	1	325	c.183C>T	c.(181-183)gcC>gcT	p.A61A	GPR157_ENST00000414642.2_Silent_p.A61A	NM_024980.4	NP_079256.4	Q5UAW9	GP157_HUMAN	G protein-coupled receptor 157	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			lung(4)|prostate(1)	5	all_lung(157;0.185)	all_epithelial(116;5.02e-20)|all_lung(118;3.6e-06)|Lung NSC(185;7.93e-06)|Renal(390;0.000147)|Breast(348;0.000688)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.16e-07)|COAD - Colon adenocarcinoma(227;7.73e-05)|Kidney(185;0.000252)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.00178)|BRCA - Breast invasive adenocarcinoma(304;0.00186)|READ - Rectum adenocarcinoma(331;0.0642)		AGTAGGAGGCGGCCGAGAGCA	0.706																																					p.A61A		.											.	GPR157	514	0			c.C183T						.						12.0	12.0	12.0					1																	9188904		2191	4289	6480	SO:0001819	synonymous_variant	80045	exon1			GGAGGCGGCCGAG	AK022194	CCDS100.2	1p36.22	2012-08-21			ENSG00000180758	ENSG00000180758		"""GPCR / Class B : Orphans"""	23687	protein-coding gene	gene with protein product						10574461	Standard	XM_005263496		Approved	FLJ12132	uc001apq.1	Q5UAW9	OTTHUMG00000001758	ENST00000377411.4:c.183C>T	1.37:g.9188904G>A		Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	17.0	NM_024980	A2A334|Q8WWB8|Q9HA73	Silent	SNP	ENST00000377411.4	37	CCDS100.2																																																																																			.		0.706	GPR157-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127658.2	NM_024980	
GPR87	53836	hgsc.bcm.edu;broad.mit.edu	37	3	151017871	151017871	+	Silent	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:151017871C>A	ENST00000260843.4	-	2	482	c.18G>T	c.(16-18)acG>acT	p.T6T	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	NM_023915.3	NP_076404.3	Q9BY21	GPR87_HUMAN	G protein-coupled receptor 87	6					negative regulation of adenylate cyclase activity (GO:0007194)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(6)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	19			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATTTTGCAAGCGTCAAGTTGA	0.408																																					p.T6T		.											.	GPR87	153	0			c.G18T						.						105.0	96.0	99.0					3																	151017871		2203	4300	6503	SO:0001819	synonymous_variant	53836	exon2			TGCAAGCGTCAAG	AF237763	CCDS3157.1	3q24	2012-08-21			ENSG00000138271	ENSG00000138271		"""GPCR / Class A : Orphans"""	4538	protein-coding gene	gene with protein product		606379		GPR95		11273702	Standard	NM_023915		Approved		uc003eyt.2	Q9BY21	OTTHUMG00000159858	ENST00000260843.4:c.18G>T	3.37:g.151017871C>A		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_023915	Q5KU35|Q96JZ8|Q9BXC2	Silent	SNP	ENST00000260843.4	37	CCDS3157.1																																																																																			.		0.408	GPR87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357788.1		
HAPLN2	60484	broad.mit.edu;mdanderson.org	37	1	156594411	156594411	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:156594411A>G	ENST00000255039.1	+	6	982	c.575A>G	c.(574-576)gAc>gGc	p.D192G	HAPLN2_ENST00000494218.1_3'UTR	NM_021817.2	NP_068589.1	Q9GZV7	HPLN2_HUMAN	hyaluronan and proteoglycan link protein 2	192	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|establishment of blood-nerve barrier (GO:0008065)|extracellular matrix assembly (GO:0085029)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	7	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAGGGTCTGGACTGGTGTAAC	0.726																																					p.D192G		.											.	HAPLN2	90	0			c.A575G						.						15.0	17.0	16.0					1																	156594411		2199	4295	6494	SO:0001583	missense	60484	exon6			GTCTGGACTGGTG	AB049054	CCDS1148.1	1q23.1	2013-01-11			ENSG00000132702	ENSG00000132702		"""Immunoglobulin superfamily / V-set domain containing"""	17410	protein-coding gene	gene with protein product	"""brain link protein 1"""					11027579, 11873941	Standard	NM_021817		Approved	BRAL1	uc001fpn.1	Q9GZV7	OTTHUMG00000033205	ENST00000255039.1:c.575A>G	1.37:g.156594411A>G	ENSP00000255039:p.Asp192Gly	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	8.0	NM_021817	Q5T3J0	Missense_Mutation	SNP	ENST00000255039.1	37	CCDS1148.1	.	.	.	.	.	.	.	.	.	.	A	15.87	2.959518	0.53400	.	.	ENSG00000132702	ENST00000255039;ENST00000544775	T	0.11930	2.73	4.19	4.19	0.49359	C-type lectin fold (1);Link (5);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.38825	0.1055	H	0.94771	3.58	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.54662	-0.8260	10	0.72032	D	0.01	-35.81	12.5086	0.55995	1.0:0.0:0.0:0.0	.	192	Q9GZV7	HPLN2_HUMAN	G	192;165	ENSP00000255039:D192G	ENSP00000255039:D192G	D	+	2	0	HAPLN2	154861035	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	2.064000	0.41432	1.880000	0.54463	0.460000	0.39030	GAC	.		0.726	HAPLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081039.1	NM_021817	
HDC	3067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	50534990	50534990	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr15:50534990G>A	ENST00000267845.3	-	12	1858	c.1456C>T	c.(1456-1458)Cgg>Tgg	p.R486W	HDC_ENST00000543581.1_Missense_Mutation_p.R453W|RN7SL494P_ENST00000461517.2_RNA	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		TTCCCAACCCGAGGGCTGGGT	0.567																																					p.R486W	GBM(95;1627 1936 6910 9570)	.											.	HDC	156	0			c.C1456T						.						42.0	47.0	45.0					15																	50534990		2196	4295	6491	SO:0001583	missense	3067	exon12			CAACCCGAGGGCT		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1456C>T	15.37:g.50534990G>A	ENSP00000267845:p.Arg486Trp	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	17.0	NM_002112		Missense_Mutation	SNP	ENST00000267845.3	37	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	G	9.894	1.204922	0.22205	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.09723	3.05;2.95	5.95	2.89	0.33648	.	0.851923	0.10338	N	0.686708	T	0.08626	0.0214	L	0.34521	1.04	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.31138	-0.9954	10	0.66056	D	0.02	-0.653	4.7158	0.12894	0.0822:0.2438:0.549:0.125	.	453;486	B7ZM01;P19113	.;DCHS_HUMAN	W	486;453	ENSP00000267845:R486W;ENSP00000440252:R453W	ENSP00000267845:R486W	R	-	1	2	HDC	48322282	0.446000	0.25665	0.029000	0.17559	0.246000	0.25737	1.871000	0.39539	0.844000	0.35094	0.563000	0.77884	CGG	.		0.567	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1		
HS6ST3	266722	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	97484795	97484795	+	Silent	SNP	C	C	T	rs368146960		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr13:97484795C>T	ENST00000376705.2	+	2	783	c.759C>T	c.(757-759)agC>agT	p.S253S		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	253	3'-phosphate binding. {ECO:0000255}.				heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					GTTACCTGAGCGAGTGGAAAC	0.473																																					p.S253S		.											.	HS6ST3	92	0			c.C759T						.	C		1,4405	2.1+/-5.4	0,1,2202	67.0	68.0	68.0		759	-3.3	1.0	13		68	0,8600		0,0,4300	no	coding-synonymous	HS6ST3	NM_153456.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		253/472	97484795	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	266722	exon2			CCTGAGCGAGTGG	AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.759C>T	13.37:g.97484795C>T		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	27.0	NM_153456	Q5W0L0|Q68CW6	Silent	SNP	ENST00000376705.2	37	CCDS9481.1																																																																																			.		0.473	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045517.2	NM_153456	
HSPA5	3309	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	128001549	128001549	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr9:128001549A>C	ENST00000324460.6	-	5	870	c.667T>G	c.(667-669)Ttt>Gtt	p.F223V	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	223					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CCCAGGTCAAACACCAGGATG	0.473										Prostate(1;0.17)																											p.F223V		.											.	HSPA5	230	0			c.T667G						.						63.0	69.0	67.0					9																	128001549		2203	4300	6503	SO:0001583	missense	3309	exon5			GGTCAAACACCAG		CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.667T>G	9.37:g.128001549A>C	ENSP00000324173:p.Phe223Val	Somatic	101.0	1.0		WXS	Illumina HiSeq	Phase_I	90.0	48.0	NM_005347	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	ENST00000324460.6	37	CCDS6863.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.406624	0.83230	.	.	ENSG00000044574	ENST00000324460;ENST00000401067	T	0.01106	5.33	4.36	4.36	0.52297	Heat shock protein 70, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.11110	0.0271	H	0.96048	3.76	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.01393	-1.1366	10	0.87932	D	0	-4.4423	12.735	0.57218	1.0:0.0:0.0:0.0	.	223	P11021	GRP78_HUMAN	V	223	ENSP00000324173:F223V	ENSP00000324173:F223V	F	-	1	0	HSPA5	127041370	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.311000	0.96282	1.599000	0.50093	0.379000	0.24179	TTT	.		0.473	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1		
ITGB3BP	23421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	63974243	63974243	+	Splice_Site	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:63974243T>C	ENST00000271002.10	-	2	87		c.e2-2		ITGB3BP_ENST00000283568.8_Splice_Site|ITGB3BP_ENST00000371092.3_Splice_Site	NM_014288.4	NP_055103.3	Q13352	CENPR_HUMAN	integrin beta 3 binding protein (beta3-endonexin)						apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9						CTTTTAACACTACAAACAAAA	0.269																																					.		.											.	ITGB3BP	90	0			c.6-2A>G						.						25.0	25.0	25.0					1																	63974243		2150	4205	6355	SO:0001630	splice_region_variant	23421	exon3			TAACACTACAAAC	U37139	CCDS30736.1, CCDS55603.1	1p31.3	2013-11-05			ENSG00000142856	ENSG00000142856			6157	protein-coding gene	gene with protein product	"""centromere protein R"""	605494				7593198, 10490654	Standard	NM_014288		Approved	NRIF3, HSU37139, TAP20, CENPR	uc001dbb.2	Q13352	OTTHUMG00000013364	ENST00000271002.10:c.6-2A>G	1.37:g.63974243T>C		Somatic	256.0	0.0		WXS	Illumina HiSeq	Phase_I	311.0	99.0	NM_014288	B2R7D8|Q13353|Q5RJ42|Q5RJ44|Q5RJ45|Q7KYX2|Q96CD5|Q9UKB6	Splice_Site	SNP	ENST00000271002.10	37	CCDS30736.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.872969	0.33069	.	.	ENSG00000142856	ENST00000271002;ENST00000371092;ENST00000283568	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3195	0.74109	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGB3BP	63746831	1.000000	0.71417	0.998000	0.56505	0.510000	0.34073	3.690000	0.54713	2.011000	0.59026	0.528000	0.53228	.	.		0.269	ITGB3BP-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000037242.2	NM_014288	Intron
KAT5	10524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65482196	65482196	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:65482196G>T	ENST00000377046.3	+	8	1094	c.822G>T	c.(820-822)aaG>aaT	p.K274N	KAT5_ENST00000341318.4_Missense_Mutation_p.K307N|KAT5_ENST00000530446.1_Missense_Mutation_p.K255N|KAT5_ENST00000534650.1_Missense_Mutation_p.K63N|KAT5_ENST00000352980.4_Missense_Mutation_p.K222N	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5	274	MYST-type HAT.				androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						GTAGTCTCAAGTGTCTTCAGC	0.577																																					p.K307N		.											.	KAT5	90	0			c.G921T						.						264.0	234.0	244.0					11																	65482196		2201	4297	6498	SO:0001583	missense	10524	exon7			TCTCAAGTGTCTT	U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.822G>T	11.37:g.65482196G>T	ENSP00000366245:p.Lys274Asn	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	53.0	NM_182710	B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Missense_Mutation	SNP	ENST00000377046.3	37	CCDS31610.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698762	0.68501	.	.	ENSG00000172977	ENST00000377046;ENST00000352980;ENST00000341318;ENST00000530446;ENST00000531880;ENST00000534650	T;T;T;T;T	0.52754	0.89;0.88;0.88;0.88;0.65	4.97	4.97	0.65823	Acyl-CoA N-acyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.43875	0.1267	M	0.67625	2.065	0.58432	D	0.999997	P;P;B;B	0.42039	0.507;0.769;0.383;0.403	B;B;B;B	0.32724	0.12;0.131;0.151;0.072	T	0.50550	-0.8815	10	0.41790	T	0.15	-21.4041	15.7539	0.78009	0.0:0.0:1.0:0.0	.	255;307;222;274	B4E3C7;Q92993-3;Q92993-2;Q92993	.;.;.;KAT5_HUMAN	N	274;222;307;255;268;63	ENSP00000366245:K274N;ENSP00000344955:K222N;ENSP00000340330:K307N;ENSP00000434765:K255N;ENSP00000436012:K268N	ENSP00000340330:K307N	K	+	3	2	KAT5	65238772	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.448000	0.52943	2.567000	0.86603	0.561000	0.74099	AAG	.		0.577	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388	
KIF20B	9585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	91522476	91522476	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr10:91522476A>G	ENST00000371728.3	+	29	4938	c.4873A>G	c.(4873-4875)Att>Gtt	p.I1625V	KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000416354.1_Missense_Mutation_p.I1655V|KIF20B_ENST00000260753.4_Missense_Mutation_p.I1585V|KIF20B_ENST00000394289.2_Missense_Mutation_p.I1625V	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1625	Interaction with PIN1.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TGAGTTAGAGATTCAATTTAC	0.418																																					p.I1585V		.											.	KIF20B	93	0			c.A4753G						.						88.0	82.0	84.0					10																	91522476		2203	4300	6503	SO:0001583	missense	9585	exon29			TTAGAGATTCAAT	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.4873A>G	10.37:g.91522476A>G	ENSP00000360793:p.Ile1625Val	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	15.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	A	28.2	4.902998	0.92035	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	6.06	6.06	0.98353	.	0.000000	0.51477	D	0.000097	T	0.71126	0.3303	M	0.68952	2.095	0.58432	D	0.999994	D;D	0.76494	0.999;0.999	D;D	0.80764	0.987;0.994	T	0.73911	-0.3833	10	0.87932	D	0	-17.8459	15.5919	0.76537	1.0:0.0:0.0:0.0	.	1625;1585	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	V	1585;1655;1625;1625	ENSP00000260753:I1585V;ENSP00000411545:I1655V;ENSP00000377830:I1625V;ENSP00000360793:I1625V	ENSP00000260753:I1585V	I	+	1	0	KIF20B	91512456	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.147000	0.89628	2.324000	0.78689	0.533000	0.62120	ATT	.		0.418	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
L1CAM	3897	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153136308	153136308	+	Missense_Mutation	SNP	C	C	A	rs202000092		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:153136308C>A	ENST00000370060.1	-	7	820	c.631G>T	c.(631-633)Gcc>Tcc	p.A211S	L1CAM_ENST00000370057.3_Missense_Mutation_p.A211S|L1CAM_ENST00000361699.4_Missense_Mutation_p.A211S|L1CAM_ENST00000538883.1_Missense_Mutation_p.A213S|L1CAM_ENST00000543994.1_Missense_Mutation_p.A213S|L1CAM_ENST00000370055.1_Missense_Mutation_p.A206S|L1CAM_ENST00000361981.3_Missense_Mutation_p.A206S	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	211	Ig-like C2-type 2.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGAAGTGGGCGTGGCAGATG	0.582																																					p.A211S		.											.	L1CAM	138	0			c.G631T						.						279.0	192.0	222.0					X																	153136308		2203	4300	6503	SO:0001583	missense	3897	exon6			AGTGGGCGTGGCA	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.631G>T	X.37:g.153136308C>A	ENSP00000359077:p.Ala211Ser	Somatic	225.0	1.0		WXS	Illumina HiSeq	Phase_I	218.0	71.0	NM_000425	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191479	0.78902	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000540065;ENST00000370055;ENST00000361699	D;D;D;D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58;-1.58;-1.58	4.37	4.37	0.52481	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000017	D	0.93015	0.7777	M	0.93594	3.435	0.49130	D	0.999752	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.979;0.998	D	0.94833	0.7998	10	0.87932	D	0	.	15.1188	0.72426	0.0:1.0:0.0:0.0	.	206;211;211	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	S	211;213;211;213;206;81;206;211	ENSP00000359077:A211S;ENSP00000438430:A213S;ENSP00000359074:A211S;ENSP00000439645:A213S;ENSP00000354712:A206S;ENSP00000359072:A206S;ENSP00000355380:A211S	ENSP00000355380:A211S	A	-	1	0	L1CAM	152789502	0.997000	0.39634	0.994000	0.49952	0.821000	0.46438	4.272000	0.58908	2.161000	0.67846	0.436000	0.28706	GCC	.		0.582	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
LAD1	3898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201351823	201351823	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:201351823C>T	ENST00000391967.2	-	8	1732	c.1431G>A	c.(1429-1431)ctG>ctA	p.L477L	LAD1_ENST00000367313.3_Silent_p.L491L|LAD1_ENST00000488842.1_5'UTR	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	477						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						TGCTGATCCACAGGTTGAGCC	0.547																																					p.L477L		.											.	LAD1	90	0			c.G1431A						.						91.0	64.0	73.0					1																	201351823		2203	4300	6503	SO:0001819	synonymous_variant	3898	exon8			GATCCACAGGTTG	U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.1431G>A	1.37:g.201351823C>T		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	16.0	NM_005558	O95614|Q96GD8	Silent	SNP	ENST00000391967.2	37	CCDS1410.1																																																																																			.		0.547	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086946.1	NM_005558	
LDB1	8861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	103870721	103870721	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr10:103870721T>C	ENST00000425280.1	-	5	599	c.257A>G	c.(256-258)gAc>gGc	p.D86G	LDB1_ENST00000490751.1_5'UTR|LDB1_ENST00000361198.5_Missense_Mutation_p.D50G	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	86					anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		CCAGAGATTGTCACACTCCTA	0.512																																					p.D86G		.											.	LDB1	289	0			c.A257G						.						141.0	138.0	139.0					10																	103870721		2203	4300	6503	SO:0001583	missense	8861	exon5			AGATTGTCACACT	AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.257A>G	10.37:g.103870721T>C	ENSP00000392466:p.Asp86Gly	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	39.0	NM_001113407	B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Missense_Mutation	SNP	ENST00000425280.1	37	CCDS44472.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.588789	0.86851	.	.	ENSG00000198728	ENST00000361198;ENST00000425280	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.81422	0.4819	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.992;0.999	D	0.84672	0.0712	9	0.87932	D	0	-1.6521	15.6438	0.77033	0.0:0.0:0.0:1.0	.	86;50	Q86U70;Q86U70-3	LDB1_HUMAN;.	G	50;86	.	ENSP00000354616:D50G	D	-	2	0	LDB1	103860711	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	2.172000	0.68678	0.459000	0.35465	GAC	.		0.512	LDB1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113407	
LHB	3972	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	49519808	49519808	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr19:49519808G>T	ENST00000221421.2	-	2	178	c.179C>A	c.(178-180)aCc>aAc	p.T60N	CTB-60B18.10_ENST00000600007.1_lincRNA	NM_000894.2	NP_000885.1	P01229	LSHB_HUMAN	luteinizing hormone beta polypeptide	60					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|male gonad development (GO:0008584)|peptide hormone processing (GO:0016486)|progesterone biosynthetic process (GO:0006701)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		GCTCACCATGGTGGGGCAGTA	0.662																																					p.T60N		.											.	LHB	90	0			c.C179A						.						48.0	40.0	43.0					19																	49519808		2193	4263	6456	SO:0001583	missense	3972	exon2			ACCATGGTGGGGC		CCDS12748.1	19q13.3	2013-02-26				ENSG00000104826		"""Endogenous ligands"""	6584	protein-coding gene	gene with protein product	"""lutropin, beta chain"", ""interstitial cell stimulating hormone, beta chain"", ""luteinizing hormone beta subunit"""	152780				1191677	Standard	NM_000894		Approved	LSH-B, CGB4, hLHB	uc002plt.3	P01229		ENST00000221421.2:c.179C>A	19.37:g.49519808G>T	ENSP00000221421:p.Thr60Asn	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	43.0	NM_000894	Q9UDI0	Missense_Mutation	SNP	ENST00000221421.2	37	CCDS12748.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.573017	0.45798	.	.	ENSG00000104826	ENST00000221421;ENST00000391870	D	0.92752	-3.1	4.03	2.97	0.34412	Cystine knot (1);Gonadotropin, beta subunit, conserved site (1);	0.103789	0.64402	D	0.000006	D	0.94430	0.8208	M	0.67397	2.05	0.36147	D	0.847169	D	0.71674	0.998	D	0.91635	0.999	D	0.95358	0.8453	10	0.87932	D	0	-18.2195	9.8631	0.41127	0.0:0.7858:0.2142:0.0	.	60	P01229	LSHB_HUMAN	N	60;76	ENSP00000221421:T60N	ENSP00000221421:T60N	T	-	2	0	LHB	54211620	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	1.932000	0.40143	1.035000	0.39972	-0.539000	0.04255	ACC	.		0.662	LHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466246.1	NM_000894	
LPPR4	9890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	99771771	99771771	+	Silent	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:99771771T>C	ENST00000370185.3	+	7	1994	c.1497T>C	c.(1495-1497)aaT>aaC	p.N499N	LPPR4_ENST00000370184.1_Silent_p.N341N|LPPR4_ENST00000457765.1_Silent_p.N441N	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		499					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		GTCCTGGCAATCAGTACCTCA	0.572																																					p.N499N		.											.	LPPR4	93	0			c.T1497C						.						159.0	161.0	160.0					1																	99771771		2203	4300	6503	SO:0001819	synonymous_variant	0	exon7			TGGCAATCAGTAC																												ENST00000370185.3:c.1497T>C	1.37:g.99771771T>C		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	38.0	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	ENST00000370185.3	37	CCDS757.1																																																																																			.		0.572	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
MAOB	4129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	43655030	43655030	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:43655030T>A	ENST00000378069.4	-	7	871	c.724A>T	c.(724-726)Aga>Tga	p.R242*	MAOB_ENST00000538942.1_Nonsense_Mutation_p.R226*|MAOB_ENST00000536181.1_Nonsense_Mutation_p.R226*|MAOB_ENST00000487544.1_5'Flank	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	242					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	ACATTTTCTCTTGTCTGGTCA	0.448																																					p.R242X		.											.	MAOB	555	0			c.A724T						.						169.0	141.0	151.0					X																	43655030		2203	4300	6503	SO:0001587	stop_gained	4129	exon7			TTTCTCTTGTCTG		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.724A>T	X.37:g.43655030T>A	ENSP00000367309:p.Arg242*	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	44.0	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Nonsense_Mutation	SNP	ENST00000378069.4	37	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	T	37	6.394621	0.97533	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	.	.	.	5.29	4.39	0.52855	.	0.049371	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-9.4189	9.8539	0.41073	0.0:0.8363:0.0:0.1637	.	.	.	.	X	242;226;226	.	ENSP00000367309:R242X	R	-	1	2	MAOB	43539974	0.880000	0.30214	0.997000	0.53966	0.771000	0.43674	1.737000	0.38197	1.113000	0.41760	-0.383000	0.06682	AGA	.		0.448	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
MAP3K4	4216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	161470524	161470524	+	Nonsense_Mutation	SNP	T	T	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:161470524T>G	ENST00000392142.4	+	3	1368	c.1220T>G	c.(1219-1221)tTa>tGa	p.L407*	MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.L407*|MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.L407*|MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.L407*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	407					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AATCAGAAATTAAGGATTATG	0.428																																					p.L407X		.											.	MAP3K4	548	0			c.T1220G						.						78.0	81.0	80.0					6																	161470524		2203	4300	6503	SO:0001587	stop_gained	4216	exon3			AGAAATTAAGGAT	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.1220T>G	6.37:g.161470524T>G	ENSP00000375986:p.Leu407*	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	64.0	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	T	38	7.227635	0.98150	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.5699	16.4447	0.83919	0.0:0.0:0.0:1.0	.	.	.	.	X	407	.	ENSP00000297332:L407X	L	+	2	0	MAP3K4	161390514	1.000000	0.71417	0.031000	0.17742	0.938000	0.57974	7.671000	0.83941	2.284000	0.76573	0.528000	0.53228	TTA	.		0.428	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
MATN2	4147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	99045370	99045370	+	Silent	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr8:99045370T>C	ENST00000520016.1	+	16	2806	c.2682T>C	c.(2680-2682)tcT>tcC	p.S894S	RPL30_ENST00000518164.1_Intron|MATN2_ENST00000524308.1_Silent_p.S853S|MATN2_ENST00000522025.2_Silent_p.S610S|MATN2_ENST00000521689.1_Silent_p.S875S|MATN2_ENST00000254898.5_Silent_p.S894S			O00339	MATN2_HUMAN	matrilin 2	894						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TTTTACGGTCTACACAAAAGC	0.368																																					p.S894S		.											.	MATN2	24	0			c.T2682C						.						75.0	65.0	68.0					8																	99045370		1812	4081	5893	SO:0001819	synonymous_variant	4147	exon17			ACGGTCTACACAA	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.2682T>C	8.37:g.99045370T>C		Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	190.0	52.0	NM_002380	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Silent	SNP	ENST00000520016.1	37	CCDS55264.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.829|9.829	1.187959|1.187959	0.21954|0.21954	.|.	.|.	ENSG00000132561|ENSG00000132561	ENST00000519582;ENST00000522135|ENST00000518154	.|.	.|.	.|.	5.76|5.76	-1.82|-1.82	0.07857|0.07857	.|.	.|.	.|.	.|.	.|.	T|T	0.39172|0.39172	0.1068|0.1068	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.33599|0.33599	-0.9862|-0.9862	4|4	.|.	.|.	.|.	-7.9502|-7.9502	1.1258|1.1258	0.01735|0.01735	0.3777:0.0909:0.2656:0.2659|0.3777:0.0909:0.2656:0.2659	.|.	.|.	.|.	.|.	P|H	131;57|658	.|.	.|.	L|Y	+|+	2|1	0|0	MATN2|MATN2	99114546|99114546	0.965000|0.965000	0.33210|0.33210	0.930000|0.930000	0.37139|0.37139	0.985000|0.985000	0.73830|0.73830	-0.112000|-0.112000	0.10791|0.10791	0.091000|0.091000	0.17302|0.17302	0.533000|0.533000	0.62120|0.62120	CTA|TAC	.		0.368	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
NVL	4931	ucsc.edu;mdanderson.org	37	1	224444769	224444769	+	Intron	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:224444769T>C	ENST00000281701.6	-	19	2442				NVL_ENST00000469075.1_Intron|NVL_ENST00000340871.4_Intron|MIR320B2_ENST00000408479.1_RNA|NVL_ENST00000361463.3_Intron|NVL_ENST00000391875.2_Intron|NVL_ENST00000482491.1_Intron	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like							membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		TCAACCCAGCTTTTCCCAACT	0.373																																					.		.											.	.	.	0			.						.						46.0	41.0	42.0					1																	224444769		1568	3582	5150	SO:0001627	intron_variant	100313769	.			CCCAGCTTTTCCC	U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.2183-6749A>G	1.37:g.224444769T>C		Somatic	379.0	2.0		WXS	Illumina HiSeq	.	537.0	141.0	.	B4DMC4|B4DP98|Q96EM7	RNA	SNP	ENST00000281701.6	37	CCDS1541.1																																																																																			.		0.373	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533	
MRGPRE	116534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	3249346	3249346	+	Missense_Mutation	SNP	G	G	T	rs531538794		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:3249346G>T	ENST00000389832.5	-	2	990	c.684C>A	c.(682-684)ttC>ttA	p.F228L	MRGPRE_ENST00000436689.2_Missense_Mutation_p.F227L|AC109309.4_ENST00000418995.2_RNA			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCAGGCCGCAGAAGAGGAAGA	0.657																																					p.F228L		.											.	MRGPRE	136	0			c.C684A						.						16.0	22.0	20.0					11																	3249346		2058	4183	6241	SO:0001583	missense	116534	exon2			GCCGCAGAAGAGG	AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.684C>A	11.37:g.3249346G>T	ENSP00000374482:p.Phe228Leu	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	13.0	NM_001039165	Q2M1V7	Missense_Mutation	SNP	ENST00000389832.5	37		.	.	.	.	.	.	.	.	.	.	g	0.404	-0.916686	0.02415	.	.	ENSG00000184350	ENST00000436689;ENST00000389832	.	.	.	3.9	1.87	0.25490	GPCR, rhodopsin-like superfamily (1);	0.576644	0.14260	U	0.330849	T	0.12944	0.0314	N	0.11106	0.095	0.09310	N	1	B	0.19817	0.039	B	0.12156	0.007	T	0.31724	-0.9933	9	0.02654	T	1	-15.8633	2.6616	0.05028	0.1085:0.1805:0.526:0.185	.	227	Q86SM8	MRGRE_HUMAN	L	228;227	.	ENSP00000374482:F227L	F	-	3	2	MRGPRE	3205922	0.002000	0.14202	0.002000	0.10522	0.009000	0.06853	0.359000	0.20233	0.833000	0.34828	-0.379000	0.06801	TTC	.		0.657	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000032346.5	XM_171536	
MRPS15	64960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	36923570	36923570	+	Missense_Mutation	SNP	G	G	C	rs376585999		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:36923570G>C	ENST00000373116.5	-	6	559	c.398C>G	c.(397-399)tCt>tGt	p.S133C	MRPS15_ENST00000488606.1_5'UTR	NM_031280.3	NP_112570.2	P82914	RT15_HUMAN	mitochondrial ribosomal protein S15	133					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GATCTTGACAGACAAGGCAAT	0.473																																					p.S133C		.											.	MRPS15	91	0			c.C398G						.	G	CYS/SER	0,4406		0,0,2203	147.0	133.0	138.0		398	5.5	1.0	1		138	1,8599	1.2+/-3.3	0,1,4299	no	missense	MRPS15	NM_031280.3	112	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	possibly-damaging	133/258	36923570	1,13005	2203	4300	6503	SO:0001583	missense	64960	exon6			TTGACAGACAAGG	AB049946	CCDS411.1	1p34.3	2012-09-13			ENSG00000116898	ENSG00000116898		"""Mitochondrial ribosomal proteins / small subunits"""	14504	protein-coding gene	gene with protein product		611979					Standard	NM_031280		Approved	FLJ11564	uc001cas.2	P82914	OTTHUMG00000008042	ENST00000373116.5:c.398C>G	1.37:g.36923570G>C	ENSP00000362208:p.Ser133Cys	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	35.0	NM_031280	B2RD82|Q9H2K1	Missense_Mutation	SNP	ENST00000373116.5	37	CCDS411.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474612	0.84640	0.0	1.16E-4	ENSG00000116898	ENST00000373116	.	.	.	5.49	5.49	0.81192	S15/NS1, RNA-binding (2);	0.144121	0.64402	D	0.000008	T	0.67979	0.2951	L	0.61036	1.89	0.36412	D	0.863802	P	0.52577	0.954	P	0.52109	0.69	T	0.76493	-0.2939	9	0.87932	D	0	-1.174	18.3538	0.90348	0.0:0.0:1.0:0.0	.	133	P82914	RT15_HUMAN	C	133	.	ENSP00000362208:S133C	S	-	2	0	MRPS15	36696157	1.000000	0.71417	0.956000	0.39512	0.934000	0.57294	6.430000	0.73391	2.559000	0.86315	0.563000	0.77884	TCT	.		0.473	MRPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022052.2	NM_031280	
MXRA5	25878	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	3227926	3227926	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:3227926G>A	ENST00000217939.6	-	7	8472	c.8318C>T	c.(8317-8319)tCg>tTg	p.S2773L		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2773	Ig-like C2-type 12.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTTCAGATGCGACTTATCCGG	0.562																																					p.S2773L		.											.	MXRA5	136	0			c.C8318T						.						126.0	104.0	111.0					X																	3227926		2203	4300	6503	SO:0001583	missense	25878	exon7			AGATGCGACTTAT	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.8318C>T	X.37:g.3227926G>A	ENSP00000217939:p.Ser2773Leu	Somatic	276.0	1.0		WXS	Illumina HiSeq	Phase_I	237.0	74.0	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896802	0.33535	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.69685	-0.42	4.32	4.32	0.51571	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35291	U	0.003307	T	0.68393	0.2996	L	0.41492	1.28	0.26834	N	0.968513	D	0.54772	0.968	P	0.52309	0.695	T	0.65397	-0.6178	10	0.56958	D	0.05	.	16.4192	0.83753	0.0:0.0:1.0:0.0	.	2773	Q9NR99	MXRA5_HUMAN	L	2773	ENSP00000217939:S2773L	ENSP00000217939:S2773L	S	-	2	0	MXRA5	3237926	0.995000	0.38212	0.002000	0.10522	0.015000	0.08874	3.695000	0.54749	1.782000	0.52362	0.502000	0.49764	TCG	.		0.562	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
MTMR8	55613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	63548663	63548663	+	Silent	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:63548663G>T	ENST00000374852.3	-	12	1537	c.1470C>A	c.(1468-1470)ccC>ccA	p.P490P	MTMR8_ENST00000453546.1_Intron|MTMR8_ENST00000478487.1_5'Flank	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	490	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						GAATGTTGTAGGGCACAGTAC	0.458																																					p.P490P		.											.	MTMR8	195	1	Whole gene deletion(1)	ovary(1)	c.C1470A						.						143.0	123.0	130.0					X																	63548663		2203	4300	6503	SO:0001819	synonymous_variant	55613	exon12			GTTGTAGGGCACA	AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1470C>A	X.37:g.63548663G>T		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	12.0	NM_017677	Q5JT99|Q9NXP6	Silent	SNP	ENST00000374852.3	37	CCDS14379.1	.	.	.	.	.	.	.	.	.	.	G	7.410	0.634610	0.14322	.	.	ENSG00000102043	ENST00000442913	.	.	.	2.93	0.856	0.19019	.	.	.	.	.	T	0.43144	0.1234	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25847	-1.0120	4	.	.	.	.	2.3034	0.04168	0.4169:0.0:0.3475:0.2357	.	.	.	.	I	294	.	.	L	-	1	2	MTMR8	63465388	1.000000	0.71417	0.987000	0.45799	0.982000	0.71751	0.850000	0.27737	0.427000	0.26145	0.506000	0.49869	CTA	.		0.458	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677	
MYO3A	53904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	26414368	26414368	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr10:26414368G>T	ENST00000265944.5	+	19	2111	c.1945G>T	c.(1945-1947)Gct>Tct	p.A649S	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	649	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A649S(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GCTACAAGAAGCTCTCACCTC	0.433																																					p.A649S		.											.	MYO3A	1007	1	Substitution - Missense(1)	endometrium(1)	c.G1945T						.						97.0	89.0	91.0					10																	26414368		2203	4300	6503	SO:0001583	missense	53904	exon19			CAAGAAGCTCTCA	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1945G>T	10.37:g.26414368G>T	ENSP00000265944:p.Ala649Ser	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	34.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	34	5.388171	0.95988	.	.	ENSG00000095777	ENST00000265944	D	0.87887	-2.31	5.91	5.91	0.95273	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.92756	0.7697	M	0.69185	2.1	0.80722	D	1	D	0.71674	0.998	D	0.67382	0.951	D	0.91608	0.5300	10	0.46703	T	0.11	.	20.2872	0.98536	0.0:0.0:1.0:0.0	.	649	Q8NEV4	MYO3A_HUMAN	S	649	ENSP00000265944:A649S	ENSP00000265944:A649S	A	+	1	0	MYO3A	26454374	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.799000	0.96334	0.585000	0.79938	GCT	.		0.433	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
MYOT	9499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	137219116	137219116	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:137219116G>T	ENST00000239926.4	+	7	1234	c.860G>T	c.(859-861)gGa>gTa	p.G287V	MYOT_ENST00000515645.1_Missense_Mutation_p.G172V|RP11-381K20.2_ENST00000508281.2_RNA|MYOT_ENST00000421631.2_Missense_Mutation_p.G103V|RP11-381K20.2_ENST00000514616.1_RNA|MYOT_ENST00000509812.1_Intron	NM_006790.2	NP_006781	Q9UBF9	MYOTI_HUMAN	myotilin	287	Ig-like C2-type 1.|Necessary for interaction with ACTA1.|Necessary for interaction with FLNC.				muscle contraction (GO:0006936)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	structural constituent of muscle (GO:0008307)			cervix(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TATCTAAATGGAAGAACAGTT	0.413																																					p.G287V		.											.	MYOT	153	0			c.G860T						.						134.0	126.0	129.0					5																	137219116		2203	4300	6503	SO:0001583	missense	9499	exon7			TAAATGGAAGAAC	AF133820	CCDS4194.1, CCDS47268.1, CCDS75309.1	5q31.2	2014-09-17	2005-09-07	2005-09-07	ENSG00000120729	ENSG00000120729		"""Immunoglobulin superfamily / I-set domain containing"""	12399	protein-coding gene	gene with protein product		604103	"""titin immunoglobulin domain protein (myotilin)"", ""limb-girdle muscular dystrophy 1A (autosomal dominant)"""	TTID, LGMD1A, LGMD1		10486214, 10369880	Standard	NM_006790		Approved		uc003lbv.3	Q9UBF9	OTTHUMG00000129154	ENST00000239926.4:c.860G>T	5.37:g.137219116G>T	ENSP00000239926:p.Gly287Val	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	55.0	NM_006790	A0A4R6|B4DT79	Missense_Mutation	SNP	ENST00000239926.4	37	CCDS4194.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.938922	0.92526	.	.	ENSG00000120729	ENST00000239926;ENST00000421631;ENST00000515645	T;T;T	0.80033	-1.33;-1.33;-1.33	5.08	5.08	0.68730	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000009	D	0.94407	0.8201	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96772	0.9569	10	0.87932	D	0	.	18.8467	0.92210	0.0:0.0:1.0:0.0	.	287	Q9UBF9	MYOTI_HUMAN	V	287;103;172	ENSP00000239926:G287V;ENSP00000391185:G103V;ENSP00000426281:G172V	ENSP00000239926:G287V	G	+	2	0	MYOT	137247015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.497000	0.84241	0.655000	0.94253	GGA	.		0.413	MYOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251219.2	NM_006790	
NEURL4	84461	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7230299	7230299	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr17:7230299C>G	ENST00000399464.2	-	4	838	c.823G>C	c.(823-825)Gtg>Ctg	p.V275L	NEURL4_ENST00000570460.1_Missense_Mutation_p.V253L|NEURL4_ENST00000315614.7_Missense_Mutation_p.V275L	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	275						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTGTTGCTCACCACCTCAGAC	0.582																																					p.V275L		.											.	NEURL4	46	0			c.G823C						.						80.0	82.0	81.0					17																	7230299		2055	4202	6257	SO:0001583	missense	84461	exon4			TGCTCACCACCTC		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.823G>C	17.37:g.7230299C>G	ENSP00000382390:p.Val275Leu	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	6.0	NM_001005408	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.719204	0.48728	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.34859	1.34;1.37	4.79	4.79	0.61399	.	0.082719	0.52532	D	0.000080	T	0.30293	0.0760	L	0.46157	1.445	0.43608	D	0.995972	P;P	0.41450	0.75;0.635	B;B	0.37144	0.242;0.122	T	0.04723	-1.0931	10	0.18276	T	0.48	-20.2816	15.2186	0.73292	0.0:1.0:0.0:0.0	.	275;275	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	L	275	ENSP00000319826:V275L;ENSP00000382390:V275L	ENSP00000319826:V275L	V	-	1	0	NEURL4	7171023	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.416000	0.66417	2.653000	0.90120	0.655000	0.94253	GTG	.		0.582	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	
NFE2L2	4780	hgsc.bcm.edu;bcgsc.ca	37	2	178098960	178098974	+	In_Frame_Del	DEL	CTATATCTTGCCTCC	CTATATCTTGCCTCC	-			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	CTATATCTTGCCTCC	CTATATCTTGCCTCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr2:178098960_178098974delCTATATCTTGCCTCC	ENST00000397062.3	-	2	625_639	c.71_85delGGAGGCAAGATATAG	c.(70-87)tggaggcaagatatagat>tat	p.24_29WRQDID>Y	NFE2L2_ENST00000423513.1_In_Frame_Del_p.8_13WRQDID>Y|NFE2L2_ENST00000397063.4_In_Frame_Del_p.8_13WRQDID>Y|NFE2L2_ENST00000464747.1_In_Frame_Del_p.8_13WRQDID>Y|NFE2L2_ENST00000446151.2_In_Frame_Del_p.8_13WRQDID>Y	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	24					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D29H(11)|p.W24C(5)|p.D29N(2)|p.D29Y(2)|p.Q26K(1)|p.D27H(1)|p.Q26L(1)|p.Q26E(1)|p.D27Y(1)|p.I28T(1)|p.Q26P(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTCCAAGATCTATATCTTGCCTCCAAAGTATGTC	0.349			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.24_29del		.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2	90	27	Substitution - Missense(27)	lung(16)|oesophagus(4)|upper_aerodigestive_tract(3)|cervix(1)|endometrium(1)|liver(1)|kidney(1)	c.71_85del						.																																			SO:0001651	inframe_deletion	4780	exon2			CAAGATCTATATC		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.71_85delGGAGGCAAGATATAG	2.37:g.178098960_178098974delCTATATCTTGCCTCC	ENSP00000380252:p.Trp24_Asp29delinsTyr	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	125.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	In_Frame_Del	DEL	ENST00000397062.3	37	CCDS42782.1																																																																																			.		0.349	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
NLGN1	22871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	173998534	173998534	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:173998534C>A	ENST00000457714.1	+	7	2342	c.1913C>A	c.(1912-1914)cCt>cAt	p.P638H	NLGN1_ENST00000361589.4_Missense_Mutation_p.P638H|NLGN1_ENST00000401917.3_Missense_Mutation_p.P678H|NLGN1_ENST00000545397.1_Missense_Mutation_p.P638H	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	655					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ACTTTCAGACCTACGAGAAAA	0.438																																					p.P638H		.											.	NLGN1	231	0			c.C1913A						.						122.0	121.0	121.0					3																	173998534		2203	4300	6503	SO:0001583	missense	22871	exon7			TCAGACCTACGAG	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1913C>A	3.37:g.173998534C>A	ENSP00000392500:p.Pro638His	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	40.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821953	0.50633	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.59	5.59	0.84812	.	0.055473	0.64402	D	0.000001	T	0.55130	0.1901	N	0.12961	0.28	0.58432	D	0.999999	B	0.16166	0.016	B	0.17722	0.019	T	0.52503	-0.8567	10	0.72032	D	0.01	.	19.9651	0.97262	0.0:1.0:0.0:0.0	.	638	Q8N2Q7-2	.	H	638;638;638;678	ENSP00000392500:P638H;ENSP00000354541:P638H;ENSP00000441108:P638H;ENSP00000385750:P678H	ENSP00000354541:P638H	P	+	2	0	NLGN1	175481228	0.993000	0.37304	0.999000	0.59377	0.968000	0.65278	2.911000	0.48774	2.793000	0.96121	0.655000	0.94253	CCT	.		0.438	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
NOP56	10528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2635458	2635458	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr20:2635458A>G	ENST00000329276.5	+	5	950	c.434A>G	c.(433-435)cAg>cGg	p.Q145R	SNORD56_ENST00000413522.1_RNA|SNORD86_ENST00000391196.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORA51_ENST00000606420.1_RNA|SNORD110_ENST00000408189.1_RNA|SNORD57_ENST00000448188.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	145					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						TGTAAAGCACAGCTGGGGCTG	0.522																																					p.Q145R		.											.	NOP56	92	0			c.A434G						.						167.0	164.0	165.0					20																	2635458		2203	4300	6503	SO:0001583	missense	10528	exon5			AAGCACAGCTGGG	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.434A>G	20.37:g.2635458A>G	ENSP00000370589:p.Gln145Arg	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	19.0	NM_006392	Q2M3T6|Q9NQ05	Missense_Mutation	SNP	ENST00000329276.5	37	CCDS13030.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.356329	0.61293	.	.	ENSG00000101361	ENST00000329276;ENST00000445139	T;T	0.59638	0.25;0.86	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.68668	0.3026	M	0.84433	2.695	0.80722	D	1	D	0.56035	0.974	P	0.48089	0.566	T	0.75243	-0.3386	10	0.62326	D	0.03	-26.6734	14.2555	0.66048	1.0:0.0:0.0:0.0	.	145	O00567	NOP56_HUMAN	R	145	ENSP00000370589:Q145R;ENSP00000388497:Q145R	ENSP00000370589:Q145R	Q	+	2	0	NOP56	2583458	1.000000	0.71417	0.929000	0.37066	0.001000	0.01503	9.090000	0.94144	2.245000	0.73994	0.454000	0.30748	CAG	.		0.522	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392	
NOS1	4842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	117723945	117723945	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr12:117723945C>T	ENST00000338101.4	-	5	1258	c.1254G>A	c.(1252-1254)tcG>tcA	p.S418S	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Silent_p.S418S			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CCACACAGCGCGAGGCATTCC	0.562																																					p.S418S	Esophageal Squamous(162;1748 2599 51982 52956)	.											.	NOS1	154	0			c.G1254A						.						130.0	131.0	130.0					12																	117723945		2168	4298	6466	SO:0001819	synonymous_variant	4842	exon6			ACAGCGCGAGGCA		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1254G>A	12.37:g.117723945C>T		Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	32.0	NM_000620		Silent	SNP	ENST00000338101.4	37	CCDS55890.1																																																																																			.		0.562	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
NXF2B	728343	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	101615541	101615541	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:101615541G>A	ENST00000372750.1	-	27	2661	c.1862C>T	c.(1861-1863)gCc>gTc	p.A621V	NXF2B_ENST00000372752.1_3'UTR|NXF2B_ENST00000457521.2_Missense_Mutation_p.A621V|NXF2B_ENST00000372749.1_Missense_Mutation_p.A621V|NXF2B_ENST00000412230.2_Missense_Mutation_p.A621V			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2B	621	TAP-C. {ECO:0000255|PROSITE- ProRule:PRU00611}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|kidney(1)|lung(4)|ovary(1)	7						TTGCTTGAAGGCCTCCGCGGG	0.517																																					p.A621V		.											.	NXF2	46	0			c.C1862T						.						198.0	152.0	169.0					X																	101615541		1984	3330	5314	SO:0001583	missense	56001	exon23			TTGAAGGCCTCCG		CCDS43979.1	Xq22.1	2013-05-14			ENSG00000185945	ENSG00000269437			23984	protein-coding gene	gene with protein product						16382448	Standard	NM_001099686		Approved	bA353J17.1		Q9GZY0	OTTHUMG00000154920	ENST00000372750.1:c.1862C>T	X.37:g.101615541G>A	ENSP00000361836:p.Ala621Val	Somatic	813.0	1.0		WXS	Illumina HiSeq	Phase_I	887.0	73.0	NM_022053	Q9BXU4|Q9NSS1|Q9NX66	Missense_Mutation	SNP	ENST00000372750.1	37	CCDS43979.1	.	.	.	.	.	.	.	.	.	.	.	15.39	2.819306	0.50633	.	.	ENSG00000185945	ENST00000457521;ENST00000372749;ENST00000372750;ENST00000412230	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	2.73	0.853	0.19001	.	0.165190	0.38111	U	0.001808	T	0.61862	0.2381	.	.	.	0.38390	D	0.945387	.	.	.	.	.	.	T	0.60500	-0.7251	7	0.66056	D	0.02	-7.352	4.3322	0.11069	0.373:0.0:0.627:0.0	.	.	.	.	V	621	ENSP00000396447:A621V;ENSP00000361835:A621V;ENSP00000361836:A621V;ENSP00000413087:A621V	ENSP00000361835:A621V	A	-	2	0	NXF2B	101502197	0.999000	0.42202	0.012000	0.15200	0.345000	0.29048	4.019000	0.57181	0.105000	0.17753	0.502000	0.49764	GCC	.		0.517	NXF2B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058979.1		
OCLN	100506658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	68805338	68805338	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:68805338A>T	ENST00000355237.2	+	3	857	c.421A>T	c.(421-423)Atg>Ttg	p.M141L	OCLN_ENST00000396442.2_Missense_Mutation_p.M141L|OCLN_ENST00000542132.1_Intron|OCLN_ENST00000380766.2_Missense_Mutation_p.M141L|OCLN_ENST00000538151.1_Intron	NM_002538.3	NP_002529.1	Q16625	OCLN_HUMAN	occludin	141	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				apoptotic process (GO:0006915)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|protein complex assembly (GO:0006461)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethionine metabolic process (GO:0046500)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)|structural molecule activity (GO:0005198)|thiopurine S-methyltransferase activity (GO:0008119)			endometrium(2)|large_intestine(1)|liver(1)|prostate(1)|skin(1)	6		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		AAAGGGCTTCATGTTGGCCAT	0.463																																					p.M141L		.											.	OCLN	68	0			c.A421T						.						159.0	112.0	128.0					5																	68805338		2203	4300	6503	SO:0001583	missense	100506658	exon3			GGCTTCATGTTGG	U49184	CCDS4006.1, CCDS54864.1	5q13.1	2014-06-13			ENSG00000197822	ENSG00000197822			8104	protein-coding gene	gene with protein product	"""tight junction protein occludin TM4 minus"", ""phosphatase 1, regulatory subunit 115"""	602876				8601611	Standard	NM_002538		Approved	PPP1R115	uc003jwu.3	Q16625	OTTHUMG00000099356	ENST00000355237.2:c.421A>T	5.37:g.68805338A>T	ENSP00000347379:p.Met141Leu	Somatic	289.0	0.0		WXS	Illumina HiSeq	Phase_I	318.0	111.0	NM_001205254	B5BU70|D2DU64|D2DU65|D2IGC0|D2IGC1|E2CYV9|Q5U1V4|Q8N6K1	Missense_Mutation	SNP	ENST00000355237.2	37	CCDS4006.1	.	.	.	.	.	.	.	.	.	.	A	5.070	0.198593	0.09652	.	.	ENSG00000197822	ENST00000355237;ENST00000396442;ENST00000380766	T;T;T	0.24350	1.86;1.86;1.86	5.82	1.38	0.22167	Marvel (1);MARVEL-like domain (1);	0.486738	0.23288	N	0.049833	T	0.07458	0.0188	N	0.02142	-0.665	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19712	-1.0297	10	0.18276	T	0.48	-20.5348	4.9156	0.13844	0.5703:0.2415:0.0:0.1882	.	141	Q16625	OCLN_HUMAN	L	141	ENSP00000347379:M141L;ENSP00000379719:M141L;ENSP00000370143:M141L	ENSP00000347379:M141L	M	+	1	0	OCLN	68841094	1.000000	0.71417	0.980000	0.43619	0.626000	0.37791	1.178000	0.31981	0.353000	0.24079	-0.887000	0.02937	ATG	.		0.463	OCLN-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216794.1	NM_002538	
ODC1	4953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	10581663	10581663	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr2:10581663T>C	ENST00000234111.4	-	11	1723	c.1213A>G	c.(1213-1215)Atc>Gtc	p.I405V	ODC1_ENST00000446285.1_5'Flank|ODC1_ENST00000405333.1_Missense_Mutation_p.I405V	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	405					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)			NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	ACATAGTAGATCGTCGGCCTC	0.502																																					p.I405V		.											.	ODC1	69	0			c.A1213G						.						59.0	53.0	55.0					2																	10581663		2203	4300	6503	SO:0001583	missense	4953	exon11			AGTAGATCGTCGG		CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.1213A>G	2.37:g.10581663T>C	ENSP00000234111:p.Ile405Val	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	98.0	NM_002539	Q53TU3|Q6LDS9	Missense_Mutation	SNP	ENST00000234111.4	37	CCDS1672.1	.	.	.	.	.	.	.	.	.	.	T	7.060	0.566151	0.13560	.	.	ENSG00000115758	ENST00000234111;ENST00000405333;ENST00000537630	T;T	0.37411	1.2;1.2	5.66	5.66	0.87406	Orn/DAP/Arg decarboxylase 2, C-terminal (1);Alanine racemase/group IV decarboxylase, C-terminal (2);	0.172204	0.56097	D	0.000037	T	0.20251	0.0487	N	0.16307	0.4	0.47341	D	0.999399	B	0.02656	0.0	B	0.09377	0.004	T	0.07966	-1.0745	10	0.06757	T	0.87	.	11.8398	0.52346	0.0:0.0:0.146:0.854	.	405	P11926	DCOR_HUMAN	V	405;405;276	ENSP00000234111:I405V;ENSP00000385333:I405V	ENSP00000234111:I405V	I	-	1	0	ODC1	10499114	1.000000	0.71417	0.907000	0.35723	0.830000	0.47004	3.927000	0.56499	2.157000	0.67596	0.482000	0.46254	ATC	.		0.502	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206896.2		
OR5H14	403273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	97868346	97868346	+	Silent	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:97868346C>A	ENST00000437310.1	+	1	177	c.117C>A	c.(115-117)atC>atA	p.I39I	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TCATCACCATCATGGGGAATC	0.408																																					p.I39I		.											.	OR5H14	91	0			c.C117A						.						207.0	210.0	209.0					3																	97868346		2203	4297	6500	SO:0001819	synonymous_variant	403273	exon1			CACCATCATGGGG		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.117C>A	3.37:g.97868346C>A		Somatic	555.0	0.0		WXS	Illumina HiSeq	Phase_I	565.0	189.0	NM_001005514	B9EH15	Silent	SNP	ENST00000437310.1	37	CCDS33798.1																																																																																			.		0.408	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
PALM3	342979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14167259	14167259	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr19:14167259C>A	ENST00000340790.4	-	4	335	c.336G>T	c.(334-336)agG>agT	p.R112S		NM_001145028.1	NP_001138500.1	A6NDB9	PALM3_HUMAN	paralemmin 3	112					negative regulation of cytokine-mediated signaling pathway (GO:0001960)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)			endometrium(1)|kidney(2)|pancreas(1)|skin(1)	5						GCCAGCTGGGCCTGCCTGAGG	0.617																																					p.R112S		.											.	PALM3	24	0			c.G336T						.						56.0	60.0	59.0					19																	14167259		692	1591	2283	SO:0001583	missense	342979	exon4			GCTGGGCCTGCCT		CCDS46001.1	19p13.12	2010-04-15			ENSG00000187867	ENSG00000187867			33274	protein-coding gene	gene with protein product							Standard	NM_001145028		Approved		uc010xnk.1	A6NDB9		ENST00000340790.4:c.336G>T	19.37:g.14167259C>A	ENSP00000344996:p.Arg112Ser	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	30.0	NM_001145028		Missense_Mutation	SNP	ENST00000340790.4	37	CCDS46001.1	.	.	.	.	.	.	.	.	.	.	c	13.76	2.333669	0.41297	.	.	ENSG00000187867	ENST00000340790	T	0.35421	1.31	4.53	3.49	0.39957	.	.	.	.	.	T	0.29556	0.0737	L	0.43152	1.355	0.27920	N	0.938271	B	0.16396	0.017	B	0.12156	0.007	T	0.18429	-1.0337	9	0.42905	T	0.14	.	8.1516	0.31143	0.0:0.8872:0.0:0.1128	.	112	A6NDB9	PALM3_HUMAN	S	112	ENSP00000344996:R112S	ENSP00000344996:R112S	R	-	3	2	PALM3	14028259	0.990000	0.36364	0.994000	0.49952	0.869000	0.49853	0.521000	0.22893	0.923000	0.37045	0.555000	0.69702	AGG	.		0.617	PALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458540.1	NM_001145028	
PCDHA10	56139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140235699	140235699	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:140235699C>T	ENST00000307360.5	+	1	66	c.66C>T	c.(64-66)gcC>gcT	p.A22A	PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Silent_p.A22A|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	22					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTCGCAGCCTGGGAGGTGG	0.597																																					p.A22A		.											.	PCDHA10	99	0			c.C66T						.						58.0	68.0	64.0					5																	140235699		2196	4273	6469	SO:0001819	synonymous_variant	56139	exon1			CGCAGCCTGGGAG	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.66C>T	5.37:g.140235699C>T		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	52.0	NM_031859	A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	37	CCDS54921.1																																																																																			.		0.597	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
PHF2	5253	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	96415567	96415567	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr9:96415567T>G	ENST00000359246.4	+	6	1076	c.709T>G	c.(709-711)Tgc>Ggc	p.C237G	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	237	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		GACCAAGTACTGCCTAATCTG	0.557																																					p.C237G		.											.	PHF2	91	0			c.T709G						.						151.0	113.0	126.0					9																	96415567		2203	4300	6503	SO:0001583	missense	5253	exon6			AAGTACTGCCTAA	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.709T>G	9.37:g.96415567T>G	ENSP00000352185:p.Cys237Gly	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	9.0	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	ENST00000359246.4	37	CCDS35069.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.018795	0.75275	.	.	ENSG00000197724	ENST00000359246	T	0.71103	-0.54	4.71	3.58	0.41010	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.86669	0.5988	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.88185	0.2873	10	0.87932	D	0	-16.968	10.4395	0.44457	0.0:0.0773:0.0:0.9227	.	237	O75151	PHF2_HUMAN	G	237	ENSP00000352185:C237G	ENSP00000352185:C237G	C	+	1	0	PHF2	95455388	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.738000	0.84966	0.943000	0.37553	0.377000	0.23210	TGC	.		0.557	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
PIN4	5303	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	71417258	71417258	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:71417258C>A	ENST00000373669.2	+	4	385	c.353C>A	c.(352-354)cCa>cAa	p.P118Q	PIN4_ENST00000423432.2_Intron|RN7SL388P_ENST00000498736.2_RNA|PIN4_ENST00000218432.5_3'UTR	NM_006223.3	NP_006214.2	Q9Y237	PIN4_HUMAN	protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)	93	PpiC. {ECO:0000255|PROSITE- ProRule:PRU00278}.				protein folding (GO:0006457)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome (GO:0030684)|spindle (GO:0005819)	bent DNA binding (GO:0003681)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(2)	3	Renal(35;0.156)					ATGGTGGGACCATTTCAAGAA	0.443																																					p.P118Q		.											.	PIN4	130	0			c.C353A						.						82.0	67.0	72.0					X																	71417258		2203	4300	6503	SO:0001583	missense	5303	exon4			TGGGACCATTTCA	AB009690	CCDS14417.1, CCDS55447.1	Xq13.1	2008-02-05	2006-01-12		ENSG00000102309	ENSG00000102309			8992	protein-coding gene	gene with protein product		300252	"""protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)"""			16522211, 17875217	Standard	NM_006223		Approved	PAR14, PAR17, EPVH	uc004eam.3	Q9Y237	OTTHUMG00000021811	ENST00000373669.2:c.353C>A	X.37:g.71417258C>A	ENSP00000362773:p.Pro118Gln	Somatic	270.0	1.0		WXS	Illumina HiSeq	Phase_I	308.0	94.0	NM_006223	A8E0G6|B3KXM0|F5H1P5|Q0D2H3|Q3MHV0|Q52M21|Q5HYW6|Q6IRW4	Missense_Mutation	SNP	ENST00000373669.2	37	CCDS14417.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615306	0.87359	.	.	ENSG00000102309	ENST00000373669	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.75324	0.3834	M	0.66378	2.025	0.80722	D	1	P	0.51351	0.944	P	0.60473	0.875	T	0.77925	-0.2405	9	0.66056	D	0.02	-8.0772	15.3582	0.74443	0.0:1.0:0.0:0.0	.	118	Q9Y237-2	.	Q	118	.	ENSP00000362773:P118Q	P	+	2	0	PIN4	71333983	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.250000	0.78287	2.218000	0.71995	0.600000	0.82982	CCA	.		0.443	PIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057175.2	NM_006223	
KIZ-AS1	101929591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	21142904	21142904	+	RNA	SNP	T	T	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr20:21142904T>A	ENST00000591761.1	-	0	5142				RP5-872K7.7_ENST00000425746.2_RNA|PLK1S1_ENST00000457464.1_RNA																							GTAATTTATCTGAAGGCAAAA	0.438																																					.		.											.	.	.	0			.						.						148.0	146.0	147.0					20																	21142904		1904	4125	6029			55857	.			TTTATCTGAAGGC																													20.37:g.21142904T>A		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	39.0	.		RNA	SNP	ENST00000591761.1	37																																																																																				.		0.438	RP4-777D9.2-002	KNOWN	basic	antisense	antisense	OTTHUMT00000078258.2		
PPEF2	5470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	76794280	76794280	+	Splice_Site	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr4:76794280C>A	ENST00000286719.7	-	12	1862	c.1506G>T	c.(1504-1506)aaG>aaT	p.K502N		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	502	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GAGCACCCACCTTGCGGTTGT	0.478																																					p.K502N	NSCLC(105;1359 1603 15961 44567 47947)	.											.	PPEF2	228	0			c.G1506T						.						130.0	119.0	123.0					4																	76794280		2203	4300	6503	SO:0001630	splice_region_variant	5470	exon12			ACCCACCTTGCGG	AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1506+1G>T	4.37:g.76794280C>A		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	21.0	NM_006239	O14831	Missense_Mutation	SNP	ENST00000286719.7	37	CCDS34013.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684002	0.47991	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	T	0.05925	3.37	4.85	4.01	0.46588	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);	0.048452	0.85682	D	0.000000	T	0.16385	0.0394	L	0.46614	1.455	0.48830	D	0.999719	P;D	0.89917	0.929;1.0	P;D	0.85130	0.734;0.997	T	0.01093	-1.1454	9	.	.	.	-3.0911	10.8508	0.46769	0.0:0.9083:0.0:0.0917	.	502;502	O14830-2;O14830	.;PPE2_HUMAN	N	502	ENSP00000286719:K502N	.	K	-	3	2	PPEF2	77013304	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	5.382000	0.66213	1.274000	0.44362	0.563000	0.77884	AAG	.		0.478	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239	Missense_Mutation
RAB6A	5870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	73431941	73431941	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:73431941T>C	ENST00000336083.3	-	3	588	c.133A>G	c.(133-135)Aca>Gca	p.T45A	RAB6A_ENST00000541588.1_Missense_Mutation_p.T45A|RAB6A_ENST00000310653.6_Missense_Mutation_p.T45A|RP11-456I15.2_ENST00000538624.1_RNA|RAB6A_ENST00000536566.1_Missense_Mutation_p.T12A	NM_198896.1	NP_942599.1	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family	45					antigen processing and presentation (GO:0019882)|early endosome to Golgi transport (GO:0034498)|GTP catabolic process (GO:0006184)|minus-end-directed organelle transport along microtubule (GO:0072385)|peptidyl-cysteine methylation (GO:0018125)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|protein domain specific binding (GO:0019904)			large_intestine(2)|lung(2)	4						ATGCCAATTGTTGCCTGTAAA	0.328																																					p.T45A		.											.	RAB6A	227	0			c.A133G						.						106.0	105.0	105.0					11																	73431941		2199	4293	6492	SO:0001583	missense	5870	exon3			CAATTGTTGCCTG	AF130986	CCDS8223.1, CCDS8224.1, CCDS58155.1, CCDS58156.1	11q13.3	2008-08-08			ENSG00000175582	ENSG00000175582		"""RAB, member RAS oncogene"""	9786	protein-coding gene	gene with protein product		179513		RAB6			Standard	NM_001243718		Approved		uc001ouf.3	P20340	OTTHUMG00000134308	ENST00000336083.3:c.133A>G	11.37:g.73431941T>C	ENSP00000336850:p.Thr45Ala	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	31.0	NM_002869	A8K133|B7Z772|F5H668|Q1W5D8|Q5U0A8|Q9UBE4	Missense_Mutation	SNP	ENST00000336083.3	37	CCDS8224.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.965060	0.92855	.	.	ENSG00000175582	ENST00000310653;ENST00000336083;ENST00000393571;ENST00000536566;ENST00000541588;ENST00000539750;ENST00000535748;ENST00000542366	D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26	5.55	5.55	0.83447	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95752	0.8618	H	0.96720	3.87	0.54753	D	0.999986	D;P;P	0.89917	1.0;0.947;0.459	D;D;P	0.83275	0.996;0.915;0.645	D	0.97089	0.9789	10	0.87932	D	0	-0.0428	15.0229	0.71643	0.0:0.0:0.0:1.0	.	45;45;45	Q1W5D8;P20340;P20340-2	.;RAB6A_HUMAN;.	A	45;45;45;12;45;45;45;45	ENSP00000311449:T45A;ENSP00000336850:T45A;ENSP00000437863:T12A;ENSP00000445350:T45A	ENSP00000311449:T45A	T	-	1	0	RAB6A	73109589	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.312000	0.78968	2.330000	0.79161	0.477000	0.44152	ACA	.		0.328	RAB6A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259241.2		
ROBO1	6091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	78685014	78685014	+	Silent	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:78685014A>G	ENST00000464233.1	-	23	3395	c.3282T>C	c.(3280-3282)tcT>tcC	p.S1094S	ROBO1_ENST00000436010.2_Silent_p.S1055S|ROBO1_ENST00000467549.1_Silent_p.S994S|ROBO1_ENST00000495273.1_Silent_p.S1049S	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1094					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GCTTCTCGCCAGAGTCCCCGC	0.517																																					p.S1094S		.											.	ROBO1	67	0			c.T3282C						.						172.0	173.0	173.0					3																	78685014		2149	4260	6409	SO:0001819	synonymous_variant	6091	exon23			CTCGCCAGAGTCC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3282T>C	3.37:g.78685014A>G		Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	60.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	CCDS54611.1																																																																																			.		0.517	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
RP1	6101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	55539906	55539906	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr8:55539906A>G	ENST00000220676.1	+	4	3612	c.3464A>G	c.(3463-3465)aAc>aGc	p.N1155S		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1155					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAGGCTACCAACAAATCTTCA	0.413																																					p.N1155S	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.A3464G						.						96.0	93.0	94.0					8																	55539906		2203	4300	6503	SO:0001583	missense	6101	exon4			CTACCAACAAATC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3464A>G	8.37:g.55539906A>G	ENSP00000220676:p.Asn1155Ser	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	244.0	58.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	0.167	-1.075663	0.01903	.	.	ENSG00000104237	ENST00000220676	T	0.19532	2.14	5.7	-7.47	0.01365	.	1.011940	0.07920	N	0.975778	T	0.07369	0.0186	N	0.03324	-0.35	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.47799	-0.9089	10	0.09843	T	0.71	-0.6741	13.0879	0.59151	0.2607:0.1047:0.6345:0.0	.	1155	P56715	RP1_HUMAN	S	1155	ENSP00000220676:N1155S	ENSP00000220676:N1155S	N	+	2	0	RP1	55702459	0.005000	0.15991	0.000000	0.03702	0.035000	0.12851	-0.013000	0.12678	-0.880000	0.03997	0.460000	0.39030	AAC	.		0.413	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	47098921	47098921	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:47098921G>A	ENST00000409792.3	-	15	6395	c.6353C>T	c.(6352-6354)aCa>aTa	p.T2118I		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2118					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GCGTTCCTCTGTAGAAAGTTT	0.428			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.T2118I		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	1273	0			c.C6353T						.						70.0	72.0	71.0					3																	47098921		2203	4300	6503	SO:0001583	missense	29072	exon15			TCCTCTGTAGAAA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6353C>T	3.37:g.47098921G>A	ENSP00000386759:p.Thr2118Ile	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	24.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437857	0.83885	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	T	0.25414	1.8	4.98	4.98	0.66077	.	0.000000	0.64402	D	0.000010	T	0.47801	0.1465	L	0.50333	1.59	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.44483	-0.9325	10	0.87932	D	0	.	18.7956	0.91993	0.0:0.0:1.0:0.0	.	2118;2118	F2Z317;Q9BYW2	.;SETD2_HUMAN	I	2118	ENSP00000386759:T2118I	ENSP00000386759:T2118I	T	-	2	0	SETD2	47073925	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.171000	0.94802	2.755000	0.94549	0.655000	0.94253	ACA	.		0.428	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SLC22A10	387775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63059095	63059095	+	Silent	SNP	A	A	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:63059095A>T	ENST00000332793.6	+	2	488	c.486A>T	c.(484-486)atA>atT	p.I162I	SLC22A10_ENST00000526800.1_Silent_p.I110I|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000544661.1_Silent_p.I7I	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	162						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	GAGGCATCATAGGTGGCCATG	0.433																																					p.I162I		.											.	SLC22A10	92	0			c.A486T						.						147.0	145.0	145.0					11																	63059095		2074	4239	6313	SO:0001819	synonymous_variant	387775	exon2			CATCATAGGTGGC	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.486A>T	11.37:g.63059095A>T		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	33.0	NM_001039752	Q68CJ0	Silent	SNP	ENST00000332793.6	37	CCDS41661.1																																																																																			.		0.433	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
SORL1	6653	broad.mit.edu;bcgsc.ca	37	11	121440944	121440944	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:121440944A>G	ENST00000260197.7	+	23	3431	c.3302A>G	c.(3301-3303)aAc>aGc	p.N1101S	SORL1_ENST00000525532.1_Missense_Mutation_p.N45S	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1101	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GACTTTGACAACGACTGTGGA	0.512																																					p.N1101S		.											.	SORL1	228	0			c.A3302G						.						261.0	207.0	225.0					11																	121440944		2203	4299	6502	SO:0001583	missense	6653	exon23			TTGACAACGACTG	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.3302A>G	11.37:g.121440944A>G	ENSP00000260197:p.Asn1101Ser	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	6.0	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	A	17.84	3.487041	0.63962	.	.	ENSG00000137642	ENST00000260197;ENST00000525532	D;D	0.95588	-3.75;-3.75	5.51	5.51	0.81932	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.158900	0.53938	D	0.000043	D	0.93621	0.7963	L	0.48877	1.53	0.80722	D	1	P	0.41131	0.739	B	0.40659	0.336	D	0.93914	0.7199	10	0.56958	D	0.05	.	15.6284	0.76882	1.0:0.0:0.0:0.0	.	1101	Q92673	SORL_HUMAN	S	1101;45	ENSP00000260197:N1101S;ENSP00000434634:N45S	ENSP00000260197:N1101S	N	+	2	0	SORL1	120946154	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	8.633000	0.90999	2.089000	0.63090	0.533000	0.62120	AAC	.		0.512	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
SPTBN5	51332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42158099	42158099	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr15:42158099C>T	ENST00000320955.6	-	39	7052	c.6825G>A	c.(6823-6825)gaG>gaA	p.E2275E	MIR4310_ENST00000582950.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2275					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TCATCTTCACCTCCTGTGAAG	0.667																																					p.E2240E		.											.	SPTBN5	91	0			c.G6720A						.						13.0	17.0	16.0					15																	42158099		2046	4170	6216	SO:0001819	synonymous_variant	51332	exon39			CTTCACCTCCTGT	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.6825G>A	15.37:g.42158099C>T		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	20.0	NM_016642		Silent	SNP	ENST00000320955.6	37																																																																																				.		0.667	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
TENM3	55714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	183659598	183659598	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr4:183659598T>C	ENST00000511685.1	+	18	3403	c.3280T>C	c.(3280-3282)Tgg>Cgg	p.W1094R	TENM3_ENST00000406950.2_Missense_Mutation_p.W1094R|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1094					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CCTGACTCTGTGGGAAAAGAG	0.468																																					p.W1094R		.											.	.	.	0			c.T3280C						.						260.0	252.0	254.0					4																	183659598		1946	4161	6107	SO:0001583	missense	55714	exon17			ACTCTGTGGGAAA	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3280T>C	4.37:g.183659598T>C	ENSP00000424226:p.Trp1094Arg	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	48.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.410027	0.83340	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.92595	-3.07;-3.07	5.25	5.25	0.73442	.	.	.	.	.	D	0.96491	0.8855	M	0.88310	2.945	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	D	0.97256	0.9901	9	0.87932	D	0	.	15.3185	0.74102	0.0:0.0:0.0:1.0	.	1094	Q9P273	TEN3_HUMAN	R	1094	ENSP00000424226:W1094R;ENSP00000385276:W1094R	ENSP00000385276:W1094R	W	+	1	0	ODZ3	183896592	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.868000	0.87116	2.206000	0.71126	0.533000	0.62120	TGG	.		0.468	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
TFAP2A	7020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	10398750	10398750	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:10398750G>T	ENST00000482890.1	-	8	1566	c.1214C>A	c.(1213-1215)gCc>gAc	p.A405D	TFAP2A_ENST00000379608.3_Missense_Mutation_p.A399D|TFAP2A_ENST00000379604.2_Missense_Mutation_p.A405D|TFAP2A_ENST00000319516.4_Missense_Mutation_p.A401D|TFAP2A_ENST00000379613.3_Missense_Mutation_p.A407D|TFAP2A_ENST00000497266.1_5'Flank			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	405	H-S-H (helix-span-helix), dimerization.				anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				GGCCTTGAGGGCCTCGGTGAG	0.572																																					p.A405D		.											.	TFAP2A	91	0			c.C1214A						.						272.0	279.0	277.0					6																	10398750		2203	4300	6503	SO:0001583	missense	7020	exon7			TTGAGGGCCTCGG	X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.1214C>A	6.37:g.10398750G>T	ENSP00000418541:p.Ala405Asp	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	60.0	NM_003220	Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	ENST00000482890.1	37	CCDS4510.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075335	0.76415	.	.	ENSG00000137203	ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890	D;D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44;-4.44	5.23	5.23	0.72850	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98311	0.9440	M	0.78223	2.4	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	0.998;0.971;1.0	D	0.99372	1.0920	10	0.72032	D	0.01	-10.3232	18.824	0.92109	0.0:0.0:1.0:0.0	.	401;405;399	Q5TAV5;P05549;Q8N1C6	.;AP2A_HUMAN;.	D	407;405;401;399;405	ENSP00000368933:A407D;ENSP00000368924:A405D;ENSP00000316516:A401D;ENSP00000368928:A399D;ENSP00000418541:A405D	ENSP00000316516:A401D	A	-	2	0	TFAP2A	10506736	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.863000	0.99569	2.438000	0.82558	0.655000	0.94253	GCC	.		0.572	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220	
THSD7B	80731	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	137814010	137814010	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr2:137814010G>C	ENST00000409968.1	+	3	338	c.160G>C	c.(160-162)Gga>Cga	p.G54R	THSD7B_ENST00000272643.3_Missense_Mutation_p.G54R|THSD7B_ENST00000413152.2_Missense_Mutation_p.G23R|THSD7B_ENST00000543459.1_5'Flank			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	54	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AAGGTGTACAGGAGACTGTGG	0.488																																					.		.											.	THSD7B	75	0			.						.						56.0	59.0	58.0					2																	137814010		1990	4164	6154	SO:0001583	missense	80731	.			TGTACAGGAGACT			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.160G>C	2.37:g.137814010G>C	ENSP00000387145:p.Gly54Arg	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	30.0	.		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	G	33	5.211904	0.95069	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.59638	0.25;0.25;0.25	5.89	5.89	0.94794	.	0.000000	0.64402	U	0.000007	T	0.64994	0.2649	N	0.26042	0.785	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.56529	-0.7964	10	0.15499	T	0.54	.	19.8459	0.96707	0.0:0.0:1.0:0.0	.	23	C9JKN6	.	R	54;54;23	ENSP00000387145:G54R;ENSP00000272643:G54R;ENSP00000413841:G23R	ENSP00000272643:G54R	G	+	1	0	THSD7B	137530480	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.788000	0.95919	0.585000	0.79938	GGA	.		0.488	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
TNFRSF1A	7132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6443355	6443355	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr12:6443355G>T	ENST00000162749.2	-	2	394	c.95C>A	c.(94-96)cCt>cAt	p.P32H	TNFRSF1A_ENST00000366159.4_Missense_Mutation_p.P32H|TNFRSF1A_ENST00000540022.1_Missense_Mutation_p.P32H|TNFRSF1A_ENST00000437813.3_5'UTR	NM_001065.3	NP_001056.1	P19438	TNR1A_HUMAN	tumor necrosis factor receptor superfamily, member 1A	32					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of angiogenesis (GO:0045766)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|prostaglandin metabolic process (GO:0006693)|protein heterooligomerization (GO:0051291)|response to alkaloid (GO:0043279)|response to amino acid (GO:0043200)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|tetrapyrrole metabolic process (GO:0033013)|viral process (GO:0016032)	axon (GO:0030424)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	tumor necrosis factor-activated receptor activity (GO:0005031)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	19						CCCTAGGTGAGGGACCAGTCC	0.502																																					p.P32H		.											.	TNFRSF1A	659	0			c.C95A						.						109.0	110.0	110.0					12																	6443355		2203	4300	6503	SO:0001583	missense	7132	exon2			AGGTGAGGGACCA	M75866	CCDS8542.1	12p13.2	2014-09-17			ENSG00000067182	ENSG00000067182		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11916	protein-coding gene	gene with protein product		191190		TNFR1		1655358, 2158863	Standard	NM_001065		Approved	TNF-R, TNFAR, TNFR60, TNF-R-I, CD120a, TNF-R55	uc001qnu.3	P19438	OTTHUMG00000168267	ENST00000162749.2:c.95C>A	12.37:g.6443355G>T	ENSP00000162749:p.Pro32His	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	43.0	NM_001065	A8K4X3|B2RDE4|B3KPQ1|B4DQB7|B4E309|B5M0B5|D3DUR1|Q9UCA4	Missense_Mutation	SNP	ENST00000162749.2	37	CCDS8542.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220583	0.58560	.	.	ENSG00000067182	ENST00000162749;ENST00000540022;ENST00000539372;ENST00000366159;ENST00000440083;ENST00000536194	D;D;D;D;D;D	0.98849	-3.03;-3.17;-3.77;-4.19;-5.18;-5.05	3.89	3.89	0.44902	.	0.615734	0.16129	N	0.228289	D	0.98454	0.9485	L	0.58101	1.795	0.09310	N	0.999992	D;D;D	0.76494	0.997;0.999;0.997	P;D;P	0.66351	0.781;0.943;0.817	D	0.94886	0.8043	10	0.42905	T	0.14	-2.6243	11.2473	0.49004	0.0:0.0:1.0:0.0	.	32;32;32	B5M0B5;F5H061;P19438	.;.;TNR1A_HUMAN	H	32	ENSP00000162749:P32H;ENSP00000438343:P32H;ENSP00000442059:P32H;ENSP00000380389:P32H;ENSP00000413224:P32H;ENSP00000442919:P32H	ENSP00000162749:P32H	P	-	2	0	TNFRSF1A	6313616	0.656000	0.27385	0.939000	0.37840	0.786000	0.44442	2.233000	0.43027	2.022000	0.59522	0.563000	0.77884	CCT	.		0.502	TNFRSF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399038.1	NM_001065	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.H193R|TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000445888.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.H193R	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,0	TP53	70225	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	c.A578G	GRCh37	CM083194|CM951225	TP53	M		.						97.0	87.0	90.0					17																	7578271		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATAAGATGCTGAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg	Somatic	121.0	1.0		WXS	Illumina HiSeq	Phase_I	66.0	32.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
WDR36	134430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	110456277	110456277	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:110456277C>A	ENST00000513710.2	+	18	2160	c.2156C>A	c.(2155-2157)aCt>aAt	p.T719N	WDR36_ENST00000506538.2_Missense_Mutation_p.T719N			Q8NI36	WDR36_HUMAN	WD repeat domain 36	719					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		CTTCCTGGTACTTGTCAAACC	0.348																																					p.T719N		.											.	WDR36	92	0			c.C2156A						.						135.0	132.0	133.0					5																	110456277		2202	4300	6502	SO:0001583	missense	134430	exon18			CTGGTACTTGTCA	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.2156C>A	5.37:g.110456277C>A	ENSP00000424628:p.Thr719Asn	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	26.0	NM_139281	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	37	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.751290	0.31046	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	T;T	0.66995	-0.24;-0.24	5.72	3.92	0.45320	.	0.403741	0.32769	N	0.005679	T	0.61464	0.2349	L	0.54323	1.7	0.80722	D	1	B	0.12013	0.005	B	0.14578	0.011	T	0.60198	-0.7310	10	0.87932	D	0	-15.5734	12.0033	0.53243	0.0:0.8124:0.1218:0.0658	.	719	Q8NI36	WDR36_HUMAN	N	719	ENSP00000423067:T719N;ENSP00000424628:T719N	ENSP00000423067:T719N	T	+	2	0	WDR36	110484176	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.627000	0.54252	0.858000	0.35431	0.650000	0.86243	ACT	.		0.348	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
ZBTB9	221504	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	6	33424110	33424110	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:33424110T>A	ENST00000395064.2	+	2	1501	c.1233T>A	c.(1231-1233)ttT>ttA	p.F411L		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						TTCGGCCTTTTGGCTGTGGCA	0.567																																					p.F411L		.											.	ZBTB9	90	0			c.T1233A						.						79.0	63.0	68.0					6																	33424110		2203	4300	6503	SO:0001583	missense	221504	exon2			GCCTTTTGGCTGT	AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.1233T>A	6.37:g.33424110T>A	ENSP00000378503:p.Phe411Leu	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	8.0	NM_152735	A2AB19	Missense_Mutation	SNP	ENST00000395064.2	37	CCDS4780.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.822422	0.71028	.	.	ENSG00000213588	ENST00000395064	T	0.50548	0.74	5.1	2.42	0.29668	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.251437	0.26143	U	0.026084	T	0.47838	0.1467	M	0.67517	2.055	0.36311	D	0.857653	D	0.76494	0.999	D	0.65874	0.939	T	0.52388	-0.8582	10	0.72032	D	0.01	.	7.2285	0.26028	0.0:0.2261:0.0:0.7739	.	411	Q96C00	ZBTB9_HUMAN	L	411	ENSP00000378503:F411L	ENSP00000378503:F411L	F	+	3	2	ZBTB9	33532088	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.488000	0.22371	0.293000	0.22520	0.533000	0.62120	TTT	.		0.567	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276533.1	NM_152735	
ZC3HAV1	56829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	138764382	138764382	+	Silent	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr7:138764382C>A	ENST00000242351.5	-	4	1621	c.1305G>T	c.(1303-1305)gtG>gtT	p.V435V	ZC3HAV1_ENST00000464606.1_Silent_p.V435V|ZC3HAV1_ENST00000471652.1_Silent_p.V435V	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	435					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TATCTGTGGCCACTCCATCAG	0.448																																					p.V435V		.											.	ZC3HAV1	91	0			c.G1305T						.						103.0	104.0	104.0					7																	138764382		2203	4300	6503	SO:0001819	synonymous_variant	56829	exon4			TGTGGCCACTCCA	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.1305G>T	7.37:g.138764382C>A		Somatic	188.0	0.0		WXS	Illumina HiSeq	Phase_I	240.0	112.0	NM_024625	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Silent	SNP	ENST00000242351.5	37	CCDS5851.1																																																																																			.		0.448	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
ZFX	7543	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	24229378	24229378	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:24229378C>A	ENST00000379177.1	+	11	2730	c.2303C>A	c.(2302-2304)tCc>tAc	p.S768Y	ZFX_ENST00000540034.1_Missense_Mutation_p.S807Y|ZFX_ENST00000304543.5_Missense_Mutation_p.S768Y|ZFX_ENST00000338565.3_Missense_Mutation_p.S718Y|ZFX_ENST00000379188.3_Missense_Mutation_p.S768Y|ZFX_ENST00000539115.1_Missense_Mutation_p.S539Y	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	768					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						CACGTTATTTCCATTCACACG	0.433																																					p.S768Y	Esophageal Squamous(20;306 562 7346 32868 37983)	.											.	ZFX	132	0			c.C2303A						.						159.0	132.0	141.0					X																	24229378		2203	4300	6503	SO:0001583	missense	7543	exon10			TTATTTCCATTCA		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.2303C>A	X.37:g.24229378C>A	ENSP00000368475:p.Ser768Tyr	Somatic	352.0	0.0		WXS	Illumina HiSeq	Phase_I	310.0	111.0	NM_003410	B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	ENST00000379177.1	37	CCDS14211.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513648	0.64522	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.15372	2.43;2.43;2.43;2.43;2.43;2.43	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000003	T	0.45756	0.1358	M	0.77406	2.37	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.97110	0.999;1.0;0.998	T	0.49184	-0.8966	10	0.72032	D	0.01	-6.9146	18.0792	0.89437	0.0:1.0:0.0:0.0	.	807;490;768	B9EG97;F5GYV7;P17010	.;.;ZFX_HUMAN	Y	539;768;490;768;768;807;718	ENSP00000438233:S539Y;ENSP00000368486:S768Y;ENSP00000368475:S768Y;ENSP00000304985:S768Y;ENSP00000441382:S807Y;ENSP00000343384:S718Y	ENSP00000304985:S768Y	S	+	2	0	ZFX	24139299	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.776000	0.85560	2.291000	0.77112	0.594000	0.82650	TCC	.		0.433	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410	
ZNF354B	117608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	178310382	178310382	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:178310382G>C	ENST00000322434.3	+	5	1155	c.929G>C	c.(928-930)aGg>aCg	p.R310T	RNU1-39P_ENST00000383897.1_RNA	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCAGTCGAAGGTCTGGGCTT	0.413																																					p.R310T		.											.	ZNF354B	92	0			c.G929C						.						65.0	65.0	65.0					5																	178310382		2203	4300	6503	SO:0001583	missense	117608	exon5			GTCGAAGGTCTGG	AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.929G>C	5.37:g.178310382G>C	ENSP00000327143:p.Arg310Thr	Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	203.0	63.0	NM_058230	A8K0V2|Q5U5Z4	Missense_Mutation	SNP	ENST00000322434.3	37	CCDS4439.1	.	.	.	.	.	.	.	.	.	.	G	7.390	0.630654	0.14322	.	.	ENSG00000178338	ENST00000322434	T	0.35605	1.3	3.62	2.72	0.32119	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23806	0.0576	L	0.39245	1.2	0.09310	N	1	B	0.30870	0.298	B	0.25614	0.062	T	0.09228	-1.0684	9	0.22109	T	0.4	-9.7869	5.9037	0.18980	0.2414:0.0:0.7586:0.0	.	310	Q96LW1	Z354B_HUMAN	T	310	ENSP00000327143:R310T	ENSP00000327143:R310T	R	+	2	0	ZNF354B	178242988	0.000000	0.05858	0.869000	0.34112	0.127000	0.20565	0.091000	0.15046	1.855000	0.53841	0.561000	0.74099	AGG	.		0.413	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253482.1	NM_058230	
ZNF559	84527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9453375	9453375	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr19:9453375A>C	ENST00000393883.2	+	6	1896	c.1248A>C	c.(1246-1248)aaA>aaC	p.K416N	ZNF559_ENST00000587557.1_Missense_Mutation_p.K480N|ZNF177_ENST00000446085.4_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000603380.1_Missense_Mutation_p.K416N|CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF177_ENST00000602856.1_Intron|ZNF177_ENST00000541595.2_Intron|ZNF177_ENST00000605471.1_Intron|ZNF559_ENST00000586255.1_Intron|ZNF559_ENST00000317221.7_3'UTR|ZNF559_ENST00000538743.1_Missense_Mutation_p.K336N	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						AGTGTGGGAAAGCCTTCATTC	0.408																																					p.K480N		.											.	ZNF559	91	0			c.A1440C						.						86.0	69.0	74.0					19																	9453375		2203	4300	6503	SO:0001583	missense	84527	exon6			TGGGAAAGCCTTC	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.1248A>C	19.37:g.9453375A>C	ENSP00000377461:p.Lys416Asn	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	47.0	NM_001202406	K7EMG6	Missense_Mutation	SNP	ENST00000393883.2	37	CCDS12211.1	.	.	.	.	.	.	.	.	.	.	A	15.88	2.962572	0.53400	.	.	ENSG00000188321	ENST00000317221;ENST00000538743;ENST00000393883	T;T	0.27890	1.64;1.64	2.22	2.22	0.28083	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.55449	0.1921	M	0.86805	2.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.999;0.995	T	0.59731	-0.7399	9	0.72032	D	0.01	.	8.3425	0.32252	1.0:0.0:0.0:0.0	.	416;416;336	B3KPL8;Q9BR84;B4DP29	.;ZN559_HUMAN;.	N	416;336;416	ENSP00000442832:K336N;ENSP00000377461:K416N	ENSP00000325393:K416N	K	+	3	2	ZNF559	9314375	0.012000	0.17670	0.956000	0.39512	0.177000	0.22998	0.111000	0.15458	1.272000	0.44329	0.260000	0.18958	AAA	.		0.408	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49427419	49427420	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr12:49427419_49427420CC>AT	ENST00000301067.7	-	39	11067_11068	c.11068_11069GG>AT	c.(11068-11070)GGa>ATa	p.G3690I	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3690	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGCCAGGGATCCAGCCCCACCA	0.594																																					p.G3690I		.											.	.	.	0			.						.																																			SO:0001583	missense	8085	.			AGGGATCCAGCCC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11068_11069delinsAT	12.37:g.49427419_49427420delinsAT	ENSP00000301067:p.Gly3690Ile	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	14.0	.	O14687	Missense_Mutation	DNP	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.594	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
