#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTSL1	92949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	18777712	18777712	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr9:18777712G>A	ENST00000380548.4	+	19	3824	c.3485G>A	c.(3484-3486)cGc>cAc	p.R1162H		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1162						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		AGGCCACACCGCAAGCCCACC	0.677																																					p.R1162H		.											.	ADAMTSL1	230	0			c.G3485A						.						25.0	31.0	29.0					9																	18777712		2152	4234	6386	SO:0001583	missense	92949	exon19			CACACCGCAAGCC	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.3485G>A	9.37:g.18777712G>A	ENSP00000369921:p.Arg1162His	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	13.0	NM_001040272	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971403	0.53614	.	.	ENSG00000178031	ENST00000380548	T	0.63913	-0.07	6.03	6.03	0.97812	.	0.274117	0.29314	N	0.012501	T	0.53965	0.1829	L	0.29908	0.895	0.80722	D	1	D	0.60160	0.987	P	0.45232	0.474	T	0.53927	-0.8369	10	0.40728	T	0.16	.	14.1466	0.65355	0.0765:0.0:0.9235:0.0	.	1162	Q8N6G6	ATL1_HUMAN	H	1162	ENSP00000369921:R1162H	ENSP00000369921:R1162H	R	+	2	0	ADAMTSL1	18767712	0.082000	0.21442	0.998000	0.56505	0.112000	0.19704	1.951000	0.40333	2.868000	0.98415	0.557000	0.71058	CGC	.		0.677	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
ADCY6	112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49176704	49176704	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr12:49176704C>A	ENST00000307885.4	-	1	1208	c.514G>T	c.(514-516)Gca>Tca	p.A172S	ADCY6_ENST00000550422.1_Missense_Mutation_p.A172S|ADCY6_ENST00000357869.3_Missense_Mutation_p.A172S	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	172					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						CGGGCGGGTGCGGCGTGGAAA	0.647																																					p.A172S		.											.	ADCY6	90	0			c.G514T						.						33.0	34.0	34.0					12																	49176704		2203	4300	6503	SO:0001583	missense	112	exon2			CGGGTGCGGCGTG		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.514G>T	12.37:g.49176704C>A	ENSP00000311405:p.Ala172Ser	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	23.0	NM_020983	Q9NR75|Q9UDB0	Missense_Mutation	SNP	ENST00000307885.4	37	CCDS8767.1	.	.	.	.	.	.	.	.	.	.	C	4.574	0.106554	0.08780	.	.	ENSG00000174233	ENST00000357869;ENST00000550422;ENST00000307885	T;T;T	0.23754	1.89;1.89;1.89	5.36	5.36	0.76844	.	0.587296	0.16428	N	0.214838	T	0.14960	0.0361	N	0.11201	0.11	0.09310	N	1	B;B	0.18863	0.031;0.002	B;B	0.20184	0.028;0.003	T	0.13469	-1.0508	10	0.33940	T	0.23	.	11.3629	0.49655	0.0:0.9154:0.0:0.0846	.	172;172	O43306-2;O43306	.;ADCY6_HUMAN	S	172	ENSP00000350536:A172S;ENSP00000446730:A172S;ENSP00000311405:A172S	ENSP00000311405:A172S	A	-	1	0	ADCY6	47462971	0.003000	0.15002	0.130000	0.21974	0.136000	0.21042	1.090000	0.30902	2.515000	0.84797	0.462000	0.41574	GCA	.		0.647	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983	
ADIPOR1	51094	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202914287	202914287	+	Silent	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:202914287C>A	ENST00000340990.5	-	5	739	c.441G>T	c.(439-441)ctG>ctT	p.L147L	ADIPOR1_ENST00000367254.3_Intron|ADIPOR1_ENST00000436244.1_Silent_p.L147L	NM_015999.4	NP_057083.2	Q96A54	ADR1_HUMAN	adiponectin receptor 1	147					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|hormone-mediated signaling pathway (GO:0009755)|leptin-mediated signaling pathway (GO:0033210)|negative regulation of cell growth (GO:0030308)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of JAK-STAT cascade (GO:0046427)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(75;0.141)			AAAAGAGAAACAGCACGAAAC	0.413																																					p.L147L		.											.	ADIPOR1	90	0			c.G441T						.						44.0	45.0	45.0					1																	202914287		2203	4300	6503	SO:0001819	synonymous_variant	51094	exon5			GAGAAACAGCACG		CCDS1430.1	1q32.1	2012-08-22			ENSG00000159346	ENSG00000159346		"""GPCR / Unclassified : Adiponectin receptors"""	24040	protein-coding gene	gene with protein product		607945				12802337	Standard	XM_006711360		Approved	PAQR1, ACDCR1	uc001gyq.5	Q96A54	OTTHUMG00000041391	ENST00000340990.5:c.441G>T	1.37:g.202914287C>A		Somatic	129.0	2.0		WXS	Illumina HiSeq	Phase_I	125.0	47.0	NM_015999	B3KMB0|Q53HS7|Q53YY6|Q9Y360	Silent	SNP	ENST00000340990.5	37	CCDS1430.1																																																																																			.		0.413	ADIPOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099160.2	NM_015999	
ALOX12B	242	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7983975	7983975	+	Splice_Site	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:7983975C>A	ENST00000319144.4	-	5	911		c.e5+1		AC129492.6_ENST00000399413.3_3'UTR|ALOX12B_ENST00000577351.1_5'Flank	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type						arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						CACGGACTCACATGGGCCCCA	0.567										Multiple Myeloma(8;0.094)	OREG0024153	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	ALOX12B	226	0			c.650+1G>T						.						64.0	63.0	63.0					17																	7983975		2203	4300	6503	SO:0001630	splice_region_variant	242	exon6			GACTCACATGGGC	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.650+1G>T	17.37:g.7983975C>A		Somatic	83.0	1.0	645	WXS	Illumina HiSeq	Phase_I	61.0	41.0	NM_001139		Splice_Site	SNP	ENST00000319144.4	37	CCDS11129.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844782	0.71603	.	.	ENSG00000179477	ENST00000319144	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2763	0.66181	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALOX12B	7924700	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.598000	0.61069	2.421000	0.82119	0.555000	0.69702	.	.		0.567	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226984.3		Intron
ANGPT1	284	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	108334350	108334350	+	5'UTR	SNP	T	T	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr8:108334350T>A	ENST00000520734.1	-	0	267				ANGPT1_ENST00000518386.1_5'Flank|ANGPT1_ENST00000520052.1_5'UTR			Q15389	ANGP1_HUMAN	angiopoietin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TTTTATGTTCTAATAAACTAC	0.303																																					p.L194F		.											.	ANGPT1	521	0			c.A582T						.						82.0	78.0	80.0					8																	108334350		2203	4300	6503	SO:0001623	5_prime_UTR_variant	284	exon4			ATGTTCTAATAAA	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.-19A>T	8.37:g.108334350T>A		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	45.0	NM_001199859	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	37		.	.	.	.	.	.	.	.	.	.	T	17.54	3.414374	0.62511	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000395820	T;T	0.44881	0.91;0.91	5.77	4.61	0.57282	.	0.000000	0.56097	D	0.000027	T	0.59473	0.2196	M	0.76838	2.35	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.65140	0.932;0.932	T	0.61869	-0.6974	10	0.87932	D	0	.	7.4641	0.27312	0.1346:0.0711:0.0:0.7943	.	194;194	Q5HYA0;Q15389	.;ANGP1_HUMAN	F	194;194;6	ENSP00000428340:L194F;ENSP00000297450:L194F	ENSP00000297450:L194F	L	-	3	2	ANGPT1	108403526	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.466000	0.45084	1.017000	0.39495	0.533000	0.62120	TTA	.		0.303	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
ANKMY1	51281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	241463777	241463777	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:241463777C>T	ENST00000272972.3	-	7	1304	c.1090G>A	c.(1090-1092)Gtt>Att	p.V364I	ANKMY1_ENST00000405523.3_Missense_Mutation_p.V223I|ANKMY1_ENST00000361678.4_Missense_Mutation_p.V223I|ANKMY1_ENST00000373318.2_Missense_Mutation_p.V223I|ANKMY1_ENST00000403283.1_Missense_Mutation_p.V302I|ANKMY1_ENST00000401804.1_Missense_Mutation_p.V453I|ANKMY1_ENST00000391987.1_Missense_Mutation_p.V364I|ANKMY1_ENST00000373320.4_Missense_Mutation_p.V134I|ANKMY1_ENST00000405002.1_Missense_Mutation_p.V134I|ANKMY1_ENST00000536462.1_Missense_Mutation_p.V176I|ANKMY1_ENST00000406958.1_Missense_Mutation_p.V223I|ANKMY1_ENST00000462004.1_5'Flank	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	364							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		AGGATTGGAACAACTGGGAAT	0.448																																					p.V364I		.											.	ANKMY1	90	0			c.G1090A						.						40.0	44.0	43.0					2																	241463777		2201	4295	6496	SO:0001583	missense	51281	exon7			TTGGAACAACTGG	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1090G>A	2.37:g.241463777C>T	ENSP00000272972:p.Val364Ile	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	17.0	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	ENST00000272972.3	37	CCDS2536.1	.	.	.	.	.	.	.	.	.	.	C	4.064	0.009642	0.07912	.	.	ENSG00000144504	ENST00000373318;ENST00000406958;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002	T;T;T;T;T;T;T;T;T;T;T	0.56103	2.88;3.59;0.5;2.21;0.5;4.36;2.44;0.48;2.16;2.18;2.44	3.16	-4.41	0.03590	Ankyrin repeat-containing domain (1);	1.581880	0.04098	N	0.312380	T	0.30823	0.0777	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B;B	0.33171	0.003;0.003;0.013;0.002;0.002;0.4;0.003	B;B;B;B;B;B;B	0.30646	0.002;0.002;0.008;0.001;0.001;0.118;0.002	T	0.20840	-1.0263	10	0.51188	T	0.08	-32.2219	5.1322	0.14917	0.0:0.3825:0.37:0.2475	.	364;176;134;223;223;223;364	Q4ZFV3;F5H558;Q9P2S6-4;Q6GPI0;B5MBY4;Q9P2S6-2;Q9P2S6	.;.;.;.;.;.;ANKY1_HUMAN	I	223;223;364;223;364;134;302;453;176;223;134	ENSP00000362415:V223I;ENSP00000384555:V223I;ENSP00000272972:V364I;ENSP00000355097:V223I;ENSP00000375847:V364I;ENSP00000362417:V134I;ENSP00000383968:V302I;ENSP00000385887:V453I;ENSP00000444707:V176I;ENSP00000385635:V223I;ENSP00000385145:V134I	ENSP00000272972:V364I	V	-	1	0	ANKMY1	241112450	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.170000	0.09897	-0.920000	0.03799	-0.339000	0.08088	GTT	.		0.448	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
ANO4	121601	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	101520844	101520844	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr12:101520844C>A	ENST00000392977.3	+	27	3074	c.2864C>A	c.(2863-2865)cCg>cAg	p.P955Q	ANO4_ENST00000299222.9_Missense_Mutation_p.P475Q|ANO4_ENST00000550015.1_Missense_Mutation_p.P475Q|ANO4_ENST00000392979.3_Missense_Mutation_p.P920Q			Q32M45	ANO4_HUMAN	anoctamin 4	955					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.P920L(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						AACGAGTGGCCGTGACCATGT	0.483										HNSCC(74;0.22)																											p.P920Q		.											.	ANO4	96	1	Substitution - Missense(1)	large_intestine(1)	c.C2759A						.						97.0	66.0	76.0					12																	101520844		2203	4300	6503	SO:0001583	missense	121601	exon26			AGTGGCCGTGACC	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2864C>A	12.37:g.101520844C>A	ENSP00000376703:p.Pro955Gln	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	26.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	C	25.2	4.614633	0.87359	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.72282	-0.59;-0.33;-0.64;-0.33	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.78039	0.4221	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.80165	-0.1496	10	0.87932	D	0	.	19.9299	0.97115	0.0:1.0:0.0:0.0	.	475;955;920	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	Q	920;475;955;475	ENSP00000376705:P920Q;ENSP00000299222:P475Q;ENSP00000376703:P955Q;ENSP00000450192:P475Q	ENSP00000299222:P475Q	P	+	2	0	ANO4	100044975	1.000000	0.71417	0.972000	0.41901	0.680000	0.39746	7.772000	0.85439	2.769000	0.95229	0.655000	0.94253	CCG	.		0.483	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
ARHGAP36	158763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	130219933	130219933	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chrX:130219933G>T	ENST00000276211.5	+	9	1496	c.1151G>T	c.(1150-1152)gGa>gTa	p.G384V	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.G248V|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.G372V	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	384	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						TTGGTGTTTGGATCTGCTCTC	0.478																																					p.G384V		.											.	ARHGAP36	133	0			c.G1151T						.						245.0	232.0	236.0					X																	130219933		2203	4300	6503	SO:0001583	missense	158763	exon9			TGTTTGGATCTGC		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1151G>T	X.37:g.130219933G>T	ENSP00000276211:p.Gly384Val	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	61.0	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530778	0.45073	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	4.71	4.71	0.59529	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.43416	D	0.000578	T	0.74581	0.3735	M	0.93507	3.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.81086	-0.1092	10	0.87932	D	0	.	11.8103	0.52179	0.0:0.0:1.0:0.0	.	353;372;384	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	V	384;372;353;248	ENSP00000276211:G384V;ENSP00000359960:G372V;ENSP00000408515:G353V;ENSP00000359959:G248V	ENSP00000276211:G384V	G	+	2	0	ARHGAP36	130047614	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	6.835000	0.75344	2.170000	0.68504	0.529000	0.55759	GGA	.		0.478	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
ATP10B	23120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	160033981	160033981	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:160033981G>T	ENST00000327245.5	-	19	3797	c.2951C>A	c.(2950-2952)tCc>tAc	p.S984Y		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	984					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAGGTGATGGATGGTGTCTT	0.468																																					p.S984Y		.											.	ATP10B	72	0			c.C2951A						.						127.0	120.0	122.0					5																	160033981		1949	4140	6089	SO:0001583	missense	23120	exon19			GTGATGGATGGTG	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2951C>A	5.37:g.160033981G>T	ENSP00000313600:p.Ser984Tyr	Somatic	187.0	1.0		WXS	Illumina HiSeq	Phase_I	300.0	166.0	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631877	0.29068	.	.	ENSG00000118322	ENST00000327245	T	0.06218	3.33	5.05	5.05	0.67936	HAD-like domain (1);	0.544252	0.18094	N	0.151903	T	0.13372	0.0324	M	0.68593	2.085	0.19575	N	0.999966	P	0.49253	0.921	P	0.48952	0.596	T	0.08576	-1.0715	9	.	.	.	.	10.9146	0.47129	0.0959:0.0:0.9041:0.0	.	984	O94823	AT10B_HUMAN	Y	984	ENSP00000313600:S984Y	.	S	-	2	0	ATP10B	159966559	0.024000	0.19004	0.078000	0.20375	0.061000	0.15899	2.123000	0.41996	2.344000	0.79699	0.563000	0.77884	TCC	.		0.468	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
AXIN1	8312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	360070	360070	+	Splice_Site	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr16:360070C>A	ENST00000262320.3	-	4	1391		c.e4-1		AXIN1_ENST00000354866.3_Splice_Site|AXIN1_ENST00000481769.1_Splice_Site	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1						activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GATCCCATCCCTGTCCAGGAG	0.627																																					.		.											.	AXIN1	684	0			c.1020-1G>T						.						50.0	34.0	39.0					16																	360070		2201	4300	6501	SO:0001630	splice_region_variant	8312	exon5			CCATCCCTGTCCA	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1020-1G>T	16.37:g.360070C>A		Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	12.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Splice_Site	SNP	ENST00000262320.3	37	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150069	0.37923	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9963	0.89185	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AXIN1	300071	1.000000	0.71417	0.995000	0.50966	0.058000	0.15608	7.310000	0.78947	2.257000	0.74773	0.456000	0.33151	.	.		0.627	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		Intron
BMPER	168667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	34118587	34118587	+	Silent	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:34118587G>T	ENST00000297161.2	+	13	1571	c.1197G>T	c.(1195-1197)tcG>tcT	p.S399S	BMPER_ENST00000426693.1_Silent_p.S399S	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	399	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.S399S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CCCCTGCCTCGCCCTTCCAGG	0.582																																					p.S399S		.											.	BMPER	92	1	Substitution - coding silent(1)	lung(1)	c.G1197T						.						99.0	105.0	103.0					7																	34118587		2203	4300	6503	SO:0001819	synonymous_variant	168667	exon13			TGCCTCGCCCTTC		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1197G>T	7.37:g.34118587G>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	21.0	NM_133468	A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	37	CCDS5442.1																																																																																			.		0.582	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
BTBD7	55727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	93720038	93720038	+	Silent	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr14:93720038G>T	ENST00000334746.5	-	7	2014	c.1707C>A	c.(1705-1707)atC>atA	p.I569I	BTBD7_ENST00000393170.2_Silent_p.I143I|BTBD7_ENST00000554565.1_Silent_p.I218I	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	569					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GACGAACATAGATGCCAGCAT	0.403																																					p.I569I		.											.	BTBD7	91	0			c.C1707A						.						172.0	155.0	161.0					14																	93720038		2203	4300	6503	SO:0001819	synonymous_variant	55727	exon7			AACATAGATGCCA	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.1707C>A	14.37:g.93720038G>T		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	33.0	NM_001002860	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Silent	SNP	ENST00000334746.5	37	CCDS32146.1																																																																																			.		0.403	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860	
C11orf57	55216	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	111953465	111953465	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:111953465A>C	ENST00000280352.9	+	6	1284	c.648A>C	c.(646-648)aaA>aaC	p.K216N	TIMM8B_ENST00000507614.1_5'Flank|C11orf57_ENST00000393047.3_Missense_Mutation_p.K217N|C11orf57_ENST00000532163.1_Missense_Mutation_p.K188N|C11orf57_ENST00000420986.2_Missense_Mutation_p.K216N	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	216	Lys-rich.									autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		CTCTCAAAAAACCTGCTTTAT	0.413																																					p.K217N		.											.	C11orf57	155	0			c.A651C						.						69.0	74.0	72.0					11																	111953465		2201	4297	6498	SO:0001583	missense	55216	exon6			CAAAAAACCTGCT	BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.648A>C	11.37:g.111953465A>C	ENSP00000339076:p.Lys216Asn	Somatic	135.0	1.0		WXS	Illumina HiSeq	Phase_I	147.0	49.0	NM_001082969	Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Missense_Mutation	SNP	ENST00000280352.9	37	CCDS41715.1	.	.	.	.	.	.	.	.	.	.	A	13.90	2.375597	0.42105	.	.	ENSG00000150776	ENST00000420986;ENST00000532163;ENST00000280352;ENST00000393047;ENST00000525785;ENST00000393048	.	.	.	5.5	3.16	0.36331	.	0.567497	0.20765	N	0.086091	T	0.19167	0.0460	N	0.14661	0.345	0.23611	N	0.997295	P;P	0.46220	0.874;0.874	P;P	0.45712	0.491;0.491	T	0.06516	-1.0822	9	0.59425	D	0.04	-0.4027	4.2097	0.10505	0.6763:0.1304:0.0684:0.1249	.	217;216	Q6ZUT1-2;Q6ZUT1	.;CK057_HUMAN	N	216;188;216;217;188;71	.	ENSP00000339076:K216N	K	+	3	2	C11orf57	111458675	0.889000	0.30405	0.313000	0.25210	0.776000	0.43924	0.614000	0.24314	0.498000	0.27948	0.533000	0.62120	AAA	.		0.413	C11orf57-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316852.1	NM_018195	
CACNA1A	773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	13387893	13387893	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:13387893A>G	ENST00000360228.5	-	23	3871	c.3872T>C	c.(3871-3873)aTg>aCg	p.M1291T	CACNA1A_ENST00000573710.2_Missense_Mutation_p.M1292T	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1292					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CTTGATCACCATCTCAAAGGT	0.453											OREG0025295	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M1292T		.											.	CACNA1A	67	0			c.T3875C						.						105.0	94.0	98.0					19																	13387893		1909	4123	6032	SO:0001583	missense	773	exon23			ATCACCATCTCAA	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3872T>C	19.37:g.13387893A>G	ENSP00000353362:p.Met1291Thr	Somatic	48.0	0.0	687	WXS	Illumina HiSeq	Phase_I	55.0	17.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	A	13.47	2.247403	0.39697	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.97575	-4.44	4.54	4.54	0.55810	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97663	0.9234	M	0.63843	1.955	0.58432	D	0.999999	D;D;D	0.76494	0.996;0.999;0.961	D;D;P	0.69142	0.952;0.962;0.584	D	0.98239	1.0487	10	0.87932	D	0	.	12.8714	0.57966	1.0:0.0:0.0:0.0	.	1292;1295;1291	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	T	1291;1295;1292;1292	ENSP00000353362:M1291T	ENSP00000317661:M1292T	M	-	2	0	CACNA1A	13248893	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	8.712000	0.91403	1.690000	0.51089	0.482000	0.46254	ATG	.		0.453	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CACNB4	785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152695776	152695776	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:152695776A>T	ENST00000539935.1	-	14	1487	c.1420T>A	c.(1420-1422)Ttg>Atg	p.L474M	CACNB4_ENST00000397327.2_Missense_Mutation_p.L427M|CACNB4_ENST00000360283.6_Missense_Mutation_p.L441M|CACNB4_ENST00000534999.1_Missense_Mutation_p.L440M|CACNB4_ENST00000201943.5_Missense_Mutation_p.L412M|CACNB4_ENST00000427385.1_Missense_Mutation_p.L456M	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit	474					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CTGGAAGACAAGCGGTTCCTA	0.463																																					p.L474M		.											.	CACNB4	24	0			c.T1420A						.						113.0	113.0	113.0					2																	152695776		1985	4183	6168	SO:0001583	missense	785	exon14			AAGACAAGCGGTT	AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.1420T>A	2.37:g.152695776A>T	ENSP00000438949:p.Leu474Met	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	77.0	NM_000726	A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Missense_Mutation	SNP	ENST00000539935.1	37	CCDS46426.1	.	.	.	.	.	.	.	.	.	.	A	10.18	1.278017	0.23307	.	.	ENSG00000182389	ENST00000539935;ENST00000360283;ENST00000543269;ENST00000439467;ENST00000534999;ENST00000397327;ENST00000427385;ENST00000201943;ENST00000339254	T;T;T;T;T;T;T	0.73897	-0.7;-0.7;-0.7;-0.7;-0.69;-0.7;-0.79	5.26	4.12	0.48240	.	0.136662	0.51477	D	0.000092	T	0.53753	0.1816	N	0.11560	0.145	0.51012	D	0.999903	B;B;B;B	0.18610	0.006;0.017;0.017;0.029	B;B;B;B	0.17979	0.009;0.015;0.015;0.02	T	0.51560	-0.8690	10	0.33141	T	0.24	-8.5623	10.4536	0.44537	0.9235:0.0:0.0765:0.0	.	412;474;456;440	A7BJ74;O00305;B4DG40;O00305-2	.;CACB4_HUMAN;.;.	M	474;441;369;469;440;427;456;412;475	ENSP00000438949:L474M;ENSP00000353425:L441M;ENSP00000390161:L469M;ENSP00000443893:L440M;ENSP00000380490:L427M;ENSP00000410978:L456M;ENSP00000201943:L412M	ENSP00000201943:L412M	L	-	1	2	CACNB4	152404022	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.249000	0.51437	1.988000	0.58038	0.377000	0.23210	TTG	.		0.463	CACNB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338385.4	NM_000726.3	
CDH9	1007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	26889956	26889956	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:26889956T>C	ENST00000231021.4	-	9	1673	c.1501A>G	c.(1501-1503)Aaa>Gaa	p.K501E		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	501	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGCCCAGGTTTTGCATTTTCA	0.308																																					p.K501E	Melanoma(8;187 585 15745 40864 52829)	.											.	CDH9	99	0			c.A1501G						.						81.0	83.0	82.0					5																	26889956		2203	4300	6503	SO:0001583	missense	1007	exon9			CAGGTTTTGCATT	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1501A>G	5.37:g.26889956T>C	ENSP00000231021:p.Lys501Glu	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	48.0	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084226	0.76642	.	.	ENSG00000113100	ENST00000231021	T	0.51574	0.7	5.31	5.31	0.75309	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.53367	0.1792	M	0.71581	2.175	0.52501	D	0.999951	B;B	0.28636	0.107;0.218	B;B	0.38327	0.256;0.271	T	0.51896	-0.8647	9	.	.	.	.	14.0813	0.64925	0.0:0.0:0.0:1.0	.	94;501	B4DFP0;Q9ULB4	.;CADH9_HUMAN	E	501	ENSP00000231021:K501E	.	K	-	1	0	CDH9	26925713	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.664000	0.83830	2.010000	0.58986	0.450000	0.29827	AAA	.		0.308	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
CHD3	1107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7811224	7811224	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:7811224G>T	ENST00000330494.7	+	34	5189	c.5039G>T	c.(5038-5040)gGt>gTt	p.G1680V	SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000380358.4_Missense_Mutation_p.G1739V|CHD3_ENST00000358181.4_Missense_Mutation_p.G1646V	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1680	Required for interaction with PCNT.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GATGTAAAAGGTGACCGGGAG	0.547																																					p.G1739V		.											.	CHD3	228	0			c.G5216T						.						81.0	73.0	76.0					17																	7811224		2203	4300	6503	SO:0001583	missense	1107	exon34			TAAAAGGTGACCG	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.5039G>T	17.37:g.7811224G>T	ENSP00000332628:p.Gly1680Val	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	15.0	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.611752	0.28712	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494;ENST00000439235	D;D;D	0.90069	-2.61;-2.53;-2.54	4.65	-0.0728	0.13738	.	0.156126	0.29900	N	0.010920	T	0.67249	0.2873	N	0.08118	0	0.46586	D	0.999116	B;P;B;B	0.37864	0.01;0.61;0.019;0.013	B;B;B;B	0.32864	0.003;0.154;0.006;0.003	T	0.56450	-0.7977	10	0.30078	T	0.28	-11.2383	0.5219	0.00613	0.2433:0.1397:0.218:0.399	.	257;1646;1680;1739	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	V	1739;1646;1680;8	ENSP00000369716:G1739V;ENSP00000350907:G1646V;ENSP00000332628:G1680V	ENSP00000332628:G1680V	G	+	2	0	CHD3	7751949	0.078000	0.21339	0.949000	0.38748	0.883000	0.51084	0.246000	0.18160	0.170000	0.19704	-0.314000	0.08810	GGT	.		0.547	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
CHRNA3	1136	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	78893648	78893648	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr15:78893648G>T	ENST00000326828.5	-	5	1720	c.1336C>A	c.(1336-1338)Caa>Aaa	p.Q446K	CHRNA3_ENST00000348639.3_Missense_Mutation_p.Q446K	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	446					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	TTGACACTTTGGATGGCTTCT	0.388																																					p.Q446K		.											.	CHRNA3	515	0			c.C1336A						.						147.0	147.0	147.0					15																	78893648		2196	4293	6489	SO:0001583	missense	1136	exon5			CACTTTGGATGGC		CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.1336C>A	15.37:g.78893648G>T	ENSP00000315602:p.Gln446Lys	Somatic	214.0	1.0		WXS	Illumina HiSeq	Phase_I	239.0	90.0	NM_000743	Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Missense_Mutation	SNP	ENST00000326828.5	37	CCDS10305.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299713	0.40694	.	.	ENSG00000080644	ENST00000348639;ENST00000326828;ENST00000326858	T;T	0.69561	-0.41;-0.41	5.58	4.67	0.58626	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.325597	0.32314	N	0.006280	T	0.44393	0.1291	N	0.03948	-0.315	0.38362	D	0.944635	B;B	0.21821	0.001;0.061	B;B	0.19666	0.007;0.026	T	0.46665	-0.9175	10	0.51188	T	0.08	.	13.2904	0.60269	0.0:0.5737:0.4263:0.0	.	446;446	P32297;P32297-3	ACHA3_HUMAN;.	K	446;446;253	ENSP00000267951:Q446K;ENSP00000315602:Q446K	ENSP00000315602:Q446K	Q	-	1	0	CHRNA3	76680703	1.000000	0.71417	0.953000	0.39169	0.998000	0.95712	3.710000	0.54860	1.356000	0.45884	0.591000	0.81541	CAA	.		0.388	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290111.3		
CR2	1380	ucsc.edu;bcgsc.ca	37	1	207642179	207642179	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:207642179T>A	ENST00000367058.3	+	4	858	c.669T>A	c.(667-669)aaT>aaA	p.N223K	CR2_ENST00000367057.3_Missense_Mutation_p.N223K|CR2_ENST00000458541.2_Missense_Mutation_p.N223K|CR2_ENST00000485707.1_3'UTR|CR2_ENST00000367059.3_Missense_Mutation_p.N223K	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	223	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						GATTTCCCAATGGGAAGGTAA	0.393																																					p.N223K		.											.	CR2	232	0			c.T669A						.						90.0	85.0	87.0					1																	207642179		2203	4300	6503	SO:0001583	missense	1380	exon4			TCCCAATGGGAAG	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.669T>A	1.37:g.207642179T>A	ENSP00000356025:p.Asn223Lys	Somatic	237.0	2.0		WXS	Illumina HiSeq	.	251.0	94.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	37	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.469200	0.43839	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.5	1.88	0.25563	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.80076	0.4557	M	0.92833	3.35	0.39310	D	0.965065	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.997	T	0.77892	-0.2418	9	0.59425	D	0.04	.	7.0712	0.25179	0.0:0.2656:0.0:0.7344	.	223;223;223	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	K	223	ENSP00000356025:N223K;ENSP00000356024:N223K;ENSP00000356026:N223K;ENSP00000404222:N223K	ENSP00000356024:N223K	N	+	3	2	CR2	205708802	1.000000	0.71417	0.987000	0.45799	0.019000	0.09904	0.375000	0.20518	0.068000	0.16574	0.460000	0.39030	AAT	.		0.393	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
CTSL	1514	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	90342998	90342998	+	Silent	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr9:90342998G>A	ENST00000343150.5	+	3	1073	c.183G>A	c.(181-183)ctG>ctA	p.L61L	CTSL_ENST00000495822.1_Intron|CTSL_ENST00000342020.5_Silent_p.L61L|CTSL_ENST00000340342.6_Silent_p.L61L			P07711	CATL1_HUMAN	cathepsin L	61					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										TGATTGAACTGCACAATCAGG	0.458																																					p.L61L		.											.	CTSL1	93	0			c.G183A						.						216.0	185.0	196.0					9																	90342998		2203	4300	6503	SO:0001819	synonymous_variant	1514	exon3			TGAACTGCACAAT	X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.183G>A	9.37:g.90342998G>A		Somatic	53.0	1.0		WXS	Illumina HiSeq	Phase_I	29.0	17.0	NM_145918	Q6IAV1|Q96QJ0	Silent	SNP	ENST00000343150.5	37	CCDS6675.1																																																																																			.		0.458	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052936.1	NM_001912	
DAGLA	747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	61502408	61502408	+	Silent	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:61502408C>A	ENST00000257215.5	+	10	1178	c.1062C>A	c.(1060-1062)atC>atA	p.I354I		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	354					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CCATTGCCATCCGGCGCCACT	0.632																																					p.I354I		.											.	DAGLA	92	0			c.C1062A						.						218.0	198.0	205.0					11																	61502408		2202	4299	6501	SO:0001819	synonymous_variant	747	exon10			TGCCATCCGGCGC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1062C>A	11.37:g.61502408C>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	11.0	NM_006133	A7E233|Q6WQJ0	Silent	SNP	ENST00000257215.5	37	CCDS31578.1																																																																																			.		0.632	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
DNMBP	23268	broad.mit.edu;bcgsc.ca	37	10	101656127	101656127	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr10:101656127T>C	ENST00000324109.4	-	10	3039	c.2948A>G	c.(2947-2949)gAt>gGt	p.D983G	DNMBP_ENST00000342239.3_Missense_Mutation_p.D1007G|DNMBP_ENST00000540316.1_Intron|DNMBP_ENST00000543621.1_Missense_Mutation_p.D229G	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	983					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CATAAGGCTATCTTCATCACC	0.433																																					p.D983G		.											.	DNMBP	233	0			c.A2948G						.						205.0	168.0	180.0					10																	101656127		2203	4300	6503	SO:0001583	missense	23268	exon10			AGGCTATCTTCAT	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.2948A>G	10.37:g.101656127T>C	ENSP00000315659:p.Asp983Gly	Somatic	141.0	1.0		WXS	Illumina HiSeq	Phase_I	149.0	6.0	NM_015221	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	37	CCDS7485.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.350824	0.82132	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621	T;T;T	0.18174	2.63;2.55;2.23	5.47	4.3	0.51218	.	0.000000	0.49305	D	0.000143	T	0.31451	0.0797	L	0.50333	1.59	0.80722	D	1	D;D;D	0.63880	0.993;0.962;0.993	P;P;P	0.61328	0.878;0.625;0.887	T	0.01532	-1.1331	10	0.56958	D	0.05	-21.875	12.4019	0.55418	0.0:0.0:0.1407:0.8593	.	983;229;1007	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	G	1007;983;229;229	ENSP00000344914:D1007G;ENSP00000315659:D983G;ENSP00000443657:D229G	ENSP00000315659:D983G	D	-	2	0	DNMBP	101646117	0.999000	0.42202	0.955000	0.39395	0.994000	0.84299	4.157000	0.58144	0.860000	0.35481	0.454000	0.30748	GAT	.		0.433	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
DTNA	1837	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	32418793	32418793	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr18:32418793C>A	ENST00000399113.3	+	12	1257	c.1257C>A	c.(1255-1257)aaC>aaA	p.N419K	DTNA_ENST00000598774.1_Intron|DTNA_ENST00000597599.1_Intron|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000601125.1_Intron|DTNA_ENST00000598334.1_Intron|DTNA_ENST00000591182.1_Intron|DTNA_ENST00000599844.1_Intron|DTNA_ENST00000597674.1_Intron|DTNA_ENST00000269192.7_Missense_Mutation_p.N128K|DTNA_ENST00000595022.1_Intron|DTNA_ENST00000269191.6_Missense_Mutation_p.N419K|DTNA_ENST00000444659.1_Missense_Mutation_p.N419K|DTNA_ENST00000556414.3_Intron|DTNA_ENST00000399097.3_Intron|DTNA_ENST00000269190.7_Missense_Mutation_p.N420K|DTNA_ENST00000348997.5_Missense_Mutation_p.N416K|DTNA_ENST00000598142.1_Intron|DTNA_ENST00000283365.9_Intron|DTNA_ENST00000399121.5_Intron			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	419	Syntrophin-binding region.				neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						TCCGGAACAACCCCTCATGGT	0.517																																					p.N419K		.											.	DTNA	153	0			c.C1257A						.						162.0	118.0	133.0					18																	32418793		2203	4300	6503	SO:0001583	missense	1837	exon12			GAACAACCCCTCA	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1257C>A	18.37:g.32418793C>A	ENSP00000382064:p.Asn419Lys	Somatic	82.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	28.0	NM_001390	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	37	CCDS59311.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.968749	0.34754	.	.	ENSG00000134769	ENST00000269190;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113;ENST00000269192	D;D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78;-1.78	5.95	5.05	0.67936	.	0.303023	0.40908	D	0.000982	T	0.78117	0.4233	L	0.50333	1.59	0.80722	D	1	B;B;B;B	0.10296	0.003;0.0;0.0;0.001	B;B;B;B	0.10450	0.005;0.001;0.002;0.003	T	0.70956	-0.4731	10	0.16420	T	0.52	-17.2776	15.6227	0.76820	0.0:0.8641:0.1359:0.0	.	128;419;419;416	B4DIR0;Q9Y4J8;Q9Y4J8-3;Q9Y4J8-4	.;DTNA_HUMAN;.;.	K	420;416;419;419;419;419;128	ENSP00000269190:N420K;ENSP00000336682:N416K;ENSP00000405819:N419K;ENSP00000269191:N419K;ENSP00000382064:N419K;ENSP00000269192:N128K	ENSP00000269190:N420K	N	+	3	2	DTNA	30672791	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.095000	0.41729	2.817000	0.96982	0.563000	0.77884	AAC	.		0.517	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390	
FANK1	92565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	127697046	127697046	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr10:127697046G>T	ENST00000368693.1	+	8	880	c.776G>T	c.(775-777)aGg>aTg	p.R259M	FANK1_ENST00000477963.1_3'UTR|FANK1_ENST00000368695.1_Missense_Mutation_p.R253M			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	259						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GGAAATCAGAGGGTGGCCTCT	0.532																																					p.R259M		.											.	FANK1	91	0			c.G776T						.						111.0	107.0	109.0					10																	127697046		2203	4300	6503	SO:0001583	missense	92565	exon8			ATCAGAGGGTGGC	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.776G>T	10.37:g.127697046G>T	ENSP00000357682:p.Arg259Met	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	41.0	NM_145235	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	37	CCDS31309.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.49|11.49	1.653705|1.653705	0.29425|0.29425	.|.	.|.	ENSG00000203780|ENSG00000203780	ENST00000456942|ENST00000368695;ENST00000368693;ENST00000368691;ENST00000368692	.|T;T;T	.|0.65732	.|-0.14;-0.14;-0.17	5.62|5.62	0.54|0.54	0.17163|0.17163	.|Ankyrin repeat-containing domain (4);	.|1.429690	.|0.04021	.|N	.|0.299830	T|T	0.59649|0.59649	0.2209|0.2209	L|L	0.37507|0.37507	1.11|1.11	0.58432|0.58432	D|D	0.999997|0.999997	.|P;P;P	.|0.48016	.|0.904;0.786;0.73	.|B;B;P	.|0.44623	.|0.443;0.326;0.455	T|T	0.50898|0.50898	-0.8773|-0.8773	5|10	.|0.72032	.|D	.|0.01	-2.3728|-2.3728	11.8524|11.8524	0.52419|0.52419	0.881:0.0:0.119:0.0|0.881:0.0:0.119:0.0	.|.	.|285;259;259	.|Q8TC84-3;Q8TC84-2;Q8TC84	.|.;.;FANK1_HUMAN	W|M	154|253;259;237;285	.|ENSP00000357684:R253M;ENSP00000357682:R259M;ENSP00000357680:R237M	.|ENSP00000357680:R237M	G|R	+|+	1|2	0|0	FANK1|FANK1	127687036|127687036	0.324000|0.324000	0.24652|0.24652	0.287000|0.287000	0.24848|0.24848	0.048000|0.048000	0.14542|0.14542	0.655000|0.655000	0.24933|0.24933	-0.135000|-0.135000	0.11495|0.11495	0.655000|0.655000	0.94253|0.94253	GGG|AGG	.		0.532	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
FER1L6	654463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	125072474	125072474	+	Silent	SNP	C	C	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr8:125072474C>G	ENST00000522917.1	+	23	3134	c.2928C>G	c.(2926-2928)acC>acG	p.T976T	FER1L6-AS2_ENST00000601180.1_RNA|FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Silent_p.T976T	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	976						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CAGACATCACCCAGATCTACC	0.572																																					p.T976T		.											.	FER1L6	100	0			c.C2928G						.						104.0	116.0	112.0					8																	125072474		2198	4297	6495	SO:0001819	synonymous_variant	654463	exon23			CATCACCCAGATC	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2928C>G	8.37:g.125072474C>G		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	13.0	NM_001039112		Silent	SNP	ENST00000522917.1	37	CCDS43767.1																																																																																			.		0.572	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
FIG4	9896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	110059526	110059526	+	Splice_Site	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:110059526A>G	ENST00000230124.3	+	7	770		c.e7-1		FIG4_ENST00000441478.2_Intron|FIG4_ENST00000368941.1_Intron	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase						cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		TTTATTTTTCAGGGGTATTTG	0.323																																					.		.											.	FIG4	69	0			c.647-2A>G						.						107.0	112.0	110.0					6																	110059526		2203	4298	6501	SO:0001630	splice_region_variant	9896	exon7			TTTTTCAGGGGTA	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.647-1A>G	6.37:g.110059526A>G		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	54.0	NM_014845	Q53H49|Q5TCS6	Splice_Site	SNP	ENST00000230124.3	37	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.162390	0.78226	.	.	ENSG00000112367	ENST00000230124;ENST00000454215	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0957	0.81123	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FIG4	110166219	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.617000	0.90927	2.199000	0.70637	0.533000	0.62120	.	.		0.323	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845	Intron
FOXRED1	55572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	126145999	126145999	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:126145999A>G	ENST00000263578.5	+	8	930	c.856A>G	c.(856-858)Att>Gtt	p.I286V	FOXRED1_ENST00000442061.2_Missense_Mutation_p.I116V|FOXRED1_ENST00000532125.1_Missense_Mutation_p.I272V|FOXRED1_ENST00000534011.1_3'UTR	NM_017547.3	NP_060017.1	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing 1	286						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		GGAATGCGCCATTGTGATCAA	0.642																																					p.I286V		.											.	FOXRED1	90	0			c.A856G						.						32.0	30.0	31.0					11																	126145999		2201	4295	6496	SO:0001583	missense	55572	exon8			TGCGCCATTGTGA		CCDS8471.1	11q24.2	2006-02-03			ENSG00000110074	ENSG00000110074			26927	protein-coding gene	gene with protein product		613622				10497265	Standard	NM_017547		Approved	H17	uc001qdi.3	Q96CU9	OTTHUMG00000165827	ENST00000263578.5:c.856A>G	11.37:g.126145999A>G	ENSP00000263578:p.Ile286Val	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	25.0	NM_017547	B3KN84|B4DHU2|Q71MG0|Q9BU39|Q9UKY9	Missense_Mutation	SNP	ENST00000263578.5	37	CCDS8471.1	.	.	.	.	.	.	.	.	.	.	A	7.716	0.696190	0.15106	.	.	ENSG00000110074	ENST00000263578;ENST00000442061;ENST00000532125	T;T;T	0.80653	-1.4;-1.4;-1.4	5.61	-4.83	0.03161	FAD dependent oxidoreductase (1);	0.654096	0.16038	N	0.232524	T	0.49355	0.1552	N	0.05230	-0.09	0.22096	N	0.999364	B;B;B	0.13145	0.001;0.007;0.001	B;B;B	0.22753	0.002;0.041;0.002	T	0.51442	-0.8705	10	0.06757	T	0.87	-1.6918	4.9131	0.13833	0.2152:0.4994:0.1921:0.0933	.	272;153;286	Q96CU9-3;B4DI59;Q96CU9	.;.;FXRD1_HUMAN	V	286;116;272	ENSP00000263578:I286V;ENSP00000404371:I116V;ENSP00000434178:I272V	ENSP00000263578:I286V	I	+	1	0	FOXRED1	125651209	0.004000	0.15560	0.071000	0.20095	0.665000	0.39181	-1.127000	0.03251	-0.798000	0.04444	-1.834000	0.00590	ATT	.		0.642	FOXRED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386434.1	NM_017547	
GLIS3	169792	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	3898836	3898836	+	Splice_Site	SNP	C	C	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr9:3898836C>G	ENST00000324333.10	-	6	1712		c.e6-1		GLIS3_ENST00000381971.3_Splice_Site|GLIS3-AS1_ENST00000451340.2_RNA|GLIS3_ENST00000461870.1_Splice_Site	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		TGGACCGCAACTAAGAGGACA	0.542																																					.		.											.	.	.	0			.						.						56.0	57.0	57.0					9																	3898836		2203	4300	6503	SO:0001630	splice_region_variant	84850	.			CCGCAACTAAGAG	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1519-1G>C	9.37:g.3898836C>G		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	24.0	.	B1AL19|Q1PHK5	RNA	SNP	ENST00000324333.10	37	CCDS6451.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265234	0.59431	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8751	0.96867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GLIS3	3888836	1.000000	0.71417	0.681000	0.30009	0.811000	0.45836	4.942000	0.63547	2.695000	0.91970	0.655000	0.94253	.	.		0.542	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051559.1	NM_152629	Intron
GMNN	51053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	24785914	24785914	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:24785914G>C	ENST00000230056.3	+	7	849	c.517G>C	c.(517-519)Gaa>Caa	p.E173Q	GMNN_ENST00000356509.3_Missense_Mutation_p.E173Q	NM_015895.4	NP_056979.1	O75496	GEMI_HUMAN	geminin, DNA replication inhibitor	173	Homeodomain binding.				mitotic cell cycle (GO:0000278)|negative regulation of cell cycle (GO:0045786)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	10						GGATAATCAGGAATTTGATTC	0.353																																					p.E173Q		.											.	GMNN	228	0			c.G517C						.						86.0	89.0	88.0					6																	24785914		2203	4300	6503	SO:0001583	missense	51053	exon7			AATCAGGAATTTG	AF067855	CCDS4560.1	6p21.32	2008-10-31			ENSG00000112312	ENSG00000112312			17493	protein-coding gene	gene with protein product		602842				9635433	Standard	NM_001251989		Approved	Gem	uc003nem.3	O75496	OTTHUMG00000014363	ENST00000230056.3:c.517G>C	6.37:g.24785914G>C	ENSP00000230056:p.Glu173Gln	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	40.0	NM_001251991	B3KMM8|Q9H1Z1	Missense_Mutation	SNP	ENST00000230056.3	37	CCDS4560.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.309312	0.60414	.	.	ENSG00000112312	ENST00000356509;ENST00000230056;ENST00000378054	T;T;T	0.15487	2.42;2.42;2.42	5.95	5.95	0.96441	.	0.453554	0.25810	N	0.028155	T	0.17534	0.0421	M	0.68317	2.08	0.31892	N	0.617107	D	0.54397	0.966	P	0.52109	0.69	T	0.06499	-1.0823	10	0.30854	T	0.27	-9.3621	12.2941	0.54836	0.0772:0.0:0.9228:0.0	.	173	O75496	GEMI_HUMAN	Q	173	ENSP00000348902:E173Q;ENSP00000230056:E173Q;ENSP00000367293:E173Q	ENSP00000230056:E173Q	E	+	1	0	GMNN	24893893	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	4.852000	0.62904	2.824000	0.97209	0.655000	0.94253	GAA	.		0.353	GMNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040021.2	NM_015895	
GOSR2	9570	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	45015970	45015970	+	Silent	SNP	T	T	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:45015970T>G	ENST00000393456.2	+	6	540	c.483T>G	c.(481-483)acT>acG	p.T161T	GOSR2_ENST00000576910.2_Silent_p.T114T|GOSR2_ENST00000225567.4_Silent_p.T161T|RP11-156P1.2_ENST00000571841.1_Silent_p.T161T|GOSR2_ENST00000439730.2_Silent_p.T161T	NM_004287.3	NP_004278.2	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2	161					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|skin(1)	7			BRCA - Breast invasive adenocarcinoma(9;0.102)			CCCAGGGGACTCAGAAGAAGA	0.478																																					p.T161T		.											.	GOSR2	92	0			c.T483G						.						265.0	266.0	266.0					17																	45015970		2203	4300	6503	SO:0001819	synonymous_variant	9570	exon6			GGGGACTCAGAAG	AF007548	CCDS11507.1, CCDS42355.1, CCDS45719.1	17q21	2006-02-10				ENSG00000108433			4431	protein-coding gene	gene with protein product		604027				9349823, 10198168	Standard	XM_005257843		Approved	GS27, Bos1	uc002ikz.3	O14653		ENST00000393456.2:c.483T>G	17.37:g.45015970T>G		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	22.0	NM_004287	D3DXJ5|D3DXJ6|Q8N4B8|Q96DA5|Q9BZZ4	Silent	SNP	ENST00000393456.2	37	CCDS42355.1																																																																																			.		0.478	GOSR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440438.1		
GRIP2	80852	broad.mit.edu;ucsc.edu	37	3	14551403	14551403	+	RNA	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr3:14551403A>G	ENST00000273083.3	-	0	2067							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						CGAAATGGTGATGCCCAGGGG	0.622																																					.		.											.	GRIP2	69	0			.						.						35.0	41.0	39.0					3																	14551403		1944	4066	6010			80852	.			ATGGTGATGCCCA	AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14551403A>G		Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	4.0	.	Q8TEH9|Q9H7H3	RNA	SNP	ENST00000273083.3	37																																																																																				.		0.622	GRIP2-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000340582.2	NM_001080423	
GSTZ1	2954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	77796672	77796672	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr14:77796672G>T	ENST00000556627.1	+	7	544	c.413G>T	c.(412-414)tGc>tTc	p.C138F	GSTZ1_ENST00000553586.1_Missense_Mutation_p.C166F|GSTZ1_ENST00000361389.4_Missense_Mutation_p.C110F|GSTZ1_ENST00000554279.1_Missense_Mutation_p.C151F|GSTZ1_ENST00000557053.1_Missense_Mutation_p.C68F|GSTZ1_ENST00000349555.3_Missense_Mutation_p.C123F|GSTZ1_ENST00000393734.1_Missense_Mutation_p.C110F|GSTZ1_ENST00000216465.5_Missense_Mutation_p.C165F|GSTZ1_ENST00000557639.1_Missense_Mutation_p.C110F			O43708	MAAI_HUMAN	glutathione S-transferase zeta 1	165	GST C-terminal.				cellular nitrogen compound metabolic process (GO:0034641)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|L-phenylalanine catabolic process (GO:0006559)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|maleylacetoacetate isomerase activity (GO:0016034)|protein homodimerization activity (GO:0042803)			lung(2)|prostate(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)	Glutathione(DB00143)	GCTGATCTGTGCTTGGTGCCT	0.612																																					p.C165F		.											.	GSTZ1	90	0			c.G494T						.						196.0	173.0	180.0					14																	77796672		2203	4300	6503	SO:0001583	missense	2954	exon8			ATCTGTGCTTGGT	U86529	CCDS9858.1, CCDS9859.1, CCDS9860.1	14q24.3	2012-06-22	2012-06-22		ENSG00000100577	ENSG00000100577	5.2.1.2, 2.5.1.18	"""Glutathione S-transferases / Soluble"""	4643	protein-coding gene	gene with protein product	"""maleylacetoacetate isomerase"""	603758	"""glutathione transferase zeta 1"""			9396740, 9417084	Standard	NM_001513		Approved	GSTZ1-1, MAAI, MAI	uc001xtj.3	O43708	OTTHUMG00000171551	ENST00000556627.1:c.413G>T	14.37:g.77796672G>T	ENSP00000450487:p.Cys138Phe	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	27.0	NM_145870	A6NED0|A6NNB8|A8MWD7|B2RCK3|O15308|O75430|Q6IB17|Q7Z610|Q9BV63	Missense_Mutation	SNP	ENST00000556627.1	37		.	.	.	.	.	.	.	.	.	.	G	18.00	3.524815	0.64747	.	.	ENSG00000100577	ENST00000216465;ENST00000361389;ENST00000554279;ENST00000557639;ENST00000349555;ENST00000556627;ENST00000557053;ENST00000393734;ENST00000553586	T;T;T;T;T;T;T;T;T	0.01998	4.51;4.51;4.51;4.51;4.51;4.51;4.51;4.51;4.51	5.62	5.62	0.85841	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.05686	0.0149	L	0.55017	1.72	0.80722	D	1	P;D	0.56035	0.763;0.974	P;P	0.48627	0.582;0.584	T	0.35992	-0.9766	10	0.45353	T	0.12	-0.1006	16.5453	0.84444	0.0:0.0:1.0:0.0	.	123;165	A6NED0;O43708	.;MAAI_HUMAN	F	165;110;151;110;123;138;68;110;166	ENSP00000216465:C165F;ENSP00000354959:C110F;ENSP00000452498:C151F;ENSP00000451927:C110F;ENSP00000314404:C123F;ENSP00000450487:C138F;ENSP00000451150:C68F;ENSP00000377335:C110F;ENSP00000451976:C166F	ENSP00000216465:C165F	C	+	2	0	GSTZ1	76866425	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	6.841000	0.75374	2.648000	0.89879	0.462000	0.41574	TGC	.		0.612	GSTZ1-012	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000414090.1	NM_145870	
HNRNPA1	3178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54676893	54676893	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr12:54676893C>G	ENST00000340913.6	+	8	835	c.782C>G	c.(781-783)tCt>tGt	p.S261C	HNRNPA1_ENST00000546500.1_Intron|HNRNPA1_ENST00000547276.1_Intron|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000330752.8_Intron	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	261	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						CCTGGTTACTCTGGAGGAAGC	0.488																																					p.S261C	Colon(83;502 1289 8436 16406 24870)	.											.	HNRNPA1	93	0			c.C782G						.						55.0	57.0	56.0					12																	54676893		2005	4171	6176	SO:0001583	missense	3178	exon8			GTTACTCTGGAGG	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.782C>G	12.37:g.54676893C>G	ENSP00000341826:p.Ser261Cys	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	34.0	NM_031157	A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	ENST00000340913.6	37	CCDS44909.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600276	0.28534	.	.	ENSG00000135486	ENST00000340913	D	0.88818	-2.43	3.87	2.98	0.34508	.	.	.	.	.	D	0.85869	0.5797	L	0.55213	1.73	0.80722	D	1	P	0.46064	0.872	P	0.45071	0.468	T	0.83188	-0.0085	9	0.41790	T	0.15	.	7.6131	0.28142	0.0:0.8837:0.0:0.1163	.	261	P09651	ROA1_HUMAN	C	261	ENSP00000341826:S261C	ENSP00000341826:S261C	S	+	2	0	HNRNPA1	52963160	0.992000	0.36948	1.000000	0.80357	0.981000	0.71138	1.421000	0.34815	1.222000	0.43521	0.305000	0.20034	TCT	.		0.488	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
HSPA1L	3305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31778524	31778524	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:31778524C>T	ENST00000375654.4	-	2	1415	c.1226G>A	c.(1225-1227)gGg>gAg	p.G409E	HSPA1L_ENST00000417199.3_Missense_Mutation_p.G409E	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	409					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						CATCACGCCCCCAGCCGTCTC	0.602																																					p.G409E		.											.	HSPA1L	230	0			c.G1226A						.						78.0	74.0	75.0					6																	31778524		2203	4300	6503	SO:0001583	missense	3305	exon2			ACGCCCCCAGCCG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1226G>A	6.37:g.31778524C>T	ENSP00000364805:p.Gly409Glu	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	38.0	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319751	0.41096	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653	T;T	0.05996	3.36;3.36	5.2	5.2	0.72013	.	0.000000	0.35407	N	0.003222	T	0.39410	0.1077	H	0.99454	4.575	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65311	-0.6199	10	0.87932	D	0	-17.4554	16.2725	0.82628	0.0:1.0:0.0:0.0	.	409	P34931	HS71L_HUMAN	E	409;409;354	ENSP00000364805:G409E;ENSP00000387691:G409E	ENSP00000364804:G354E	G	-	2	0	HSPA1L	31886503	1.000000	0.71417	0.390000	0.26220	0.006000	0.05464	5.930000	0.70104	2.704000	0.92352	0.585000	0.79938	GGG	.		0.602	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
IFITM5	387733	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	299408	299408	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:299408G>A	ENST00000382614.2	-	1	118	c.83C>T	c.(82-84)gCc>gTc	p.A28V		NM_001025295.2	NP_001020466.1	A6NNB3	IFM5_HUMAN	interferon induced transmembrane protein 5	28					bone mineralization (GO:0030282)|regulation of bone mineralization (GO:0030500)|response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGGGTGCGGGGCCCCCAGTGT	0.682																																					p.A28V		.											.	IFITM5	514	0			c.C83T						.						22.0	22.0	22.0					11																	299408		2184	4278	6462	SO:0001583	missense	387733	exon1			TGCGGGGCCCCCA	AA463818, CR747200, DY654432	CCDS31323.1	11p15.5	2010-05-12			ENSG00000206013	ENSG00000206013			16644	protein-coding gene	gene with protein product		614757				11106657, 12659663, 18442316	Standard	NM_001025295		Approved	fragilis4, Hrmp1, BRIL	uc001low.2	A6NNB3	OTTHUMG00000165355	ENST00000382614.2:c.83C>T	11.37:g.299408G>A	ENSP00000372059:p.Ala28Val	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	29.0	NM_001025295		Missense_Mutation	SNP	ENST00000382614.2	37	CCDS31323.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262466	0.23051	.	.	ENSG00000206013	ENST00000382614	D	0.86164	-2.08	4.23	3.3	0.37823	.	0.733349	0.12020	N	0.507048	T	0.81688	0.4875	L	0.38175	1.15	0.09310	N	1	B	0.23442	0.085	B	0.25759	0.063	T	0.68135	-0.5489	10	0.33940	T	0.23	-5.7791	11.9061	0.52713	0.0:0.0:0.8239:0.1761	.	28	A6NNB3	IFM5_HUMAN	V	28	ENSP00000372059:A28V	ENSP00000372059:A28V	A	-	2	0	IFITM5	289408	0.091000	0.21658	0.001000	0.08648	0.018000	0.09664	1.957000	0.40392	0.722000	0.32252	0.561000	0.74099	GCC	.		0.682	IFITM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383588.1	NM_001025295	
IP6K3	117283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33690707	33690707	+	Silent	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:33690707G>A	ENST00000293756.4	-	6	1349	c.1023C>T	c.(1021-1023)ggC>ggT	p.G341G	IP6K3_ENST00000451316.1_Silent_p.G341G	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	341					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						GATGCGGGCTGCCTGGGGCTC	0.562																																					p.G341G		.											.	IP6K3	240	0			c.C1023T						.						70.0	71.0	71.0					6																	33690707		2203	4300	6503	SO:0001819	synonymous_variant	117283	exon7			CGGGCTGCCTGGG	AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.1023C>T	6.37:g.33690707G>A		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	41.0	NM_001142883	Q96MQ9	Silent	SNP	ENST00000293756.4	37	CCDS34435.1																																																																																			.		0.562	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
KCNH2	3757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150644109	150644109	+	Silent	SNP	A	A	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:150644109A>T	ENST00000262186.5	-	14	3587	c.3186T>A	c.(3184-3186)acT>acA	p.T1062T	KCNH2_ENST00000330883.4_Silent_p.T722T|KCNH2_ENST00000392968.2_Silent_p.T966T	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1062					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GCTGCAGGACAGTGGCCATGT	0.667																																					p.T1062T	GBM(137;110 1844 13671 20123 45161)	.											.	KCNH2	94	0			c.T3186A						.						40.0	43.0	42.0					7																	150644109		2203	4300	6503	SO:0001819	synonymous_variant	3757	exon14			CAGGACAGTGGCC	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3186T>A	7.37:g.150644109A>T		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	46.0	NM_000238	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	ENST00000262186.5	37	CCDS5910.1																																																																																			.		0.667	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
KIAA0355	9710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34810943	34810943	+	Silent	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:34810943C>T	ENST00000299505.6	+	3	1500	c.627C>T	c.(625-627)ggC>ggT	p.G209G		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	209										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					AGAACAGCGGCAGTGGCGGCG	0.562																																					p.G209G		.											.	KIAA0355	91	0			c.C627T						.						85.0	82.0	83.0					19																	34810943		2203	4300	6503	SO:0001819	synonymous_variant	9710	exon3			CAGCGGCAGTGGC		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.627C>T	19.37:g.34810943C>T		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	41.0	NM_014686	Q2M3W4	Silent	SNP	ENST00000299505.6	37	CCDS12436.1																																																																																			.		0.562	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
KIF14	9928	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	200587131	200587131	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:200587131delG	ENST00000367350.4	-	2	1159	c.721delC	c.(721-723)cagfs	p.Q241fs		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	241	Required for PRC1-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						AACTTGCTCTGAGTAGGTTTC	0.383																																					p.Q241fs		.											.	KIF14	140	0			c.721delC						.						168.0	172.0	171.0					1																	200587131		2203	4300	6503	SO:0001589	frameshift_variant	9928	exon2			TGCTCTGAGTAGG	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.721delC	1.37:g.200587131delG	ENSP00000356319:p.Gln241fs	Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	56.0	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Frame_Shift_Del	DEL	ENST00000367350.4	37	CCDS30963.1																																																																																			.		0.383	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
KSR2	283455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	118298110	118298110	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr12:118298110T>A	ENST00000339824.5	-	2	1034	c.307A>T	c.(307-309)Aag>Tag	p.K103*	KSR2_ENST00000425217.1_Nonsense_Mutation_p.K74*			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	103					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGACCTCCTTGCGCACATCG	0.632																																					p.K74X		.											.	KSR2	1449	0			c.A220T						.						57.0	61.0	60.0					12																	118298110		1568	3582	5150	SO:0001587	stop_gained	283455	exon2			CCTCCTTGCGCAC	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.307A>T	12.37:g.118298110T>A	ENSP00000339952:p.Lys103*	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	8.0	NM_173598	A0PJT2|Q3B828|Q8N775	Nonsense_Mutation	SNP	ENST00000339824.5	37		.	.	.	.	.	.	.	.	.	.	T	35	5.493094	0.96339	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	.	.	.	4.54	2.09	0.27110	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.5154	0.22244	0.0:0.0849:0.1567:0.7585	.	.	.	.	X	74;103	.	ENSP00000339952:K103X	K	-	1	0	KSR2	116782493	1.000000	0.71417	0.999000	0.59377	0.712000	0.41017	3.307000	0.51888	0.332000	0.23536	0.260000	0.18958	AAG	.		0.632	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
LGR4	55366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	27389536	27389536	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:27389536C>A	ENST00000379214.4	-	18	3177	c.2734G>T	c.(2734-2736)Gaa>Taa	p.E912*	LGR4_ENST00000389858.4_Nonsense_Mutation_p.E888*	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	912					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						AAGGAATCTTCTTCATCTGCA	0.532																																					p.E912X		.											.	LGR4	91	0			c.G2734T						.						74.0	75.0	75.0					11																	27389536		2202	4299	6501	SO:0001587	stop_gained	55366	exon18			AATCTTCTTCATC	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.2734G>T	11.37:g.27389536C>A	ENSP00000368516:p.Glu912*	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	17.0	NM_018490	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Nonsense_Mutation	SNP	ENST00000379214.4	37	CCDS31449.1	.	.	.	.	.	.	.	.	.	.	C	43	10.343996	0.99388	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	.	.	.	5.78	5.78	0.91487	.	0.261784	0.44097	D	0.000482	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	20.005	0.97433	0.0:1.0:0.0:0.0	.	.	.	.	X	912;888	.	ENSP00000368516:E912X	E	-	1	0	LGR4	27346112	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.625000	0.83145	2.745000	0.94114	0.555000	0.69702	GAA	.		0.532	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	
LGR6	59352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202249945	202249945	+	Silent	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:202249945C>A	ENST00000367278.3	+	6	770	c.681C>A	c.(679-681)acC>acA	p.T227T	LGR6_ENST00000439764.2_Intron|LGR6_ENST00000308543.3_3'UTR|LGR6_ENST00000255432.7_Silent_p.T175T	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	227					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						ATCTGGGGACCCACAGCTTCG	0.562																																					p.T227T		.											.	LGR6	160	0			c.C681A						.						125.0	111.0	116.0					1																	202249945		2203	4300	6503	SO:0001819	synonymous_variant	59352	exon6			GGGGACCCACAGC	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.681C>A	1.37:g.202249945C>A		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	26.0	NM_001017403	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Silent	SNP	ENST00000367278.3	37	CCDS30971.1																																																																																			.		0.562	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636	
LNX1	84708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	54373548	54373548	+	Silent	SNP	C	C	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr4:54373548C>G	ENST00000263925.7	-	4	1025	c.711G>C	c.(709-711)ggG>ggC	p.G237G	LNX1_ENST00000306888.2_Silent_p.G141G|LNX1-AS1_ENST00000510785.1_RNA|LNX1-AS1_ENST00000511989.1_RNA|FIP1L1_ENST00000507166.1_Intron|LNX1-AS1_ENST00000514364.1_RNA	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	237	Interaction with MAGEB18.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G141G(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CAACTGCACTCCCGCTCTTTG	0.478																																					p.G237G		.											.	LNX1	229	1	Substitution - coding silent(1)	lung(1)	c.G711C						.						130.0	121.0	124.0					4																	54373548		2203	4300	6503	SO:0001819	synonymous_variant	84708	exon4			TGCACTCCCGCTC	AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.711G>C	4.37:g.54373548C>G		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	37.0	NM_001126328	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Silent	SNP	ENST00000263925.7	37	CCDS47057.1																																																																																			.		0.478	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
LRP1B	53353	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141660519	141660519	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:141660519C>A	ENST00000389484.3	-	23	4707	c.3736G>T	c.(3736-3738)Gat>Tat	p.D1246Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1246	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCGTCTACATCCAGCTTCCAA	0.378										TSP Lung(27;0.18)																											p.D1246Y	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.G3736T						.						152.0	140.0	144.0					2																	141660519		2203	4300	6503	SO:0001583	missense	53353	exon23			CTACATCCAGCTT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3736G>T	2.37:g.141660519C>A	ENSP00000374135:p.Asp1246Tyr	Somatic	120.0	1.0		WXS	Illumina HiSeq	Phase_I	116.0	46.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553433	0.65425	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.88431	-2.38;-2.38	5.44	3.62	0.41486	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.390918	0.25189	N	0.032471	D	0.90981	0.7164	M	0.77406	2.37	0.36641	D	0.876823	P;P	0.51933	0.949;0.681	P;B	0.55871	0.786;0.235	D	0.91653	0.5336	10	0.62326	D	0.03	.	5.4998	0.16823	0.0:0.6243:0.0:0.3757	.	429;1246	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	Y	1246;1184;391	ENSP00000374135:D1246Y;ENSP00000413239:D391Y	ENSP00000374135:D1246Y	D	-	1	0	LRP1B	141376989	0.601000	0.26907	0.966000	0.40874	0.845000	0.48019	1.583000	0.36579	1.428000	0.47296	0.585000	0.79938	GAT	.		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
MAP2K1	5604	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	66729181	66729181	+	Missense_Mutation	SNP	A	A	G	rs121908595		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr15:66729181A>G	ENST00000307102.5	+	3	920	c.389A>G	c.(388-390)tAt>tGt	p.Y130C		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	130	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		Y -> C (in CFC3). {ECO:0000269|PubMed:16439621}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	GTGGGCTTCTATGGTGCGTTC	0.522																																					p.Y130C		.											.	MAP2K1	978	0			c.A389G	GRCh37	CM061104	MAP2K1	M	rs121908595	.						180.0	137.0	152.0					15																	66729181		2201	4299	6500	SO:0001583	missense	5604	exon3			GCTTCTATGGTGC	L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.389A>G	15.37:g.66729181A>G	ENSP00000302486:p.Tyr130Cys	Somatic	76.0	1.0		WXS	Illumina HiSeq	Phase_I	52.0	16.0	NM_002755		Missense_Mutation	SNP	ENST00000307102.5	37	CCDS10216.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.576928	0.86645	.	.	ENSG00000169032	ENST00000307102	D	0.94280	-3.39	5.15	5.15	0.70609	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97052	0.9037	M	0.89095	3.005	0.80722	A	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97896	1.0300	9	0.87932	D	0	-15.4258	15.0077	0.71524	1.0:0.0:0.0:0.0	.	108;130	B4DFY5;Q02750	.;MP2K1_HUMAN	C	130	ENSP00000302486:Y130C	ENSP00000302486:Y130C	Y	+	2	0	MAP2K1	64516235	1.000000	0.71417	0.979000	0.43373	0.954000	0.61252	9.202000	0.95026	1.934000	0.56057	0.533000	0.62120	TAT	.		0.522	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4		
MAP7D3	79649	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	135318411	135318411	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chrX:135318411T>C	ENST00000316077.9	-	7	948	c.728A>G	c.(727-729)aAg>aGg	p.K243R	MAP7D3_ENST00000370661.1_Missense_Mutation_p.K208R|MAP7D3_ENST00000370663.5_Missense_Mutation_p.K225R	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	243					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					ACCACGTGGCTTCCTTTCGGC	0.328																																					p.K243R		.											.	MAP7D3	110	0			c.A728G						.						96.0	86.0	89.0					X																	135318411		1826	4075	5901	SO:0001583	missense	79649	exon7			CGTGGCTTCCTTT	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.728A>G	X.37:g.135318411T>C	ENSP00000318086:p.Lys243Arg	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	4.0	NM_024597	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	T	9.445	1.089128	0.20390	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.05717	4.23;3.4;3.4;3.4	5.81	0.624	0.17659	.	.	.	.	.	T	0.04407	0.0121	N	0.19112	0.55	0.09310	N	1	P;P;P;P	0.39759	0.56;0.687;0.56;0.687	B;B;B;B	0.42555	0.219;0.391;0.219;0.391	T	0.42292	-0.9460	9	0.15066	T	0.55	-10.0297	5.4445	0.16527	0.0:0.2258:0.1344:0.6398	.	225;243;243;208	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	R	208;243;225;243	ENSP00000359695:K208R;ENSP00000318086:K243R;ENSP00000359697:K225R;ENSP00000359694:K243R	ENSP00000318086:K243R	K	-	2	0	MAP7D3	135146077	0.006000	0.16342	0.000000	0.03702	0.018000	0.09664	0.307000	0.19296	-0.231000	0.09825	0.486000	0.48141	AAG	.		0.328	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
MAPK1	5594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	22160192	22160192	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr22:22160192G>A	ENST00000215832.6	-	3	627	c.439C>T	c.(439-441)Cac>Tac	p.H147Y	MAPK1_ENST00000398822.3_Missense_Mutation_p.H147Y|MAPK1_ENST00000544786.1_Missense_Mutation_p.H147Y	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	147	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	AGGTCACGGTGCAGAACGTTA	0.428																																					p.H147Y		.											.	MAPK1	1405	0			c.C439T						.						200.0	179.0	186.0					22																	22160192		2203	4300	6503	SO:0001583	missense	5594	exon3			CACGGTGCAGAAC	M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.439C>T	22.37:g.22160192G>A	ENSP00000215832:p.His147Tyr	Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	46.0	NM_002745	A8CZ64	Missense_Mutation	SNP	ENST00000215832.6	37	CCDS13795.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444037	0.83993	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	T;T;T	0.72051	-0.62;-0.62;-0.62	4.77	3.76	0.43208	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.046654	0.85682	N	0.000000	D	0.87120	0.6098	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90244	0.4288	10	0.87932	D	0	-7.6907	13.3578	0.60638	0.0765:0.0:0.9235:0.0	.	147;147	A8CZ64;P28482	.;MK01_HUMAN	Y	147;135;147;147	ENSP00000215832:H147Y;ENSP00000381803:H147Y;ENSP00000440842:H147Y	ENSP00000215832:H147Y	H	-	1	0	MAPK1	20490192	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.640000	0.98453	1.374000	0.46228	0.650000	0.86243	CAC	.		0.428	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075396.2		
MB21D2	151963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	192516790	192516790	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr3:192516790C>T	ENST00000392452.2	-	2	1181	c.861G>A	c.(859-861)tgG>tgA	p.W287*		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	287							protein complex binding (GO:0032403)			endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						AGGACAGCCGCCATTCATTGT	0.507																																					p.W287X		.											.	MB21D2	70	0			c.G861A						.						43.0	37.0	39.0					3																	192516790		2203	4300	6503	SO:0001587	stop_gained	151963	exon2			CAGCCGCCATTCA	AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.861G>A	3.37:g.192516790C>T	ENSP00000376246:p.Trp287*	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	47.0	NM_178496	Q86VD8	Nonsense_Mutation	SNP	ENST00000392452.2	37	CCDS3302.2	.	.	.	.	.	.	.	.	.	.	C	38	6.718924	0.97788	.	.	ENSG00000180611	ENST00000392452	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.3039	18.4392	0.90658	0.0:1.0:0.0:0.0	.	.	.	.	X	287	.	ENSP00000376246:W287X	W	-	3	0	MB21D2	193999484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.783000	0.85696	2.593000	0.87608	0.655000	0.94253	TGG	.		0.507	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496	
MPP1	4354	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	154007594	154007594	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chrX:154007594T>C	ENST00000369534.3	-	12	1406	c.1259A>G	c.(1258-1260)gAg>gGg	p.E420G	MPP1_ENST00000393531.1_Missense_Mutation_p.E400G|MPP1_ENST00000413259.3_Missense_Mutation_p.E390G	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	420	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.|Interaction with MPP5.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCGGATGGCCTCAGAGTCCTT	0.527																																					p.E420G		.											.	MPP1	132	0			c.A1259G						.						74.0	62.0	66.0					X																	154007594		2203	4300	6503	SO:0001583	missense	4354	exon12			ATGGCCTCAGAGT		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.1259A>G	X.37:g.154007594T>C	ENSP00000358547:p.Glu420Gly	Somatic	44.0	1.0		WXS	Illumina HiSeq	Phase_I	44.0	34.0	NM_002436	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	ENST00000369534.3	37	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	T	15.23	2.772971	0.49680	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531	T;T;T	0.21031	2.03;2.03;2.03	5.86	4.68	0.58851	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.205916	0.51477	D	0.000093	T	0.24890	0.0604	M	0.68317	2.08	0.58432	D	0.999996	B;B;B;B	0.16603	0.018;0.014;0.011;0.014	B;B;B;B	0.22386	0.019;0.039;0.023;0.039	T	0.02698	-1.1122	10	0.56958	D	0.05	.	10.3989	0.44218	0.1487:0.0:0.0:0.8513	.	403;390;400;420	B4E325;B4DZV5;G3XAI1;Q00013	.;.;.;EM55_HUMAN	G	420;390;400	ENSP00000358547:E420G;ENSP00000400155:E390G;ENSP00000377165:E400G	ENSP00000358547:E420G	E	-	2	0	MPP1	153660788	1.000000	0.71417	0.914000	0.36105	0.876000	0.50452	5.934000	0.70138	0.805000	0.34159	0.486000	0.48141	GAG	.		0.527	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	
MRPL1	65008	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	78806454	78806454	+	Silent	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr4:78806454A>G	ENST00000315567.8	+	4	776	c.447A>G	c.(445-447)ccA>ccG	p.P149P	MRPL1_ENST00000506674.1_3'UTR	NM_020236.3	NP_064621.3	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1	149					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)	17						TGCCATACCCATTTGCTTCCG	0.328																																					p.P149P		.											.	MRPL1	90	0			c.A447G						.						129.0	129.0	129.0					4																	78806454		2202	4300	6502	SO:0001819	synonymous_variant	65008	exon4			ATACCCATTTGCT	AB049474	CCDS3583.2	4q21.1	2012-09-13			ENSG00000169288	ENSG00000169288		"""Mitochondrial ribosomal proteins / large subunits"""	14275	protein-coding gene	gene with protein product		611821					Standard	NM_020236		Approved	BM022	uc003hku.2	Q9BYD6	OTTHUMG00000130200	ENST00000315567.8:c.447A>G	4.37:g.78806454A>G		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	55.0	NM_020236	A6NG03|Q4W5B8|Q6IAG4|Q96BW3|Q9H793|Q9NRL5	Silent	SNP	ENST00000315567.8	37	CCDS3583.2	.	.	.	.	.	.	.	.	.	.	A	1.625	-0.520506	0.04171	.	.	ENSG00000169288	ENST00000502384	.	.	.	5.71	-3.31	0.04988	.	.	.	.	.	T	0.37865	0.1019	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33317	-0.9873	4	.	.	.	-2.3981	0.9725	0.01419	0.2409:0.3202:0.133:0.3059	.	.	.	.	V	103	.	.	I	+	1	0	MRPL1	79025478	0.812000	0.29077	0.677000	0.29947	0.045000	0.14185	-0.258000	0.08733	-0.665000	0.05317	0.524000	0.50904	ATT	.		0.328	MRPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252518.3	NM_020236	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9057255	9057255	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:9057255G>T	ENST00000397910.4	-	3	30394	c.30191C>A	c.(30190-30192)aCa>aAa	p.T10064K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10066	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCTGTGCTTGTGTCTGTAGT	0.468																																					p.T10064K		.											.	MUC16	566	0			c.C30191A						.						93.0	85.0	87.0					19																	9057255		1963	4172	6135	SO:0001583	missense	94025	exon3			GTGCTTGTGTCTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30191C>A	19.37:g.9057255G>T	ENSP00000381008:p.Thr10064Lys	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	45.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.945	-0.218029	0.06101	.	.	ENSG00000181143	ENST00000397910	T	0.23348	1.91	2.35	-2.18	0.07037	.	.	.	.	.	T	0.14570	0.0352	N	0.19112	0.55	.	.	.	B	0.20550	0.046	B	0.26416	0.069	T	0.26430	-1.0103	8	0.87932	D	0	.	4.6718	0.12692	0.305:0.2249:0.4701:0.0	.	10064	B5ME49	.	K	10064	ENSP00000381008:T10064K	ENSP00000381008:T10064K	T	-	2	0	MUC16	8918255	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.161000	0.10026	-0.743000	0.04784	-1.595000	0.00837	ACA	.		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ICE2	79664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	60740303	60740303	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr15:60740303C>T	ENST00000261520.4	-	11	2395	c.2161G>A	c.(2161-2163)Gaa>Aaa	p.E721K	NARG2_ENST00000439632.1_Missense_Mutation_p.E584K	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						GCTAGGTATTCCGATGTATCT	0.368																																					p.E721K		.											.	NARG2	227	0			c.G2161A						.						75.0	71.0	73.0					15																	60740303		2203	4300	6503	SO:0001583	missense	79664	exon11			GGTATTCCGATGT																												ENST00000261520.4:c.2161G>A	15.37:g.60740303C>T	ENSP00000261520:p.Glu721Lys	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	31.0	NM_024611		Missense_Mutation	SNP	ENST00000261520.4	37	CCDS10176.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819076	0.90873	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.99	5.02	0.67125	NMDA receptor-regulated gene protein 2 (1);	0.096319	0.64402	D	0.000001	T	0.66416	0.2787	L	0.44542	1.39	0.39315	D	0.96514	D	0.63046	0.992	D	0.63192	0.912	T	0.69179	-0.5213	9	0.72032	D	0.01	-28.0583	14.1784	0.65557	0.0:0.8508:0.1492:0.0	.	721	Q659A1	NARG2_HUMAN	K	721;584	.	ENSP00000261520:E721K	E	-	1	0	NARG2	58527595	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.964000	0.40462	2.831000	0.97527	0.650000	0.86243	GAA	.		0.368	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
NETO1	81832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	70417752	70417752	+	Silent	SNP	G	G	A	rs145217972		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr18:70417752G>A	ENST00000327305.6	-	9	1743	c.1086C>T	c.(1084-1086)atC>atT	p.I362I	NETO1_ENST00000583169.1_Silent_p.I362I|NETO1_ENST00000299430.2_Silent_p.I361I|RNA5SP460_ENST00000516789.1_RNA	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	362					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TGATCTGTACGATGACAGAGA	0.453																																					p.I362I		.											.	NETO1	94	0			c.C1086T						.	G	,	1,4405	2.1+/-5.4	0,1,2202	94.0	79.0	84.0		1086,1086	-5.1	1.0	18	dbSNP_134	84	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	NETO1	NM_001201465.1,NM_138966.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	362/534,362/534	70417752	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	81832	exon9			CTGTACGATGACA	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1086C>T	18.37:g.70417752G>A		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	21.0	NM_001201465	Q86W85|Q8ND78|Q8TDF4	Silent	SNP	ENST00000327305.6	37	CCDS12000.1																																																																																			G|1.000;A|0.000		0.453	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
NUP62	23636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50411919	50411919	+	Silent	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:50411919C>A	ENST00000596217.1	-	2	3033	c.1146G>T	c.(1144-1146)gtG>gtT	p.V382V	NUP62_ENST00000597723.1_Silent_p.V306V|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000413454.1_Silent_p.V382V|NUP62_ENST00000597029.1_Silent_p.V382V|IL4I1_ENST00000595948.1_Intron|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000352066.3_Silent_p.V382V|NUP62_ENST00000422090.2_Silent_p.V382V			P37198	NUP62_HUMAN	nucleoporin 62kDa	382					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GGTCCAGCTTCACCTTCTCCA	0.607																																					p.V382V		.											.	NUP62	615	0			c.G1146T						.						112.0	106.0	108.0					19																	50411919		2203	4300	6503	SO:0001819	synonymous_variant	23636	exon3			CAGCTTCACCTTC	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.1146G>T	19.37:g.50411919C>A		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	22.0	NM_153719	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Silent	SNP	ENST00000596217.1	37	CCDS12788.1																																																																																			.		0.607	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
ODF4	146852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	8243610	8243610	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:8243610C>T	ENST00000328248.2	+	1	429	c.241C>T	c.(241-243)Cag>Tag	p.Q81*	ODF4_ENST00000584943.1_Intron|RP11-849F2.4_ENST00000585275.1_lincRNA	NM_153007.4	NP_694552.2	Q2M2E3	ODFP4_HUMAN	outer dense fiber of sperm tails 4	81					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|outer dense fiber (GO:0001520)				endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)	8						CTGGATGGCCCAGGTGTTGGC	0.562																																					p.Q81X		.											.	ODF4	69	0			c.C241T						.						65.0	57.0	60.0					17																	8243610		2203	4300	6503	SO:0001587	stop_gained	146852	exon1			ATGGCCCAGGTGT	AB081120	CCDS11140.1	17p13	2010-09-27			ENSG00000184650	ENSG00000184650			19056	protein-coding gene	gene with protein product	"""cancer/testis antigen 136"""	610097					Standard	NM_153007		Approved	OPPO1, CT136	uc002gle.1	Q2M2E3	OTTHUMG00000108190	ENST00000328248.2:c.241C>T	17.37:g.8243610C>T	ENSP00000331086:p.Gln81*	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	28.0	NM_153007	Q8J021	Nonsense_Mutation	SNP	ENST00000328248.2	37	CCDS11140.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202207	0.79127	.	.	ENSG00000184650	ENST00000328248	.	.	.	4.89	3.86	0.44501	.	0.164598	0.29314	N	0.012508	.	.	.	.	.	.	0.21386	N	0.999706	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.6581	9.4822	0.38908	0.2263:0.7737:0.0:0.0	.	.	.	.	X	81	.	ENSP00000331086:Q81X	Q	+	1	0	ODF4	8184335	0.713000	0.27926	0.208000	0.23602	0.013000	0.08279	1.788000	0.38714	2.526000	0.85167	0.655000	0.94253	CAG	.		0.562	ODF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226996.1		
OR10G8	219869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123900948	123900948	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:123900948T>C	ENST00000431524.1	+	1	652	c.619T>C	c.(619-621)Tcg>Ccg	p.S207P		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AATAGTGGCCTCGGGCTGCTT	0.537																																					p.S207P		.											.	OR10G8	92	0			c.T619C						.						193.0	169.0	177.0					11																	123900948		2201	4299	6500	SO:0001583	missense	219869	exon1			GTGGCCTCGGGCT	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.619T>C	11.37:g.123900948T>C	ENSP00000389072:p.Ser207Pro	Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	215.0	95.0	NM_001004464	B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	T	10.03	1.239663	0.22711	.	.	ENSG00000234560	ENST00000431524	T	0.37584	1.19	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.953949	0.08599	N	0.921764	T	0.41971	0.1182	N	0.12961	0.28	0.09310	N	1	D	0.53151	0.958	D	0.65573	0.936	T	0.42783	-0.9431	10	0.72032	D	0.01	.	11.0743	0.48021	0.0:0.0:0.0:1.0	.	207	Q8NGN5	O10G8_HUMAN	P	207	ENSP00000389072:S207P	ENSP00000389072:S207P	S	+	1	0	OR10G8	123406158	0.000000	0.05858	0.780000	0.31762	0.263000	0.26337	0.369000	0.20416	1.319000	0.45190	0.455000	0.32223	TCG	.		0.537	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
OR12D2	26529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29364910	29364910	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:29364910C>A	ENST00000383555.2	+	1	495	c.434C>A	c.(433-435)aCa>aAa	p.T145K	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						ATGGCCATCACAATCTGGGTC	0.488																																					p.T145K		.											.	OR12D2	69	0			c.C434A						.						142.0	137.0	139.0					6																	29364910		1511	2709	4220	SO:0001583	missense	26529	exon1			CCATCACAATCTG		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.434C>A	6.37:g.29364910C>A	ENSP00000373047:p.Thr145Lys	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	227.0	63.0	NM_013936	B0S862|Q5SUN9|Q6IET9	Missense_Mutation	SNP	ENST00000383555.2	37	CCDS4659.1	.	.	.	.	.	.	.	.	.	.	C	3.847	-0.032719	0.07543	.	.	ENSG00000168787	ENST00000383555	T	0.37752	1.18	3.94	0.994	0.19832	GPCR, rhodopsin-like superfamily (1);	0.428574	0.21811	N	0.068773	T	0.21186	0.0510	M	0.75085	2.285	0.09310	N	1	P	0.34699	0.464	B	0.39971	0.315	T	0.13872	-1.0493	10	0.48119	T	0.1	.	6.8125	0.23812	0.0:0.685:0.1437:0.1713	.	145	P58182	O12D2_HUMAN	K	145	ENSP00000373047:T145K	ENSP00000373047:T145K	T	+	2	0	OR12D2	29472889	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	0.451000	0.21779	0.308000	0.22923	0.205000	0.17691	ACA	.		0.488	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2		
OR2T11	127077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248790035	248790035	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:248790035A>G	ENST00000330803.2	-	1	456	c.395T>C	c.(394-396)cTg>cCg	p.L132P		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCGGTTCATCAGGACTGGGTA	0.537																																					p.L132P		.											.	OR2T11	69	0			c.T395C						.						50.0	57.0	55.0					1																	248790035		2050	4232	6282	SO:0001583	missense	127077	exon1			TTCATCAGGACTG	BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.395T>C	1.37:g.248790035A>G	ENSP00000328934:p.Leu132Pro	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	40.0	NM_001001964	Q6IEY6	Missense_Mutation	SNP	ENST00000330803.2	37	CCDS31122.1	.	.	.	.	.	.	.	.	.	.	.	15.10	2.733512	0.48939	.	.	ENSG00000183130	ENST00000330803	T	0.33654	1.4	4.38	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35739	N	0.003008	T	0.66587	0.2804	M	0.92880	3.355	0.53005	D	0.999962	D	0.89917	1.0	D	0.72338	0.977	T	0.75701	-0.3226	10	0.87932	D	0	.	12.724	0.57159	1.0:0.0:0.0:0.0	.	132	Q8NH01	O2T11_HUMAN	P	132	ENSP00000328934:L132P	ENSP00000328934:L132P	L	-	2	0	OR2T11	246856658	0.001000	0.12720	0.445000	0.26908	0.376000	0.30014	1.352000	0.34033	1.820000	0.53075	0.533000	0.62120	CTG	.		0.537	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097134.1	NM_001001964	
P2RX6	9127	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	21380718	21380718	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr22:21380718C>T	ENST00000413302.2	+	12	1286	c.1138C>T	c.(1138-1140)Ccg>Tcg	p.P380S	P2RX6_ENST00000402329.3_3'UTR|P2RX6_ENST00000336296.2_Missense_Mutation_p.P370S|P2RX6_ENST00000443995.3_Missense_Mutation_p.P327S|P2RX6_ENST00000401443.1_Missense_Mutation_p.P354S			O15547	P2RX6_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 6	380					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|channel activity (GO:0015267)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)										GGCCAAGGCCCCGAAAGCAAC	0.632																																					p.P380S		.											.	.	.	0			c.C1138T						.						42.0	38.0	39.0					22																	21380718		2202	4296	6498	SO:0001583	missense	9127	exon12			AAGGCCCCGAAAG		CCDS13788.2, CCDS54504.1	22q11.21	2012-01-17	2008-03-28	2008-03-28	ENSG00000099957	ENSG00000099957		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8538	protein-coding gene	gene with protein product		608077	"""purinergic receptor P2X-like 1, orphan receptor"""	P2RXL1		9242461, 10591208, 8786426	Standard	NM_005446		Approved	P2XM, MGC129625, P2X6	uc010gsu.1	O15547	OTTHUMG00000150689	ENST00000413302.2:c.1138C>T	22.37:g.21380718C>T	ENSP00000416193:p.Pro380Ser	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	19.0	NM_005446	F6V3D7|Q32MB6|Q58F04|Q6IC33|Q9UL50	Missense_Mutation	SNP	ENST00000413302.2	37	CCDS13788.2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091536	0.76756	.	.	ENSG00000099957	ENST00000413302;ENST00000336296;ENST00000401443;ENST00000443995	T;T;T;T	0.03920	3.76;3.76;3.76;3.76	4.54	3.53	0.40419	.	0.000000	0.53938	D	0.000043	T	0.13200	0.0320	L	0.59436	1.845	0.23758	N	0.996924	D;P	0.76494	0.999;0.551	D;B	0.70935	0.971;0.209	T	0.06570	-1.0819	10	0.27082	T	0.32	-9.0567	8.801	0.34909	0.0:0.8993:0.0:0.1007	.	380;354	O15547;F6V3D7	P2RX6_HUMAN;.	S	380;370;354;327	ENSP00000416193:P380S;ENSP00000338797:P370S;ENSP00000385309:P354S;ENSP00000408088:P327S	ENSP00000338797:P370S	P	+	1	0	P2RX6	19710718	0.136000	0.22515	0.512000	0.27736	0.659000	0.38960	3.664000	0.54525	1.506000	0.48736	0.655000	0.94253	CCG	.		0.632	P2RX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319625.2	NM_005446	
PEX14	5195	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	10678434	10678434	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:10678434T>C	ENST00000356607.4	+	5	424	c.344T>C	c.(343-345)aTc>aCc	p.I115T	RN7SL614P_ENST00000461850.2_RNA|PEX14_ENST00000538836.1_Missense_Mutation_p.I51T	NM_004565.2	NP_004556.1	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	115					microtubule anchoring (GO:0034453)|negative regulation of protein binding (GO:0032091)|negative regulation of protein homotetramerization (GO:1901094)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peroxisome organization (GO:0007031)|peroxisome transport along microtubule (GO:0036250)|protein complex assembly (GO:0006461)|protein homooligomerization (GO:0051260)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, substrate release (GO:0044721)|protein import into peroxisome matrix, translocation (GO:0016561)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(3)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	13	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		CTGGCCATCATCATGGCAGGC	0.622																																					p.I115T		.											.	PEX14	90	0			c.T344C						.						88.0	76.0	80.0					1																	10678434		2203	4300	6503	SO:0001583	missense	5195	exon5			CCATCATCATGGC	AF045186	CCDS30582.1	1p36.22	2008-05-14			ENSG00000142655	ENSG00000142655			8856	protein-coding gene	gene with protein product		601791				9653144	Standard	NM_004565		Approved		uc001arn.3	O75381	OTTHUMG00000001908	ENST00000356607.4:c.344T>C	1.37:g.10678434T>C	ENSP00000349016:p.Ile115Thr	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	9.0	NM_004565	B2R7N1|B3KML6|B7Z1N2|Q8WX51	Missense_Mutation	SNP	ENST00000356607.4	37	CCDS30582.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.531245	0.85706	.	.	ENSG00000142655	ENST00000356607;ENST00000538836	T;T	0.43294	0.95;1.51	4.94	4.94	0.65067	Peroxisome membrane anchor protein Pex14p, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60301	0.2258	L	0.60845	1.875	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.83275	0.996;0.994;0.977	T	0.61628	-0.7024	10	0.49607	T	0.09	.	14.6148	0.68541	0.0:0.0:0.0:1.0	.	72;51;115	O75381-2;B7Z4Z4;O75381	.;.;PEX14_HUMAN	T	115;51	ENSP00000349016:I115T;ENSP00000444877:I51T	ENSP00000349016:I115T	I	+	2	0	PEX14	10601021	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.662000	0.83803	1.847000	0.53656	0.533000	0.62120	ATC	.		0.622	PEX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005414.1		
PHTF1	10745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	114255975	114255975	+	Nonsense_Mutation	SNP	G	G	A	rs61730007	byFrequency	TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:114255975G>A	ENST00000369604.1	-	8	1192	c.709C>T	c.(709-711)Caa>Taa	p.Q237*	PHTF1_ENST00000369600.1_Nonsense_Mutation_p.Q184*|PHTF1_ENST00000447664.2_Intron|PHTF1_ENST00000369596.2_Nonsense_Mutation_p.Q184*|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000357783.2_Nonsense_Mutation_p.Q237*|PHTF1_ENST00000393357.2_Nonsense_Mutation_p.Q237*|PHTF1_ENST00000369598.1_Nonsense_Mutation_p.Q192*			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	237					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGTCGACATTGTCTCCTCTTA	0.343																																					p.Q237X		.											.	PHTF1	91	0			c.C709T						.						146.0	143.0	144.0					1																	114255975		2203	4300	6503	SO:0001587	stop_gained	10745	exon7			GACATTGTCTCCT	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.709C>T	1.37:g.114255975G>A	ENSP00000358617:p.Gln237*	Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	216.0	72.0	NM_006608	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Nonsense_Mutation	SNP	ENST00000369604.1	37	CCDS861.1	.	.	.	.	.	.	.	.	.	.	G	41	8.969095	0.99019	.	.	ENSG00000116793	ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783	.	.	.	5.55	4.62	0.57501	.	0.524935	0.20981	N	0.082206	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-4.9277	10.4484	0.44507	0.0:0.1453:0.7037:0.1509	.	.	.	.	X	192;237;184;192;184;237;237	.	ENSP00000350428:Q237X	Q	-	1	0	PHTF1	114057498	1.000000	0.71417	0.885000	0.34714	0.601000	0.36947	3.570000	0.53834	1.314000	0.45095	0.467000	0.42956	CAA	G|0.991;T|0.009		0.343	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
PI15	51050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	75761417	75761417	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr8:75761417T>A	ENST00000260113.2	+	6	885	c.706T>A	c.(706-708)Tat>Aat	p.Y236N	PI15_ENST00000523773.1_Missense_Mutation_p.Y236N|RP11-758M4.4_ENST00000523860.1_RNA|RP11-758M4.4_ENST00000518128.1_RNA|RP11-758M4.4_ENST00000522914.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	236						extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			TCCTCCAAGTTATGGGGGATC	0.393																																					p.Y236N		.											.	PI15	515	0			c.T706A						.						199.0	177.0	184.0					8																	75761417		2203	4300	6503	SO:0001583	missense	51050	exon6			CCAAGTTATGGGG	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.706T>A	8.37:g.75761417T>A	ENSP00000260113:p.Tyr236Asn	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	259.0	65.0	NM_015886	Q68CY1	Missense_Mutation	SNP	ENST00000260113.2	37	CCDS6218.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.465498	0.84425	.	.	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.10099	2.91;2.91	5.15	5.15	0.70609	.	0.059145	0.64402	D	0.000001	T	0.36331	0.0963	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.14531	-1.0469	10	0.46703	T	0.11	.	15.4212	0.75011	0.0:0.0:0.0:1.0	.	236	O43692	PI15_HUMAN	N	236	ENSP00000260113:Y236N;ENSP00000428567:Y236N	ENSP00000260113:Y236N	Y	+	1	0	PI15	75923972	1.000000	0.71417	0.992000	0.48379	0.949000	0.60115	7.482000	0.81143	2.285000	0.76669	0.477000	0.44152	TAT	.		0.393	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886	
POTEC	388468	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	14542851	14542851	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr18:14542851C>A	ENST00000358970.5	-	1	294	c.295G>T	c.(295-297)Ggc>Tgc	p.G99C	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	99										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CACCACTTGCCCATCTTGCTC	0.622																																					p.G99C		.											.	POTEC	3	0			c.G295T						.						39.0	45.0	43.0					18																	14542851		692	1591	2283	SO:0001583	missense	388468	exon1			ACTTGCCCATCTT	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.295G>T	18.37:g.14542851C>A	ENSP00000351856:p.Gly99Cys	Somatic	247.0	0.0		WXS	Illumina HiSeq	Phase_I	268.0	91.0	NM_001137671		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	C	5.295	0.239815	0.10023	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.37915	1.17	0.399	0.399	0.16325	.	.	.	.	.	T	0.35913	0.0948	L	0.39898	1.24	0.09310	N	1	D	0.55172	0.97	P	0.51487	0.671	T	0.19451	-1.0305	8	0.66056	D	0.02	.	.	.	.	.	99	B2RU33	POTEC_HUMAN	C	99	ENSP00000351856:G99C	ENSP00000351856:G99C	G	-	1	0	POTEC	14532851	0.000000	0.05858	0.010000	0.14722	0.029000	0.11900	-0.174000	0.09839	0.448000	0.26722	0.175000	0.17021	GGC	.		0.622	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
PPP1R3A	5506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	113519285	113519285	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:113519285C>T	ENST00000284601.3	-	4	1930	c.1862G>A	c.(1861-1863)aGa>aAa	p.R621K		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	621					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATTTCCAGTTCTTGATGAACA	0.383																																					p.R621K		.											.	PPP1R3A	832	0			c.G1862A						.						94.0	92.0	92.0					7																	113519285		2203	4300	6503	SO:0001583	missense	5506	exon4			CCAGTTCTTGATG	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1862G>A	7.37:g.113519285C>T	ENSP00000284601:p.Arg621Lys	Somatic	273.0	0.0		WXS	Illumina HiSeq	Phase_I	309.0	163.0	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	1.268	-0.613821	0.03690	.	.	ENSG00000154415	ENST00000284601	T	0.17528	2.27	6.02	-1.78	0.07957	.	0.538685	0.18505	N	0.139238	T	0.12390	0.0301	M	0.67953	2.075	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.30060	-0.9991	10	0.17369	T	0.5	-0.4639	2.544	0.04732	0.1062:0.2339:0.1966:0.4633	.	621	Q16821	PPR3A_HUMAN	K	621	ENSP00000284601:R621K	ENSP00000284601:R621K	R	-	2	0	PPP1R3A	113306521	0.158000	0.22850	0.683000	0.30040	0.044000	0.14063	0.130000	0.15850	-0.035000	0.13691	-0.727000	0.03589	AGA	.		0.383	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
PPP2R2B	5521	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	146077624	146077624	+	Silent	SNP	C	C	T	rs200884068		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:146077624C>T	ENST00000394413.3	-	3	822	c.252G>A	c.(250-252)aaG>aaA	p.K84K	PPP2R2B_ENST00000508545.2_Silent_p.K73K|PPP2R2B_ENST00000394409.3_Silent_p.K142K|PPP2R2B_ENST00000394414.1_Silent_p.K150K|PPP2R2B_ENST00000453001.1_Silent_p.K84K|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000504198.1_Silent_p.K90K|PPP2R2B_ENST00000356826.3_Silent_p.K84K|PPP2R2B_ENST00000394410.2_Silent_p.K73K|PPP2R2B_ENST00000336640.6_Silent_p.K87K|PPP2R2B_ENST00000394411.4_Silent_p.K84K			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	84					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTCTAAACTCTTCAGGTAAT	0.388																																					p.K190K		.											.	PPP2R2B	659	0			c.G570A						.	C	,,,,,,	0,4406		0,0,2203	125.0	131.0	129.0		252,252,252,252,261,192,219	4.0	1.0	5		129	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PPP2R2B	NM_001127381.1,NM_004576.2,NM_181674.2,NM_181675.2,NM_181676.2,NM_181677.2,NM_181678.2	,,,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,,	84/444,84/444,84/444,84/444,87/447,64/424,73/433	146077624	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5521	exon4			TAAACTCTTCAGG	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.252G>A	5.37:g.146077624C>T		Somatic	169.0	1.0		WXS	Illumina HiSeq	Phase_I	264.0	78.0	NM_181675	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Silent	SNP	ENST00000394413.3	37	CCDS4284.1																																																																																			C|0.999;T|0.001		0.388	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251893.2	NM_181678	
PRKCSH	5589	ucsc.edu;bcgsc.ca	37	19	11548763	11548763	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:11548763C>T	ENST00000589838.1	+	3	263	c.263C>T	c.(262-264)cCc>cTc	p.P88L	PRKCSH_ENST00000591462.1_Missense_Mutation_p.P88L|CCDC151_ENST00000586836.1_5'Flank|snoU13_ENST00000459022.1_RNA|CCDC151_ENST00000356392.4_5'Flank|PRKCSH_ENST00000587327.1_Missense_Mutation_p.P88L|CCDC151_ENST00000545100.1_5'Flank|PRKCSH_ENST00000252455.2_Missense_Mutation_p.P88L|CCDC151_ENST00000591179.1_5'Flank|PRKCSH_ENST00000412601.1_Missense_Mutation_p.P88L|PRKCSH_ENST00000592741.1_Missense_Mutation_p.P88L			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	88					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						CTGTATATCCCCTCCAACCGG	0.557																																					p.P88L		.											.	PRKCSH	90	0			c.C263T						.						115.0	106.0	109.0					19																	11548763		2203	4300	6503	SO:0001583	missense	5589	exon4			ATATCCCCTCCAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.263C>T	19.37:g.11548763C>T	ENSP00000465461:p.Pro88Leu	Somatic	147.0	2.0		WXS	Illumina HiSeq	.	134.0	47.0	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Missense_Mutation	SNP	ENST00000589838.1	37	CCDS32911.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946477	0.53186	.	.	ENSG00000130175	ENST00000252455;ENST00000412601	T;T	0.73258	-0.73;-0.73	4.28	3.24	0.37175	.	0.185790	0.47455	N	0.000221	T	0.68677	0.3027	M	0.79258	2.445	0.80722	D	1	B;B;B	0.20988	0.05;0.013;0.02	B;B;B	0.29077	0.059;0.098;0.086	T	0.60816	-0.7188	10	0.18710	T	0.47	-9.1239	10.079	0.42377	0.0:0.8967:0.0:0.1033	.	88;88;88	E7EQZ9;A8K318;P14314	.;.;GLU2B_HUMAN	L	88	ENSP00000252455:P88L;ENSP00000395616:P88L	ENSP00000252455:P88L	P	+	2	0	PRKCSH	11409763	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.363000	0.52321	0.769000	0.33313	0.561000	0.74099	CCC	.		0.557	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
PRPF8	10594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	1580416	1580416	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:1580416A>T	ENST00000572621.1	-	14	2300	c.2035T>A	c.(2035-2037)Tca>Aca	p.S679T	PRPF8_ENST00000304992.6_Missense_Mutation_p.S679T			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	679					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TCAAAATGTGACTCCACTCGC	0.512																																					p.S679T		.											.	PRPF8	525	0			c.T2035A						.						167.0	141.0	150.0					17																	1580416		2203	4300	6503	SO:0001583	missense	10594	exon15			AATGTGACTCCAC	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.2035T>A	17.37:g.1580416A>T	ENSP00000460348:p.Ser679Thr	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	21.0	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	A	15.59	2.879960	0.51801	.	.	ENSG00000174231	ENST00000304992	D	0.83335	-1.71	5.94	5.94	0.96194	PROCN (1);	0.000000	0.85682	D	0.000000	D	0.89677	0.6784	M	0.76838	2.35	0.80722	D	1	D	0.55800	0.973	P	0.60068	0.868	D	0.88651	0.3182	10	0.33940	T	0.23	.	16.3951	0.83601	1.0:0.0:0.0:0.0	.	679	Q6P2Q9	PRP8_HUMAN	T	679	ENSP00000304350:S679T	ENSP00000304350:S679T	S	-	1	0	PRPF8	1527166	1.000000	0.71417	0.982000	0.44146	0.566000	0.35808	9.297000	0.96120	2.272000	0.75746	0.460000	0.39030	TCA	.		0.512	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
RFTN2	130132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	198436936	198436936	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:198436936G>T	ENST00000295049.4	-	9	1838	c.1302C>A	c.(1300-1302)gaC>gaA	p.D434E		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	434					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						ACGAGGTTGTGTCTAATCCGA	0.527																																					p.D434E		.											.	RFTN2	90	0			c.C1302A						.						284.0	228.0	247.0					2																	198436936		2203	4300	6503	SO:0001583	missense	130132	exon9			GGTTGTGTCTAAT	AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.1302C>A	2.37:g.198436936G>T	ENSP00000295049:p.Asp434Glu	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	62.0	NM_144629	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	ENST00000295049.4	37	CCDS2323.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.844456	0.32606	.	.	ENSG00000162944	ENST00000295049;ENST00000454447	T;T	0.30182	1.54;1.54	4.84	0.951	0.19579	.	0.929500	0.09076	N	0.852065	T	0.24314	0.0589	L	0.29908	0.895	0.23227	N	0.998087	D	0.56035	0.974	P	0.46275	0.51	T	0.14309	-1.0477	10	0.40728	T	0.16	-11.1573	5.7903	0.18357	0.2988:0.129:0.5722:0.0	.	434	Q52LD8	RFTN2_HUMAN	E	434;126	ENSP00000295049:D434E;ENSP00000387459:D126E	ENSP00000295049:D434E	D	-	3	2	RFTN2	198145181	1.000000	0.71417	0.007000	0.13788	0.042000	0.13812	2.750000	0.47500	-0.000000	0.14550	0.561000	0.74099	GAC	.		0.527	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256106.2	NM_144629	
RFX5	5993	broad.mit.edu;bcgsc.ca	37	1	151316341	151316341	+	Silent	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:151316341T>C	ENST00000290524.4	-	9	751	c.573A>G	c.(571-573)gaA>gaG	p.E191E	RFX5_ENST00000452671.2_Silent_p.E191E|RFX5_ENST00000368870.2_Silent_p.E191E|RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000452513.2_Silent_p.E151E|RP11-126K1.8_ENST00000422153.1_RNA	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	191					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTGGGGTTACTTCTGGGCCCA	0.532																																					p.E191E		.											.	RFX5	91	0			c.A573G						.						68.0	63.0	65.0					1																	151316341		2203	4300	6503	SO:0001819	synonymous_variant	5993	exon9			GGTTACTTCTGGG		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.573A>G	1.37:g.151316341T>C		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_000449	B7Z848|D3DV19|E9PFU4|Q5VWC3	Silent	SNP	ENST00000290524.4	37	CCDS994.1																																																																																			.		0.532	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449	
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	109695878	109695878	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chrX:109695878C>T	ENST00000465301.2	+	3	2279	c.2033C>T	c.(2032-2034)gCa>gTa	p.A678V	RGAG1_ENST00000540313.1_Missense_Mutation_p.A678V	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	678										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GCTTCTGGAGCAATGTCCACA	0.507																																					p.A678V		.											.	RGAG1	132	0			c.C2033T						.						109.0	90.0	97.0					X																	109695878		2203	4300	6503	SO:0001583	missense	57529	exon3			CTGGAGCAATGTC	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2033C>T	X.37:g.109695878C>T	ENSP00000419786:p.Ala678Val	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	38.0	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	C	4.134	0.023173	0.08006	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.50001	0.76;0.76	4.08	-1.83	0.07833	.	1.573820	0.04513	N	0.383154	T	0.33030	0.0849	L	0.34521	1.04	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.11060	-1.0603	9	.	.	.	2.2927	4.7846	0.13219	0.1646:0.3668:0.0:0.4686	.	678	Q8NET4	RGAG1_HUMAN	V	678	ENSP00000419786:A678V;ENSP00000441452:A678V	.	A	+	2	0	RGAG1	109582534	0.001000	0.12720	0.000000	0.03702	0.348000	0.29142	-0.810000	0.04505	-0.564000	0.06070	0.600000	0.82982	GCA	.		0.507	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
ROBO4	54538	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	124766856	124766856	+	Silent	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:124766856G>T	ENST00000306534.3	-	2	857	c.372C>A	c.(370-372)gtC>gtA	p.V124V	ROBO4_ENST00000526899.1_5'UTR|ROBO4_ENST00000533054.1_5'UTR	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	124	Ig-like C2-type 1.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CGCCTCTGCTGACTGCCGTGC	0.642																																					p.V124V		.											.	ROBO4	92	0			c.C372A						.						30.0	32.0	31.0					11																	124766856		2200	4297	6497	SO:0001819	synonymous_variant	54538	exon2			TCTGCTGACTGCC	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.372C>A	11.37:g.124766856G>T		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	17.0	NM_019055	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	ENST00000306534.3	37	CCDS8455.1																																																																																			.		0.642	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055	
RPL10L	140801	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	47120791	47120791	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr14:47120791C>T	ENST00000298283.3	-	1	237	c.149G>A	c.(148-150)gGc>gAc	p.G50D		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	50					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						CACCATGTGGCCACCGAGTGG	0.502																																					p.G50D		.											.	RPL10L	91	0			c.G149A						.						91.0	93.0	92.0					14																	47120791		2203	4300	6503	SO:0001583	missense	140801	exon1			ATGTGGCCACCGA	AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.149G>A	14.37:g.47120791C>T	ENSP00000298283:p.Gly50Asp	Somatic	92.0	1.0		WXS	Illumina HiSeq	Phase_I	91.0	35.0	NM_080746	Q8IUD1	Missense_Mutation	SNP	ENST00000298283.3	37	CCDS32071.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321004	0.60634	.	.	ENSG00000165496	ENST00000298283	T	0.72167	-0.63	4.17	3.26	0.37387	Ribosomal protein L10e/L16 (2);	0.112719	0.64402	D	0.000013	T	0.80773	0.4687	M	0.63843	1.955	0.51233	D	0.999915	P	0.41673	0.759	D	0.65140	0.932	T	0.82055	-0.0647	10	0.72032	D	0.01	-24.9562	12.0994	0.53774	0.0:0.8248:0.1752:0.0	.	50	Q96L21	RL10L_HUMAN	D	50	ENSP00000298283:G50D	ENSP00000298283:G50D	G	-	2	0	RPL10L	46190541	0.926000	0.31397	0.786000	0.31890	0.880000	0.50808	1.944000	0.40263	1.302000	0.44855	0.655000	0.94253	GGC	.		0.502	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349819.1		
SATB1	6304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	18462375	18462375	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr3:18462375T>G	ENST00000338745.6	-	2	1819	c.85A>C	c.(85-87)Aag>Cag	p.K29Q	SATB1_ENST00000493952.2_Missense_Mutation_p.K29Q|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Missense_Mutation_p.K29Q|SATB1_ENST00000417717.2_Missense_Mutation_p.K29Q	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	29					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						CGGGCAATCTTGGCTGGTGGA	0.512																																					p.K29Q		.											.	SATB1	228	0			c.A85C						.						134.0	137.0	136.0					3																	18462375		2203	4300	6503	SO:0001583	missense	6304	exon2			CAATCTTGGCTGG		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.85A>C	3.37:g.18462375T>G	ENSP00000341024:p.Lys29Gln	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	95.0	NM_002971	B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	37	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.949754	0.92660	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717;ENST00000440737;ENST00000452260;ENST00000415069;ENST00000457005;ENST00000414509;ENST00000444341	T;T;T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.83	5.83	0.93111	.	0.093160	0.64402	D	0.000001	T	0.79100	0.4389	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80921	-0.1166	10	0.87932	D	0	-26.1861	16.2147	0.82198	0.0:0.0:0.0:1.0	.	29;29	Q01826-2;Q01826	.;SATB1_HUMAN	Q	29	ENSP00000341024:K29Q;ENSP00000399708:K29Q;ENSP00000399518:K29Q;ENSP00000402982:K29Q;ENSP00000406727:K29Q;ENSP00000390529:K29Q;ENSP00000398072:K29Q;ENSP00000408871:K29Q;ENSP00000391344:K29Q	ENSP00000341024:K29Q	K	-	1	0	SATB1	18437379	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.665000	0.83852	2.231000	0.72958	0.460000	0.39030	AAG	.		0.512	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
SERPINA12	145264	broad.mit.edu;bcgsc.ca	37	14	94964608	94964608	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr14:94964608T>C	ENST00000341228.2	-	3	922	c.127A>G	c.(127-129)Atg>Gtg	p.M43V	SERPINA12_ENST00000556881.1_Missense_Mutation_p.M43V	NM_173850.2	NP_776249.1	Q8IW75	SPA12_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12	43					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33				COAD - Colon adenocarcinoma(157;0.235)		TTGGCTGCCATCCTTTGCTTC	0.493																																					p.M43V		.											.	SERPINA12	310	0			c.A127G						.						164.0	153.0	157.0					14																	94964608		2203	4300	6503	SO:0001583	missense	145264	exon3			CTGCCATCCTTTG	AY177692	CCDS9926.1	14q32.13	2014-02-21	2005-08-18		ENSG00000165953	ENSG00000165953		"""Serine (or cysteine) peptidase inhibitors"""	18359	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12"""			24172014	Standard	NM_173850		Approved	OL-64, Vaspin	uc001ydj.3	Q8IW75	OTTHUMG00000171349	ENST00000341228.2:c.127A>G	14.37:g.94964608T>C	ENSP00000342109:p.Met43Val	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	5.0	NM_173850		Missense_Mutation	SNP	ENST00000341228.2	37	CCDS9926.1	.	.	.	.	.	.	.	.	.	.	T	9.293	1.051103	0.19827	.	.	ENSG00000165953	ENST00000556881;ENST00000341228	D;D	0.86956	-2.19;-2.19	5.61	-1.52	0.08637	Serpin domain (1);	1.372030	0.04592	N	0.396890	T	0.72495	0.3467	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.58842	-0.7565	10	0.26408	T	0.33	.	6.7422	0.23443	0.0:0.2053:0.3363:0.4584	.	43	Q8IW75	SPA12_HUMAN	V	43	ENSP00000451738:M43V;ENSP00000342109:M43V	ENSP00000342109:M43V	M	-	1	0	SERPINA12	94034361	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-2.382000	0.01064	0.084000	0.17077	0.533000	0.62120	ATG	.		0.493	SERPINA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413097.1	NM_173850	
SHANK1	50944	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	51169520	51169526	+	Frame_Shift_Del	DEL	CCCACTG	CCCACTG	-			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	CCCACTG	CCCACTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:51169520_51169526delCCCACTG	ENST00000293441.1	-	22	5709_5715	c.5691_5697delCAGTGGG	c.(5689-5697)ggcagtgggfs	p.GSG1897fs	SHANK1_ENST00000391814.1_Frame_Shift_Del_p.GSG1905fs|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000391813.1_Frame_Shift_Del_p.GSG1284fs|SHANK1_ENST00000359082.3_Frame_Shift_Del_p.GSG1888fs	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1897	Poly-Gly.				adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CTCCGCCTCCCCCACTGCCTCCTCGGG	0.662																																					p.1897_1899del		.											.	SHANK1	153	0			c.5691_5697del						.																																			SO:0001589	frameshift_variant	50944	exon22			GCCTCCCCCACTG	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.5691_5697delCAGTGGG	19.37:g.51169520_51169526delCCCACTG	ENSP00000293441:p.Gly1897fs	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	19.0	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Frame_Shift_Del	DEL	ENST00000293441.1	37	CCDS12799.1																																																																																			.		0.662	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
SIRT2	22933	broad.mit.edu;bcgsc.ca	37	19	39380761	39380761	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:39380761C>T	ENST00000249396.7	-	5	551	c.250G>A	c.(250-252)Gga>Aga	p.G84R	SIRT2_ENST00000358931.5_Missense_Mutation_p.G84R|SIRT2_ENST00000392081.2_Missense_Mutation_p.G47R	NM_012237.3	NP_036369.2	Q8IXJ6	SIR2_HUMAN	sirtuin 2	84	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				autophagy (GO:0006914)|cellular lipid catabolic process (GO:0044242)|cellular response to caloric restriction (GO:0061433)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to hypoxia (GO:0071456)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to oxidative stress (GO:0034599)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|chromatin silencing at telomere (GO:0006348)|gene silencing (GO:0016458)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|innate immune response (GO:0045087)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|myelination in peripheral nervous system (GO:0022011)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)|negative regulation of defense response to bacterium (GO:1900425)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of oligodendrocyte progenitor proliferation (GO:0070446)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cell division (GO:0051781)|positive regulation of DNA binding (GO:0043388)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of meiosis (GO:0045836)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)|protein kinase B signaling (GO:0043491)|regulation of cell cycle (GO:0051726)|regulation of exit from mitosis (GO:0007096)|regulation of myelination (GO:0031641)|regulation of phosphorylation (GO:0042325)|response to redox state (GO:0051775)|ripoptosome assembly involved in necroptotic process (GO:1901026)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)	centriole (GO:0005814)|centrosome (GO:0005813)|chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|glial cell projection (GO:0097386)|juxtaparanode region of axon (GO:0044224)|lateral loop (GO:0043219)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|myelin sheath (GO:0043209)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|spindle (GO:0005819)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|NAD-dependent protein deacetylase activity (GO:0034979)|protein deacetylase activity (GO:0033558)|transcription factor binding (GO:0008134)|tubulin deacetylase activity (GO:0042903)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			ATTCCAGCTCCCACCAAACAG	0.577																																					p.G84R		.											.	SIRT2	226	0			c.G250A						.						117.0	92.0	101.0					19																	39380761		2203	4300	6503	SO:0001583	missense	22933	exon5			CAGCTCCCACCAA	AF083107	CCDS12523.1, CCDS46069.1, CCDS74361.1	19q13	2010-06-25	2010-06-25		ENSG00000068903	ENSG00000068903			10886	protein-coding gene	gene with protein product		604480	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 2"", ""sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)"""	SIR2L		10393250, 10381378	Standard	NM_012237		Approved		uc002ojt.2	Q8IXJ6	OTTHUMG00000150480	ENST00000249396.7:c.250G>A	19.37:g.39380761C>T	ENSP00000249396:p.Gly84Arg	Somatic	68.0	1.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_012237	A8K3V1|B2RB45|O95889|Q924Y7|Q9P0G8|Q9UNT0|Q9Y6E9|U5TP13	Missense_Mutation	SNP	ENST00000249396.7	37	CCDS12523.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.532934	0.85812	.	.	ENSG00000068903	ENST00000249396;ENST00000392081;ENST00000358931;ENST00000456703;ENST00000414941;ENST00000407552;ENST00000381766;ENST00000437828;ENST00000447739	D;D;D;D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.93795	0.8016	H	0.98629	4.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95997	0.8990	10	0.87932	D	0	-10.6302	15.6636	0.77209	0.0:1.0:0.0:0.0	.	84;47;84;64	Q8IXJ6-4;Q8IXJ6-2;Q8IXJ6;Q8IXJ6-3	.;.;SIRT2_HUMAN;.	R	84;47;84;69;47;47;47;47;47	ENSP00000249396:G84R;ENSP00000375931:G47R;ENSP00000351809:G84R;ENSP00000404309:G47R;ENSP00000385146:G47R;ENSP00000401203:G47R;ENSP00000397022:G47R;ENSP00000408023:G47R	ENSP00000249396:G84R	G	-	1	0	SIRT2	44072601	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.055000	0.76656	2.437000	0.82529	0.561000	0.74099	GGA	.		0.577	SIRT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318278.1		
SKP1	6500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	133494206	133494206	+	Silent	SNP	A	A	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:133494206A>C	ENST00000353411.6	-	5	579	c.396T>G	c.(394-396)ccT>ccG	p.P132P	SKP1_ENST00000517625.1_Silent_p.P132P|SKP1_ENST00000522552.1_Silent_p.P132P|SKP1_ENST00000521216.1_Silent_p.P132P|SKP1_ENST00000522855.1_Silent_p.P132P	NM_170679.2	NP_733779.1	P63208	SKP1_HUMAN	S-phase kinase-associated protein 1	132	Interaction with the F-box domain of F- box proteins. {ECO:0000250}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H2A monoubiquitination (GO:0035518)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	Cul7-RING ubiquitin ligase complex (GO:0031467)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GAATCTCCTCAGGAGTTTTCC	0.408																																					p.P132P		.											.	SKP1	226	0			c.T396G						.						143.0	138.0	139.0					5																	133494206		2203	4300	6503	SO:0001819	synonymous_variant	6500	exon5			CTCCTCAGGAGTT	U33760	CCDS4171.1, CCDS4172.1	5q31	2011-11-18	2007-11-13	2007-11-13	ENSG00000113558	ENSG00000113558			10899	protein-coding gene	gene with protein product		601434	"""S-phase kinase-associated protein 1A (p19A)"""	SKP1A		7553852, 8646875	Standard	NM_006930		Approved	EMC19, OCP2, TCEB1L, MGC34403, OCP-II, p19A	uc003kzc.4	P63208	OTTHUMG00000129117	ENST00000353411.6:c.396T>G	5.37:g.133494206A>C		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	44.0	NM_170679	D3DQ97|D3DQ98|P34991|Q8TAY2	Silent	SNP	ENST00000353411.6	37	CCDS4171.1																																																																																			.		0.408	SKP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251162.2	NM_170679	
SLFN14	342618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33884944	33884944	+	Silent	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:33884944G>T	ENST00000415846.3	-	1	173	c.138C>A	c.(136-138)atC>atA	p.I46I		NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	46							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						ATATAGCCCGGATAATTCTAG	0.408																																					p.I46I		.											.	SLFN14	1	0			c.C138A						.						128.0	103.0	110.0					17																	33884944		692	1591	2283	SO:0001819	synonymous_variant	342618	exon1			AGCCCGGATAATT		CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.138C>A	17.37:g.33884944G>T		Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	61.0	NM_001129820	B2RTW9	Silent	SNP	ENST00000415846.3	37	CCDS45650.1																																																																																			.		0.408	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448928.1	NM_001129820	
SPTBN1	6711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	54853192	54853192	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:54853192G>A	ENST00000356805.4	+	12	1746	c.1465G>A	c.(1465-1467)Gag>Aag	p.E489K	SPTBN1_ENST00000333896.5_Missense_Mutation_p.E476K	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	489					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			CAGGGAGCTCGAGGCCGAGAA	0.582																																					p.E489K		.											.	SPTBN1	140	0			c.G1465A						.						104.0	101.0	102.0					2																	54853192		2203	4300	6503	SO:0001583	missense	6711	exon12			GAGCTCGAGGCCG		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.1465G>A	2.37:g.54853192G>A	ENSP00000349259:p.Glu489Lys	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	42.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	G	36	5.600953	0.96614	.	.	ENSG00000115306	ENST00000356805;ENST00000389980;ENST00000333896	T;T;T	0.50548	0.74;0.74;0.74	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.58694	0.2140	L	0.49699	1.58	0.80722	D	1	P;D	0.60575	0.88;0.988	B;P	0.54238	0.212;0.746	T	0.57980	-0.7717	10	0.51188	T	0.08	.	19.5969	0.95544	0.0:0.0:1.0:0.0	.	476;489	Q01082-3;Q01082	.;SPTB2_HUMAN	K	489;489;476	ENSP00000349259:E489K;ENSP00000374630:E489K;ENSP00000334156:E476K	ENSP00000334156:E476K	E	+	1	0	SPTBN1	54706696	1.000000	0.71417	0.952000	0.39060	0.885000	0.51271	9.802000	0.99131	2.634000	0.89283	0.650000	0.86243	GAG	.		0.582	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
SYNE3	161176	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	95942020	95942020	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr14:95942020T>C	ENST00000334258.5	-	1	153	c.139A>G	c.(139-141)Acc>Gcc	p.T47A	SYNE3_ENST00000553340.1_Missense_Mutation_p.T47A|SYNE3_ENST00000557275.1_Missense_Mutation_p.T47A	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	47					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						CATACCTCGGTCTCCCACAGC	0.642																																					p.T47A		.											.	.	.	0			c.A139G						.						36.0	30.0	32.0					14																	95942020		2203	4300	6503	SO:0001583	missense	161176	exon1			CCTCGGTCTCCCA	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.139A>G	14.37:g.95942020T>C	ENSP00000334308:p.Thr47Ala	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	4.0	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	37	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.473862	0.84640	.	.	ENSG00000176438	ENST00000334258;ENST00000557275;ENST00000553340	T;T;T	0.10573	3.43;3.42;2.86	5.56	5.56	0.83823	.	0.000000	0.35555	N	0.003122	T	0.30039	0.0752	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.03354	-1.1045	10	0.20046	T	0.44	-21.5767	15.7067	0.77588	0.0:0.0:0.0:1.0	.	47;47;47	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	A	47	ENSP00000334308:T47A;ENSP00000450562:T47A;ENSP00000450774:T47A	ENSP00000334308:T47A	T	-	1	0	C14orf49	95011773	1.000000	0.71417	0.998000	0.56505	0.783000	0.44284	7.242000	0.78210	2.116000	0.64780	0.379000	0.24179	ACC	.		0.642	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
TCF4	6925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	52901914	52901914	+	Splice_Site	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr18:52901914C>T	ENST00000356073.4	-	16	1962	c.1351G>A	c.(1351-1353)Gtg>Atg	p.V451M	TCF4_ENST00000561992.1_Splice_Site_p.V321M|TCF4_ENST00000543082.1_Splice_Site_p.V409M|TCF4_ENST00000567880.1_Splice_Site_p.V391M|TCF4_ENST00000561831.3_Splice_Site_p.V291M|TCF4_ENST00000564403.2_Splice_Site_p.V457M|TCF4_ENST00000565018.2_Splice_Site_p.V451M|TCF4_ENST00000537578.1_Splice_Site_p.V427M|TCF4_ENST00000564999.1_Splice_Site_p.V451M|TCF4_ENST00000566279.1_Splice_Site_p.V391M|TCF4_ENST00000566286.1_Splice_Site_p.V448M|TCF4_ENST00000457482.3_Splice_Site_p.V291M|TCF4_ENST00000544241.2_Splice_Site_p.V380M|TCF4_ENST00000564228.1_Splice_Site_p.V380M|TCF4_ENST00000398339.1_Splice_Site_p.V553M|TCF4_ENST00000568673.1_Splice_Site_p.V427M|TCF4_ENST00000568740.1_Splice_Site_p.V426M|TCF4_ENST00000570287.2_Splice_Site_p.V291M|TCF4_ENST00000570177.2_Splice_Site_p.V321M|TCF4_ENST00000537856.3_Splice_Site_p.V321M|TCF4_ENST00000540999.1_Splice_Site_p.V427M|TCF4_ENST00000354452.3_Splice_Site_p.V451M	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	451					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		TGGGTCCCCACCTGAAAGGGC	0.567											OREG0024990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V553M		.											.	TCF4	523	0			c.G1657A						.						77.0	81.0	80.0					18																	52901914		2203	4300	6503	SO:0001630	splice_region_variant	6925	exon17			TCCCCACCTGAAA	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1351-1G>A	18.37:g.52901914C>T		Somatic	45.0	0.0	988	WXS	Illumina HiSeq	Phase_I	27.0	16.0	NM_001243226	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	ENST00000356073.4	37	CCDS11960.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537000	0.65085	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.79621	0.4477	L	0.56396	1.775	0.80722	D	1	P;D;D;D;D;P;P;P;D	0.89917	0.928;0.995;1.0;0.993;0.968;0.935;0.935;0.815;0.994	P;D;D;D;P;P;P;B;D	0.80764	0.737;0.965;0.994;0.943;0.652;0.737;0.737;0.387;0.986	T	0.78239	-0.2281	10	0.45353	T	0.12	-2.8082	18.3978	0.90504	0.0:1.0:0.0:0.0	.	427;451;291;553;451;409;380;291;448	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	M	451;291;451;409;427;427;380;321;553	ENSP00000346440:V451M;ENSP00000409447:V291M;ENSP00000348374:V451M;ENSP00000439656:V409M;ENSP00000445202:V427M;ENSP00000440731:V427M;ENSP00000441562:V380M;ENSP00000439827:V321M;ENSP00000381382:V553M	ENSP00000346440:V451M	V	-	1	0	TCF4	51052912	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	6.414000	0.73318	2.723000	0.93209	0.563000	0.77884	GTG	.		0.567	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199	Missense_Mutation
TMEM173	340061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	138856001	138856001	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:138856001C>A	ENST00000330794.4	-	8	1318	c.985G>T	c.(985-987)Gtt>Ttt	p.V329F	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	329	c-di-GMP-binding domain (CBD).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGCCGGAGAACCTCCTGGGAC	0.557																																					p.V329F		.											.	TMEM173	69	0			c.G985T						.						56.0	54.0	55.0					5																	138856001		2203	4300	6503	SO:0001583	missense	340061	exon8			GGAGAACCTCCTG		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.985G>T	5.37:g.138856001C>A	ENSP00000331288:p.Val329Phe	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	13.0	NM_198282	A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Missense_Mutation	SNP	ENST00000330794.4	37	CCDS4215.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.956615	0.34565	.	.	ENSG00000184584	ENST00000330794	T	0.27720	1.65	5.19	3.04	0.35103	.	0.129349	0.49305	D	0.000144	T	0.23210	0.0561	L	0.36672	1.1	0.38398	D	0.94559	P	0.49090	0.919	B	0.43274	0.414	T	0.06058	-1.0848	10	0.72032	D	0.01	-6.136	5.9319	0.19144	0.0:0.1885:0.0:0.8115	.	329	Q86WV6	TM173_HUMAN	F	329	ENSP00000331288:V329F	ENSP00000331288:V329F	V	-	1	0	TMEM173	138836185	0.825000	0.29262	0.989000	0.46669	0.235000	0.25334	1.011000	0.29911	0.421000	0.25980	-0.379000	0.06801	GTT	.		0.557	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282	
TMEM88	92162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7758491	7758491	+	Silent	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:7758491C>T	ENST00000301599.6	+	1	109	c.99C>T	c.(97-99)gcC>gcT	p.A33A	CYB5D1_ENST00000332439.4_5'Flank|LSMD1_ENST00000570555.1_5'Flank|TMEM88_ENST00000574668.1_Silent_p.A33A|CYB5D1_ENST00000571846.1_5'Flank|CYB5D1_ENST00000570446.1_5'Flank	NM_203411.1	NP_981956.1	Q6PEY1	TMM88_HUMAN	transmembrane protein 88	33					multicellular organismal development (GO:0007275)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				lung(1)	1		all_cancers(10;0.00528)|Prostate(122;0.202)				TTGTAACAGCCCAGAATCTGC	0.637																																					p.A33A		.											.	TMEM88	68	0			c.C99T						.						75.0	68.0	71.0					17																	7758491		2203	4300	6503	SO:0001819	synonymous_variant	92162	exon1			AACAGCCCAGAAT	BC057812	CCDS11121.1	17p13.1	2005-12-13				ENSG00000167874			32371	protein-coding gene	gene with protein product							Standard	NM_203411		Approved	MGC71744, FLJ20025	uc002giy.3	Q6PEY1		ENST00000301599.6:c.99C>T	17.37:g.7758491C>T		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	18.0	NM_203411		Silent	SNP	ENST00000301599.6	37	CCDS11121.1																																																																																			.		0.637	TMEM88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440252.1	NM_203411	
TMPRSS11B	132724	broad.mit.edu;ucsc.edu;mdanderson.org	37	4	69095161	69095161	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr4:69095161G>A	ENST00000332644.5	-	8	921	c.760C>T	c.(760-762)Caa>Taa	p.Q254*		NM_182502.3	NP_872308.2	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	254	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)	27						ATAATGTTTTGGACTTTCCGT	0.338																																					p.Q254X		.											.	TMPRSS11B	91	0			c.C760T						.						65.0	64.0	64.0					4																	69095161		2203	4300	6503	SO:0001587	stop_gained	132724	exon8			TGTTTTGGACTTT	BX537945	CCDS3521.1	4q13.2	2010-04-13			ENSG00000185873	ENSG00000185873		"""Serine peptidases / Transmembrane"""	25398	protein-coding gene	gene with protein product							Standard	NM_182502		Approved		uc003hdw.4	Q86T26	OTTHUMG00000129301	ENST00000332644.5:c.760C>T	4.37:g.69095161G>A	ENSP00000330475:p.Gln254*	Somatic	197.0	1.0		WXS	Illumina HiSeq	Phase_I	204.0	64.0	NM_182502	A8K4D9	Nonsense_Mutation	SNP	ENST00000332644.5	37	CCDS3521.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283280	0.80803	.	.	ENSG00000185873	ENST00000332644	.	.	.	4.76	0.623	0.17654	.	0.684284	0.12074	N	0.501990	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.0552	0.09813	0.0841:0.1355:0.5037:0.2767	.	.	.	.	X	254	.	ENSP00000330475:Q254X	Q	-	1	0	TMPRSS11B	68777756	0.000000	0.05858	0.000000	0.03702	0.657000	0.38888	0.098000	0.15189	0.267000	0.21916	0.555000	0.69702	CAA	.		0.338	TMPRSS11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251431.2	NM_182502	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	G	A	rs121913344		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:7577022G>A	ENST00000269305.4	-	8	1105	c.916C>T	c.(916-918)Cga>Tga	p.R306*	TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	306	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTACCTCGCTTAGTGCTC	0.562	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R306X	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,brain,glioma,+2	TP53	70225	147	Substitution - Nonsense(133)|Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(39)|breast(21)|upper_aerodigestive_tract(15)|ovary(11)|central_nervous_system(10)|oesophagus(10)|stomach(8)|lung(8)|endometrium(6)|bone(4)|pancreas(3)|haematopoietic_and_lymphoid_tissue(3)|biliary_tract(3)|kidney(2)|NS(2)|urinary_tract(1)|liver(1)	c.C916T	GRCh37	CM971506	TP53	M	rs121913344	.						120.0	106.0	110.0					17																	7577022		2203	4300	6503	SO:0001587	stop_gained	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TACCTCGCTTAGT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.916C>T	17.37:g.7577022G>A	ENSP00000269305:p.Arg306*	Somatic	64.0	1.0		WXS	Illumina HiSeq	Phase_I	39.0	21.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782988	0.90282	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	3.21	0.36854	.	1.348720	0.05032	N	0.474808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4785	0.44678	0.0:0.0:0.6334:0.3666	.	.	.	.	X	306;306;306;306;306;295;174	.	ENSP00000269305:R306X	R	-	1	2	TP53	7517747	1.000000	0.71417	0.970000	0.41538	0.345000	0.29048	2.280000	0.43443	0.735000	0.32537	0.561000	0.74099	CGA	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TOM1L1	10040	broad.mit.edu;bcgsc.ca	37	17	53027430	53027430	+	Missense_Mutation	SNP	C	C	T	rs545805013		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:53027430C>T	ENST00000575882.1	+	14	1666	c.1313C>T	c.(1312-1314)cCa>cTa	p.P438L	TOM1L1_ENST00000445275.2_Missense_Mutation_p.P427L|TOM1L1_ENST00000540336.1_Missense_Mutation_p.P326L|COX11_ENST00000573912.1_5'Flank|TOM1L1_ENST00000536554.1_Missense_Mutation_p.P361L|TOM1L1_ENST00000572158.1_Missense_Mutation_p.P431L|TOM1L1_ENST00000348161.4_Missense_Mutation_p.P361L	NM_005486.2	NP_005477.2	O75674	TM1L1_HUMAN	target of myb1 (chicken)-like 1	438					activation of protein kinase activity (GO:0032147)|intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|positive regulation of protein autophosphorylation (GO:0031954)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	clathrin binding (GO:0030276)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|ubiquitin binding (GO:0043130)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	15						GATCTCCAGCCACCTAATTAC	0.348													C|||	1	0.000199681	0.0	0.0	5008	,	,		19725	0.001		0.0	False		,,,				2504	0.0				p.P438L		.											.	TOM1L1	91	0			c.C1313T						.						101.0	97.0	98.0					17																	53027430		2203	4300	6503	SO:0001583	missense	10040	exon14			TCCAGCCACCTAA	AJ010071	CCDS11582.1	17q23.2	2008-01-03	2007-01-12			ENSG00000141198			11983	protein-coding gene	gene with protein product		604701	"""target of myb1 (chicken) homolog-like 1"""			10329004, 15611048, 17977829	Standard	NM_005486		Approved	SRCASM	uc002iud.2	O75674		ENST00000575882.1:c.1313C>T	17.37:g.53027430C>T	ENSP00000460823:p.Pro438Leu	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	5.0	NM_005486	Q53G06|Q8N749	Missense_Mutation	SNP	ENST00000575882.1	37	CCDS11582.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.476641	0.26511	.	.	ENSG00000141198	ENST00000445275;ENST00000540336;ENST00000348161;ENST00000536554	T;T;T;T	0.28666	1.6;1.97;2.0;2.0	5.51	2.43	0.29744	.	0.587759	0.17331	N	0.178105	T	0.16557	0.0398	N	0.21448	0.665	0.44976	D	0.997997	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.06405	0.002;0.001;0.002;0.001	T	0.08066	-1.0740	10	0.14656	T	0.56	0.3891	6.563	0.22497	0.0:0.6943:0.1477:0.158	.	326;431;361;438	B4DUW5;B4E1N0;B7Z9E2;O75674	.;.;.;TM1L1_HUMAN	L	438;326;361;361	ENSP00000408958:P438L;ENSP00000441242:P326L;ENSP00000343901:P361L;ENSP00000443099:P361L	ENSP00000343901:P361L	P	+	2	0	TOM1L1	50382429	0.992000	0.36948	0.997000	0.53966	0.989000	0.77384	0.238000	0.18004	0.434000	0.26340	0.561000	0.74099	CCA	.		0.348	TOM1L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439029.2	NM_005486	
TRPS1	7227	hgsc.bcm.edu;bcgsc.ca	37	8	116617020	116617020	+	Frame_Shift_Del	DEL	A	A	-			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr8:116617020delA	ENST00000220888.5	-	3	1296	c.1137delT	c.(1135-1137)tctfs	p.S379fs	TRPS1_ENST00000519076.1_Frame_Shift_Del_p.S333fs|TRPS1_ENST00000395715.3_Frame_Shift_Del_p.S392fs|TRPS1_ENST00000520276.1_Frame_Shift_Del_p.S383fs|TRPS1_ENST00000519674.1_Frame_Shift_Del_p.S379fs			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	379					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TGGACTTGTTAGAGTTTTTCT	0.438									Langer-Giedion syndrome																												p.S392fs		.											.	TRPS1	229	0			c.1176delT						.						108.0	100.0	102.0					8																	116617020		1850	4098	5948	SO:0001589	frameshift_variant	7227	exon4	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	CTTGTTAGAGTTT	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1137delT	8.37:g.116617020delA	ENSP00000220888:p.Ser379fs	Somatic	172.0	2.0		WXS	Illumina HiSeq	Phase_I	216.0	56.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Frame_Shift_Del	DEL	ENST00000220888.5	37																																																																																				.		0.438	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
TSC1	7248	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	135786464	135786464	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr9:135786464delT	ENST00000298552.3	-	11	1287	c.1066delA	c.(1066-1068)accfs	p.T357fs	TSC1_ENST00000545250.1_Frame_Shift_Del_p.T306fs|TSC1_ENST00000440111.2_Frame_Shift_Del_p.T357fs	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	357					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GGAGGAGTGGTCATACCACAA	0.438			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.T356fs		.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	1906	1	Unknown(1)	bone(1)	c.1066delA						.						618.0	584.0	596.0					9																	135786464		2203	4300	6503	SO:0001589	frameshift_variant	7248	exon11	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GAGTGGTCATACC	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.1066delA	9.37:g.135786464delT	ENSP00000298552:p.Thr357fs	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	28.0	NM_000368	B7Z897|Q5VVN5	Frame_Shift_Del	DEL	ENST00000298552.3	37	CCDS6956.1																																																																																			.		0.438	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
TYW1	55253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	66463919	66463919	+	Missense_Mutation	SNP	G	G	T	rs542889524		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:66463919G>T	ENST00000359626.5	+	3	415	c.251G>T	c.(250-252)gGt>gTt	p.G84V		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	84	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				ATTTTTTATGGTTCTCAGACT	0.368																																					p.G84V		.											.	TYW1	91	0			c.G251T						.						115.0	111.0	112.0					7																	66463919		2203	4300	6503	SO:0001583	missense	55253	exon3			TTTATGGTTCTCA	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.251G>T	7.37:g.66463919G>T	ENSP00000352645:p.Gly84Val	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	35.0	NM_018264	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	ENST00000359626.5	37	CCDS5538.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351430	0.61183	.	.	ENSG00000198874	ENST00000359626;ENST00000442959	T;D	0.87571	-0.15;-2.27	4.45	3.52	0.40303	Flavodoxin/nitric oxide synthase (2);	0.066589	0.64402	U	0.000013	D	0.94689	0.8287	H	0.96398	3.815	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.94988	0.8132	9	.	.	.	.	10.4509	0.44522	0.0:0.1967:0.8033:0.0	.	84	Q9NV66	TYW1_HUMAN	V	84	ENSP00000352645:G84V;ENSP00000398897:G84V	.	G	+	2	0	TYW1	66101354	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.002000	0.57053	2.328000	0.79073	0.563000	0.77884	GGT	.		0.368	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264	
UNC13D	201294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73840324	73840324	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:73840324G>A	ENST00000207549.4	-	1	474	c.95C>T	c.(94-96)cCc>cTc	p.P32L	UNC13D_ENST00000412096.2_Missense_Mutation_p.P32L|UNC13D_ENST00000587504.1_5'Flank	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	32					defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTGGGGCGGGGGATCCTGTAG	0.652									Familial Hemophagocytic Lymphohistiocytosis																												p.P32L		.											.	UNC13D	92	0			c.C95T						.						43.0	49.0	47.0					17																	73840324		2202	4300	6502	SO:0001583	missense	201294	exon1	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GGCGGGGGATCCT	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.95C>T	17.37:g.73840324G>A	ENSP00000207549:p.Pro32Leu	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	10.0	NM_199242	B4DWG9|Q9H7K5	Missense_Mutation	SNP	ENST00000207549.4	37	CCDS11730.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.644735	0.29246	.	.	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	T;T	0.70164	-0.43;-0.46	4.04	2.0	0.26442	.	0.495999	0.17124	N	0.186104	T	0.54447	0.1859	L	0.48642	1.525	0.09310	N	1	B	0.27823	0.19	B	0.24155	0.051	T	0.50684	-0.8799	10	0.72032	D	0.01	-0.5365	6.5283	0.22312	0.2264:0.0:0.7736:0.0	.	32	Q70J99	UN13D_HUMAN	L	32	ENSP00000207549:P32L;ENSP00000388093:P32L	ENSP00000207549:P32L	P	-	2	0	UNC13D	71351919	0.397000	0.25270	0.000000	0.03702	0.497000	0.33675	1.716000	0.37981	0.369000	0.24510	0.561000	0.74099	CCC	.		0.652	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950	
USP9Y	8287	broad.mit.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	Y	14968376	14968377	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chrY:14968376_14968377GG>AT	ENST00000338981.3	+	43	8121_8122	c.7176_7177GG>AT	c.(7174-7179)atGGta>atATta	p.2392_2393MV>IL	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	2392					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TAAAATGTATGGTAGCTCTATT	0.386																																					p.M2392I|p.V2393L		.											.	USP9Y	136	0			c.G7176A|c.G7177T						.																																			SO:0001583	missense	8287	exon43			ATGTATGGTAGCT|TGTATGGTAGCTC	Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	Exception_encountered	Y.37:g.14968376_14968377delinsAT	ENSP00000342812:p.M2392_V2393delinsIL	Somatic	119.0|118.0	1.0|0.0		WXS	Illumina HiSeq	Phase_I	94.0|92.0	76.0|75.0	NM_004654	O14601	Missense_Mutation	SNP	ENST00000338981.3	37	CCDS14781.1																																																																																			.		0.386	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82836955	82836955	+	Silent	SNP	T	T	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:82836955T>A	ENST00000265077.3	+	8	8698	c.8133T>A	c.(8131-8133)gcT>gcA	p.A2711A	VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000343200.5_Silent_p.A1724A|VCAN-AS1_ENST00000513899.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2711	GAG-beta.			IKAEA -> EFREV (in Ref. 7; AAA36437). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GAATAAAAGCTGAAGCAAAAG	0.423																																					p.A2711A		.											.	VCAN	238	0			c.T8133A						.						61.0	58.0	59.0					5																	82836955		2203	4300	6503	SO:0001819	synonymous_variant	1462	exon8			AAAAGCTGAAGCA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8133T>A	5.37:g.82836955T>A		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	27.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																			.		0.423	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
WNT2	7472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	116955172	116955172	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:116955172C>T	ENST00000265441.3	-	3	840	c.541G>A	c.(541-543)Gat>Aat	p.D181N	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	181					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		GCTCTGGCAtcctttcctttc	0.463																																					p.D181N		.											.	WNT2	1011	0			c.G541A						.						132.0	121.0	125.0					7																	116955172		2203	4300	6503	SO:0001583	missense	7472	exon3			TGGCATCCTTTCC	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.541G>A	7.37:g.116955172C>T	ENSP00000265441:p.Asp181Asn	Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	354.0	94.0	NM_003391	A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	37	CCDS5771.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353979	0.82243	.	.	ENSG00000105989	ENST00000265441	T	0.76839	-1.05	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.88028	0.6327	M	0.73319	2.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.86549	0.1833	10	0.45353	T	0.12	.	20.0965	0.97849	0.0:1.0:0.0:0.0	.	181;181	A4D0V1;P09544	.;WNT2_HUMAN	N	181	ENSP00000265441:D181N	ENSP00000265441:D181N	D	-	1	0	WNT2	116742408	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.050000	0.71063	2.824000	0.97209	0.655000	0.94253	GAT	.		0.463	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391	
ZNF410	57862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	74363143	74363143	+	Silent	SNP	G	G	A	rs150263864		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr14:74363143G>A	ENST00000555044.1	+	4	488	c.294G>A	c.(292-294)ccG>ccA	p.P98P	ZNF410_ENST00000556797.1_Silent_p.P45P|RP5-1021I20.5_ENST00000554009.1_RNA|ZNF410_ENST00000334521.4_Silent_p.P45P|ZNF410_ENST00000412490.3_3'UTR|ZNF410_ENST00000540593.1_Intron|RP5-1021I20.4_ENST00000556551.2_3'UTR|ZNF410_ENST00000324593.6_Silent_p.P98P|ZNF410_ENST00000442160.3_Silent_p.P115P	NM_001242928.1|NM_021188.2	NP_001229857.1|NP_067011.1	Q86VK4	ZN410_HUMAN	zinc finger protein 410	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(234;0.00369)		AGAAATCCCCGGAGTTTTTGT	0.478																																					p.P115P		.											.	ZNF410	91	0			c.G345A						.	G	,,,,	1,4405	2.1+/-5.4	0,1,2202	137.0	132.0	133.0		345,294,,,294	-10.4	0.4	14	dbSNP_134	133	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,intron,utr-5,coding-synonymous	ZNF410	NM_001242924.1,NM_001242926.1,NM_001242927.1,NM_001242928.1,NM_021188.2	,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,	115/517,98/432,,,98/479	74363143	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57862	exon5			ATCCCCGGAGTTT	U90919	CCDS9821.1, CCDS55929.1, CCDS55930.1, CCDS55931.1	14q24.3	2013-01-08				ENSG00000119725		"""Zinc fingers, C2H2-type"""	20144	protein-coding gene	gene with protein product						12370286	Standard	NM_001242924		Approved	APA1, APA-1	uc010arz.2	Q86VK4		ENST00000555044.1:c.294G>A	14.37:g.74363143G>A		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	33.0	NM_001242924	B4DDV5|B4DR78|O00153|Q9BQ19	Silent	SNP	ENST00000555044.1	37	CCDS9821.1	.	.	.	.	.	.	.	.	.	.	G	6.079	0.382894	0.11524	2.27E-4	0.0	ENSG00000119725	ENST00000458102	.	.	.	5.3	-10.4	0.00318	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.2662	0.31815	0.6921:0.0737:0.1204:0.1138	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF410	73432896	0.026000	0.19158	0.400000	0.26346	0.160000	0.22226	-1.039000	0.03550	-2.003000	0.00962	-0.948000	0.02665	.	G|1.000;A|0.000		0.478	ZNF410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412597.1	NM_021188	
ZNF618	114991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	116731402	116731402	+	Silent	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr9:116731402C>T	ENST00000374126.5	+	2	138	c.39C>T	c.(37-39)gaC>gaT	p.D13D	ZNF618_ENST00000288466.7_Silent_p.D13D			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	13					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						TGCAGGCTGACGGAGCCAGTG	0.557																																					p.D13D		.											.	ZNF618	22	0			c.C39T						.						134.0	149.0	144.0					9																	116731402		2016	4205	6221	SO:0001819	synonymous_variant	114991	exon2			GGCTGACGGAGCC	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.39C>T	9.37:g.116731402C>T		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	16.0	NM_133374	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Silent	SNP	ENST00000374126.5	37																																																																																				.		0.557	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053749.1	XM_054983	
ZPLD1	131368	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	102157387	102157387	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr3:102157387C>T	ENST00000491959.1	+	9	938	c.56C>T	c.(55-57)gCt>gTt	p.A19V	ZPLD1_ENST00000466937.1_Missense_Mutation_p.A19V|ZPLD1_ENST00000306176.1_Missense_Mutation_p.A35V			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	19						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						CCGGGGTCTGCTCAGTTCAAC	0.428																																					p.A35V		.											.	ZPLD1	72	0			c.C104T						.						138.0	123.0	128.0					3																	102157387		2203	4300	6503	SO:0001583	missense	131368	exon2			GGTCTGCTCAGTT	AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.56C>T	3.37:g.102157387C>T	ENSP00000420265:p.Ala19Val	Somatic	123.0	1.0		WXS	Illumina HiSeq	Phase_I	183.0	59.0	NM_175056	Q49AS1|Q8WU36	Missense_Mutation	SNP	ENST00000491959.1	37		.	.	.	.	.	.	.	.	.	.	C	15.99	2.995861	0.54147	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	D;D;D	0.81821	-1.51;-1.54;-1.51	5.0	4.11	0.48088	.	0.105878	0.64402	D	0.000004	T	0.70988	0.3287	L	0.32530	0.975	0.52099	D	0.999949	P;B	0.34724	0.465;0.22	B;B	0.31101	0.124;0.039	T	0.69643	-0.5090	10	0.41790	T	0.15	-1.9622	15.2489	0.73529	0.0:0.8587:0.1413:0.0	.	35;19	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	V	19;35;19	ENSP00000420265:A19V;ENSP00000307801:A35V;ENSP00000418253:A19V	ENSP00000307801:A35V	A	+	2	0	ZPLD1	103640077	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.735000	0.55044	1.073000	0.40885	-0.282000	0.10007	GCT	.		0.428	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056	
