#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu	37	7	48559880	48559880	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr7:48559880C>T	ENST00000435803.1	+	53	14065	c.14041C>T	c.(14041-14043)Cga>Tga	p.R4681*	ABCA13_ENST00000544596.1_Nonsense_Mutation_p.R411*	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4681					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GGACCTTCTGCGATGGCCAAG	0.493																																					p.R4681X		.											.	ABCA13	521	0			c.C14041T						.						43.0	40.0	41.0					7																	48559880		1923	4151	6074	SO:0001587	stop_gained	154664	exon53			CTTCTGCGATGGC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14041C>T	7.37:g.48559880C>T	ENSP00000411096:p.Arg4681*	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	8.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	55	24.171996	0.99959	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	.	.	.	5.32	2.39	0.29439	.	0.977254	0.08337	N	0.961457	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	2.8352	0.05512	0.1517:0.5483:0.1381:0.1618	.	.	.	.	X	4681;454;411	.	ENSP00000391042:R454X	R	+	1	2	ABCA13	48530426	0.001000	0.12720	0.003000	0.11579	0.882000	0.50991	0.918000	0.28678	0.188000	0.20168	0.655000	0.94253	CGA	.		0.493	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ACLY	47	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40028400	40028400	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:40028400C>T	ENST00000352035.2	-	24	2808	c.2678G>A	c.(2677-2679)tGt>tAt	p.C893Y	ACLY_ENST00000537919.1_Missense_Mutation_p.C622Y|ACLY_ENST00000393896.2_Missense_Mutation_p.C883Y|ACLY_ENST00000588779.1_5'Flank|ACLY_ENST00000353196.1_Missense_Mutation_p.C883Y|ACLY_ENST00000590151.1_Missense_Mutation_p.C893Y	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	893					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				CACCATCAGACACATCTCAAT	0.567																																					p.C893Y	Colon(64;807 1396 15971 30971)	.											.	ACLY	228	0			c.G2678A						.						74.0	62.0	66.0					17																	40028400		2203	4300	6503	SO:0001583	missense	47	exon24			ATCAGACACATCT	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.2678G>A	17.37:g.40028400C>T	ENSP00000253792:p.Cys893Tyr	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	21.0	NM_001096	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	37	CCDS11412.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.153538	0.57259	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	T;T;D;T	0.88509	-1.39;-1.4;-2.39;-1.4	6.17	5.21	0.72293	Citrate synthase-like, large alpha subdomain (1);Citrate synthase-like, core (1);	0.000000	0.85682	D	0.000000	D	0.94036	0.8089	M	0.74389	2.26	0.80722	D	1	D;D;D;P;D	0.76494	0.999;0.999;0.963;0.912;0.999	D;D;P;P;D	0.87578	0.998;0.994;0.71;0.813;0.998	D	0.94705	0.7887	10	0.87932	D	0	.	15.565	0.76284	0.0:0.9345:0.0:0.0655	.	622;937;947;883;893	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	Y	893;947;883;622;883	ENSP00000253792:C893Y;ENSP00000345398:C883Y;ENSP00000445349:C622Y;ENSP00000377474:C883Y	ENSP00000253792:C893Y	C	-	2	0	ACLY	37281926	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	7.770000	0.85390	1.636000	0.50526	-0.136000	0.14681	TGT	.		0.567	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
ABCA5	23461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	67300830	67300830	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:67300830A>T	ENST00000392676.3	-	7	974	c.910T>A	c.(910-912)Ttc>Atc	p.F304I	ABCA5_ENST00000588877.1_Missense_Mutation_p.F304I|ABCA5_ENST00000392677.2_Missense_Mutation_p.F304I			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	304					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	CCATAAAGGAAAAAAAGCAGA	0.308																																					p.F304I		.											.	ABCA5	93	0			c.T910A						.						43.0	43.0	43.0					17																	67300830		2203	4295	6498	SO:0001583	missense	23461	exon6			AAAGGAAAAAAAG	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.910T>A	17.37:g.67300830A>T	ENSP00000376443:p.Phe304Ile	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	41.0	NM_018672	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.517016	0.85495	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	T;T	0.79554	-1.28;-1.28	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000003	D	0.87489	0.6190	M	0.71036	2.16	0.48341	D	0.999638	D;D	0.89917	0.989;1.0	P;D	0.71870	0.857;0.975	D	0.87546	0.2462	9	.	.	.	.	11.6476	0.51269	0.8518:0.1482:0.0:0.0	.	304;304	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	I	304	ENSP00000376444:F304I;ENSP00000376443:F304I	.	F	-	1	0	ABCA5	64812425	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.128000	0.64733	2.086000	0.62901	0.460000	0.39030	TTC	.		0.308	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
ADAL	161823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43643144	43643144	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr15:43643144T>C	ENST00000562188.1	+	9	794	c.778T>C	c.(778-780)Tgt>Cgt	p.C260R	ADAL_ENST00000422466.2_Missense_Mutation_p.C260R|ADAL_ENST00000428046.3_Missense_Mutation_p.C233R			Q6DHV7	ADAL_HUMAN	adenosine deaminase-like	260					adenosine catabolic process (GO:0006154)|drug metabolic process (GO:0017144)|inosine biosynthetic process (GO:0046103)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	adenosine deaminase activity (GO:0004000)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)	7		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		TCTAGAACTCTGTTTGACCTC	0.383																																					p.C233R		.											.	ADAL	90	0			c.T697C						.						298.0	234.0	254.0					15																	43643144		690	1590	2280	SO:0001583	missense	161823	exon11			GAACTCTGTTTGA		CCDS32214.1, CCDS53936.1	15q15.3	2014-08-08			ENSG00000168803	ENSG00000168803			31853	protein-coding gene	gene with protein product							Standard	NM_001012969		Approved		uc010udo.2	Q6DHV7	OTTHUMG00000176646	ENST00000562188.1:c.778T>C	15.37:g.43643144T>C	ENSP00000456242:p.Cys260Arg	Somatic	212.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	38.0	NM_001159280	A6NHZ3|B4DQM8	Missense_Mutation	SNP	ENST00000562188.1	37		.	.	.	.	.	.	.	.	.	.	T	23.1	4.379751	0.82682	.	.	ENSG00000168803	ENST00000422466;ENST00000428046	D;D	0.88975	-2.45;-2.45	5.69	5.69	0.88448	Adenosine/AMP deaminase (1);	.	.	.	.	D	0.95900	0.8665	H	0.94345	3.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96873	0.9641	9	0.87932	D	0	1.2022	13.9004	0.63799	0.0:0.0:0.0:1.0	.	233;260	B4DQM8;Q6DHV7	.;ADAL_HUMAN	R	260;233	ENSP00000398744:C260R;ENSP00000413074:C233R	ENSP00000398744:C260R	C	+	1	0	ADAL	41430436	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.312000	0.78968	2.170000	0.68504	0.528000	0.53228	TGT	.		0.383	ADAL-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432960.1	XM_091156	
ADI1	55256	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	3502749	3502749	+	Silent	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr2:3502749C>T	ENST00000327435.6	-	4	773	c.525G>A	c.(523-525)ctG>ctA	p.L175L	RP11-1293J14.1_ENST00000607415.1_lincRNA|ADI1_ENST00000382093.5_Silent_p.L169L	NM_018269.3	NP_060739.2			acireductone dioxygenase 1											breast(2)|large_intestine(2)|lung(4)|ovary(1)|stomach(1)	10	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		CGGTCTGTGCCAGAAATTTCA	0.537																																					p.L175L		.											.	ADI1	91	0			c.G525A						.						71.0	73.0	73.0					2																	3502749		2203	4300	6503	SO:0001819	synonymous_variant	55256	exon4			CTGTGCCAGAAAT		CCDS1653.1	2p25.2	2013-05-29			ENSG00000182551	ENSG00000182551	1.13.11.54		30576	protein-coding gene	gene with protein product	"""membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1"""	613400				14718544, 15938715	Standard	NM_018269		Approved	SIPL, MTCBP-1, ARD, APL1, FLJ10913, HMFT1638, mtnD	uc002qxp.4	Q9BV57	OTTHUMG00000112441	ENST00000327435.6:c.525G>A	2.37:g.3502749C>T		Somatic	146.0	2.0		WXS	Illumina HiSeq	Phase_I	171.0	27.0	NM_018269		Silent	SNP	ENST00000327435.6	37	CCDS1653.1	.	.	.	.	.	.	.	.	.	.	C	4.850	0.157977	0.09236	.	.	ENSG00000182551	ENST00000415131	.	.	.	4.89	3.98	0.46160	.	.	.	.	.	T	0.68751	0.3035	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67292	-0.5707	4	.	.	.	-37.5787	14.1653	0.65473	0.0:0.8501:0.1499:0.0	.	.	.	.	S	113	.	.	G	-	1	0	ADI1	3481756	1.000000	0.71417	0.560000	0.28344	0.086000	0.17979	4.452000	0.60054	2.537000	0.85549	0.655000	0.94253	GGC	.		0.537	ADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000231914.6	NM_018269	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105414938	105414938	+	Missense_Mutation	SNP	C	C	T	rs112406618	byFrequency	TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr14:105414938C>T	ENST00000333244.5	-	7	6969	c.6850G>A	c.(6850-6852)Gtg>Atg	p.V2284M	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2284						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.V2284M(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCACCTCCACGCTGGGCAGA	0.617													.|||	2	0.000399361	0.0008	0.0014	5008	,	,		19314	0.0		0.0	False		,,,				2504	0.0				p.V2284M		.											.	AHNAK2	47	1	Substitution - Missense(1)	endometrium(1)	c.G6850A						.	T	MET/VAL	9,3983		0,9,1987	140.0	157.0	152.0		6850	-1.2	0.0	14	dbSNP_132	152	0,8338		0,0,4169	no	missense	AHNAK2	NM_138420.2	21	0,9,6156	TT,TC,CC		0.0,0.2255,0.073	probably-damaging	2284/5796	105414938	9,12321	1996	4169	6165	SO:0001583	missense	113146	exon7			CCTCCACGCTGGG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6850G>A	14.37:g.105414938C>T	ENSP00000353114:p.Val2284Met	Somatic	227.0	0.0		WXS	Illumina HiSeq	Phase_I	446.0	57.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	15.86	2.958906	0.53400	0.002255	0.0	ENSG00000185567	ENST00000333244	T	0.00682	5.86	4.28	-1.2	0.09554	.	.	.	.	.	T	0.01156	0.0038	L	0.41492	1.28	0.09310	N	1	D	0.59767	0.986	P	0.55112	0.769	T	0.47661	-0.9100	9	0.44086	T	0.13	.	0.8829	0.01238	0.2396:0.3287:0.2347:0.197	.	2284	Q8IVF2	AHNK2_HUMAN	M	2284	ENSP00000353114:V2284M	ENSP00000353114:V2284M	V	-	1	0	AHNAK2	104485983	0.000000	0.05858	0.028000	0.17463	0.194000	0.23727	-2.346000	0.01096	-0.605000	0.05753	0.485000	0.47835	GTG	C|0.500;T|0.500		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AJAP1	55966	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	4772487	4772487	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:4772487C>T	ENST00000378191.4	+	2	938	c.557C>T	c.(556-558)aCg>aTg	p.T186M	AJAP1_ENST00000378190.3_Missense_Mutation_p.T186M	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	186	Thr-rich.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		TGGGGGCCCACGGGGGACGAG	0.652																																					p.T186M		.											.	AJAP1	515	0			c.C557T						.						19.0	19.0	19.0					1																	4772487		2199	4299	6498	SO:0001583	missense	55966	exon2			GGCCCACGGGGGA	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.557C>T	1.37:g.4772487C>T	ENSP00000367433:p.Thr186Met	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	13.0	NM_018836	Q9Y229	Missense_Mutation	SNP	ENST00000378191.4	37	CCDS54.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023501	0.54683	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.64085	-0.08;-0.08	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.69922	0.3165	L	0.32530	0.975	0.53688	D	0.999979	D	0.89917	1.0	D	0.91635	0.999	T	0.73196	-0.4059	10	0.87932	D	0	-13.4007	14.0163	0.64525	0.0:1.0:0.0:0.0	.	186	Q9UKB5	AJAP1_HUMAN	M	186	ENSP00000367432:T186M;ENSP00000367433:T186M	ENSP00000367432:T186M	T	+	2	0	AJAP1	4672347	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	5.784000	0.68990	2.362000	0.80069	0.313000	0.20887	ACG	.		0.652	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	NM_018836	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	114274746	114274746	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr4:114274746G>C	ENST00000357077.4	+	38	5025	c.4972G>C	c.(4972-4974)Gtt>Ctt	p.V1658L	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.V1625L	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1658					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCTGCAGACAGTTCAAGATAA	0.473																																					p.V1658L		.											.	ANK2	583	0			c.G4972C						.						81.0	80.0	80.0					4																	114274746		2203	4300	6503	SO:0001583	missense	287	exon38			CAGACAGTTCAAG	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4972G>C	4.37:g.114274746G>C	ENSP00000349588:p.Val1658Leu	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	25.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.287877	0.00248	.	.	ENSG00000145362	ENST00000503423;ENST00000504454;ENST00000357077;ENST00000264366	T;T;T;T	0.66099	0.07;-0.05;-0.17;-0.19	5.29	4.43	0.53597	.	1.852170	0.03076	N	0.157916	T	0.41328	0.1154	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.41787	-0.9489	10	0.10902	T	0.67	.	2.5139	0.04663	0.1517:0.1464:0.5281:0.1739	.	1625;1658	Q01484;Q01484-4	ANK2_HUMAN;.	L	1571;1673;1658;1625	ENSP00000421011:V1571L;ENSP00000424722:V1673L;ENSP00000349588:V1658L;ENSP00000264366:V1625L	ENSP00000264366:V1625L	V	+	1	0	ANK2	114494195	0.000000	0.05858	0.001000	0.08648	0.149000	0.21700	0.507000	0.22675	1.184000	0.42957	0.655000	0.94253	GTT	.		0.473	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ASAP1	50807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	131104271	131104271	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr8:131104271G>T	ENST00000518721.1	-	25	2747	c.2520C>A	c.(2518-2520)gaC>gaA	p.D840E	ASAP1_ENST00000357668.1_Missense_Mutation_p.D840E	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	840	Pro-rich.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						GGCTGGGAGGGTCGGATAGGG	0.597																																					p.D840E		.											.	ASAP1	95	0			c.C2520A						.						109.0	116.0	114.0					8																	131104271		2203	4300	6503	SO:0001583	missense	50807	exon25			GGGAGGGTCGGAT	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2520C>A	8.37:g.131104271G>T	ENSP00000429900:p.Asp840Glu	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	40.0	NM_018482	B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	37	CCDS6362.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.11|15.11	2.735669|2.735669	0.49045|0.49045	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721|ENST00000524124	T;T|.	0.05786|.	3.39;3.39|.	5.3|5.3	3.48|3.48	0.39840|0.39840	.|.	0.612156|.	0.16915|.	N|.	0.194339|.	T|T	0.61261|0.61261	0.2333|0.2333	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999991|0.999991	D;D;D|.	0.61697|.	0.984;0.984;0.99|.	D;D;D|.	0.75484|.	0.967;0.967;0.986|.	T|T	0.59440|0.59440	-0.7454|-0.7454	10|5	0.07813|.	T|.	0.8|.	.|.	12.0001|12.0001	0.53226|0.53226	0.1497:0.0:0.8503:0.0|0.1497:0.0:0.8503:0.0	.|.	840;840;843|.	B2RNV3;Q9ULH1;Q9ULH1-2|.	.;ASAP1_HUMAN;.|.	E|T	843;840;840|661	ENSP00000350297:D840E;ENSP00000429900:D840E|.	ENSP00000344591:D843E|.	D|P	-|-	3|1	2|0	ASAP1|ASAP1	131173453|131173453	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	4.780000|4.780000	0.62382|0.62382	1.373000|1.373000	0.46208|0.46208	-0.463000|-0.463000	0.05309|0.05309	GAC|CCC	.		0.597	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
ASPN	54829	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	95228783	95228783	+	Missense_Mutation	SNP	C	C	T	rs371768627		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr9:95228783C>T	ENST00000375544.3	-	4	701	c.458G>A	c.(457-459)cGa>cAa	p.R153Q	CENPP_ENST00000375587.3_Intron|ASPN_ENST00000375543.1_Missense_Mutation_p.R153Q|ASPN_ENST00000395538.3_Missense_Mutation_p.R153Q	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	153					bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						ATACAGCCTTCGCAACTTCTT	0.358																																					p.R153Q		.											.	ASPN	514	0			c.G458A						.	C	,GLN/ARG,GLN/ARG	0,4406		0,0,2203	231.0	219.0	223.0		,458,458	5.6	1.0	9		223	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense,missense	ASPN,CENPP	NM_001012267.1,NM_001193335.1,NM_017680.4	,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,possibly-damaging,possibly-damaging	,153/244,153/381	95228783	1,13005	2203	4300	6503	SO:0001583	missense	54829	exon4			AGCCTTCGCAACT	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.458G>A	9.37:g.95228783C>T	ENSP00000364694:p.Arg153Gln	Somatic	202.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	17.0	NM_001193335	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	ENST00000375544.3	37		.	.	.	.	.	.	.	.	.	.	C	12.04	1.817561	0.32145	0.0	1.16E-4	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538	T;T;T	0.58060	0.36;0.36;0.36	5.55	5.55	0.83447	.	0.180534	0.46442	D	0.000297	T	0.45696	0.1355	L	0.48174	1.505	0.32410	N	0.55075	B;B	0.22746	0.015;0.074	B;B	0.15484	0.013;0.012	T	0.49062	-0.8978	10	0.06757	T	0.87	.	19.8869	0.96915	0.0:1.0:0.0:0.0	.	153;153	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	Q	153	ENSP00000364694:R153Q;ENSP00000364693:R153Q;ENSP00000378909:R153Q	ENSP00000364693:R153Q	R	-	2	0	ASPN	94268604	0.993000	0.37304	0.995000	0.50966	0.947000	0.59692	2.669000	0.46825	2.780000	0.95670	0.655000	0.94253	CGA	.		0.358	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680	
ATP1A4	480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160121863	160121863	+	Silent	SNP	T	T	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:160121863T>G	ENST00000368081.4	+	1	504	c.33T>G	c.(31-33)gcT>gcG	p.A11A		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	11					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGACAGTGGCTCCCCATGACC	0.498																																					p.A11A		.											.	ATP1A4	94	0			c.T33G						.						64.0	64.0	64.0					1																	160121863		2203	4300	6503	SO:0001819	synonymous_variant	480	exon1			AGTGGCTCCCCAT	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.33T>G	1.37:g.160121863T>G		Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	14.0	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	ENST00000368081.4	37	CCDS1197.1																																																																																			.		0.498	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
BEND4	389206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	42145862	42145862	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr4:42145862C>T	ENST00000502486.1	-	3	1216	c.637G>A	c.(637-639)Gag>Aag	p.E213K	BEND4_ENST00000504360.1_Missense_Mutation_p.E209K	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	213										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						TGACAGTGCTCCTGTCTTTCG	0.438																																					p.E213K		.											.	BEND4	90	0			c.G637A						.						99.0	99.0	99.0					4																	42145862		1927	4152	6079	SO:0001583	missense	389206	exon3			AGTGCTCCTGTCT	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.637G>A	4.37:g.42145862C>T	ENSP00000421169:p.Glu213Lys	Somatic	266.0	0.0		WXS	Illumina HiSeq	Phase_I	284.0	77.0	NM_001159547	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	ENST00000502486.1	37	CCDS47048.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.061525	0.55432	.	.	ENSG00000188848	ENST00000411720;ENST00000502486;ENST00000504360	.	.	.	5.72	5.72	0.89469	.	0.247257	0.40144	N	0.001169	T	0.35128	0.0921	N	0.08118	0	0.47547	D	0.999458	P;B;B	0.35272	0.493;0.181;0.277	B;B;B	0.27380	0.079;0.036;0.079	T	0.39583	-0.9607	9	0.72032	D	0.01	-5.0808	19.8965	0.96963	0.0:1.0:0.0:0.0	.	135;213;213	Q6ZU67-3;Q6ZU67;Q6ZU67-2	.;BEND4_HUMAN;.	K	84;213;209	.	ENSP00000412495:E84K	E	-	1	0	BEND4	41840619	1.000000	0.71417	0.998000	0.56505	0.281000	0.26958	5.434000	0.66526	2.717000	0.92951	0.655000	0.94253	GAG	.		0.438	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360975.2	NM_207406	
C10orf40	283025	ucsc.edu;mdanderson.org	37	10	61719363	61719363	+	5'UTR	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr10:61719363G>T	ENST00000521074.1	-	0	395				C10orf40_ENST00000430888.1_5'Flank|C10orf40_ENST00000444900.1_5'UTR					chromosome 10 open reading frame 40																		GTTAGGTCAAGGGTTTAGTTA	0.433																																					.		.											.	.	.	0			.						.																																			SO:0001623	5_prime_UTR_variant	283025	.			GGTCAAGGGTTTA	BC038741		10q21.3	2013-01-15			ENSG00000235931	ENSG00000235931			23524	other	unknown						12477932	Standard	NR_024340		Approved	AC023904.2	uc021prf.1	A4QN01	OTTHUMG00000018285	ENST00000521074.1:c.-692C>A	10.37:g.61719363G>T		Somatic	424.0	0.0		WXS	Illumina HiSeq	.	337.0	75.0	.		RNA	SNP	ENST00000521074.1	37																																																																																				.		0.433	C10orf40-002	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379562.1	NR_024340	
C10orf76	79591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	103609618	103609618	+	Missense_Mutation	SNP	G	G	A	rs199549255		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr10:103609618G>A	ENST00000370033.4	-	25	2011	c.1892C>T	c.(1891-1893)aCg>aTg	p.T631M	C10orf76_ENST00000495001.1_5'UTR	NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	631						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		CAGCGTGAGCGTGTCATAGTT	0.587																																					p.T631M		.											.	C10orf76	90	0			c.C1892T						.						102.0	103.0	103.0					10																	103609618		2136	4247	6383	SO:0001583	missense	79591	exon25			GTGAGCGTGTCAT	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.1892C>T	10.37:g.103609618G>A	ENSP00000359050:p.Thr631Met	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	40.0	NM_024541	Q2TB87|Q9H8Z9	Missense_Mutation	SNP	ENST00000370033.4	37	CCDS41563.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	32	5.183907	0.94885	.	.	ENSG00000120029	ENST00000370033	.	.	.	5.83	5.83	0.93111	Domain of unknown function DUF1741 (1);	0.000000	0.85682	D	0.000000	T	0.79805	0.4509	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.80358	-0.1416	9	0.72032	D	0.01	-9.5961	19.7186	0.96134	0.0:0.0:1.0:0.0	.	631	Q5T2E6	CJ076_HUMAN	M	631	.	ENSP00000359050:T631M	T	-	2	0	C10orf76	103599608	1.000000	0.71417	0.972000	0.41901	0.963000	0.63663	9.266000	0.95659	2.764000	0.94973	0.555000	0.69702	ACG	G|1.000;A|0.000		0.587	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	NM_024541	
C6orf165	154313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	88128105	88128105	+	Missense_Mutation	SNP	C	C	A	rs140570931		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr6:88128105C>A	ENST00000507897.1	+	7	894	c.811C>A	c.(811-813)Caa>Aaa	p.Q271K	C6ORF165_ENST00000369562.4_Missense_Mutation_p.Q271K			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	271										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TAATATACGACAATATGAGGT	0.403																																					p.Q271K		.											.	C6orf165	90	0			c.C811A						.						98.0	105.0	103.0					6																	88128105		2203	4300	6503	SO:0001583	missense	154313	exon7			ATACGACAATATG	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.811C>A	6.37:g.88128105C>A	ENSP00000426769:p.Gln271Lys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	23.0	NM_001031743	A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	ENST00000507897.1	37	CCDS34498.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.897363	0.72639	.	.	ENSG00000213204	ENST00000369562	T	0.50277	0.75	5.16	5.16	0.70880	.	0.109289	0.64402	D	0.000005	T	0.64638	0.2616	M	0.80847	2.515	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.65573	0.936;0.936	T	0.66964	-0.5790	10	0.51188	T	0.08	.	18.607	0.91270	0.0:1.0:0.0:0.0	.	271;271	Q8IYR0;E1P509	CF165_HUMAN;.	K	271	ENSP00000358575:Q271K	ENSP00000358575:Q271K	Q	+	1	0	C6orf165	88184824	1.000000	0.71417	0.855000	0.33649	0.352000	0.29268	6.706000	0.74649	2.575000	0.86900	0.591000	0.81541	CAA	C|1.000;T|0.000		0.403	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000470406.1	NM_178823	
CABP5	56344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48543934	48543934	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:48543934G>C	ENST00000293255.2	-	3	296	c.166C>G	c.(166-168)Ctc>Gtc	p.L56V		NM_019855.4	NP_062829.1	Q9NP86	CABP5_HUMAN	calcium binding protein 5	56	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	11		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		GTCCTCATGAGATTCCCCAGA	0.517																																					p.L56V		.											.	CABP5	91	0			c.C166G						.						125.0	106.0	112.0					19																	48543934		2203	4300	6503	SO:0001583	missense	56344	exon3			TCATGAGATTCCC	AF169159	CCDS12709.1	19q13.33	2014-08-12			ENSG00000105507	ENSG00000105507		"""EF-hand domain containing"""	13714	protein-coding gene	gene with protein product		607315	"""calcium binding protein 3"""	CABP3		10625670	Standard	NM_019855		Approved	CaBP3	uc002phu.2	Q9NP86	OTTHUMG00000183139	ENST00000293255.2:c.166C>G	19.37:g.48543934G>C	ENSP00000293255:p.Leu56Val	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	240.0	30.0	NM_019855	A0AUY4	Missense_Mutation	SNP	ENST00000293255.2	37	CCDS12709.1	.	.	.	.	.	.	.	.	.	.	G	8.758	0.922908	0.18056	.	.	ENSG00000105507	ENST00000293255	T	0.64618	-0.11	4.4	4.4	0.53042	EF-hand-like domain (1);	0.000000	0.64402	D	0.000001	T	0.34077	0.0885	N	0.04508	-0.205	0.40675	D	0.982254	B	0.21071	0.051	B	0.29077	0.098	T	0.32613	-0.9900	10	0.02654	T	1	-17.8162	8.9843	0.35983	0.1046:0.0:0.8954:0.0	.	56	Q9NP86	CABP5_HUMAN	V	56	ENSP00000293255:L56V	ENSP00000293255:L56V	L	-	1	0	CABP5	53235746	0.947000	0.32204	1.000000	0.80357	0.994000	0.84299	0.921000	0.28718	2.403000	0.81681	0.549000	0.68633	CTC	.		0.517	CABP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465212.1	NM_019855	
CACNA1D	776	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	53845180	53845180	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr3:53845180C>T	ENST00000350061.5	+	48	6744	c.6233C>T	c.(6232-6234)cCa>cTa	p.P2078L	CACNA1D_ENST00000422281.2_Missense_Mutation_p.P2054L|CACNA1D_ENST00000544977.1_3'UTR|CACNA1D_ENST00000288139.4_Missense_Mutation_p.P2098L	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	2078					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCAAGGGACCCAAAATTTGTG	0.532																																					p.P2098L		.											.	CACNA1D	100	0			c.C6293T						.						109.0	102.0	105.0					3																	53845180		2203	4300	6503	SO:0001583	missense	776	exon49			GGGACCCAAAATT	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.6233C>T	3.37:g.53845180C>T	ENSP00000288133:p.Pro2078Leu	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	203.0	13.0	NM_000720	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	C	33	5.219502	0.95139	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.39	5.39	0.77823	.	0.340044	0.26334	N	0.024973	T	0.80929	0.4718	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.91635	0.999;0.974;0.997;0.999	T	0.82596	-0.0379	10	0.87932	D	0	.	19.5276	0.95213	0.0:1.0:0.0:0.0	.	2054;1771;2078;2098	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	L	2078;2098;2054;1771	ENSP00000288133:P2078L;ENSP00000288139:P2098L;ENSP00000409174:P2054L;ENSP00000418014:P1771L	ENSP00000288139:P2098L	P	+	2	0	CACNA1D	53820220	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.757000	0.85209	2.710000	0.92621	0.655000	0.94253	CCA	.		0.532	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
CAMTA1	23261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	7724692	7724692	+	Silent	SNP	G	G	T	rs567138522	byFrequency	TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:7724692G>T	ENST00000303635.7	+	9	2292	c.2085G>T	c.(2083-2085)tcG>tcT	p.S695S	CAMTA1_ENST00000439411.2_Silent_p.S695S	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	695					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TGGAGACCTCGCAGGCGGCGG	0.627			T	WWTR1	epitheliod hemangioendothelioma																																p.S695S		.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	520	0			c.G2085T						.						56.0	54.0	55.0					1																	7724692		2203	4300	6503	SO:0001819	synonymous_variant	23261	exon9			GACCTCGCAGGCG	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2085G>T	1.37:g.7724692G>T		Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	79.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	ENST00000303635.7	37	CCDS30576.1																																																																																			.		0.627	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	181700351	181700351	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:181700351C>A	ENST00000367573.2	+	19	2281	c.2281C>A	c.(2281-2283)Cca>Aca	p.P761T	CACNA1E_ENST00000526775.1_Intron|CACNA1E_ENST00000358338.5_Intron|CACNA1E_ENST00000367567.4_Missense_Mutation_p.P368T|CACNA1E_ENST00000360108.3_Intron|CACNA1E_ENST00000357570.5_Missense_Mutation_p.P712T|CACNA1E_ENST00000367570.1_Missense_Mutation_p.P761T	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	761					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GATGTGGGAGCCACGCAGCAG	0.517																																					p.P761T		.											.	CACNA1E	95	0			c.C2281A						.						166.0	186.0	180.0					1																	181700351		2171	4248	6419	SO:0001583	missense	777	exon19			TGGGAGCCACGCA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2281C>A	1.37:g.181700351C>A	ENSP00000356545:p.Pro761Thr	Somatic	282.0	0.0		WXS	Illumina HiSeq	Phase_I	404.0	75.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653682	0.47362	.	.	ENSG00000198216	ENST00000367570;ENST00000357570;ENST00000367567;ENST00000367573	D;D;D;D	0.96041	-3.8;-3.82;-3.89;-3.8	5.23	5.23	0.72850	.	1.451740	0.03413	N	0.205023	D	0.91523	0.7323	N	0.08118	0	0.37560	D	0.919042	P	0.50819	0.939	P	0.47206	0.541	T	0.81942	-0.0702	10	0.12103	T	0.63	.	11.8669	0.52499	0.0:0.919:0.0:0.081	.	761	Q15878-3	.	T	761;712;368;761	ENSP00000356542:P761T;ENSP00000350183:P712T;ENSP00000356539:P368T;ENSP00000356545:P761T	ENSP00000350183:P712T	P	+	1	0	CACNA1E	179966974	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	5.094000	0.64523	2.417000	0.82017	0.650000	0.86243	CCA	.		0.517	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CAPN6	827	hgsc.bcm.edu;bcgsc.ca	37	X	110497516	110497516	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chrX:110497516delT	ENST00000324068.1	-	3	448	c.281delA	c.(280-282)gagfs	p.E94fs	CAPN6_ENST00000541758.1_5'UTR	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	94	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						CCAATGAGACTCCTGAACAGC	0.453																																					p.E94fs		.											.	CAPN6	195	0			c.281delA						.						147.0	124.0	132.0					X																	110497516		2203	4300	6503	SO:0001589	frameshift_variant	827	exon3			TGAGACTCCTGAA	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.281delA	X.37:g.110497516delT	ENSP00000317214:p.Glu94fs	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	74.0	NM_014289	D3DUY7|Q9UEQ1|Q9UJA8	Frame_Shift_Del	DEL	ENST00000324068.1	37	CCDS14555.1																																																																																			.		0.453	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1		
CCDC108	255101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219874178	219874178	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr2:219874178G>A	ENST00000341552.5	-	28	4540	c.4457C>T	c.(4456-4458)tCt>tTt	p.S1486F	CCDC108_ENST00000441968.1_Missense_Mutation_p.S1486F|AC097468.4_ENST00000441450.1_RNA|CCDC108_ENST00000453220.1_Missense_Mutation_p.S1486F	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1486						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGACTCACAGACACCTGTTG	0.527																																					p.S1486F		.											.	CCDC108	94	0			c.C4457T						.						51.0	47.0	49.0					2																	219874178		2201	4296	6497	SO:0001583	missense	255101	exon28			CTCACAGACACCT	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.4457C>T	2.37:g.219874178G>A	ENSP00000340776:p.Ser1486Phe	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	36.0	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398867	0.62177	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.05925	3.37;3.37;3.37	5.43	3.51	0.40186	.	0.536026	0.15834	N	0.242372	T	0.10895	0.0266	L	0.54323	1.7	0.80722	D	1	D	0.62365	0.991	P	0.50970	0.655	T	0.04593	-1.0940	10	0.66056	D	0.02	-7.6728	6.1582	0.20350	0.0941:0.0:0.722:0.1838	.	1486	Q6ZU64	CC108_HUMAN	F	1486	ENSP00000340776:S1486F;ENSP00000413377:S1486F;ENSP00000409117:S1486F	ENSP00000340776:S1486F	S	-	2	0	CCDC108	219582422	0.327000	0.24678	0.995000	0.50966	0.895000	0.52256	1.555000	0.36277	1.306000	0.44926	0.555000	0.69702	TCT	.		0.527	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
CDH8	1006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	61687728	61687728	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr16:61687728C>G	ENST00000577390.1	-	12	3138	c.2184G>C	c.(2182-2184)agG>agC	p.R728S	CDH8_ENST00000299345.6_Intron|CDH8_ENST00000577730.1_Intron	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	728					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CCTCATGCAGCCTTACATTTA	0.483																																					p.R728S		.											.	CDH8	161	0			c.G2184C						.						88.0	92.0	91.0					16																	61687728		2203	4300	6503	SO:0001583	missense	1006	exon12			ATGCAGCCTTACA	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.2184G>C	16.37:g.61687728C>G	ENSP00000462701:p.Arg728Ser	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	8.0	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992335	0.54041	.	.	ENSG00000150394	ENST00000299345	.	.	.	5.7	4.75	0.60458	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	T	0.77545	0.4146	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79720	-0.1685	9	0.87932	D	0	.	13.1998	0.59761	0.0:0.9241:0.0:0.0759	.	728	P55286	CADH8_HUMAN	S	728	.	ENSP00000299345:R728S	R	-	3	2	CDH8	60245229	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.604000	0.46274	2.679000	0.91253	0.655000	0.94253	AGG	.		0.483	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
CFL2	1073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	35182517	35182517	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr14:35182517T>C	ENST00000341223.3	-	2	405	c.254A>G	c.(253-255)tAc>tGc	p.Y85C	CFL2_ENST00000556161.1_Missense_Mutation_p.Y68C|CFL2_ENST00000298159.6_Missense_Mutation_p.Y85C|CFL2_ENST00000555765.1_Missense_Mutation_p.Y68C	NM_001243645.1|NM_021914.7	NP_001230574.1|NP_068733.1	Q9Y281	COF2_HUMAN	cofilin 2 (muscle)	85	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament depolymerization (GO:0030042)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of actin filament depolymerization (GO:0030836)|regulation of dendritic spine morphogenesis (GO:0061001)|sarcomere organization (GO:0045214)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|nucleus (GO:0005634)				breast(3)|endometrium(2)|lung(3)	8	Breast(36;0.0361)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;6.07e-06)|Lung(238;2.23e-05)|Epithelial(34;0.0387)|all cancers(34;0.0814)	GBM - Glioblastoma multiforme(112;0.0424)		TGTGGCATCGTACAAAGCATA	0.378																																					p.Y85C		.											.	CFL2	289	0			c.A254G						.						106.0	102.0	104.0					14																	35182517		2203	4300	6503	SO:0001583	missense	1073	exon2			GCATCGTACAAAG	AF087867	CCDS9649.1, CCDS9650.1, CCDS58311.1	14q13.2	2014-09-17			ENSG00000165410	ENSG00000165410			1875	protein-coding gene	gene with protein product	"""nemaline myopathy type 7"""	601443				8800436	Standard	NM_138638		Approved	NEM7	uc001wsh.3	Q9Y281	OTTHUMG00000029536	ENST00000341223.3:c.254A>G	14.37:g.35182517T>C	ENSP00000340635:p.Tyr85Cys	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	62.0	NM_021914	G3V5P4	Missense_Mutation	SNP	ENST00000341223.3	37	CCDS9650.1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.451023	0.63290	.	.	ENSG00000165410	ENST00000341223;ENST00000298159;ENST00000555765;ENST00000556161	D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03	6.02	6.02	0.97574	Actin-binding, cofilin/tropomyosin type (3);	0.000000	0.85682	D	0.000000	D	0.95050	0.8397	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96435	0.9322	10	0.87932	D	0	-4.9599	16.5446	0.84426	0.0:0.0:0.0:1.0	.	85	Q9Y281	COF2_HUMAN	C	85;85;68;68	ENSP00000340635:Y85C;ENSP00000298159:Y85C;ENSP00000452451:Y68C;ENSP00000452188:Y68C	ENSP00000298159:Y85C	Y	-	2	0	CFL2	34252268	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.967000	0.87967	2.311000	0.77944	0.533000	0.62120	TAC	.		0.378	CFL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276639.1	NM_138638	
COG7	91949	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	23409377	23409377	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr16:23409377T>C	ENST00000307149.5	-	14	2062	c.1877A>G	c.(1876-1878)tAc>tGc	p.Y626C		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	626					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		GTTGCTGATGTACTCGAGAGG	0.502																																					p.Y626C		.											.	COG7	90	0			c.A1877G						.						156.0	126.0	136.0					16																	23409377		2197	4300	6497	SO:0001583	missense	91949	exon14			CTGATGTACTCGA	AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1877A>G	16.37:g.23409377T>C	ENSP00000305442:p.Tyr626Cys	Somatic	144.0	1.0		WXS	Illumina HiSeq	Phase_I	163.0	37.0	NM_153603	Q6UWU7	Missense_Mutation	SNP	ENST00000307149.5	37	CCDS10610.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.585348	0.86748	.	.	ENSG00000168434	ENST00000307149	T	0.59638	0.25	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.73473	0.3591	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.75895	-0.3156	10	0.62326	D	0.03	-20.4912	13.537	0.61652	0.0:0.0:0.0:1.0	.	626	P83436	COG7_HUMAN	C	626	ENSP00000305442:Y626C	ENSP00000305442:Y626C	Y	-	2	0	COG7	23316878	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.599000	0.82757	2.131000	0.65755	0.533000	0.62120	TAC	.		0.502	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211625.1		
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113519031	113519031	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr8:113519031G>T	ENST00000297405.5	-	29	5028	c.4784C>A	c.(4783-4785)tCt>tAt	p.S1595Y	CSMD3_ENST00000455883.2_Missense_Mutation_p.S1491Y|CSMD3_ENST00000343508.3_Missense_Mutation_p.S1555Y|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1595Y	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1595	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AAAGCCTGAAGATCCTGTTAA	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S1595Y		.											.	CSMD3	1132	0			c.C4784A						.						102.0	96.0	98.0					8																	113519031		2203	4300	6503	SO:0001583	missense	114788	exon29			CCTGAAGATCCTG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4784C>A	8.37:g.113519031G>T	ENSP00000297405:p.Ser1595Tyr	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	31.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954010	0.73902	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11	4.99	4.99	0.66335	CUB (5);	0.000000	0.64402	D	0.000001	T	0.42154	0.1190	L	0.52266	1.64	0.42082	D	0.991254	D;D;D	0.69078	0.997;0.997;0.985	D;D;P	0.71656	0.926;0.974;0.905	T	0.25882	-1.0119	10	0.62326	D	0.03	.	18.4644	0.90750	0.0:0.0:1.0:0.0	.	1491;1595;1555	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Y	1555;1595;935;1491;1595	ENSP00000345799:S1555Y;ENSP00000297405:S1595Y;ENSP00000341558:S935Y;ENSP00000412263:S1491Y;ENSP00000343124:S1595Y	ENSP00000297405:S1595Y	S	-	2	0	CSMD3	113588207	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.657000	0.98554	2.587000	0.87381	0.557000	0.71058	TCT	.		0.343	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CTNND1	1500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57577636	57577637	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:57577636_57577637GG>TT	ENST00000399050.4	+	16	3027_3028	c.2491_2492GG>TT	c.(2491-2493)GGa>TTa	p.G831L	CTNND1_ENST00000415361.2_Missense_Mutation_p.G730L|CTNND1_ENST00000526357.1_Missense_Mutation_p.G771L|CTNND1_ENST00000532463.1_Missense_Mutation_p.G724L|CTNND1_ENST00000526938.1_Missense_Mutation_p.G831L|CTNND1_ENST00000361332.4_Missense_Mutation_p.G825L|CTNND1_ENST00000358694.6_Missense_Mutation_p.G825L|CTNND1_ENST00000532787.1_Missense_Mutation_p.G724L|CTNND1_ENST00000527467.1_Missense_Mutation_p.G508L|CTNND1_ENST00000529873.1_Missense_Mutation_p.G771L|CTNND1_ENST00000530094.1_Missense_Mutation_p.G724L|CTNND1_ENST00000532844.1_Missense_Mutation_p.G777L|CTNND1_ENST00000534579.1_Missense_Mutation_p.G771L|CTNND1_ENST00000526772.1_Missense_Mutation_p.G502L|CTNND1_ENST00000524630.1_Missense_Mutation_p.G825L|CTNND1_ENST00000426142.2_Missense_Mutation_p.G724L|CTNND1_ENST00000360682.6_Missense_Mutation_p.G831L|CTNND1_ENST00000528232.1_Missense_Mutation_p.G730L|CTNND1_ENST00000361796.4_Missense_Mutation_p.G825L|CTNND1_ENST00000531014.1_Missense_Mutation_p.G502L|CTNND1_ENST00000529986.1_Missense_Mutation_p.G724L|CTNND1_ENST00000525902.1_Missense_Mutation_p.G508L|CTNND1_ENST00000529526.1_Missense_Mutation_p.G771L|CTNND1_ENST00000528621.1_Missense_Mutation_p.G771L|CTNND1_ENST00000428599.2_Missense_Mutation_p.G825L|CTNND1_ENST00000399039.4_Missense_Mutation_p.G831L|CTNND1_ENST00000530748.1_Missense_Mutation_p.G777L|CTNND1_ENST00000361391.6_Missense_Mutation_p.G825L|CTNND1_ENST00000529919.1_Missense_Mutation_p.G831L|CTNND1_ENST00000532245.1_Missense_Mutation_p.G724L|CTNND1_ENST00000533667.1_Missense_Mutation_p.G502L|CTNND1_ENST00000532649.1_Missense_Mutation_p.G771L	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	831					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				GACAATCTGGGGATATAAGGAA	0.386																																					p.G831X|p.G831V		.											.	CTNND1	272	0			c.G2491T|c.G2492T						.																																			SO:0001583	missense	1500	exon16			ATCTGGGGATATA|TCTGGGGATATAA	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		Exception_encountered	11.37:g.57577636_57577637delinsTT	ENSP00000382004:p.Gly831Leu	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	12.0	NM_001085458	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000399050.4	37	CCDS44604.1																																																																																			.		0.386	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331	
CYLC1	1538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	83128349	83128349	+	Silent	SNP	T	T	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chrX:83128349T>A	ENST00000329312.4	+	4	670	c.633T>A	c.(631-633)acT>acA	p.T211T		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	211					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AGACAAACACTGAATTCCTAC	0.313																																					p.T211T		.											.	CYLC1	112	0			c.T633A						.						25.0	24.0	24.0					X																	83128349		2191	4278	6469	SO:0001819	synonymous_variant	1538	exon4			AAACACTGAATTC	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.633T>A	X.37:g.83128349T>A		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	28.0	NM_021118	A0AVQ8|Q5JQQ9	Silent	SNP	ENST00000329312.4	37	CCDS35341.1																																																																																			.		0.313	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
CYP2A7	1549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41387953	41387953	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:41387953A>T	ENST00000301146.4	-	1	704	c.163T>A	c.(163-165)Tgt>Agt	p.C55S	CTC-490E21.12_ENST00000601627.1_Intron|CYP2A7_ENST00000291764.3_Missense_Mutation_p.C55S	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	55						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ATGGAGTCACATATGTGCTCT	0.592																																					p.C55S		.											.	CYP2A7	93	0			c.T163A						.						90.0	68.0	76.0					19																	41387953		2203	4300	6503	SO:0001583	missense	1549	exon1			AGTCACATATGTG	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.163T>A	19.37:g.41387953A>T	ENSP00000301146:p.Cys55Ser	Somatic	264.0	0.0		WXS	Illumina HiSeq	Phase_I	290.0	131.0	NM_000764	Q13121	Missense_Mutation	SNP	ENST00000301146.4	37	CCDS12569.1	.	.	.	.	.	.	.	.	.	.	A	5.616	0.298363	0.10622	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.11604	5.13;2.76	2.33	2.33	0.28932	.	0.372378	0.27358	U	0.019728	T	0.04679	0.0127	N	0.04746	-0.17	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.41875	-0.9484	10	0.21014	T	0.42	.	9.3499	0.38131	1.0:0.0:0.0:0.0	.	55;55	F8W816;P20853	.;CP2A7_HUMAN	S	55	ENSP00000301146:C55S;ENSP00000291764:C55S	ENSP00000291764:C55S	C	-	1	0	CYP2A7	46079793	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.930000	0.28858	1.072000	0.40860	0.155000	0.16302	TGT	.		0.592	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589	
CYP3A7	1551	ucsc.edu;bcgsc.ca	37	7	99314832	99314832	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr7:99314832T>G	ENST00000336374.2	-	6	491	c.489A>C	c.(487-489)gaA>gaC	p.E163D		NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	163					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	CTGTCTCTGCTTCCCGCCTCA	0.512																																					p.E163D		.											.	CYP3A7	91	0			c.A489C						.						157.0	140.0	145.0					7																	99314832		2203	4300	6503	SO:0001583	missense	1551	exon6			CTCTGCTTCCCGC	AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.489A>C	7.37:g.99314832T>G	ENSP00000337450:p.Glu163Asp	Somatic	275.0	2.0		WXS	Illumina HiSeq	.	267.0	75.0	NM_000765	A4D288|Q9H241	Missense_Mutation	SNP	ENST00000336374.2	37	CCDS5673.1	.	.	.	.	.	.	.	.	.	.	T	6.781	0.513100	0.12944	.	.	ENSG00000160870	ENST00000292414;ENST00000336374	T	0.69040	-0.37	3.98	0.151	0.14888	.	0.428616	0.27043	N	0.021206	T	0.61788	0.2375	M	0.77820	2.39	0.09310	N	1	B	0.20550	0.046	B	0.25405	0.06	T	0.54153	-0.8336	10	0.39692	T	0.17	.	6.938	0.24476	0.0:0.3148:0.0:0.6852	.	163	P24462	CP3A7_HUMAN	D	163	ENSP00000337450:E163D	ENSP00000292414:E163D	E	-	3	2	CYP3A7	99152768	0.009000	0.17119	0.009000	0.14445	0.157000	0.22087	0.589000	0.23939	-0.175000	0.10725	0.379000	0.24179	GAA	.		0.512	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345484.1		
DEFB110	245913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	49989618	49989618	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr6:49989618G>T	ENST00000371148.2	-	1	76	c.31C>A	c.(31-33)Cac>Aac	p.H11N	DEFB110_ENST00000393660.2_Missense_Mutation_p.H11N	NM_001037497.1	NP_001032586.1	Q30KQ9	DB110_HUMAN	defensin, beta 110 locus	11					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(1)|lung(1)|ovary(1)	3	Lung NSC(77;0.042)					ACCCAAAAGTGCAGAATAAAG	0.308																																					p.H11N		.											.	DEFB110	45	0			c.C31A						.						33.0	37.0	36.0					6																	49989618		2201	4296	6497	SO:0001583	missense	245913	exon1			AAAAGTGCAGAAT	DQ012014, BC148541	CCDS43473.1, CCDS34475.1	6p12.3	2010-11-26	2010-11-26		ENSG00000203970	ENSG00000203970		"""Defensins, beta"""	18091	protein-coding gene	gene with protein product			"""defensin, beta 110"""			11854508, 16033865	Standard	NM_001037728		Approved	DEFB-10, DEFB-11, DEFB111	uc003pac.3	Q30KQ9	OTTHUMG00000160208	ENST00000371148.2:c.31C>A	6.37:g.49989618G>T	ENSP00000360190:p.His11Asn	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	11.0	NM_001037728	Q30KR0	Missense_Mutation	SNP	ENST00000371148.2	37	CCDS34475.1	.	.	.	.	.	.	.	.	.	.	G	7.164	0.586354	0.13749	.	.	ENSG00000203970	ENST00000393660;ENST00000371148	T	0.17854	2.25	4.64	2.77	0.32553	.	0.190119	0.26173	N	0.025911	T	0.02727	0.0082	.	.	.	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.44907	-0.9297	8	.	.	.	-2.6558	6.6037	0.22714	0.0991:0.1808:0.7201:0.0	.	11;11	Q30KQ9-2;Q30KQ9	.;DB110_HUMAN	N	11	ENSP00000377270:H11N	.	H	-	1	0	DEFB110	50097577	1.000000	0.71417	0.958000	0.39756	0.109000	0.19521	2.418000	0.44662	0.631000	0.30412	0.467000	0.42956	CAC	.		0.308	DEFB110-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359664.1	NM_001037728	
DIMT1	27292	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	61690415	61690415	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr5:61690415G>C	ENST00000199320.4	-	7	626	c.466C>G	c.(466-468)Caa>Gaa	p.Q156E	DIMT1_ENST00000506390.1_Missense_Mutation_p.Q156E|KIF2A_ENST00000509663.2_Intron	NM_014473.2	NP_055288.1	Q9UNQ2	DIM1_HUMAN	DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)	156						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	18S rRNA (adenine(1779)-N(6)/adenine(1780)-N(6))-dimethyltransferase activity (GO:0052909)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)										AATTCTCTTTGAAACATAAGT	0.373																																					p.Q156E		.											.	.	.	0			c.C466G						.						94.0	93.0	94.0					5																	61690415		2203	4300	6503	SO:0001583	missense	27292	exon7			CTCTTTGAAACAT	AF102147	CCDS3981.1	5q12.1	2011-08-11	2011-08-11	2011-08-11	ENSG00000086189	ENSG00000086189			30217	protein-coding gene	gene with protein product		612499	"""DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)"""	DIMT1L		11124703	Standard	NM_014473		Approved	HSA9761	uc003jta.3	Q9UNQ2	OTTHUMG00000131223	ENST00000199320.4:c.466C>G	5.37:g.61690415G>C	ENSP00000199320:p.Gln156Glu	Somatic	227.0	1.0		WXS	Illumina HiSeq	Phase_I	232.0	44.0	NM_014473	O76025|Q9BU77|Q9UES1	Missense_Mutation	SNP	ENST00000199320.4	37	CCDS3981.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.542518	0.85917	.	.	ENSG00000086189	ENST00000199320;ENST00000506390	T;T	0.33865	1.39;1.39	5.11	5.11	0.69529	.	0.154508	0.64402	D	0.000015	T	0.71986	0.3405	H	0.96889	3.9	0.80722	D	1	D	0.65815	0.995	P	0.62014	0.897	T	0.82739	-0.0308	10	0.87932	D	0	-16.3856	18.732	0.91738	0.0:0.0:1.0:0.0	.	156	Q9UNQ2	DIM1_HUMAN	E	156	ENSP00000199320:Q156E;ENSP00000421754:Q156E	ENSP00000199320:Q156E	Q	-	1	0	DIMT1L	61726172	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.094000	0.94168	2.651000	0.90000	0.655000	0.94253	CAA	.		0.373	DIMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253967.1	NM_014473	
DNAJB1	3337	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	14629102	14629102	+	Silent	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:14629102G>A	ENST00000254322.2	-	1	130	c.60C>T	c.(58-60)atC>atT	p.I20I	DNAJB1_ENST00000396969.4_Intron	NM_006145.1	NP_006136.1	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	20	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				chaperone cofactor-dependent protein refolding (GO:0070389)|chaperone mediated protein folding requiring cofactor (GO:0051085)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(1328;0.0476)		AGGCCCGCTTGATCTCCTCGT	0.692																																					p.I20I		.											.	DNAJB1	650	0			c.C60T						.						38.0	31.0	33.0					19																	14629102		2202	4298	6500	SO:0001819	synonymous_variant	3337	exon1			CCGCTTGATCTCC	D49547	CCDS12312.1, CCDS74295.1	19p13.12	2014-08-12			ENSG00000132002	ENSG00000132002		"""Heat shock proteins / DNAJ (HSP40)"""	5270	protein-coding gene	gene with protein product	"""radial spoke 16 homolog B (Chlamydomonas)"""	604572		HSPF1		8975727, 8250930	Standard	XM_006722733		Approved	Hsp40, Sis1, RSPH16B	uc002myz.1	P25685	OTTHUMG00000183289	ENST00000254322.2:c.60C>T	19.37:g.14629102G>A		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	20.0	NM_006145	B4DX52	Silent	SNP	ENST00000254322.2	37	CCDS12312.1																																																																																			.		0.692	DNAJB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465987.1	NM_006145	
DYNC2H1	79659	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	102988459	102988459	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:102988459C>T	ENST00000375735.2	+	6	1010	c.866C>T	c.(865-867)tCa>tTa	p.S289L	DYNC2H1_ENST00000334267.7_Missense_Mutation_p.S289L|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.S289L	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	289	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GCTGGTATTTCAATTTGTGAA	0.388																																					p.S289L		.											.	DYNC2H1	68	0			c.C866T						.						105.0	101.0	102.0					11																	102988459		1870	4118	5988	SO:0001583	missense	79659	exon6			GTATTTCAATTTG	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.866C>T	11.37:g.102988459C>T	ENSP00000364887:p.Ser289Leu	Somatic	67.0	1.0		WXS	Illumina HiSeq	Phase_I	81.0	11.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.354084	0.41700	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093	T;T;T	0.56941	0.43;0.43;0.43	5.02	5.02	0.67125	Dynein heavy chain, domain-1 (1);	1.055580	0.07639	U	0.930041	T	0.43567	0.1253	L	0.27053	0.805	0.28786	N	0.899552	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.10450	0.003;0.005;0.003	T	0.22836	-1.0205	10	0.35671	T	0.21	.	12.2535	0.54611	0.0:0.9111:0.0:0.0889	.	289;289;289	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	L	289	ENSP00000364887:S289L;ENSP00000334021:S289L;ENSP00000381167:S289L	ENSP00000334021:S289L	S	+	2	0	DYNC2H1	102493669	0.918000	0.31147	1.000000	0.80357	0.977000	0.68977	2.957000	0.49137	2.322000	0.78497	0.650000	0.86243	TCA	.		0.388	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
EBF1	1879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	158139190	158139190	+	Silent	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr5:158139190G>A	ENST00000313708.6	-	14	1803	c.1521C>T	c.(1519-1521)aaC>aaT	p.N507N	EBF1_ENST00000380654.4_Silent_p.N476N|EBF1_ENST00000517373.1_Intron|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	507	Pro/Ser/Thr-rich.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGCTGAGCCGTTGAGGAAGG	0.562			T	HMGA2	lipoma																																p.N507N		.		Dom	yes		5	5q34	1879	early B-cell factor 1		M	.	EBF1	92	0			c.C1521T						.						73.0	56.0	62.0					5																	158139190		2203	4300	6503	SO:0001819	synonymous_variant	1879	exon14			TGAGCCGTTGAGG	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1521C>T	5.37:g.158139190G>A		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	25.0	NM_024007	Q8IW11	Silent	SNP	ENST00000313708.6	37	CCDS4343.1																																																																																			.		0.562	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007	
ECE2	9718	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	184008634	184008634	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr3:184008634C>A	ENST00000402825.3	+	16	2174	c.2174C>A	c.(2173-2175)gCc>gAc	p.A725D	EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000359140.4_Missense_Mutation_p.A578D|ECE2_ENST00000357474.5_Missense_Mutation_p.A653D|ECE2_ENST00000404464.3_Missense_Mutation_p.A607D	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	725	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TTGACGCATGCCTTTGATGAC	0.587																																					p.A725D		.											.	ECE2	94	0			c.C2174A						.						108.0	102.0	104.0					3																	184008634		2203	4300	6503	SO:0001583	missense	9718	exon16			CGCATGCCTTTGA	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.2174C>A	3.37:g.184008634C>A	ENSP00000384223:p.Ala725Asp	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	7.0	NM_014693	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534659	0.85812	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07;-2.07	5.38	5.38	0.77491	Peptidase M13, neprilysin, C-terminal (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95427	0.8515	H	0.97214	3.96	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.966;1.0;1.0;1.0	D	0.97041	0.9757	10	0.87932	D	0	-20.1971	17.6892	0.88265	0.0:1.0:0.0:0.0	.	327;578;596;607;653;578;725	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	D	725;578;607;653;599	ENSP00000384223:A725D;ENSP00000352052:A578D;ENSP00000385846:A607D;ENSP00000350066:A653D;ENSP00000398444:A599D	ENSP00000350066:A653D	A	+	2	0	ECE2	185491328	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.484000	0.81180	2.494000	0.84150	0.561000	0.74099	GCC	.		0.587	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
EFCAB3	146779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	60493468	60493468	+	Silent	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:60493468C>T	ENST00000305286.3	+	10	1173	c.1095C>T	c.(1093-1095)gaC>gaT	p.D365D	EFCAB3_ENST00000450662.2_Silent_p.D417D	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	365							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			TTGGGATGGACTCTAGAAATG	0.398																																					p.D417D		.											.	EFCAB3	227	0			c.C1251T						.						116.0	117.0	117.0					17																	60493468		2203	4300	6503	SO:0001819	synonymous_variant	146779	exon12			GATGGACTCTAGA	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.1095C>T	17.37:g.60493468C>T		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	190.0	44.0	NM_001144933	J3KQM8	Silent	SNP	ENST00000305286.3	37	CCDS11632.1																																																																																			.		0.398	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379114.1	NM_173503	
EIF2B2	8892	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	75471535	75471535	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr14:75471535T>G	ENST00000266126.5	+	4	609	c.529T>G	c.(529-531)Ttc>Gtc	p.F177V	RP11-950C14.3_ENST00000554430.1_RNA	NM_014239.3	NP_055054.1	P49770	EI2BB_HUMAN	eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa	177					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|central nervous system development (GO:0007417)|gene expression (GO:0010467)|myelination (GO:0042552)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.00661)		AGTAGAGGCCTTCCTCAAAGA	0.498																																					p.F177V		.											.	EIF2B2	91	0			c.T529G	GRCh37	CD067166	EIF2B2	D		.						87.0	86.0	86.0					14																	75471535		2203	4300	6503	SO:0001583	missense	8892	exon4			GAGGCCTTCCTCA		CCDS9836.1	14q24.3	2008-08-11	2002-08-29			ENSG00000119718			3258	protein-coding gene	gene with protein product		606454	"""eukaryotic translation initiation factor 2B, subunit 2 (beta, 39kD)"""			8887689	Standard	NM_014239		Approved	EIF2B, EIF-2Bbeta	uc001xrc.2	P49770		ENST00000266126.5:c.529T>G	14.37:g.75471535T>G	ENSP00000266126:p.Phe177Val	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	21.0	NM_014239	O43201	Missense_Mutation	SNP	ENST00000266126.5	37	CCDS9836.1	.	.	.	.	.	.	.	.	.	.	T	32	5.165451	0.94768	.	.	ENSG00000119718	ENST00000266126	D	0.90504	-2.68	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.95771	0.8624	M	0.86343	2.81	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.96412	0.9305	10	0.87932	D	0	-29.0445	15.827	0.78718	0.0:0.0:0.0:1.0	.	177	P49770	EI2BB_HUMAN	V	177	ENSP00000266126:F177V	ENSP00000266126:F177V	F	+	1	0	EIF2B2	74541288	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.805000	0.86005	2.324000	0.78689	0.533000	0.62120	TTC	.		0.498	EIF2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414993.1	NM_014239	
FBLN1	2192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	45939311	45939311	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr22:45939311G>A	ENST00000327858.6	+	11	1321	c.1226G>A	c.(1225-1227)cGc>cAc	p.R409H	FBLN1_ENST00000442170.2_Missense_Mutation_p.R409H|FBLN1_ENST00000348697.2_Missense_Mutation_p.R409H|FBLN1_ENST00000402984.3_Missense_Mutation_p.R447H|FBLN1_ENST00000476366.1_3'UTR|FBLN1_ENST00000262722.7_Missense_Mutation_p.R409H|FBLN1_ENST00000340923.5_Missense_Mutation_p.R409H	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	409	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.|Self-association and FN1-binding; calcium is necessary for homotypic binding, but not for heterotypic binding.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TACCCCGGGCGCCTGTGTGGC	0.607																																					p.R409H		.											.	FBLN1	515	0			c.G1226A						.						59.0	51.0	54.0					22																	45939311		2203	4300	6503	SO:0001583	missense	2192	exon11			CCGGGCGCCTGTG		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1226G>A	22.37:g.45939311G>A	ENSP00000331544:p.Arg409His	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	24.0	NM_006487	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551577	0.65311	.	.	ENSG00000077942	ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923	D;D;D;D;D;D	0.86030	-1.63;-2.06;-1.93;-1.75;-1.7;-1.61	5.13	5.13	0.70059	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.70228	0.3200	N	0.03917	-0.325	0.80722	D	1	P;B;B;P	0.41214	0.742;0.269;0.362;0.727	B;B;B;B	0.35353	0.139;0.042;0.091;0.201	T	0.77422	-0.2594	10	0.54805	T	0.06	.	18.5383	0.91018	0.0:0.0:1.0:0.0	.	447;409;409;409	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	H	409;447;409;409;409;409	ENSP00000262723:R409H;ENSP00000385521:R447H;ENSP00000262722:R409H;ENSP00000331544:R409H;ENSP00000393812:R409H;ENSP00000342212:R409H	ENSP00000262722:R409H	R	+	2	0	FBLN1	44317975	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	6.455000	0.73497	2.539000	0.85634	0.563000	0.77884	CGC	.		0.607	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127705012	127705012	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr5:127705012C>A	ENST00000508053.1	-	22	3085	c.2111G>T	c.(2110-2112)aGt>aTt	p.S704I	Y_RNA_ENST00000384560.1_RNA|FBN2_ENST00000262464.4_Missense_Mutation_p.S704I|FBN2_ENST00000511489.1_5'UTR|FBN2_ENST00000508989.1_Missense_Mutation_p.S671I			P35556	FBN2_HUMAN	fibrillin 2	704	TB 3.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ATAGCAGGTACTGCGCATGTG	0.453																																					p.S704I		.											.	FBN2	146	0			c.G2111T						.						138.0	106.0	117.0					5																	127705012		2203	4300	6503	SO:0001583	missense	2201	exon16			CAGGTACTGCGCA	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2111G>T	5.37:g.127705012C>A	ENSP00000424571:p.Ser704Ile	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	17.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921631	0.73213	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.92299	-3.01;-3.01;-2.87	4.35	4.35	0.52113	Matrix fibril-associated (2);TGF-beta binding (1);	0.063358	0.64402	D	0.000014	D	0.94785	0.8316	M	0.76328	2.33	0.53005	D	0.999962	D;P	0.62365	0.991;0.845	P;B	0.57152	0.814;0.273	D	0.95075	0.8208	10	0.62326	D	0.03	.	18.1762	0.89762	0.0:1.0:0.0:0.0	.	671;704	D6RJI3;P35556	.;FBN2_HUMAN	I	704;704;671	ENSP00000262464:S704I;ENSP00000424571:S704I;ENSP00000425596:S671I	ENSP00000262464:S704I	S	-	2	0	FBN2	127732911	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.555000	0.45854	2.707000	0.92482	0.655000	0.94253	AGT	.		0.453	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FCRL1	115350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	157771741	157771741	+	Missense_Mutation	SNP	C	C	T	rs200955967		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:157771741C>T	ENST00000368176.3	-	5	917	c.850G>A	c.(850-852)Gcc>Acc	p.A284T	FCRL1_ENST00000491942.1_Missense_Mutation_p.A284T|FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000358292.3_Missense_Mutation_p.A284T	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	284	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CTGCGCTGGGCCCCCAGGCCA	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		20161	0.0		0.001	False		,,,				2504	0.0				p.A284T	GBM(54;482 1003 11223 30131 35730)	.											.	FCRL1	153	0			c.G850A						.						79.0	83.0	82.0					1																	157771741		2203	4300	6503	SO:0001583	missense	115350	exon5			GCTGGGCCCCCAG	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.850G>A	1.37:g.157771741C>T	ENSP00000357158:p.Ala284Thr	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	306.0	35.0	NM_001159397	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	37	CCDS1170.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.65	2.894895	0.52121	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.03181	4.02;4.02;4.02	5.1	2.11	0.27256	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.520850	0.03430	N	0.207609	T	0.04092	0.0114	L	0.45352	1.415	0.09310	N	1	P;D;D	0.62365	0.753;0.991;0.976	B;P;P	0.62649	0.381;0.905;0.703	T	0.41016	-0.9532	10	0.35671	T	0.21	.	7.4085	0.27004	0.0:0.5899:0.3218:0.0883	.	284;284;284	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	T	284	ENSP00000351039:A284T;ENSP00000357158:A284T;ENSP00000418130:A284T	ENSP00000351039:A284T	A	-	1	0	FCRL1	156038365	0.000000	0.05858	0.002000	0.10522	0.873000	0.50193	-0.555000	0.05999	0.379000	0.24794	0.650000	0.86243	GCC	C|0.999;T|0.000		0.562	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938	
FLII	2314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	18154288	18154288	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:18154288T>C	ENST00000327031.4	-	14	1865	c.1640A>G	c.(1639-1641)tAc>tGc	p.Y547C	FLII_ENST00000379450.4_Missense_Mutation_p.Y461C|FLII_ENST00000578558.1_Missense_Mutation_p.Y546C|FLII_ENST00000584444.1_5'Flank|FLII_ENST00000545457.2_Missense_Mutation_p.Y492C|FLII_ENST00000579294.1_Missense_Mutation_p.Y536C	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	547	Interaction with ACTL6A.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					GCCAATCCAGTAGTAGATCTC	0.602																																					p.Y547C		.											.	FLII	91	0			c.A1640G						.						67.0	69.0	68.0					17																	18154288		2203	4300	6503	SO:0001583	missense	2314	exon14			ATCCAGTAGTAGA	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.1640A>G	17.37:g.18154288T>C	ENSP00000324573:p.Tyr547Cys	Somatic	223.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	26.0	NM_002018	B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	ENST00000327031.4	37	CCDS11192.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.739550	0.89573	.	.	ENSG00000177731	ENST00000327031;ENST00000545457;ENST00000379450	T;T	0.56103	0.48;0.48	5.91	5.91	0.95273	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	T	0.75451	0.3851	M	0.83384	2.64	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.979;0.979;0.994;0.992;0.999	T	0.79408	-0.1816	10	0.87932	D	0	-34.5379	16.3436	0.83110	0.0:0.0:0.0:1.0	.	461;461;547;547;516	E7EPM0;B4DIL0;F5H407;Q13045;B4DIX0	.;.;.;FLII_HUMAN;.	C	547;547;461	ENSP00000324573:Y547C;ENSP00000368763:Y461C	ENSP00000324573:Y547C	Y	-	2	0	FLII	18095013	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.706000	0.84615	2.269000	0.75478	0.533000	0.62120	TAC	.		0.602	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018	
FOLR3	2352	ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71847151	71847151	+	Silent	SNP	C	C	T	rs151190708	byFrequency	TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:71847151C>T	ENST00000445078.2	+	2	218	c.147C>T	c.(145-147)gaC>gaT	p.D49D	FOLR3_ENST00000442948.2_Silent_p.D51D|FOLR3_ENST00000456237.1_Silent_p.D51D			P41439	FOLR3_HUMAN	folate receptor 3 (gamma)	49					folic acid transport (GO:0015884)	extracellular region (GO:0005576)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	folic acid binding (GO:0005542)			large_intestine(3)|lung(8)|prostate(2)	13					Folic Acid(DB00158)	GCCCCGAGGACGAGCTGTATG	0.637													c|||	114	0.0227636	0.0825	0.0072	5008	,	,		21917	0.0		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			.						.	T		279,4121		12,255,1933	92.0	95.0	94.0		153	-1.6	0.0	11	dbSNP_134	94	1,8585		0,1,4292	no	coding-synonymous	FOLR3	NM_000804.2		12,256,6225	TT,TC,CC		0.0116,6.3409,2.1562		51/246	71847151	280,12706	2200	4293	6493	SO:0001819	synonymous_variant	2352	.			CGAGGACGAGCTG	U08471	CCDS73344.1	11q13.4	2012-11-14			ENSG00000110203	ENSG00000110203			3795	protein-coding gene	gene with protein product		602469				8110752	Standard	NM_000804		Approved	FR-G	uc001orx.1	P41439	OTTHUMG00000167870	ENST00000445078.2:c.147C>T	11.37:g.71847151C>T		Somatic	302.0	0.0		WXS	Illumina HiSeq	.	377.0	102.0	.	J3KQ90|Q05C14	Silent	SNP	ENST00000445078.2	37																																																																																				C|0.979;T|0.021		0.637	FOLR3-001	NOVEL	upstream_ATG|basic	protein_coding	protein_coding	OTTHUMT00000396739.1	NM_000804	
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	79398969	79398969	+	Splice_Site	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr4:79398969G>A	ENST00000264895.6	+	55	8292	c.7852G>A	c.(7852-7854)Gtc>Atc	p.V2618I		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2614	Calx-beta 1.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TTTGTGACAGGTCCAGTTTGA	0.498																																					p.V2618I		.											.	FRAS1	68	0			c.G7852A						.						67.0	62.0	63.0					4																	79398969		2062	4206	6268	SO:0001630	splice_region_variant	80144	exon55			TGACAGGTCCAGT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7852-1G>A	4.37:g.79398969G>A		Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	207.0	110.0	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.957404|3.957404	0.73902|0.73902	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000512123|ENST00000264895	.|T	.|0.31769	.|1.48	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49270|0.49270	0.1547|0.1547	L|L	0.39633|0.39633	1.23|1.23	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.18650|0.18650	-1.0330|-1.0330	5|9	.|.	.|.	.|.	.|.	20.181|20.181	0.98201|0.98201	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2618	.|E9PHH6	.|.	D|I	846|2618	.|ENSP00000264895:V2618I	.|.	G|V	+|+	2|1	0|0	FRAS1|FRAS1	79617993|79617993	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.479000|0.479000	0.33129|0.33129	9.278000|9.278000	0.95766|0.95766	2.840000|2.840000	0.97914|0.97914	0.655000|0.655000	0.94253|0.94253	GGT|GTC	.		0.498	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Missense_Mutation
FSCB	84075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	44975318	44975318	+	Silent	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr14:44975318G>T	ENST00000340446.4	-	1	1164	c.873C>A	c.(871-873)gtC>gtA	p.V291V	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	291						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GCTGTACTTGGACATGGGTCT	0.512																																					p.V291V		.											.	FSCB	587	0			c.C873A						.						54.0	54.0	54.0					14																	44975318		2203	4300	6503	SO:0001819	synonymous_variant	84075	exon1			TACTTGGACATGG	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.873C>A	14.37:g.44975318G>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	5.0	NM_032135	Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	ENST00000340446.4	37	CCDS9679.1																																																																																			.		0.512	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135	
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	120602471	120602471	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr12:120602471C>A	ENST00000300648.6	-	17	1679	c.1667G>T	c.(1666-1668)aGa>aTa	p.R556I		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	556					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCCAGTGAGTCTATGCGGGTG	0.473																																					p.R556I		.											.	GCN1L1	94	0			c.G1667T						.						140.0	141.0	141.0					12																	120602471		1986	4147	6133	SO:0001583	missense	10985	exon17			GTGAGTCTATGCG	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.1667G>T	12.37:g.120602471C>A	ENSP00000300648:p.Arg556Ile	Somatic	193.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	13.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998322	0.93227	.	.	ENSG00000089154	ENST00000300648	T	0.04603	3.59	5.83	5.83	0.93111	Domain of unknown function DUF3554 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.19644	0.0472	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.68353	0.957	T	0.00013	-1.2414	10	0.51188	T	0.08	.	20.1184	0.97949	0.0:1.0:0.0:0.0	.	556	Q92616	GCN1L_HUMAN	I	556	ENSP00000300648:R556I	ENSP00000300648:R556I	R	-	2	0	GCN1L1	119086854	1.000000	0.71417	0.968000	0.41197	0.968000	0.65278	6.304000	0.72800	2.769000	0.95229	0.655000	0.94253	AGA	.		0.473	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
GDF2	2658	ucsc.edu;bcgsc.ca;mdanderson.org	37	10	48413956	48413956	+	Silent	SNP	C	C	T	rs201627211		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr10:48413956C>T	ENST00000249598.1	-	2	1071	c.912G>A	c.(910-912)acG>acA	p.T304T		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	304					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CGTGGCCATCCGTGTCCTCCT	0.607																																					p.T304T		.											.	GDF2	229	0			c.G912A						.						78.0	66.0	70.0					10																	48413956		2203	4300	6503	SO:0001819	synonymous_variant	2658	exon2			GCCATCCGTGTCC	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.912G>A	10.37:g.48413956C>T		Somatic	142.0	2.0		WXS	Illumina HiSeq	.	104.0	21.0	NM_016204	Q5VSQ9|Q9Y571	Silent	SNP	ENST00000249598.1	37	CCDS7219.1																																																																																			C|0.999;T|0.001		0.607	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204	
GPR179	440435	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	36485933	36485933	+	Silent	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:36485933G>A	ENST00000342292.4	-	11	3539	c.3519C>T	c.(3517-3519)agC>agT	p.S1173S	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1173					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTTGTTCCCTGCTGCCCTCCC	0.567																																					p.S1173S		.											.	GPR179	93	0			c.C3519T						.						196.0	200.0	199.0					17																	36485933		2134	4233	6367	SO:0001819	synonymous_variant	440435	exon11			TTCCCTGCTGCCC		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.3519C>T	17.37:g.36485933G>A		Somatic	151.0	1.0		WXS	Illumina HiSeq	Phase_I	182.0	42.0	NM_001004334		Silent	SNP	ENST00000342292.4	37	CCDS42308.1																																																																																			.		0.567	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
GPRIN3	285513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	90170573	90170573	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr4:90170573G>T	ENST00000609438.1	-	2	1207	c.689C>A	c.(688-690)tCt>tAt	p.S230Y	GPRIN3_ENST00000333209.4_Missense_Mutation_p.S230Y	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	230										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CCTCATTTCAGAGTCACAGAT	0.547																																					p.S230Y		.											.	GPRIN3	71	0			c.C689A						.						49.0	53.0	52.0					4																	90170573		2203	4300	6503	SO:0001583	missense	285513	exon2			ATTTCAGAGTCAC	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.689C>A	4.37:g.90170573G>T	ENSP00000476603:p.Ser230Tyr	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	20.0	NM_198281	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014707	0.35511	.	.	ENSG00000185477	ENST00000333209	T	0.11604	2.76	5.15	2.39	0.29439	.	0.838313	0.09746	N	0.761294	T	0.12135	0.0295	N	0.19112	0.55	0.09310	N	1	P	0.40875	0.731	P	0.49752	0.621	T	0.34925	-0.9809	10	0.45353	T	0.12	-3.2931	8.0316	0.30467	0.1495:0.1335:0.717:0.0	.	230	Q6ZVF9	GRIN3_HUMAN	Y	230	ENSP00000328672:S230Y	ENSP00000328672:S230Y	S	-	2	0	GPRIN3	90389596	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	0.794000	0.26958	0.802000	0.34089	0.650000	0.86243	TCT	.		0.547	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
HDAC9	9734	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	18767353	18767353	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr7:18767353C>A	ENST00000432645.2	+	12	1873	c.1873C>A	c.(1873-1875)Cgc>Agc	p.R625S	HDAC9_ENST00000441542.2_Missense_Mutation_p.R628S|HDAC9_ENST00000406451.4_Missense_Mutation_p.R625S|HDAC9_ENST00000401921.1_Missense_Mutation_p.R584S	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	625					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	AGCAATGGACCGCCCCCTCCA	0.527																																					p.R628S		.											.	HDAC9	227	0			c.C1882A						.						41.0	46.0	44.0					7																	18767353		1988	4143	6131	SO:0001583	missense	9734	exon12			ATGGACCGCCCCC	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1873C>A	7.37:g.18767353C>A	ENSP00000410337:p.Arg625Ser	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	284.0	18.0	NM_178425	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	C	5.499	0.276989	0.10403	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.57107	0.43;0.42;0.42;0.43	4.87	1.44	0.22558	.	0.387462	0.22358	N	0.061105	T	0.35537	0.0935	L	0.36672	1.1	0.80722	D	1	B;B;B;B;B;B;B	0.19817	0.001;0.01;0.034;0.01;0.02;0.01;0.039	B;B;B;B;B;B;B	0.17979	0.003;0.01;0.018;0.018;0.008;0.018;0.02	T	0.10337	-1.0634	10	0.09338	T	0.73	-24.6513	9.38	0.38306	0.0:0.7311:0.0:0.2689	.	625;537;584;628;625;625;603	Q9UKV0-4;Q9UKV0-2;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;.;HDAC9_HUMAN;.;.	S	625;584;625;628;537	ENSP00000384657:R625S;ENSP00000383912:R584S;ENSP00000410337:R625S;ENSP00000408617:R628S	ENSP00000339165:R537S	R	+	1	0	HDAC9	18733878	1.000000	0.71417	0.829000	0.32907	0.991000	0.79684	1.096000	0.30976	0.150000	0.19136	0.557000	0.71058	CGC	.		0.527	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
HORMAD1	84072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150680868	150680868	+	Silent	SNP	G	G	A	rs368484414		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:150680868G>A	ENST00000361824.2	-	9	516	c.411C>T	c.(409-411)aaC>aaT	p.N137N	HORMAD1_ENST00000368993.2_Silent_p.N137N|HORMAD1_ENST00000368995.4_Silent_p.N57N|HORMAD1_ENST00000322343.7_Silent_p.N130N	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	137	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TGCTAGATTCGTTGCTTTGGT	0.323																																					p.N137N		.											.	HORMAD1	92	0			c.C411T						.	G	,	0,4406		0,0,2203	99.0	92.0	94.0		390,411	-2.7	0.0	1		94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	HORMAD1	NM_001199829.1,NM_032132.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	130/388,137/395	150680868	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84072	exon9			AGATTCGTTGCTT	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.411C>T	1.37:g.150680868G>A		Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	21.0	NM_032132	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Silent	SNP	ENST00000361824.2	37	CCDS967.1																																																																																			.		0.323	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084722.1	NM_032132	
HSPA12B	116835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3728929	3728929	+	Silent	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr20:3728929G>A	ENST00000254963.2	+	8	886	c.741G>A	c.(739-741)tcG>tcA	p.S247S	HSPA12B_ENST00000542646.1_Silent_p.S81S	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	247							ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						AGGCCGCCTCGGTATACTGCC	0.682																																					p.S247S		.											.	HSPA12B	226	0			c.G741A						.						57.0	53.0	55.0					20																	3728929		2203	4300	6503	SO:0001819	synonymous_variant	116835	exon8			CGCCTCGGTATAC	AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.741G>A	20.37:g.3728929G>A		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	17.0	NM_052970	D3DVX7|Q2TAK3|Q9BR52	Silent	SNP	ENST00000254963.2	37	CCDS13061.1																																																																																			.		0.682	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077756.2	NM_052970	
IKZF3	22806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37922298	37922298	+	Silent	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:37922298G>A	ENST00000346872.3	-	8	1336	c.1275C>T	c.(1273-1275)taC>taT	p.Y425Y	IKZF3_ENST00000350532.3_Silent_p.Y386Y|IKZF3_ENST00000377958.2_Silent_p.Y338Y|IKZF3_ENST00000583368.1_Silent_p.Y178Y|IKZF3_ENST00000346243.3_Silent_p.Y347Y|IKZF3_ENST00000535189.1_Silent_p.Y391Y|IKZF3_ENST00000377945.3_Silent_p.Y291Y|IKZF3_ENST00000377944.3_Silent_p.Y282Y|IKZF3_ENST00000467757.1_Silent_p.Y369Y|IKZF3_ENST00000439167.2_Silent_p.Y352Y|IKZF3_ENST00000439016.2_Silent_p.Y330Y|IKZF3_ENST00000351680.3_Silent_p.Y386Y|RP11-94L15.2_ENST00000488188.2_lincRNA|IKZF3_ENST00000377952.2_Silent_p.Y204Y|IKZF3_ENST00000394189.2_Silent_p.Y243Y	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	425					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGAGGAGTTCGTAAGAGCGGG	0.552																																					p.Y425Y		.											.	IKZF3	971	0			c.C1275T						.						146.0	142.0	143.0					17																	37922298		2203	4300	6503	SO:0001819	synonymous_variant	22806	exon8			GAGTTCGTAAGAG	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.1275C>T	17.37:g.37922298G>A		Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	27.0	NM_012481	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Silent	SNP	ENST00000346872.3	37	CCDS11346.1	.	.	.	.	.	.	.	.	.	.	G	5.978	0.364475	0.11296	.	.	ENSG00000161405	ENST00000439167;ENST00000439016	.	.	.	5.72	-2.11	0.07187	.	.	.	.	.	T	0.63165	0.2488	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60525	-0.7246	4	.	.	.	-11.5725	12.7773	0.57455	0.5173:0.0:0.4827:0.0	.	.	.	.	M	340;379	.	.	T	-	2	0	IKZF3	35175824	0.288000	0.24324	0.970000	0.41538	0.920000	0.55202	-0.286000	0.08399	-0.393000	0.07739	-1.105000	0.02106	ACG	.		0.552	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481	
INCENP	3619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	61912532	61912532	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:61912532G>A	ENST00000394818.3	+	12	1886	c.1684G>A	c.(1684-1686)Gac>Aac	p.D562N	INCENP_ENST00000278849.4_Missense_Mutation_p.D558N	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	562					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GGTGGAGGAGGACAAGCGGCG	0.672																																					p.D562N		.											.	INCENP	227	0			c.G1684A						.						45.0	44.0	44.0					11																	61912532		2202	4299	6501	SO:0001583	missense	3619	exon12			GAGGAGGACAAGC	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.1684G>A	11.37:g.61912532G>A	ENSP00000378295:p.Asp562Asn	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	49.0	NM_001040694	A8MQD2|Q5Y192	Missense_Mutation	SNP	ENST00000394818.3	37	CCDS44624.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473169	0.84640	.	.	ENSG00000149503	ENST00000394818;ENST00000278849	T;T	0.43294	0.95;0.95	5.93	5.93	0.95920	.	0.204219	0.34555	N	0.003880	T	0.58538	0.2129	L	0.60455	1.87	0.39734	D	0.971641	D;D;D	0.65815	0.995;0.992;0.986	P;P;P	0.59357	0.722;0.856;0.722	T	0.57124	-0.7865	10	0.48119	T	0.1	.	17.8376	0.88704	0.0:0.0:1.0:0.0	.	558;558;562	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	N	562;558	ENSP00000378295:D562N;ENSP00000278849:D558N	ENSP00000278849:D558N	D	+	1	0	INCENP	61669108	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.557000	0.67313	2.815000	0.96918	0.561000	0.74099	GAC	.		0.672	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
INHBE	83729	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	57849890	57849890	+	Silent	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr12:57849890C>T	ENST00000266646.2	+	2	528	c.312C>T	c.(310-312)gcC>gcT	p.A104A	INHBE_ENST00000551553.1_3'UTR	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	104					growth (GO:0040007)	extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						CCACTTCAGCCTACAGCTCCC	0.582											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A104A	GBM(191;1808 2166 15720 36624 50371)	.											.	INHBE	577	0			c.C312T						.						207.0	209.0	208.0					12																	57849890		2203	4300	6503	SO:0001819	synonymous_variant	83729	exon2			TTCAGCCTACAGC		CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.312C>T	12.37:g.57849890C>T		Somatic	69.0	0.0	1026	WXS	Illumina HiSeq	Phase_I	98.0	6.0	NM_031479		Silent	SNP	ENST00000266646.2	37	CCDS8939.1																																																																																			.		0.582	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406773.1	NM_031479	
ITGAD	3681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31419146	31419146	+	Silent	SNP	G	G	A	rs141660381		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr16:31419146G>A	ENST00000389202.2	+	9	967	c.918G>A	c.(916-918)gcG>gcA	p.A306A		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	306	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TCAGCTCAGCGCCTCCGCAGG	0.582																																					p.A306A		.											.	ITGAD	226	0			c.G918A						.	G		0,4394		0,0,2197	58.0	54.0	56.0		918	-3.6	0.0	16	dbSNP_134	56	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	ITGAD	NM_005353.2		0,5,6492	AA,AG,GG		0.0581,0.0,0.0385		306/1162	31419146	5,12989	2197	4300	6497	SO:0001819	synonymous_variant	3681	exon9			CTCAGCGCCTCCG	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.918G>A	16.37:g.31419146G>A		Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	33.0	NM_005353	Q15575|Q15576	Silent	SNP	ENST00000389202.2	37	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	g	7.901	0.734461	0.15574	0.0	5.81E-4	ENSG00000156886	ENST00000316569	.	.	.	5.01	-3.62	0.04543	.	.	.	.	.	T	0.19366	0.0465	.	.	.	0.19300	N	0.999975	B	0.21147	0.052	B	0.11329	0.006	T	0.33599	-0.9862	7	0.87932	D	0	.	0.5817	0.00713	0.2558:0.1337:0.1902:0.4203	.	339	B7Z6V7	.	T	203	.	ENSP00000323325:A203T	A	+	1	0	ITGAD	31326647	0.000000	0.05858	0.000000	0.03702	0.850000	0.48378	-0.461000	0.06712	-0.184000	0.10567	0.586000	0.80456	GCC	G|1.000;A|0.000		0.582	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
JAM3	83700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134014143	134014143	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:134014143G>C	ENST00000299106.4	+	4	423	c.264G>C	c.(262-264)ttG>ttC	p.L88F	JAM3_ENST00000441717.3_Intron|JAM3_ENST00000524969.1_3'UTR|JAM3_ENST00000529443.2_Missense_Mutation_p.L133F			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	88	Ig-like V-type.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		TAGGAGACTTGGCGGGTCGTG	0.483																																					p.L88F		.											.	JAM3	91	0			c.G264C						.						95.0	89.0	91.0					11																	134014143		2201	4297	6498	SO:0001583	missense	83700	exon4			AGACTTGGCGGGT	AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.264G>C	11.37:g.134014143G>C	ENSP00000299106:p.Leu88Phe	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	21.0	NM_032801	B3KWG9|Q8WWL8|Q96FL1	Missense_Mutation	SNP	ENST00000299106.4	37	CCDS8494.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.957|3.957	-0.011062|-0.011062	0.07727|0.07727	.|.	.|.	ENSG00000166086|ENSG00000166086	ENST00000534549|ENST00000299106	.|T	.|0.58652	.|0.32	5.47|5.47	2.58|2.58	0.30949|0.30949	.|Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.161867	.|0.42682	.|D	.|0.000679	T|T	0.39572|0.39572	0.1083|0.1083	L|L	0.37507|0.37507	1.11|1.11	0.40407|0.40407	D|D	0.979719|0.979719	.|B	.|0.17465	.|0.022	.|B	.|0.25987	.|0.065	T|T	0.09618|0.09618	-1.0666|-1.0666	5|10	.|0.11794	.|T	.|0.64	.|.	3.7926|3.7926	0.08727|0.08727	0.1372:0.1226:0.5986:0.1417|0.1372:0.1226:0.5986:0.1417	.|.	.|88	.|Q9BX67	.|JAM3_HUMAN	R|F	33|133	.|ENSP00000299106:L133F	.|ENSP00000299106:L133F	G|L	+|+	1|3	0|2	JAM3|JAM3	133519353|133519353	1.000000|1.000000	0.71417|0.71417	0.863000|0.863000	0.33907|0.33907	0.626000|0.626000	0.37791|0.37791	1.020000|1.020000	0.30027|0.30027	0.288000|0.288000	0.22398|0.22398	0.561000|0.561000	0.74099|0.74099	GGC|TTG	.		0.483	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393303.4	NM_032801	
KLHDC3	116138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42986679	42986679	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr6:42986679G>T	ENST00000326974.4	+	8	1094	c.899G>T	c.(898-900)gGt>gTt	p.G300V	KLHDC3_ENST00000332245.8_Missense_Mutation_p.G241V|KLHDC3_ENST00000244670.8_Missense_Mutation_p.G166V|RRP36_ENST00000244496.5_5'Flank	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	300					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGTATTGTTGGTGACAAGATT	0.512																																					p.G300V		.											.	KLHDC3	91	0			c.G899T						.						63.0	72.0	69.0					6																	42986679		2202	4300	6502	SO:0001583	missense	116138	exon8			TTGTTGGTGACAA	AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.899G>T	6.37:g.42986679G>T	ENSP00000313995:p.Gly300Val	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	13.0	NM_057161	A8K2W9	Missense_Mutation	SNP	ENST00000326974.4	37	CCDS4880.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073867	0.76415	.	.	ENSG00000124702	ENST00000326974;ENST00000432243;ENST00000244670;ENST00000394096;ENST00000426116;ENST00000332245	T;T;T	0.72051	-0.62;-0.62;-0.62	5.41	5.41	0.78517	.	0.158508	0.56097	D	0.000030	T	0.74336	0.3703	M	0.78456	2.415	0.80722	D	1	P;P;P;P	0.48834	0.851;0.849;0.881;0.916	B;B;B;P	0.48334	0.431;0.276;0.433;0.574	T	0.79052	-0.1961	10	0.87932	D	0	-4.2416	19.5682	0.95404	0.0:0.0:1.0:0.0	.	300;241;166;300	E7ENU0;E7ERR0;F8W6A4;Q9BQ90	.;.;.;KLDC3_HUMAN	V	300;300;166;300;273;241	ENSP00000313995:G300V;ENSP00000244670:G166V;ENSP00000331562:G241V	ENSP00000244670:G166V	G	+	2	0	KLHDC3	43094657	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	9.095000	0.94175	2.706000	0.92434	0.205000	0.17691	GGT	.		0.512	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040570.1	NM_057161	
KLHL1	57626	broad.mit.edu;bcgsc.ca	37	13	70456494	70456494	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr13:70456494A>C	ENST00000377844.4	-	5	1907	c.1148T>G	c.(1147-1149)gTc>gGc	p.V383G	KLHL1_ENST00000545028.1_Missense_Mutation_p.V190G	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	383					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GTCATACTTGACCCACATCAT	0.448																																					p.V383G		.											.	KLHL1	90	0			c.T1148G						.						174.0	139.0	151.0					13																	70456494		2203	4300	6503	SO:0001583	missense	57626	exon5			TACTTGACCCACA	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1148T>G	13.37:g.70456494A>C	ENSP00000367075:p.Val383Gly	Somatic	200.0	2.0		WXS	Illumina HiSeq	Phase_I	266.0	12.0	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.112818	0.77210	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.72167	-0.63;-0.63	5.03	5.03	0.67393	BTB/Kelch-associated (2);	0.000000	0.64402	D	0.000020	D	0.87826	0.6275	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.91133	0.4939	10	0.87932	D	0	.	15.0438	0.71811	1.0:0.0:0.0:0.0	.	383;383	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	G	383;190	ENSP00000367075:V383G;ENSP00000439602:V190G	ENSP00000367075:V383G	V	-	2	0	KLHL1	69354495	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.287000	0.95975	2.017000	0.59298	0.482000	0.46254	GTC	.		0.448	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
KLHL33	123103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20898551	20898551	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr14:20898551C>T	ENST00000344581.4	-	2	506	c.284G>A	c.(283-285)cGt>cAt	p.R95H		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	95												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		GAGGTAGTGACGGGCTTTGCT	0.617																																					p.R95H		.											.	.	.	0			c.G284A						.						72.0	79.0	77.0					14																	20898551		692	1591	2283	SO:0001583	missense	123103	exon2			TAGTGACGGGCTT		CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.284G>A	14.37:g.20898551C>T	ENSP00000341549:p.Arg95His	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	22.0	NM_001109997		Missense_Mutation	SNP	ENST00000344581.4	37	CCDS53882.1	.	.	.	.	.	.	.	.	.	.	C	7.403	0.633184	0.14322	.	.	ENSG00000185271	ENST00000344581	T	0.69306	-0.39	4.52	1.42	0.22433	BTB/Kelch-associated (2);	0.550372	0.19617	N	0.109991	T	0.38878	0.1057	N	0.11000	0.08	0.22185	N	0.999307	B	0.02656	0.0	B	0.04013	0.001	T	0.13656	-1.0501	10	0.19590	T	0.45	.	5.2071	0.15297	0.0:0.5237:0.0:0.4763	.	95	A6NCF5	KLH33_HUMAN	H	95	ENSP00000341549:R95H	ENSP00000341549:R95H	R	-	2	0	KLHL33	19968391	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	1.481000	0.35476	0.521000	0.28445	0.655000	0.94253	CGT	.		0.617	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411038.1	XM_063481	
KRT8	3856	broad.mit.edu;ucsc.edu;mdanderson.org	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8	92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	7.0	NM_001256282	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
KRT8	3856	ucsc.edu;bcgsc.ca	37	12	53298699	53298699	+	Missense_Mutation	SNP	G	G	A	rs201807576	byFrequency	TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr12:53298699G>A	ENST00000552551.1	-	2	499	c.67C>T	c.(67-69)Cgc>Tgc	p.R23C	KRT8_ENST00000546897.1_Missense_Mutation_p.R23C|KRT8_ENST00000293308.6_Missense_Mutation_p.R23C|KRT8_ENST00000552150.1_Missense_Mutation_p.R51C			P05787	K2C8_HUMAN	keratin 8	23	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	GTGTAGGAGCGGCTGCTGAAG	0.667																																					p.R51C		.											.	KRT8	92	0			c.C151T						.						11.0	13.0	13.0					12																	53298699		1953	3904	5857	SO:0001583	missense	3856	exon2			AGGAGCGGCTGCT	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.67C>T	12.37:g.53298699G>A	ENSP00000447566:p.Arg23Cys	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	52.0	9.0	NM_001256282	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	13.69	2.312705	0.40895	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	D;D;D;D;D;D;D;T	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-0.98	4.71	4.71	0.59529	.	0.431059	0.26883	N	0.022003	T	0.75824	0.3902	L	0.33293	1	0.41950	D	0.99065	B;B;B	0.12630	0.006;0.003;0.003	B;B;B	0.15484	0.013;0.005;0.002	T	0.69450	-0.5142	10	0.27082	T	0.32	.	9.653	0.39908	0.0974:0.0:0.9026:0.0	.	51;23;23	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	C	23;23;23;23;51;23;63;23;101	ENSP00000447566:R23C;ENSP00000293308:R23C;ENSP00000447402:R23C;ENSP00000449404:R51C;ENSP00000447881:R23C;ENSP00000447040:R63C;ENSP00000448681:R23C;ENSP00000450228:R101C	ENSP00000293308:R23C	R	-	1	0	KRT8	51584966	0.070000	0.21116	1.000000	0.80357	0.819000	0.46315	0.097000	0.15168	2.582000	0.87167	0.531000	0.56144	CGC	G|0.944;A|0.055		0.667	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
LGALS12	85329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63277947	63277947	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:63277947G>A	ENST00000394618.3	+	5	862	c.571G>A	c.(571-573)Ggc>Agc	p.G191S	LGALS12_ENST00000425950.2_Missense_Mutation_p.G130S|LGALS12_ENST00000415491.2_Missense_Mutation_p.G130S|LGALS12_ENST00000340246.5_Missense_Mutation_p.G192S|LGALS12_ENST00000255684.5_Missense_Mutation_p.G191S	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	191					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						ATTTGTGGAGGGCAGCAGAGA	0.557																																					p.G192S		.											.	LGALS12	92	0			c.G574A						.						116.0	93.0	101.0					11																	63277947		2201	4298	6499	SO:0001583	missense	85329	exon5			GTGGAGGGCAGCA	AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.571G>A	11.37:g.63277947G>A	ENSP00000378116:p.Gly191Ser	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	46.0	NM_001142535	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000394618.3	37	CCDS8045.1	.	.	.	.	.	.	.	.	.	.	G	8.955	0.969137	0.18659	.	.	ENSG00000133317	ENST00000255684;ENST00000394618;ENST00000340246;ENST00000415491;ENST00000425950	T;T;T;T;T	0.09163	3.36;3.53;3.47;3.28;3.01	5.64	4.72	0.59763	.	0.096801	0.45867	D	0.000327	T	0.08133	0.0203	L	0.51422	1.61	0.36773	D	0.883912	P;P;B;P	0.43287	0.802;0.525;0.383;0.802	B;B;B;B	0.34489	0.184;0.164;0.095;0.184	T	0.18871	-1.0323	10	0.12430	T	0.62	-30.4601	9.5019	0.39022	0.0936:0.0:0.9064:0.0	.	151;192;191;191	Q9NZ03;G5E970;Q96DT0-3;Q96DT0	.;.;.;LEG12_HUMAN	S	191;191;192;130;130	ENSP00000255684:G191S;ENSP00000378116:G191S;ENSP00000339374:G192S;ENSP00000394659:G130S;ENSP00000399093:G130S	ENSP00000255684:G191S	G	+	1	0	LGALS12	63034523	1.000000	0.71417	0.767000	0.31495	0.519000	0.34347	2.694000	0.47035	2.654000	0.90174	0.609000	0.83330	GGC	.		0.557	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396378.1	NM_033101	
LILRA2	11027	ucsc.edu;bcgsc.ca	37	19	55086870	55086870	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:55086870G>T	ENST00000251377.3	+	6	936	c.803G>T	c.(802-804)gGt>gTt	p.G268V	LILRA2_ENST00000391737.1_Missense_Mutation_p.G256V|LILRA2_ENST00000391738.3_Missense_Mutation_p.G268V|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000251376.3_Missense_Mutation_p.G268V|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	268	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CAGCGCCCTGGTTGGCAGCCC	0.627																																					p.G268V		.											.	LILRA2	91	0			c.G803T						.						79.0	77.0	78.0					19																	55086870		2203	4300	6503	SO:0001583	missense	11027	exon5			GCCCTGGTTGGCA	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.803G>T	19.37:g.55086870G>T	ENSP00000251377:p.Gly268Val	Somatic	192.0	2.0		WXS	Illumina HiSeq	.	257.0	57.0	NM_001130917	O75020	Missense_Mutation	SNP	ENST00000251377.3	37	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	G	8.619	0.891018	0.17613	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.00678	5.87;5.87;5.87;5.87;5.87	2.26	-1.97	0.07503	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.720370	0.01616	N	0.022766	T	0.03477	0.0100	M	0.68952	2.095	0.09310	N	1	B;P;D;D	0.63046	0.195;0.934;0.992;0.99	B;P;D;P	0.65573	0.105;0.734;0.936;0.849	T	0.41016	-0.9532	10	0.56958	D	0.05	.	9.694	0.40145	0.0:0.643:0.357:0.0	.	268;256;268;268	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	V	268;268;268;268;256	ENSP00000388131:G268V;ENSP00000251377:G268V;ENSP00000375618:G268V;ENSP00000251376:G268V;ENSP00000375617:G256V	ENSP00000251376:G268V	G	+	2	0	LILRA2	59778682	.	.	0.000000	0.03702	0.009000	0.06853	.	.	-0.303000	0.08856	0.400000	0.26472	GGT	.		0.627	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141128766	141128766	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr2:141128766A>C	ENST00000389484.3	-	70	11828	c.10857T>G	c.(10855-10857)tgT>tgG	p.C3619W		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3619	LDL-receptor class A 28. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AACCATCAGCACAATCATATT	0.303										TSP Lung(27;0.18)																											p.C3619W	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.T10857G						.						35.0	34.0	35.0					2																	141128766		2201	4289	6490	SO:0001583	missense	53353	exon70			ATCAGCACAATCA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10857T>G	2.37:g.141128766A>C	ENSP00000374135:p.Cys3619Trp	Somatic	211.0	0.0		WXS	Illumina HiSeq	Phase_I	271.0	36.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.094241	0.56075	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.99919	-8.0	5.2	4.05	0.47172	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99941	0.9974	H	0.99619	4.66	0.80722	D	1	D	0.67145	0.996	P	0.62649	0.905	D	0.96673	0.9498	10	0.87932	D	0	.	8.409	0.32632	0.8479:0.0:0.1521:0.0	.	3619	Q9NZR2	LRP1B_HUMAN	W	3619;3557	ENSP00000374135:C3619W	ENSP00000374135:C3619W	C	-	3	2	LRP1B	140845236	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.679000	0.54634	0.926000	0.37118	0.482000	0.46254	TGT	.		0.303	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRP8	7804	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	53727880	53727880	+	Splice_Site	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:53727880C>T	ENST00000306052.6	-	12	1876		c.e12-1		LRP8_ENST00000354412.3_Splice_Site|LRP8_ENST00000465675.1_Splice_Site|LRP8_ENST00000347547.2_Splice_Site|LRP8_ENST00000460214.1_Splice_Site|LRP8_ENST00000371454.2_Splice_Site	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor						ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						CTCAGCAGATCTTGGGAAGGA	0.542																																					.		.											.	LRP8	90	0			c.1388-1G>A						.						96.0	97.0	96.0					1																	53727880		2203	4300	6503	SO:0001630	splice_region_variant	7804	exon12			GCAGATCTTGGGA	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.1775-1G>A	1.37:g.53727880C>T		Somatic	152.0	1.0		WXS	Illumina HiSeq	Phase_I	152.0	44.0	NM_017522	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Splice_Site	SNP	ENST00000306052.6	37	CCDS578.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298386	0.81025	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP8	53500468	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	.	.		0.542	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	Intron
LSM14A	26065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34687544	34687544	+	Silent	SNP	A	A	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:34687544A>G	ENST00000433627.5	+	3	366	c.291A>G	c.(289-291)tcA>tcG	p.S97S	LSM14A_ENST00000540746.2_Silent_p.S97S|LSM14A_ENST00000544216.3_Silent_p.S97S	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	97					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					TTCAGTCCTCACTAGGCTCAT	0.393																																					p.S97S		.											.	LSM14A	91	0			c.A291G						.						171.0	152.0	159.0					19																	34687544		2203	4300	6503	SO:0001819	synonymous_variant	26065	exon3			GTCCTCACTAGGC	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.291A>G	19.37:g.34687544A>G		Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	63.0	NM_001114093	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Silent	SNP	ENST00000433627.5	37	CCDS46040.1																																																																																			.		0.393	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
LUC7L3	51747	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	48823123	48823123	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:48823123C>T	ENST00000505658.1	+	8	925	c.736C>T	c.(736-738)Cgt>Tgt	p.R246C	LUC7L3_ENST00000544170.1_Missense_Mutation_p.R170C|LUC7L3_ENST00000393227.2_Missense_Mutation_p.R246C|LUC7L3_ENST00000240304.1_Missense_Mutation_p.R246C			O95232	LC7L3_HUMAN	LUC7-like 3 (S. cerevisiae)	246	Arg/Ser-rich.|Glu-rich.				mRNA splice site selection (GO:0006376)|RNA splicing (GO:0008380)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U1 snRNP (GO:0005685)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	12						TCGTGATGAGCGTCTAAAAAA	0.363																																					p.R246C		.											.	LUC7L3	90	0			c.C736T						.						33.0	34.0	34.0					17																	48823123		2171	4281	6452	SO:0001583	missense	51747	exon8			GATGAGCGTCTAA		CCDS11573.1	17q21.33	2010-02-17			ENSG00000108848	ENSG00000108848			24309	protein-coding gene	gene with protein product	"""cisplatin resistance associated overexpressed protein"", ""CRE-associated protein"""	609434				10631324, 12565863	Standard	NM_016424		Approved	LUC7A, CROP, OA48-18, CREAP-1, FLJ11063, CRA, hLuc7A	uc002iss.3	O95232	OTTHUMG00000162257	ENST00000505658.1:c.736C>T	17.37:g.48823123C>T	ENSP00000425092:p.Arg246Cys	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	13.0	NM_006107	B3KN54|D3DTY1|Q6PHR9|Q9NUY0|Q9P2S7	Missense_Mutation	SNP	ENST00000505658.1	37	CCDS11573.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425715	0.62733	.	.	ENSG00000108848	ENST00000505658;ENST00000393227;ENST00000240304;ENST00000544170	T;T;T;T	0.32023	1.48;1.47;1.48;1.47	5.95	5.95	0.96441	.	0.309371	0.34484	N	0.003928	T	0.53658	0.1810	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.83275	0.993;0.993;0.996	T	0.49495	-0.8934	10	0.54805	T	0.06	-8.3748	15.8482	0.78907	0.1363:0.8637:0.0:0.0	.	170;246;246	B4DJ96;O95232;A8K3C5	.;LC7L3_HUMAN;.	C	246;246;246;170	ENSP00000425092:R246C;ENSP00000376919:R246C;ENSP00000240304:R246C;ENSP00000444253:R170C	ENSP00000240304:R246C	R	+	1	0	LUC7L3	46178122	0.998000	0.40836	1.000000	0.80357	0.947000	0.59692	2.870000	0.48451	2.824000	0.97209	0.655000	0.94253	CGT	.		0.363	LUC7L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368205.2	NM_016424	
MAG	4099	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35800859	35800859	+	Silent	SNP	G	G	C	rs111518896		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:35800859G>C	ENST00000392213.3	+	8	1473	c.1314G>C	c.(1312-1314)ccG>ccC	p.P438P	MAG_ENST00000537831.2_Silent_p.P413P|MAG_ENST00000361922.4_Silent_p.P438P|MAG_ENST00000593348.1_3'UTR	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	438	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			AGTCCAACCCGGAGCCGTCCG	0.657																																					p.P438P		.											.	MAG	947	0			c.G1314C						.						78.0	74.0	75.0					19																	35800859		2203	4300	6503	SO:0001819	synonymous_variant	4099	exon8			CAACCCGGAGCCG	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1314G>C	19.37:g.35800859G>C		Somatic	50.0	1.0		WXS	Illumina HiSeq	Phase_I	27.0	11.0	NM_080600	B7Z2E5|F5GYC0|Q567S4	Silent	SNP	ENST00000392213.3	37	CCDS12455.1																																																																																			G|1.000;A|0.000		0.657	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
MAGEE2	139599	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	75003421	75003421	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chrX:75003421C>T	ENST00000373359.2	-	1	1658	c.1466G>A	c.(1465-1467)aGa>aAa	p.R489K		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	489	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.									autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TGGTCGCTTTCTGTAGAGCCT	0.478																																					p.R489K		.											.	MAGEE2	132	0			c.G1466A						.						90.0	71.0	78.0					X																	75003421		2203	4300	6503	SO:0001583	missense	139599	exon1			CGCTTTCTGTAGA	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.1466G>A	X.37:g.75003421C>T	ENSP00000362457:p.Arg489Lys	Somatic	266.0	2.0		WXS	Illumina HiSeq	Phase_I	126.0	47.0	NM_138703	Q5JSI5	Missense_Mutation	SNP	ENST00000373359.2	37	CCDS14431.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.717913	0.00706	.	.	ENSG00000186675	ENST00000373359	T	0.03301	3.98	2.73	1.86	0.25419	.	.	.	.	.	T	0.01835	0.0058	N	0.05031	-0.125	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49143	-0.8970	9	0.20046	T	0.44	.	4.9989	0.14255	0.0:0.8261:0.0:0.1739	.	489	Q8TD90	MAGE2_HUMAN	K	489	ENSP00000362457:R489K	ENSP00000362457:R489K	R	-	2	0	MAGEE2	74920146	1.000000	0.71417	0.145000	0.22337	0.753000	0.42808	0.951000	0.29135	0.572000	0.29383	-0.453000	0.05500	AGA	.		0.478	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703	
MEPE	56955	broad.mit.edu;bcgsc.ca	37	4	88766214	88766214	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr4:88766214T>C	ENST00000424957.3	+	4	267	c.194T>C	c.(193-195)gTc>gCc	p.V65A	MEPE_ENST00000497649.2_Missense_Mutation_p.V41A|MEPE_ENST00000361056.3_Missense_Mutation_p.V65A|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000560249.1_5'UTR|MEPE_ENST00000395102.4_Missense_Mutation_p.V96A|MEPE_ENST00000511670.1_3'UTR|MEPE_ENST00000540395.1_5'UTR	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	65					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		GAAAATATTGTCCAGGAAAGA	0.308																																					p.V65A		.											.	MEPE	93	0			c.T194C						.						46.0	50.0	49.0					4																	88766214		2201	4296	6497	SO:0001583	missense	56955	exon4			ATATTGTCCAGGA	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.194T>C	4.37:g.88766214T>C	ENSP00000416984:p.Val65Ala	Somatic	38.0	1.0		WXS	Illumina HiSeq	Phase_I	27.0	10.0	NM_020203	A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	37	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	T	7.995	0.754094	0.15778	.	.	ENSG00000152595	ENST00000535138;ENST00000424957;ENST00000395102;ENST00000497649;ENST00000361056	T;T;T;T	0.45276	4.31;0.9;0.9;4.31	4.99	-8.95	0.00765	.	1.586910	0.03839	N	0.270304	T	0.27384	0.0672	N	0.20328	0.56	0.09310	N	0.999998	B	0.13145	0.007	B	0.15870	0.014	T	0.15983	-1.0418	10	0.23302	T	0.38	0.7903	16.0208	0.80486	0.0:0.6944:0.0:0.3056	.	65	Q9NQ76	MEPE_HUMAN	A	65;65;96;41;65	ENSP00000416984:V65A;ENSP00000378534:V96A;ENSP00000422747:V41A;ENSP00000354341:V65A	ENSP00000354341:V65A	V	+	2	0	MEPE	88985238	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.142000	0.03203	-2.041000	0.00915	-0.256000	0.11100	GTC	.		0.308	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1		
MGAM	8972	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	141734140	141734140	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr7:141734140A>C	ENST00000549489.2	+	15	1843	c.1748A>C	c.(1747-1749)cAc>cCc	p.H583P	MGAM_ENST00000475668.2_Missense_Mutation_p.H583P	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	583	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TATGACATTCACAATCTGTAT	0.433																																					p.H583P		.											.	MGAM	70	0			c.A1748C						.						47.0	46.0	46.0					7																	141734140		2045	4203	6248	SO:0001583	missense	8972	exon15			ACATTCACAATCT	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.1748A>C	7.37:g.141734140A>C	ENSP00000447378:p.His583Pro	Somatic	241.0	2.0		WXS	Illumina HiSeq	Phase_I	153.0	132.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.956115	0.73902	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.93019	-3.15	5.21	4.07	0.47477	Glycoside hydrolase, superfamily (1);	0.000000	0.64402	D	0.000008	D	0.97888	0.9306	H	0.98866	4.355	0.45837	D	0.998709	D	0.89917	1.0	D	0.91635	0.999	D	0.97388	0.9987	10	0.87932	D	0	.	10.0798	0.42381	0.9198:0.0:0.0802:0.0	.	583	O43451	MGA_HUMAN	P	583;583;460	ENSP00000447378:H583P	ENSP00000316431:H460P	H	+	2	0	MGAM	141380609	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.081000	0.94049	1.007000	0.39238	-0.256000	0.11100	CAC	.		0.433	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
MSLN	10232	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	815541	815541	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr16:815541G>T	ENST00000382862.3	+	9	814	c.719G>T	c.(718-720)tGg>tTg	p.W240L	MSLN_ENST00000563941.1_Missense_Mutation_p.W240L|MSLN_ENST00000545450.2_Missense_Mutation_p.W240L|MSLN_ENST00000566549.1_Missense_Mutation_p.W240L	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	240					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				CCGTCGACATGGTCTGTCTCC	0.692																																					p.W240L		.											.	MSLN	91	0			c.G719T						.						34.0	35.0	34.0					16																	815541		2181	4284	6465	SO:0001583	missense	10232	exon10			CGACATGGTCTGT	U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.719G>T	16.37:g.815541G>T	ENSP00000372313:p.Trp240Leu	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	4.0	NM_005823	D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Missense_Mutation	SNP	ENST00000382862.3	37	CCDS32356.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.051760	0.55218	.	.	ENSG00000102854	ENST00000446427;ENST00000445361;ENST00000545450;ENST00000382862	T;T	0.19394	2.15;2.15	2.98	2.98	0.34508	.	0.194918	0.36591	U	0.002514	T	0.39279	0.1072	M	0.61703	1.905	0.43114	D	0.994829	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.996;0.998	T	0.27331	-1.0077	10	0.87932	D	0	-0.4912	9.2171	0.37353	0.0:0.0:1.0:0.0	.	239;240;240;240	Q13421-4;Q13421;Q13421-2;Q13421-3	.;MSLN_HUMAN;.;.	L	240	ENSP00000442965:W240L;ENSP00000372313:W240L	ENSP00000372313:W240L	W	+	2	0	MSLN	755542	0.305000	0.24481	0.110000	0.21437	0.011000	0.07611	0.687000	0.25407	1.483000	0.48342	0.551000	0.68910	TGG	.		0.692	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109253.2		
MYOCD	93649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12655884	12655884	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:12655884C>A	ENST00000343344.4	+	10	1279	c.1279C>A	c.(1279-1281)Ccc>Acc	p.P427T	AC005358.1_ENST00000609971.1_Missense_Mutation_p.P331T|MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Missense_Mutation_p.P427T			Q8IZQ8	MYCD_HUMAN	myocardin	427					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TCCTGTCACACCCAACACGCT	0.572																																					p.P427T		.											.	MYOCD	93	0			c.C1279A						.						147.0	131.0	136.0					17																	12655884		2203	4300	6503	SO:0001583	missense	93649	exon10			GTCACACCCAACA	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1279C>A	17.37:g.12655884C>A	ENSP00000341835:p.Pro427Thr	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	32.0	NM_001146312	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	C	11.37	1.619684	0.28801	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.44881	0.93;0.91	5.66	4.67	0.58626	.	0.050975	0.85682	D	0.000000	T	0.55386	0.1917	L	0.55834	1.745	0.53005	D	0.999969	D;D;D;D	0.89917	0.983;1.0;1.0;1.0	P;D;D;D	0.97110	0.904;1.0;0.998;0.995	T	0.52689	-0.8542	10	0.07644	T	0.81	-16.7553	15.309	0.74016	0.0:0.859:0.141:0.0	.	146;331;427;427	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	T	146;427;427;331;132	ENSP00000341835:P427T;ENSP00000400148:P132T	ENSP00000341835:P427T	P	+	1	0	MYOCD	12596609	1.000000	0.71417	0.042000	0.18584	0.762000	0.43233	7.519000	0.81809	1.355000	0.45865	0.591000	0.81541	CCC	.		0.572	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
MYCBPAP	84073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48601116	48601116	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:48601116G>A	ENST00000323776.5	+	12	1897	c.1735G>A	c.(1735-1737)Gtt>Att	p.V579I	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.V542I	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			GACCCAGGACGTTTTTGAGGA	0.532																																					p.V579I		.											.	MYCBPAP	230	0			c.G1735A						.						56.0	55.0	56.0					17																	48601116		2203	4300	6503	SO:0001583	missense	84073	exon12			CAGGACGTTTTTG	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1735G>A	17.37:g.48601116G>A	ENSP00000323184:p.Val579Ile	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	54.0	NM_032133		Missense_Mutation	SNP	ENST00000323776.5	37	CCDS32680.2	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.899122	0.00517	.	.	ENSG00000136449	ENST00000323776;ENST00000436259	T;T	0.43294	0.95;0.95	5.74	-4.73	0.03259	.	0.746389	0.12709	N	0.445652	T	0.09686	0.0238	N	0.00823	-1.155	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.39663	-0.9603	10	0.07644	T	0.81	0.2452	6.9197	0.24380	0.3277:0.3947:0.2775:0.0	.	542	Q8TBZ2	MYBPP_HUMAN	I	579;542	ENSP00000323184:V579I;ENSP00000397209:V542I	ENSP00000323184:V579I	V	+	1	0	MYCBPAP	45956115	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-0.215000	0.09279	-0.450000	0.07107	-1.058000	0.02302	GTT	.		0.532	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133	
NBEAL1	65065	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	204067444	204067444	+	Silent	SNP	A	A	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr2:204067444A>T	ENST00000449802.1	+	50	7692	c.7359A>T	c.(7357-7359)ggA>ggT	p.G2453G		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2453										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ATTACTGTGGAATACATTTGA	0.323																																					p.G2453G		.											.	NBEAL1	92	0			c.A7359T						.						130.0	124.0	126.0					2																	204067444		1858	4093	5951	SO:0001819	synonymous_variant	65065	exon50			CTGTGGAATACAT	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.7359A>T	2.37:g.204067444A>T		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	7.0	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Silent	SNP	ENST00000449802.1	37	CCDS46495.1																																																																																			.		0.323	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
NDUFA13	51079	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19626948	19626948	+	5'UTR	SNP	A	A	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:19626948A>C	ENST00000507754.4	+	0	385				YJEFN3_ENST00000608404.1_5'Flank|CTC-260F20.3_ENST00000555938.1_5'Flank|NDUFA13_ENST00000512771.3_5'Flank|NDUFA13_ENST00000428459.2_5'Flank|TSSK6_ENST00000360913.3_5'Flank|TSSK6_ENST00000585580.3_5'Flank|NDUFA13_ENST00000252576.5_Silent_p.L50L|NDUFA13_ENST00000503283.1_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13						apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						GGGACTTCCTAGCCGTGCCGC	0.632																																					.		.											.	NDUFA13	650	0			.						.						47.0	46.0	46.0					19																	19626948		2203	4300	6503	SO:0001623	5_prime_UTR_variant	51079	.			CTTCCTAGCCGTG	AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211	ENST00000507754.4:c.-100A>C	19.37:g.19626948A>C		Somatic	176.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	88.0	.	B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Silent	SNP	ENST00000507754.4	37	CCDS12404.2																																																																																			.		0.632	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367916.6	NM_015965	
NEB	4703	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152466364	152466364	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr2:152466364C>G	ENST00000172853.10	-	77	11707	c.11560G>C	c.(11560-11562)Gac>Cac	p.D3854H	NEB_ENST00000427231.2_Missense_Mutation_p.D4097H|NEB_ENST00000604864.1_Missense_Mutation_p.D4097H|NEB_ENST00000603639.1_Missense_Mutation_p.D4097H|NEB_ENST00000397345.3_Missense_Mutation_p.D4097H|NEB_ENST00000409198.1_Missense_Mutation_p.D3854H			P20929	NEBU_HUMAN	nebulin	3854					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGATAATGTCGTTTTGATCC	0.433																																					p.D4097H		.											.	NEB	145	0			c.G12289C						.						223.0	208.0	213.0					2																	152466364		1960	4149	6109	SO:0001583	missense	4703	exon81			TAATGTCGTTTTG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11560G>C	2.37:g.152466364C>G	ENSP00000172853:p.Asp3854His	Somatic	170.0	1.0		WXS	Illumina HiSeq	Phase_I	210.0	48.0	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	24.0	4.481740	0.84747	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.55	5.55	0.83447	.	0.043254	0.85682	D	0.000000	T	0.75932	0.3917	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.79329	-0.1848	10	0.56958	D	0.05	.	19.8667	0.96806	0.0:1.0:0.0:0.0	.	3854	P20929	NEBU_HUMAN	H	3854;4097;4097;3854	ENSP00000386259:D3854H;ENSP00000380505:D4097H;ENSP00000416578:D4097H;ENSP00000172853:D3854H	ENSP00000172853:D3854H	D	-	1	0	NEB	152174610	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	4.802000	0.62539	2.773000	0.95371	0.655000	0.94253	GAC	.		0.433	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NFKBIZ	64332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	101571988	101571988	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr3:101571988T>G	ENST00000326172.5	+	5	733	c.618T>G	c.(616-618)aaT>aaG	p.N206K	NFKBIZ_ENST00000326151.5_Missense_Mutation_p.N206K|NFKBIZ_ENST00000394054.2_Missense_Mutation_p.N106K	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	206					inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						TTCATCTCAATGAACCCAAAC	0.458																																					p.N206K		.											.	NFKBIZ	92	0			c.T618G						.						96.0	104.0	101.0					3																	101571988		2203	4300	6503	SO:0001583	missense	64332	exon5			TCTCAATGAACCC	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.618T>G	3.37:g.101571988T>G	ENSP00000325663:p.Asn206Lys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	36.0	NM_031419	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	ENST00000326172.5	37	CCDS2946.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.345338	0.24426	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326151;ENST00000326172;ENST00000491281	T;T;T;T	0.56103	0.52;0.48;0.48;0.55	5.26	2.81	0.32909	.	0.797452	0.11878	N	0.520791	T	0.41419	0.1158	L	0.46157	1.445	0.31838	N	0.623881	B;B	0.30021	0.078;0.265	B;B	0.28139	0.025;0.086	T	0.41963	-0.9479	10	0.12430	T	0.62	0.7596	9.3716	0.38256	0.0:0.1482:0.0:0.8518	.	206;206	Q9BYH8-3;Q9BYH8	.;IKBZ_HUMAN	K	106;106;206;206;106	ENSP00000419800:N106K;ENSP00000377618:N106K;ENSP00000325593:N206K;ENSP00000325663:N206K	ENSP00000325593:N206K	N	+	3	2	NFKBIZ	103054678	0.023000	0.18921	0.724000	0.30704	0.304000	0.27724	0.038000	0.13862	0.789000	0.33779	0.460000	0.39030	AAT	.		0.458	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	NM_031419	
NUP160	23279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47801951	47801951	+	Missense_Mutation	SNP	T	T	C	rs62000434		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:47801951T>C	ENST00000378460.2	-	35	4211	c.4165A>G	c.(4165-4167)Att>Gtt	p.I1389V	NUP160_ENST00000530326.1_Intron	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	1389					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						AGCTGATCAATAGAGGAGTAT	0.463																																					p.I1389V		.											.	NUP160	209	0			c.A4165G						.						101.0	95.0	97.0					11																	47801951		2201	4298	6499	SO:0001583	missense	23279	exon35			GATCAATAGAGGA	D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.4165A>G	11.37:g.47801951T>C	ENSP00000367721:p.Ile1389Val	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	30.0	NM_015231	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	ENST00000378460.2	37	CCDS31484.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.737736	0.89573	.	.	ENSG00000030066	ENST00000378460	T	0.48201	0.82	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.57961	0.2089	L	0.55481	1.735	0.80722	D	1	D	0.61697	0.99	P	0.54544	0.755	T	0.59123	-0.7513	10	0.51188	T	0.08	.	15.8267	0.78711	0.0:0.0:0.0:1.0	.	1389	Q12769	NU160_HUMAN	V	1389	ENSP00000367721:I1389V	ENSP00000367721:I1389V	I	-	1	0	NUP160	47758527	1.000000	0.71417	0.857000	0.33713	0.975000	0.68041	5.404000	0.66344	2.214000	0.71695	0.477000	0.44152	ATT	T|0.987;C|0.013		0.463	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231	
NUP210L	91181	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	154018769	154018769	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:154018769G>A	ENST00000368559.3	-	26	3631	c.3560C>T	c.(3559-3561)aCc>aTc	p.T1187I	NUP210L_ENST00000271854.3_Missense_Mutation_p.T1187I|NUP210L_ENST00000368553.1_Missense_Mutation_p.T120I	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1187					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			ACTGACCTTGGTAGCTGTGAT	0.453																																					p.T1187I		.											.	NUP210L	77	0			c.C3560T						.						93.0	91.0	92.0					1																	154018769		1918	4139	6057	SO:0001583	missense	91181	exon26			ACCTTGGTAGCTG	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.3560C>T	1.37:g.154018769G>A	ENSP00000357547:p.Thr1187Ile	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	9.0	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133262	0.77662	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;T;T	0.25414	3.37;1.8;3.13	5.71	4.8	0.61643	.	0.164042	0.43579	D	0.000560	T	0.20981	0.0505	M	0.69358	2.11	0.31704	N	0.640329	P;P	0.52577	0.954;0.91	P;B	0.49799	0.622;0.343	T	0.07009	-1.0795	10	0.33141	T	0.24	-8.4839	11.5364	0.50639	0.0829:0.0:0.9171:0.0	.	1187;1187	E7EP56;Q5VU65	.;P210L_HUMAN	I	1187;120;1187	ENSP00000357547:T1187I;ENSP00000357541:T120I;ENSP00000271854:T1187I	ENSP00000271854:T1187I	T	-	2	0	NUP210L	152285393	0.993000	0.37304	0.725000	0.30721	0.986000	0.74619	6.245000	0.72398	1.425000	0.47237	0.650000	0.86243	ACC	.		0.453	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
OR5T1	390155	hgsc.bcm.edu;bcgsc.ca	37	11	56044023	56044051	+	Frame_Shift_Del	DEL	TTTGCGGAACAAAGATGTAAAGGAGGCAA	TTTGCGGAACAAAGATGTAAAGGAGGCAA	-	rs148135770|rs374592813|rs549381739|rs143790336	byFrequency	TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	TTTGCGGAACAAAGATGTAAAGGAGGCAA	TTTGCGGAACAAAGATGTAAAGGAGGCAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:56044023_56044051delTTTGCGGAACAAAGATGTAAAGGAGGCAA	ENST00000313033.2	+	1	995_1023	c.909_937delTTTGCGGAACAAAGATGTAAAGGAGGCAA	c.(907-939)agtttgcggaacaaagatgtaaaggaggcaatcfs	p.LRNKDVKEAI304fs		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R305W(1)|p.R305P(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TCATCTACAGTTTGCGGAACAAAGATGTAAAGGAGGCAATCAAAAGATT	0.358																																					p.303_313del		.											.	OR5T1	71	2	Substitution - Missense(2)	lung(1)|kidney(1)	c.909_937del						.																																			SO:0001589	frameshift_variant	390155	exon1			CTACAGTTTGCGG	AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.909_937delTTTGCGGAACAAAGATGTAAAGGAGGCAA	11.37:g.56044023_56044051delTTTGCGGAACAAAGATGTAAAGGAGGCAA	ENSP00000323612:p.Leu304fs	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	4.0	NM_001004745	B2RNM9	Frame_Shift_Del	DEL	ENST00000313033.2	37	CCDS31525.1																																																																																			.		0.358	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745	
OSGIN1	29948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	83999421	83999421	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr16:83999421G>A	ENST00000343939.2	+	7	1875	c.1492G>A	c.(1492-1494)Gat>Aat	p.D498N	NECAB2_ENST00000305202.4_5'Flank|OSGIN1_ENST00000393306.1_Missense_Mutation_p.D415N|OSGIN1_ENST00000361711.3_Missense_Mutation_p.D415N			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	498					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						CTTTGCAGTGGATCCTGACCA	0.657																																					p.D415N		.											.	OSGIN1	68	0			c.G1243A						.						55.0	54.0	55.0					16																	83999421		2198	4298	6496	SO:0001583	missense	29948	exon6			GCAGTGGATCCTG	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.1492G>A	16.37:g.83999421G>A	ENSP00000343376:p.Asp498Asn	Somatic	252.0	0.0		WXS	Illumina HiSeq	Phase_I	223.0	49.0	NM_182981	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Missense_Mutation	SNP	ENST00000343939.2	37		.	.	.	.	.	.	.	.	.	.	G	15.18	2.757584	0.49468	.	.	ENSG00000140961	ENST00000343939;ENST00000361711;ENST00000393306	T;T;T	0.39229	1.09;1.09;1.09	4.56	4.56	0.56223	.	0.197713	0.52532	D	0.000067	T	0.53367	0.1792	L	0.56124	1.755	0.80722	D	1	D	0.71674	0.998	P	0.57425	0.82	T	0.50642	-0.8804	10	0.30854	T	0.27	-35.4649	16.3197	0.82945	0.0:0.0:1.0:0.0	.	498	Q9UJX0	OSGI1_HUMAN	N	498;415;415	ENSP00000343376:D498N;ENSP00000355374:D415N;ENSP00000376983:D415N	ENSP00000343376:D498N	D	+	1	0	OSGIN1	82556922	1.000000	0.71417	0.417000	0.26559	0.655000	0.38815	5.608000	0.67654	2.082000	0.62665	0.313000	0.20887	GAT	.		0.657	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370	
PAPOLB	56903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4900131	4900131	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr7:4900131C>T	ENST00000404991.1	-	1	1494	c.1308G>A	c.(1306-1308)atG>atA	p.M436I	RADIL_ENST00000399583.3_Intron|RADIL_ENST00000536091.1_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	436					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		CAATCACCCACATTGTACGAA	0.393																																					p.M437I		.											.	PAPOLB	493	0			c.G1311A						.						140.0	151.0	147.0					7																	4900131		2190	4297	6487	SO:0001583	missense	56903	exon1			CACCCACATTGTA	AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.1308G>A	7.37:g.4900131C>T	ENSP00000384700:p.Met436Ile	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	273.0	55.0	NM_020144	Q75LH1|Q8NE14	Missense_Mutation	SNP	ENST00000404991.1	37		.	.	.	.	.	.	.	.	.	.	C	16.13	3.036662	0.54896	.	.	ENSG00000218823	ENST00000404991	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	T	0.72914	0.3520	M	0.62723	1.935	0.58432	D	0.999994	P	0.43973	0.823	P	0.55112	0.769	T	0.72541	-0.4262	8	0.49607	T	0.09	.	16.3421	0.83085	0.0:1.0:0.0:0.0	.	437	A4D1Z6	.	I	436	.	ENSP00000384700:M436I	M	-	3	0	PAPOLB	4866657	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	7.320000	0.79064	2.809000	0.96659	0.467000	0.42956	ATG	.		0.393	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000323797.1	NM_020144	
PDPR	55066	broad.mit.edu;mdanderson.org	37	16	70165260	70165260	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr16:70165260C>G	ENST00000288050.4	+	8	1742	c.785C>G	c.(784-786)gCc>gGc	p.A262G	PDPR_ENST00000398122.3_Missense_Mutation_p.A162G|PDPR_ENST00000568530.1_Missense_Mutation_p.A262G	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	262					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCGCTACATGCCTGCGAACAC	0.502																																					p.A262G		.											.	PDPR	135	0			c.C785G						.						22.0	22.0	22.0					16																	70165260		1799	4024	5823	SO:0001583	missense	55066	exon8			TACATGCCTGCGA		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.785C>G	16.37:g.70165260C>G	ENSP00000288050:p.Ala262Gly	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	16.0	NM_017990	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	37	CCDS45520.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.230494	0.58777	.	.	ENSG00000090857	ENST00000288050;ENST00000398122	T;T	0.33438	1.41;1.41	4.94	4.94	0.65067	FAD dependent oxidoreductase (1);	0.054073	0.64402	D	0.000001	T	0.40595	0.1123	M	0.71206	2.165	0.80722	D	1	B	0.23806	0.091	B	0.32022	0.139	T	0.39623	-0.9605	10	0.59425	D	0.04	.	17.1388	0.86748	0.0:1.0:0.0:0.0	.	262	Q8NCN5	PDPR_HUMAN	G	262;162	ENSP00000288050:A262G;ENSP00000381190:A162G	ENSP00000288050:A262G	A	+	2	0	PDPR	68722761	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.915000	0.63355	2.274000	0.75844	0.544000	0.68410	GCC	.		0.502	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990	
PEX6	5190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42932089	42932089	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr6:42932089T>G	ENST00000304611.8	-	17	2996	c.2927A>C	c.(2926-2928)aAg>aCg	p.K976T	PEX6_ENST00000244546.4_3'UTR	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	976					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GGCAGCAAACTTGCGCTGGAT	0.632																																					p.K976T		.											.	PEX6	91	0			c.A2927C						.						38.0	40.0	39.0					6																	42932089		2203	4299	6502	SO:0001583	missense	5190	exon17			GCAAACTTGCGCT	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.2927A>C	6.37:g.42932089T>G	ENSP00000303511:p.Lys976Thr	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	42.0	NM_000287	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	ENST00000304611.8	37	CCDS4877.1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.173788	0.57692	.	.	ENSG00000124587	ENST00000304611	D	0.94613	-3.47	5.97	5.97	0.96955	.	0.126822	0.64402	D	0.000001	D	0.84488	0.5483	N	0.25201	0.72	0.80722	D	1	P	0.38250	0.624	B	0.35550	0.205	D	0.85440	0.1154	10	0.19147	T	0.46	-28.3012	16.1238	0.81380	0.0:0.0:0.0:1.0	.	976	Q13608	PEX6_HUMAN	T	976	ENSP00000303511:K976T	ENSP00000303511:K976T	K	-	2	0	PEX6	43040067	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.289000	0.65656	2.288000	0.76882	0.533000	0.62120	AAG	.		0.632	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
PIAS3	10401	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	145585532	145585532	+	Silent	SNP	T	T	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:145585532T>G	ENST00000393045.2	+	14	1887	c.1797T>G	c.(1795-1797)ccT>ccG	p.P599P	NUDT17_ENST00000444015.2_5'Flank|PIAS3_ENST00000369298.1_Silent_p.P564P	NM_006099.3	NP_006090.2	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	599					positive regulation of gene expression (GO:0010628)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)|synapse (GO:0045202)	enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)	28	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTGTGGCCCCTGGGGGGGCCT	0.667																																					p.P599P		.											.	PIAS3	658	0			c.T1797G						.						42.0	48.0	46.0					1																	145585532		2203	4296	6499	SO:0001819	synonymous_variant	10401	exon14			GGCCCCTGGGGGG	AB021868	CCDS72866.1	1q21	2011-10-11			ENSG00000131788	ENSG00000131788		"""Zinc fingers, MIZ-type"""	16861	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 5"""	605987				10319586	Standard	NM_006099		Approved	FLJ14651, ZMIZ5	uc001eoc.1	Q9Y6X2	OTTHUMG00000013750	ENST00000393045.2:c.1797T>G	1.37:g.145585532T>G		Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	10.0	8.0	NM_006099	Q9UFI3	Silent	SNP	ENST00000393045.2	37	CCDS920.2																																																																																			.		0.667	PIAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038533.4	NM_006099	
PIP4K2C	79837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57985226	57985226	+	Silent	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr12:57985226C>T	ENST00000354947.5	+	1	170	c.154C>T	c.(154-156)Ctg>Ttg	p.L52L	PIP4K2C_ENST00000540759.2_Silent_p.L52L|PIP4K2C_ENST00000422156.3_Silent_p.L52L|PIP4K2C_ENST00000550465.1_Silent_p.L52L			Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, gamma	52	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(13)|pancreas(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Melanoma(17;0.122)					GGGTGTGTTCCTGTGGGGCGT	0.652																																					p.L52L		.											.	PIP4K2C	689	0			c.C154T						.						88.0	94.0	92.0					12																	57985226		2203	4300	6503	SO:0001819	synonymous_variant	79837	exon1			GTGTTCCTGTGGG	AK125526	CCDS8946.1, CCDS53808.1, CCDS55839.1	12q13.3	2014-09-04	2007-08-14	2007-08-14	ENSG00000166908	ENSG00000166908			23786	protein-coding gene	gene with protein product			"""phosphatidylinositol-4-phosphate 5-kinase, type II, gamma"""	PIP5K2C		9367159	Standard	NM_024779		Approved	FLJ22055	uc001sot.3	Q8TBX8	OTTHUMG00000170144	ENST00000354947.5:c.154C>T	12.37:g.57985226C>T		Somatic	222.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	90.0	NM_001146258	B2RDL3|B4DM11|B4DY44|Q9H6N2	Silent	SNP	ENST00000354947.5	37	CCDS8946.1																																																																																			.		0.652	PIP4K2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407644.1	NM_024779	
PIWIL2	55124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	22136992	22136992	+	Silent	SNP	T	T	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr8:22136992T>G	ENST00000454009.2	+	2	602	c.93T>G	c.(91-93)gcT>gcG	p.A31A	PIWIL2_ENST00000356766.6_Silent_p.A31A|PIWIL2_ENST00000521356.1_Silent_p.A31A	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	31					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		GGCCACAAGCTTCTAAACCTT	0.602																																					p.A31A		.											.	PIWIL2	91	0			c.T93G						.						111.0	102.0	105.0					8																	22136992		2203	4300	6503	SO:0001819	synonymous_variant	55124	exon2			ACAAGCTTCTAAA	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.93T>G	8.37:g.22136992T>G		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	52.0	NM_001135721	A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Silent	SNP	ENST00000454009.2	37	CCDS6029.1																																																																																			.		0.602	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375438.1		
POLR2A	5430	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7417050	7417070	+	In_Frame_Del	DEL	CCCAGCTACAGCCCCAGCTCG	CCCAGCTACAGCCCCAGCTCG	-	rs199873553|rs370656689|rs1058386		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	CCCAGCTACAGCCCCAGCTCG	CCCAGCTACAGCCCCAGCTCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:7417050_7417070delCCCAGCTACAGCCCCAGCTCG	ENST00000322644.6	+	29	5866_5886	c.5467_5487delCCCAGCTACAGCCCCAGCTCG	c.(5467-5487)cccagctacagccccagctcgdel	p.PSYSPSS1823del		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1823	C-terminal domain (CTD); 52 X 7 AA approximate tandem repeats of Y-[ST]-P- [STQ]-[ST]-P-[SRTEVKGN].				7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				CCCAAGCTCAcccagctacagccccagctcgcccagctaca	0.57																																					p.1823_1829del		.											.	POLR2A	91	0			c.5467_5487del						.																																			SO:0001651	inframe_deletion	5430	exon29			AGCTCACCCAGCT			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.5467_5487delCCCAGCTACAGCCCCAGCTCG	17.37:g.7417050_7417070delCCCAGCTACAGCCCCAGCTCG	ENSP00000314949:p.Pro1823_Ser1829del	Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	37.0	NM_000937	A6NN93|B9EH88|Q6NX41	In_Frame_Del	DEL	ENST00000322644.6	37	CCDS32548.1																																																																																			.		0.570	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
POU4F1	5457	broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	79175687	79175687	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr13:79175687C>T	ENST00000377208.5	-	2	1334	c.1123G>A	c.(1123-1125)Gcc>Acc	p.A375T	RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000606124.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000607205.1_RNA|RNF219-AS1_ENST00000607220.1_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	375					axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		GGCTGCACGGCGAAGTAGGCC	0.612																																					p.A375T	Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)	.											.	POU4F1	515	0			c.G1123A						.						56.0	60.0	59.0					13																	79175687		2203	4300	6503	SO:0001583	missense	5457	exon2			GCACGGCGAAGTA	X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.1123G>A	13.37:g.79175687C>T	ENSP00000366413:p.Ala375Thr	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	5.0	NM_006237	Q14986|Q15318|Q5T227	Missense_Mutation	SNP	ENST00000377208.5	37	CCDS31996.1	.	.	.	.	.	.	.	.	.	.	C	18.19	3.568666	0.65651	.	.	ENSG00000152192	ENST00000377208	D	0.96334	-3.98	4.35	4.35	0.52113	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	U	0.000000	D	0.96716	0.8928	L	0.41632	1.29	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	D	0.96700	0.9517	10	0.44086	T	0.13	.	16.8947	0.86097	0.0:1.0:0.0:0.0	.	375	Q01851	PO4F1_HUMAN	T	375	ENSP00000366413:A375T	ENSP00000366413:A375T	A	-	1	0	POU4F1	78073688	1.000000	0.71417	0.979000	0.43373	0.689000	0.40095	7.622000	0.83099	2.159000	0.67721	0.499000	0.49734	GCC	.		0.612	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045360.3		
PPCS	79717	hgsc.bcm.edu;broad.mit.edu	37	1	42922564	42922564	+	Missense_Mutation	SNP	C	C	T	rs372401432		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:42922564C>T	ENST00000372561.3	+	1	335	c.328C>T	c.(328-330)Cca>Tca	p.P110S	PPCS_ENST00000472013.1_3'UTR|PPCS_ENST00000372556.3_Intron|PPCS_ENST00000372560.3_Missense_Mutation_p.P110S|PPCS_ENST00000372562.1_Intron|ZMYND12_ENST00000372565.3_5'Flank|ZMYND12_ENST00000433602.2_5'Flank|PPCS_ENST00000455780.1_Intron	NM_024664.2	NP_078940.2	Q9HAB8	PPCS_HUMAN	phosphopantothenoylcysteine synthetase	110					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	phosphopantothenate--cysteine ligase activity (GO:0004632)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|skin(3)	12	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCCTTCGGGCCCAGCCCTTTC	0.657																																					p.P110S		.											.	PPCS	90	0			c.C328T						.	C	,SER/PRO	0,3754		0,0,1877	58.0	62.0	61.0		,328	1.5	0.0	1		61	1,8179		0,1,4089	no	intron,missense	PPCS	NM_001077447.1,NM_024664.2	,74	0,1,5966	TT,TC,CC		0.0122,0.0,0.0084	,benign	,110/312	42922564	1,11933	1877	4090	5967	SO:0001583	missense	79717	exon1			TCGGGCCCAGCCC	AK021900	CCDS41311.1, CCDS41312.1	1p34.2	2008-02-05			ENSG00000127125	ENSG00000127125	6.3.2.5		25686	protein-coding gene	gene with protein product		609853				11923312	Standard	NM_024664		Approved	FLJ11838	uc001chl.3	Q9HAB8	OTTHUMG00000007332	ENST00000372561.3:c.328C>T	1.37:g.42922564C>T	ENSP00000361642:p.Pro110Ser	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	4.0	NM_024664	Q3KQT2|Q5VVM0	Missense_Mutation	SNP	ENST00000372561.3	37	CCDS41311.1	.	.	.	.	.	.	.	.	.	.	C	2.603	-0.292498	0.05568	0.0	1.22E-4	ENSG00000127125	ENST00000372560;ENST00000372561	.	.	.	5.96	1.52	0.23074	DNA/pantothenate metabolism flavoprotein, C-terminal (3);	0.881385	0.10426	N	0.676059	T	0.21801	0.0525	N	0.14661	0.345	0.18873	N	0.999985	B	0.02656	0.0	B	0.04013	0.001	T	0.28396	-1.0045	9	0.10636	T	0.68	-0.0012	7.3416	0.26640	0.0:0.472:0.3703:0.1577	.	110	Q9HAB8	PPCS_HUMAN	S	110	.	ENSP00000361641:P110S	P	+	1	0	PPCS	42695151	0.000000	0.05858	0.001000	0.08648	0.359000	0.29487	-0.130000	0.10498	0.325000	0.23359	0.650000	0.86243	CCA	.		0.657	PPCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019166.1	NM_024664	
PREX1	57580	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	47249156	47249156	+	Missense_Mutation	SNP	A	A	G	rs200234810	byFrequency	TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr20:47249156A>G	ENST00000371941.3	-	34	4311	c.4289T>C	c.(4288-4290)aTt>aCt	p.I1430T	PREX1_ENST00000396220.1_Missense_Mutation_p.I1430T	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1430					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GCTGCCCTCAATGTGGTAGAA	0.627													.|||	2	0.000399361	0.0015	0.0	5008	,	,		18865	0.0		0.0	False		,,,				2504	0.0				p.I1430T		.											.	PREX1	231	0			c.T4289C						.						63.0	58.0	60.0					20																	47249156		2203	4300	6503	SO:0001583	missense	57580	exon34			CCCTCAATGTGGT	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.4289T>C	20.37:g.47249156A>G	ENSP00000361009:p.Ile1430Thr	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	36.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	A	21.0	4.089631	0.76756	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.66099	1.0;-0.19	4.7	4.7	0.59300	.	0.000000	0.53938	U	0.000042	T	0.59636	0.2208	L	0.59436	1.845	0.48901	D	0.99972	B;B	0.16396	0.017;0.005	B;B	0.17722	0.009;0.019	T	0.60444	-0.7262	10	0.59425	D	0.04	.	14.1756	0.65539	1.0:0.0:0.0:0.0	.	1430;727	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	T	1430	ENSP00000361009:I1430T;ENSP00000379522:I1430T	ENSP00000361009:I1430T	I	-	2	0	PREX1	46682563	1.000000	0.71417	0.990000	0.47175	0.988000	0.76386	8.829000	0.92055	1.738000	0.51689	0.459000	0.35465	ATT	A|0.999;G|0.001		0.627	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PRKCG	5582	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54407908	54407908	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:54407908A>T	ENST00000263431.3	+	16	1958	c.1676A>T	c.(1675-1677)gAc>gTc	p.D559V	PRKCG_ENST00000542049.1_Intron|PRKCG_ENST00000540413.1_Missense_Mutation_p.D559V	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	559	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	GATGGGGAGGACGAGGAGGAG	0.597																																					p.D559V		.											.	PRKCG	1367	0			c.A1676T						.						107.0	73.0	85.0					19																	54407908		2203	4300	6503	SO:0001583	missense	5582	exon16			GGGAGGACGAGGA	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1676A>T	19.37:g.54407908A>T	ENSP00000263431:p.Asp559Val	Somatic	119.0	1.0		WXS	Illumina HiSeq	Phase_I	148.0	16.0	NM_002739	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.257381	0.80246	.	.	ENSG00000126583	ENST00000540413;ENST00000263431	T;T	0.27402	1.67;1.67	5.07	5.07	0.68467	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.55689	0.1936	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.77557	0.962;0.99	T	0.61292	-0.7092	9	0.87932	D	0	.	13.0868	0.59146	1.0:0.0:0.0:0.0	.	559;559	F5H5C4;P05129	.;KPCG_HUMAN	V	559	ENSP00000443493:D559V;ENSP00000263431:D559V	ENSP00000263431:D559V	D	+	2	0	PRKCG	59099720	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	9.055000	0.93873	2.043000	0.60533	0.402000	0.26972	GAC	.		0.597	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
PTPRJ	5795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	48185171	48185171	+	Splice_Site	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:48185171G>T	ENST00000418331.2	+	23	4071		c.e23+1			NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J						contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TGCATTGCAGGTACGCAGATG	0.463																																					.		.											.	PTPRJ	541	0			c.3719+1G>T						.						93.0	64.0	73.0					11																	48185171		2201	4298	6499	SO:0001630	splice_region_variant	5795	exon23			TTGCAGGTACGCA	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.3719+1G>T	11.37:g.48185171G>T		Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	57.0	NM_002843	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Splice_Site	SNP	ENST00000418331.2	37	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221721	0.79464	.	.	ENSG00000149177	ENST00000418331	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7469	0.85475	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPRJ	48141747	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	9.823000	0.99369	2.545000	0.85829	0.650000	0.86243	.	.		0.463	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		Intron
RASGRP4	115727	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	38912788	38912788	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:38912788G>A	ENST00000587738.1	-	2	99	c.29C>T	c.(28-30)tCc>tTc	p.S10F	RASGRP4_ENST00000433821.2_Missense_Mutation_p.S10F|RASGRP4_ENST00000454404.2_Missense_Mutation_p.S10F|RASGRP4_ENST00000587753.1_Missense_Mutation_p.S10F|RASGRP4_ENST00000293062.9_Missense_Mutation_p.S10F|RASGRP4_ENST00000426920.2_Missense_Mutation_p.S10F|RASGRP4_ENST00000586305.1_Missense_Mutation_p.S10F			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	10					activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTCCTGGTGGGACTTCCTGTG	0.602																																					p.S10F		.											.	RASGRP4	660	0			c.C29T						.						33.0	38.0	36.0					19																	38912788		1921	4128	6049	SO:0001583	missense	115727	exon2			TGGTGGGACTTCC	AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.29C>T	19.37:g.38912788G>A	ENSP00000465772:p.Ser10Phe	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	6.0	NM_001146206	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	ENST00000587738.1	37	CCDS46068.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.995087	0.54041	.	.	ENSG00000171777	ENST00000433821;ENST00000293062;ENST00000426920;ENST00000405332;ENST00000454404	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	4.07	2.93	0.34026	.	0.827806	0.10518	N	0.665357	T	0.49915	0.1585	L	0.56769	1.78	0.39437	D	0.967186	D;D;D;D;D;D;D	0.61697	0.984;0.984;0.99;0.976;0.99;0.986;0.976	P;P;P;P;P;P;P	0.57371	0.819;0.75;0.527;0.556;0.804;0.748;0.459	T	0.54748	-0.8247	10	0.72032	D	0.01	-23.1122	11.5958	0.50972	0.0:0.1823:0.8177:0.0	.	10;10;10;10;10;10;10	C0LTP5;C0LTP7;C0LTP2;C0LTP4;C0LTP3;Q8TDF6-2;Q8TDF6	.;.;.;.;.;.;GRP4_HUMAN	F	10	ENSP00000411878:S10F;ENSP00000293062:S10F;ENSP00000445966:S10F;ENSP00000416463:S10F	ENSP00000293062:S10F	S	-	2	0	RASGRP4	43604628	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	3.129000	0.50500	2.284000	0.76573	0.462000	0.41574	TCC	.		0.602	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460540.1	NM_170604	
RBM12	10137	hgsc.bcm.edu;broad.mit.edu	37	20	34241969	34241969	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr20:34241969G>T	ENST00000374114.3	-	3	1539	c.1276C>A	c.(1276-1278)Cat>Aat	p.H426N	CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000317677.5_5'Flank|RBM12_ENST00000359646.1_Missense_Mutation_p.H426N|CPNE1_ENST00000397445.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397446.1_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.H426N|CPNE1_ENST00000397443.1_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	426						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			CCAGCCTCATGTGGTGATCTT	0.423											OREG0004044	type=REGULATORY REGION|Gene=CPNE1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.H426N		.											.	RBM12	93	0			c.C1276A						.						82.0	88.0	86.0					20																	34241969		2203	4300	6503	SO:0001583	missense	10137	exon2			CCTCATGTGGTGA	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.1276C>A	20.37:g.34241969G>T	ENSP00000363228:p.His426Asn	Somatic	75.0	0.0	846	WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_001198840	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	37	CCDS13261.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708023	0.48412	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.14516	2.5;2.5;2.5	4.77	3.83	0.44106	.	0.066271	0.64402	D	0.000012	T	0.15609	0.0376	L	0.55481	1.735	0.80722	D	1	B	0.12013	0.005	B	0.19666	0.026	T	0.03157	-1.1066	10	0.40728	T	0.16	-0.7006	13.2267	0.59919	0.0764:0.0:0.9236:0.0	.	426	Q9NTZ6	RBM12_HUMAN	N	426;426;426;225	ENSP00000363228:H426N;ENSP00000352668:H426N;ENSP00000363217:H426N	ENSP00000339879:H225N	H	-	1	0	RBM12	33705383	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	7.390000	0.79816	1.251000	0.43983	0.549000	0.68633	CAT	.		0.423	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
RET	5979	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	43615627	43615627	+	Silent	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr10:43615627G>A	ENST00000355710.3	+	15	2938	c.2706G>A	c.(2704-2706)gaG>gaA	p.E902E	RET_ENST00000340058.5_Silent_p.E902E	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	902	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TTTATGAAGAGGATTCCTACG	0.592		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.E902E	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	.	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	RET	4507	0			c.G2706A						.						70.0	62.0	65.0					10																	43615627		2202	4299	6501	SO:0001819	synonymous_variant	5979	exon15	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	TGAAGAGGATTCC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2706G>A	10.37:g.43615627G>A		Somatic	93.0	1.0		WXS	Illumina HiSeq	Phase_I	75.0	21.0	NM_020975	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	ENST00000355710.3	37	CCDS7200.1																																																																																			.		0.592	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975	
RFPL3	10738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32756294	32756294	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr22:32756294C>A	ENST00000249007.4	+	2	634	c.429C>A	c.(427-429)gaC>gaA	p.D143E	RFPL3_ENST00000397468.1_Missense_Mutation_p.D114E|RFPL3S_ENST00000400234.1_3'UTR|RFPL3S_ENST00000461833.1_5'Flank|RFPL3_ENST00000382088.3_Missense_Mutation_p.D114E|RFPL3S_ENST00000382084.4_3'UTR	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	143	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						TTTCTGACGACCTCAGGAGCG	0.522																																					p.D143E		.											.	RFPL3	91	0			c.C429A						.						131.0	118.0	123.0					22																	32756294		2203	4300	6503	SO:0001583	missense	10738	exon2			TGACGACCTCAGG	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.429C>A	22.37:g.32756294C>A	ENSP00000249007:p.Asp143Glu	Somatic	288.0	0.0		WXS	Illumina HiSeq	Phase_I	348.0	81.0	NM_001098535	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Missense_Mutation	SNP	ENST00000249007.4	37	CCDS43011.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.023273	0.35701	.	.	ENSG00000128276	ENST00000397468;ENST00000249007;ENST00000382088	T;T;T	0.18016	2.24;2.24;2.24	0.664	0.664	0.17890	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.35335	0.0928	M	0.79475	2.455	0.51233	D	0.999911	D	0.71674	0.998	D	0.69479	0.964	T	0.18808	-1.0325	9	0.87932	D	0	.	7.1611	0.25664	0.0:0.9999:0.0:1.0E-4	.	143	O75679	RFPL3_HUMAN	E	114;143;114	ENSP00000380609:D114E;ENSP00000249007:D143E;ENSP00000371520:D114E	ENSP00000249007:D143E	D	+	3	2	RFPL3	31086294	0.003000	0.15002	0.119000	0.21687	0.033000	0.12548	-0.268000	0.08607	0.624000	0.30286	0.194000	0.17425	GAC	C|1.000;A|0.000		0.522	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
RGPD4	285190	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	108499260	108499260	+	Missense_Mutation	SNP	C	C	A	rs570292087		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr2:108499260C>A	ENST00000408999.3	+	22	5274	c.5197C>A	c.(5197-5199)Ctt>Att	p.L1733I	RGPD4_ENST00000354986.4_Missense_Mutation_p.L1733I	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1733	GRIP. {ECO:0000255|PROSITE- ProRule:PRU00250}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AGAGAGACTTCTTCCTGTTAT	0.453																																					p.L1733I		.											.	RGPD4	2	0			c.C5197A						.						92.0	87.0	88.0					2																	108499260		692	1578	2270	SO:0001583	missense	285190	exon22			AGACTTCTTCCTG	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.5197C>A	2.37:g.108499260C>A	ENSP00000386810:p.Leu1733Ile	Somatic	937.0	0.0		WXS	Illumina HiSeq	Phase_I	1025.0	200.0	NM_182588	B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	14.11	2.436512	0.43224	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.40756	1.02;1.02	0.854	0.854	0.19007	GRIP (3);	.	.	.	.	T	0.28532	0.0706	L	0.39085	1.19	0.21499	N	0.999668	P	0.43352	0.804	B	0.37508	0.252	T	0.17961	-1.0352	9	0.87932	D	0	-0.7016	6.0524	0.19792	0.2992:0.7008:0.0:0.0	.	1733	Q7Z3J3	RGPD4_HUMAN	I	1733;1733;1100	ENSP00000347081:L1733I;ENSP00000386810:L1733I	ENSP00000347081:L1733I	L	+	1	0	RGPD4	107865692	1.000000	0.71417	0.918000	0.36340	0.887000	0.51463	1.684000	0.37649	0.767000	0.33267	0.398000	0.26397	CTT	.		0.453	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
ROBO2	6092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	77656991	77656991	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr3:77656991A>C	ENST00000461745.1	+	21	4079	c.3179A>C	c.(3178-3180)aAa>aCa	p.K1060T	ROBO2_ENST00000469233.1_3'UTR|ROBO2_ENST00000487694.3_Missense_Mutation_p.K1076T|ROBO2_ENST00000332191.8_Missense_Mutation_p.K1060T	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1060					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AACTCTTCTAAACCACAGAAA	0.433																																					p.K1060T		.											.	ROBO2	328	0			c.A3179C						.						71.0	74.0	73.0					3																	77656991		1833	4089	5922	SO:0001583	missense	6092	exon21			CTTCTAAACCACA	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3179A>C	3.37:g.77656991A>C	ENSP00000417164:p.Lys1060Thr	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	15.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	17.66|17.66|17.66	3.444552|3.444552|3.444552	0.63178|0.63178|0.63178	.|.|.	.|.|.	ENSG00000185008|ENSG00000185008|ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000461745;ENST00000332191|ENST00000490991|ENST00000471893	T;T;T|.|.	0.75154|.|.	-0.91;-0.87;-0.59|.|.	5.95|5.95|5.95	5.95|5.95|5.95	0.96441|0.96441|0.96441	.|.|.	0.000000|.|.	0.48286|.|.	D|.|.	0.000182|.|.	T|T|.	0.72486|0.72486|.	0.3466|0.3466|.	M|M|M	0.64997|0.64997|0.64997	1.995|1.995|1.995	.|.|.	.|.|.	.|.|.	P;D;D|.|.	0.61080|.|.	0.664;0.989;0.985|.|.	B;P;P|.|.	0.61592|.|.	0.115;0.891;0.777|.|.	T|T|.	0.72707|0.72707|.	-0.4212|-0.4212|.	9|4|.	0.59425|.|.	D|.|.	0.04|.|.	.|.|.	16.4237|16.4237|16.4237	0.83790|0.83790|0.83790	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	1076;1060;1060|.|.	Q19AB5;F8W703;Q9HCK4|.|.	.;.;ROBO2_HUMAN|.|.	T|H|Y	1076;1076;1060;1060|217|176	ENSP00000417335:K1076T;ENSP00000417164:K1060T;ENSP00000327536:K1060T|.|.	ENSP00000327536:K1060T|.|.	K|N|X	+|+|+	2|1|3	0|0|2	ROBO2|ROBO2|ROBO2	77739681|77739681|77739681	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.995000|0.995000|0.995000	0.50966|0.50966|0.50966	0.984000|0.984000|0.984000	0.73092|0.73092|0.73092	8.962000|8.962000|8.962000	0.93254|0.93254|0.93254	2.279000|2.279000|2.279000	0.76181|0.76181|0.76181	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	AAA|AAC|TAA	.		0.433	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
RPP25L	138716	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	34610870	34610870	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr9:34610870G>C	ENST00000297613.4	-	2	704	c.424C>G	c.(424-426)Ctg>Gtg	p.L142V	DCTN3_ENST00000479399.1_5'Flank|RPP25L_ENST00000378959.4_Missense_Mutation_p.L142V	NM_148179.2	NP_680545.1	Q8N5L8	RP25L_HUMAN	ribonuclease P/MRP 25kDa subunit-like	142						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										ATGGAACCCAGGCCAGGGGGT	0.662																																					p.L142V		.											.	.	.	0			c.C424G						.						41.0	47.0	45.0					9																	34610870		2203	4299	6502	SO:0001583	missense	138716	exon2			AACCCAGGCCAGG	BC032136	CCDS6559.1	9p11.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164967	ENSG00000164967			19909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 23"""	C9orf23		16998185	Standard	NM_148178		Approved	bA296L22.5, MGC29635	uc003zuv.3	Q8N5L8	OTTHUMG00000000443	ENST00000297613.4:c.424C>G	9.37:g.34610870G>C	ENSP00000297613:p.Leu142Val	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	12.0	NM_148179	D3DRM5	Missense_Mutation	SNP	ENST00000297613.4	37	CCDS6559.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783663	0.49891	.	.	ENSG00000164967	ENST00000378959;ENST00000297613	.	.	.	4.72	1.82	0.25136	.	0.238192	0.34750	N	0.003719	T	0.28200	0.0696	N	0.12746	0.255	0.32825	D	0.503318	P	0.46578	0.88	P	0.50270	0.636	T	0.28776	-1.0033	9	0.14656	T	0.56	-34.9387	8.3213	0.32130	0.2625:0.0:0.7375:0.0	.	142	Q8N5L8	CI023_HUMAN	V	142	.	ENSP00000297613:L142V	L	-	1	2	C9orf23	34600870	0.560000	0.26570	1.000000	0.80357	0.978000	0.69477	0.259000	0.18405	0.604000	0.29930	0.643000	0.83706	CTG	.		0.662	RPP25L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001130.1	NM_148179	
RTL1	388015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	101349498	101349498	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr14:101349498G>A	ENST00000534062.1	-	1	1686	c.1628C>T	c.(1627-1629)gCc>gTc	p.A543V	MIR433_ENST00000384837.1_RNA|MIR432_ENST00000606207.1_RNA|MIR136_ENST00000385207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	543					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						CCTCTCTAGGGCAATGCATGG	0.612																																					p.A543V		.											.	RTL1	46	0			c.C1628T						.						34.0	36.0	35.0					14																	101349498		692	1591	2283	SO:0001583	missense	388015	exon1			TCTAGGGCAATGC		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.1628C>T	14.37:g.101349498G>A	ENSP00000435342:p.Ala543Val	Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	36.0	NM_001134888	E9PKS8	Missense_Mutation	SNP	ENST00000534062.1	37	CCDS53910.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118516	0.37436	.	.	ENSG00000254656	ENST00000534062	T	0.23950	1.88	3.8	2.9	0.33743	.	0.256197	0.20606	N	0.089068	T	0.24236	0.0587	M	0.62723	1.935	0.19300	N	0.999977	P	0.48162	0.906	B	0.41571	0.36	T	0.14952	-1.0454	10	0.52906	T	0.07	.	6.8456	0.23987	0.0:0.196:0.6016:0.2024	.	543	E9PKS8	.	V	543	ENSP00000435342:A543V	ENSP00000435342:A543V	A	-	2	0	RTL1	100419251	0.089000	0.21612	0.485000	0.27403	0.387000	0.30353	1.592000	0.36676	1.173000	0.42796	-0.165000	0.13383	GCC	.		0.612	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
SCN9A	6335	hgsc.bcm.edu;bcgsc.ca	37	2	167056365	167056366	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr2:167056365_167056366delAG	ENST00000409435.1	-	26	4782_4783	c.4783_4784delCT	c.(4783-4785)ctafs	p.L1595fs	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Frame_Shift_Del_p.L1596fs|SCN9A_ENST00000409672.1_Frame_Shift_Del_p.L1584fs|SCN9A_ENST00000375387.4_Frame_Shift_Del_p.L1596fs			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1595					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAAATCAGCTAGAAACATACCT	0.381																																					p.1584_1584del		.											.	SCN9A	181	0			c.4750_4751del						.																																			SO:0001589	frameshift_variant	6335	exon27			TCAGCTAGAAACA	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4783_4784delCT	2.37:g.167056365_167056366delAG	ENSP00000386330:p.Leu1595fs	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	51.0	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Frame_Shift_Del	DEL	ENST00000409435.1	37	CCDS46441.1																																																																																			.		0.381	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
SCUBE1	80274	ucsc.edu;bcgsc.ca;mdanderson.org	37	22	43654278	43654278	+	Missense_Mutation	SNP	G	G	T	rs73420094	byFrequency	TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr22:43654278G>T	ENST00000360835.4	-	6	800	c.674C>A	c.(673-675)aCg>aAg	p.T225K	SCUBE1_ENST00000290460.7_Missense_Mutation_p.T225K	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	225					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				GCAACCACACGTGGGGCCTGT	0.587																																					p.T225K		.											.	SCUBE1	93	0			c.C674A						.						129.0	104.0	113.0					22																	43654278		2203	4300	6503	SO:0001583	missense	80274	exon6			CCACACGTGGGGC		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.674C>A	22.37:g.43654278G>T	ENSP00000354080:p.Thr225Lys	Somatic	133.0	1.0		WXS	Illumina HiSeq	.	126.0	29.0	NM_173050	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	37	CCDS14048.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	11.56|11.56|11.56	1.674274|1.674274|1.674274	0.29693|0.29693|0.29693	.|.|.	.|.|.	ENSG00000159307|ENSG00000159307|ENSG00000159307	ENST00000449304|ENST00000381243|ENST00000360835;ENST00000434132;ENST00000290460	.|.|T;T	.|.|0.30182	.|.|1.54;1.54	4.76|4.76|4.76	0.121|0.121|0.121	0.14695|0.14695|0.14695	.|.|Epidermal growth factor-like (1);	.|.|0.242286	.|.|0.41823	.|.|D	.|.|0.000807	T|T|T	0.14056|0.14056|0.14056	0.0340|0.0340|0.0340	N|N|N	0.17474|0.17474|0.17474	0.49|0.49|0.49	0.09310|0.09310|0.09310	N|N|N	0.999994|0.999994|0.999994	.|.|B;B	.|.|0.14012	.|.|0.009;0.0	.|.|B;B	.|.|0.13407	.|.|0.009;0.001	T|T|T	0.36040|0.36040|0.36040	-0.9764|-0.9764|-0.9764	5|6|10	.|0.87932|0.06625	.|D|T	.|0|0.88	.|.|.	9.8294|9.8294|9.8294	0.40932|0.40932|0.40932	0.6203:0.0:0.3797:0.0|0.6203:0.0:0.3797:0.0|0.6203:0.0:0.3797:0.0	.|.|.	.|.|225;225	.|.|B1AH90;Q8IWY4	.|.|.;SCUB1_HUMAN	Q|S|K	48|18|225	.|.|ENSP00000354080:T225K;ENSP00000290460:T225K	.|ENSP00000370642:R18S|ENSP00000290460:T225K	H|R|T	-|-|-	3|1|2	2|0|0	SCUBE1|SCUBE1|SCUBE1	41984222|41984222|41984222	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.977000|0.977000|0.977000	0.42913|0.42913|0.42913	0.994000|0.994000|0.994000	0.84299|0.84299|0.84299	1.872000|1.872000|1.872000	0.39549|0.39549|0.39549	-0.518000|-0.518000|-0.518000	0.06452|0.06452|0.06452	-0.254000|-0.254000|-0.254000	0.11334|0.11334|0.11334	CAC|CGT|ACG	G|0.974;A|0.026		0.587	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	
SDHA	6389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	223682	223682	+	Splice_Site	SNP	C	C	T	rs369321221		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr5:223682C>T	ENST00000264932.6	+	2	264	c.149C>T	c.(148-150)tCc>tTc	p.S50F	SDHA_ENST00000504309.1_Splice_Site_p.S50F|SDHA_ENST00000510361.1_Splice_Site_p.S50F	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	50					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GTTTCAGATTCCGTAAGTTCA	0.408									Familial Paragangliomas																												p.S50F		.											.	SDHA	226	0			c.C149T						.						81.0	78.0	79.0					5																	223682		2203	4300	6503	SO:0001630	splice_region_variant	6389	exon2	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	CAGATTCCGTAAG	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.150+1C>T	5.37:g.223682C>T		Somatic	355.0	0.0		WXS	Illumina HiSeq	Phase_I	331.0	75.0	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	c	7.855	0.724921	0.15439	.	.	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	T;T;T	0.72725	-0.68;0.17;-0.62	5.81	4.93	0.64822	.	0.516501	0.18259	U	0.146684	T	0.62011	0.2393	L	0.45581	1.43	0.27511	N	0.951698	P;P;P;B;P	0.44478	0.529;0.836;0.748;0.356;0.529	B;B;B;B;B	0.40329	0.163;0.326;0.243;0.322;0.322	T	0.55186	-0.8180	10	0.08381	T	0.77	.	14.5541	0.68089	0.0:0.8526:0.1474:0.0	.	50;50;50;50;56	E9PBJ5;B4DYN5;D6RFM5;P31040;Q59GW8	.;.;.;DHSA_HUMAN;.	F	50	ENSP00000264932:S50F;ENSP00000426514:S50F;ENSP00000427703:S50F	ENSP00000264932:S50F	S	+	2	0	SDHA	276682	0.993000	0.37304	0.034000	0.17996	0.243000	0.25628	3.607000	0.54102	1.423000	0.47198	0.557000	0.71058	TCC	.		0.408	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	Missense_Mutation
SDK1	221935	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4008918	4008918	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr7:4008918C>T	ENST00000404826.2	+	11	1715	c.1576C>T	c.(1576-1578)Cgg>Tgg	p.R526W	SDK1_ENST00000389531.3_Missense_Mutation_p.R526W	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	526	Ig-like C2-type 5.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R526R(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TGGCTCTGTCCGGATTCCTAG	0.502																																					p.R526W		.											.	SDK1	138	1	Substitution - coding silent(1)	lung(1)	c.C1576T						.						282.0	305.0	297.0					7																	4008918		2203	4300	6503	SO:0001583	missense	221935	exon11			TCTGTCCGGATTC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1576C>T	7.37:g.4008918C>T	ENSP00000385899:p.Arg526Trp	Somatic	145.0	1.0		WXS	Illumina HiSeq	Phase_I	185.0	68.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	32	5.107054	0.94292	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.68903	-0.36;-0.36	5.63	4.75	0.60458	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.349472	0.25648	N	0.029229	T	0.75729	0.3889	L	0.50333	1.59	0.39917	D	0.974102	D	0.76494	0.999	D	0.63192	0.912	T	0.77624	-0.2518	10	0.45353	T	0.12	.	16.2941	0.82762	0.1335:0.8665:0.0:0.0	.	526	Q7Z5N4	SDK1_HUMAN	W	526	ENSP00000385899:R526W;ENSP00000374182:R526W	ENSP00000374182:R526W	R	+	1	2	SDK1	3975444	1.000000	0.71417	0.956000	0.39512	0.995000	0.86356	5.694000	0.68272	1.515000	0.48885	0.655000	0.94253	CGG	.		0.502	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SEMA3C	10512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	80435065	80435065	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr7:80435065A>T	ENST00000265361.3	-	7	1109	c.548T>A	c.(547-549)cTt>cAt	p.L183H	SEMA3C_ENST00000544525.1_Missense_Mutation_p.L201H|SEMA3C_ENST00000536800.1_Missense_Mutation_p.L35H|SEMA3C_ENST00000419255.2_Missense_Mutation_p.L183H	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	183	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TCCAGAGAAAAGCTCCTCATC	0.323																																					p.L183H		.											.	SEMA3C	515	0			c.T548A						.						59.0	56.0	57.0					7																	80435065		2203	4298	6501	SO:0001583	missense	10512	exon7			GAGAAAAGCTCCT	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.548T>A	7.37:g.80435065A>T	ENSP00000265361:p.Leu183His	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	8.0	NM_006379	B4DRL8	Missense_Mutation	SNP	ENST00000265361.3	37	CCDS5596.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480304	0.84747	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525;ENST00000536800	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.65450	0.2692	H	0.96889	3.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.78730	-0.2090	10	0.87932	D	0	.	15.0131	0.71565	1.0:0.0:0.0:0.0	.	35;201;183	B4DRL8;F5H1Z7;Q99985	.;.;SEM3C_HUMAN	H	183;183;201;35	ENSP00000265361:L183H;ENSP00000411193:L183H;ENSP00000445649:L201H;ENSP00000438258:L35H	ENSP00000265361:L183H	L	-	2	0	SEMA3C	80273001	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.308000	0.96247	1.946000	0.56461	0.482000	0.46254	CTT	.		0.323	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379	
SF1	7536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64537468	64537468	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:64537468T>G	ENST00000377390.3	-	5	784	c.447A>C	c.(445-447)gaA>gaC	p.E149D	SF1_ENST00000334944.5_Missense_Mutation_p.E149D|SF1_ENST00000227503.9_Missense_Mutation_p.E149D|SF1_ENST00000377394.3_Missense_Mutation_p.E149D|SF1_ENST00000377387.1_Missense_Mutation_p.E274D|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000433274.2_Missense_Mutation_p.E123D|SF1_ENST00000422298.2_Missense_Mutation_p.E34D	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	149	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						CAAAGTTGATTTCTGGGTACT	0.468																																					p.E274D		.											.	SF1	227	0			c.A822C						.						92.0	80.0	84.0					11																	64537468		2201	4297	6498	SO:0001583	missense	7536	exon5			GTTGATTTCTGGG	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.447A>C	11.37:g.64537468T>G	ENSP00000366607:p.Glu149Asp	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	50.0	NM_001178030	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	ENST00000377390.3	37	CCDS31599.1	.	.	.	.	.	.	.	.	.	.	T	10.78	1.445870	0.25987	.	.	ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000377394;ENST00000334944;ENST00000422298;ENST00000433274	T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08	6.04	-1.36	0.09085	K Homology (1);	0.000000	0.85682	D	0.000000	T	0.18215	0.0437	N	0.05230	-0.09	0.45183	D	0.998196	B;B;B;B;B;B	0.27229	0.013;0.135;0.01;0.082;0.067;0.172	B;B;B;B;B;B	0.24394	0.053;0.024;0.017;0.053;0.031;0.046	T	0.05852	-1.0860	10	0.23891	T	0.37	.	11.574	0.50850	0.0:0.5902:0.0:0.4098	.	34;149;149;149;149;274	B4DX42;Q15637-6;Q15637-4;Q15637;Q15637-2;Q15637-5	.;.;.;SF01_HUMAN;.;.	D	274;149;149;149;149;34;123	ENSP00000366604:E274D;ENSP00000366607:E149D;ENSP00000227503:E149D;ENSP00000366611:E149D;ENSP00000334414:E149D;ENSP00000413084:E34D;ENSP00000396793:E123D	ENSP00000227503:E149D	E	-	3	2	SF1	64294044	0.745000	0.28261	0.998000	0.56505	0.145000	0.21501	-0.185000	0.09684	-0.038000	0.13624	0.460000	0.39030	GAA	.		0.468	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630	
SIX4	51804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	61186834	61186834	+	Nonsense_Mutation	SNP	G	G	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr14:61186834G>C	ENST00000216513.4	-	2	1252	c.1193C>G	c.(1192-1194)tCa>tGa	p.S398*		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	398					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		CACAATGTTTGATGACATTTT	0.423																																					p.S398X		.											.	SIX4	154	0			c.C1193G						.						124.0	98.0	107.0					14																	61186834		2203	4300	6503	SO:0001587	stop_gained	51804	exon2			ATGTTTGATGACA	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.1193C>G	14.37:g.61186834G>C	ENSP00000216513:p.Ser398*	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	31.0	NM_017420	Q4QQH5|Q4V764	Nonsense_Mutation	SNP	ENST00000216513.4	37	CCDS9749.2	.	.	.	.	.	.	.	.	.	.	G	34	5.400052	0.96030	.	.	ENSG00000100625	ENST00000216513;ENST00000554079;ENST00000556952	.	.	.	5.72	5.72	0.89469	.	0.304520	0.32314	N	0.006276	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.8965	0.96963	0.0:0.0:1.0:0.0	.	.	.	.	X	398;71;390	.	ENSP00000216513:S398X	S	-	2	0	SIX4	60256587	0.984000	0.35163	1.000000	0.80357	0.996000	0.88848	5.897000	0.69831	2.717000	0.92951	0.655000	0.94253	TCA	.		0.423	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2		
SLC1A1	6505	hgsc.bcm.edu;broad.mit.edu	37	9	4583116	4583116	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr9:4583116delT	ENST00000262352.3	+	11	1508	c.1272delT	c.(1270-1272)agtfs	p.S424fs		NM_004170.5	NP_004161.4	P43005	EAA3_HUMAN	solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1	424					D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|pancreas(1)|skin(1)	15		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|Pregabalin(DB00230)	TTGTGCTGAGTGCCGTGGGCC	0.597																																					p.S424fs		.											.	SLC1A1	514	0			c.1272delT						.						137.0	115.0	122.0					9																	4583116		2203	4300	6503	SO:0001589	frameshift_variant	6505	exon11			GCTGAGTGCCGTG		CCDS6452.1	9p24	2013-05-22			ENSG00000106688	ENSG00000106688		"""Solute carriers"""	10939	protein-coding gene	gene with protein product		133550				8020993	Standard	NM_004170		Approved	EAAC1, EAAT3	uc003zij.2	P43005	OTTHUMG00000019468	ENST00000262352.3:c.1272delT	9.37:g.4583116delT	ENSP00000262352:p.Ser424fs	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	13.0	NM_004170	O75587|Q5VZ24|Q8N199|Q9UEW2	Frame_Shift_Del	DEL	ENST00000262352.3	37	CCDS6452.1																																																																																			.		0.597	SLC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051571.1		
SLC1A1	6505	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	4583118	4583133	+	Frame_Shift_Del	DEL	CCGTGGGCCTGCCCGC	CCGTGGGCCTGCCCGC	-	rs139707526|rs199857691		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	CCGTGGGCCTGCCCGC	CCGTGGGCCTGCCCGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr9:4583118_4583133delCCGTGGGCCTGCCCGC	ENST00000262352.3	+	11	1510_1525	c.1274_1289delCCGTGGGCCTGCCCGC	c.(1273-1290)gccgtgggcctgcccgccfs	p.AVGLPA425fs		NM_004170.5	NP_004161.4	P43005	EAA3_HUMAN	solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1	425					D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.V426V(1)|p.A430T(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|pancreas(1)|skin(1)	15		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|Pregabalin(DB00230)	GTGCTGAGTGCCGTGGGCCTGCCCGCCGAGGATGTC	0.606																																					p.425_430del		.											.	SLC1A1	514	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.1274_1289del						.																																			SO:0001589	frameshift_variant	6505	exon11			TGAGTGCCGTGGG		CCDS6452.1	9p24	2013-05-22			ENSG00000106688	ENSG00000106688		"""Solute carriers"""	10939	protein-coding gene	gene with protein product		133550				8020993	Standard	NM_004170		Approved	EAAC1, EAAT3	uc003zij.2	P43005	OTTHUMG00000019468	ENST00000262352.3:c.1274_1289delCCGTGGGCCTGCCCGC	9.37:g.4583118_4583133delCCGTGGGCCTGCCCGC	ENSP00000262352:p.Ala425fs	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	13.0	NM_004170	O75587|Q5VZ24|Q8N199|Q9UEW2	Frame_Shift_Del	DEL	ENST00000262352.3	37	CCDS6452.1																																																																																			.		0.606	SLC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051571.1		
SLC26A9	115019	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	205890933	205890933	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:205890933G>A	ENST00000367135.3	-	17	1929	c.1816C>T	c.(1816-1818)Ccc>Tcc	p.P606S	SLC26A9_ENST00000367134.2_Missense_Mutation_p.P606S|SLC26A9_ENST00000340781.4_Missense_Mutation_p.P606S	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	606	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.		P -> L (in dbSNP:rs74146719). {ECO:0000269|PubMed:22544634}.		anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TCGGTGGGGGGCGCATTCTCA	0.622																																					p.P606S		.											.	SLC26A9	92	0			c.C1816T						.						73.0	61.0	65.0					1																	205890933		2203	4300	6503	SO:0001583	missense	115019	exon17			TGGGGGGCGCATT	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1816C>T	1.37:g.205890933G>A	ENSP00000356103:p.Pro606Ser	Somatic	101.0	1.0		WXS	Illumina HiSeq	Phase_I	175.0	56.0	NM_134325	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.843805	0.00067	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.91792	-2.91;-2.87;-2.91	4.23	-8.46	0.00942	Sulphate transporter/antisigma-factor antagonist STAS (3);	1.062670	0.07219	N	0.860518	T	0.65647	0.2711	N	0.00760	-1.21	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.62576	-0.6825	10	0.07482	T	0.82	.	1.8723	0.03211	0.2363:0.389:0.1849:0.1898	.	606;606	Q7LBE3;B1AVM8	S26A9_HUMAN;.	S	606	ENSP00000341682:P606S;ENSP00000356103:P606S;ENSP00000356102:P606S	ENSP00000341682:P606S	P	-	1	0	SLC26A9	204157556	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-0.169000	0.09911	-3.298000	0.00193	-1.004000	0.02495	CCC	.		0.622	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934	
SLC30A10	55532	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	220089062	220089067	+	In_Frame_Del	DEL	AAGTCC	AAGTCC	-	rs370815252		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	AAGTCC	AAGTCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:220089062_220089067delAAGTCC	ENST00000366926.3	-	4	1343_1348	c.1182_1187delGGACTT	c.(1180-1188)aaggactta>aaa	p.DL395del	SLC30A10_ENST00000536446.1_In_Frame_Del_p.DL150del|SLC30A10_ENST00000484079.1_5'UTR	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	395					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		GAGCAACAGTAAGTCCTTCTGCTCCA	0.529																																					p.394_396del	Colon(76;360 1614 43677 51136)	.											.	SLC30A10	90	0			c.1182_1187del						.																																			SO:0001651	inframe_deletion	55532	exon4			AACAGTAAGTCCT	AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.1182_1187delGGACTT	1.37:g.220089062_220089067delAAGTCC	ENSP00000355893:p.Asp395_Leu396del	Somatic	176.0	0.0		WXS	Illumina HiSeq	Phase_I	248.0	22.0	NM_018713	Q49AL9|Q9NPW0	In_Frame_Del	DEL	ENST00000366926.3	37	CCDS31026.1																																																																																			.		0.529	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713	
SLC6A9	6536	hgsc.bcm.edu;bcgsc.ca	37	1	44468280	44468280	+	Silent	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:44468280C>T	ENST00000360584.2	-	7	1172	c.981G>A	c.(979-981)ctG>ctA	p.L327L	SLC6A9_ENST00000372310.3_Silent_p.L254L|SLC6A9_ENST00000537678.1_Silent_p.L189L|SLC6A9_ENST00000372306.3_Silent_p.L254L|SLC6A9_ENST00000475075.2_Silent_p.L143L|SLC6A9_ENST00000357730.2_Silent_p.L273L|SLC6A9_ENST00000372307.3_Silent_p.L189L	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	327					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	ACAGAATGGTCAGCACCACGT	0.612																																					p.L327L		.											.	SLC6A9	90	0			c.G981A						.						111.0	111.0	111.0					1																	44468280		2203	4300	6503	SO:0001819	synonymous_variant	6536	exon7			AATGGTCAGCACC	S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.981G>A	1.37:g.44468280C>T		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	5.0	NM_201649	A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Silent	SNP	ENST00000360584.2	37	CCDS41317.1																																																																																			.		0.612	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000022825.2	NM_201649	
SLITRK1	114798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	84454076	84454076	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr13:84454076G>T	ENST00000377084.2	-	1	2452	c.1567C>A	c.(1567-1569)Cag>Aag	p.Q523K		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	523					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		AGGTCTATCTGGATGATGGAG	0.557																																					p.Q523K		.											.	SLITRK1	94	0			c.C1567A						.						53.0	54.0	54.0					13																	84454076		2203	4300	6503	SO:0001583	missense	114798	exon1			CTATCTGGATGAT	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1567C>A	13.37:g.84454076G>T	ENSP00000366288:p.Gln523Lys	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	29.0	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803158	0.70682	.	.	ENSG00000178235	ENST00000377084	T	0.50813	0.73	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.54498	0.1862	L	0.41356	1.27	0.80722	D	1	P	0.51653	0.947	P	0.54100	0.742	T	0.55490	-0.8133	10	0.56958	D	0.05	-11.0837	17.693	0.88273	0.0:0.0:1.0:0.0	.	523	Q96PX8	SLIK1_HUMAN	K	523	ENSP00000366288:Q523K	ENSP00000366288:Q523K	Q	-	1	0	SLITRK1	83352077	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.841000	0.86834	2.603000	0.88011	0.655000	0.94253	CAG	.		0.557	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
ST6GALNAC1	55808	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	74625422	74625422	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:74625422C>A	ENST00000156626.7	-	2	702	c.503G>T	c.(502-504)gGg>gTg	p.G168V	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	168					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						GGTCTGGCCCCCATTTCCTTG	0.582																																					p.G168V		.											.	ST6GALNAC1	90	0			c.G503T						.						176.0	154.0	162.0					17																	74625422		2203	4300	6503	SO:0001583	missense	55808	exon2			TGGCCCCCATTTC	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.503G>T	17.37:g.74625422C>A	ENSP00000156626:p.Gly168Val	Somatic	269.0	0.0		WXS	Illumina HiSeq	Phase_I	439.0	32.0	NM_018414	Q6UW90|Q9NSC6	Missense_Mutation	SNP	ENST00000156626.7	37	CCDS11748.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.221649	0.39300	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.34667	1.47;1.35	3.77	-3.86	0.04230	.	1.585260	0.03407	N	0.204202	T	0.40570	0.1122	L	0.38175	1.15	0.09310	N	1	D	0.57899	0.981	P	0.55161	0.77	T	0.48139	-0.9061	10	0.38643	T	0.18	-1.3588	9.5701	0.39422	0.0:0.3291:0.0:0.6709	.	168	Q9NSC7	SIA7A_HUMAN	V	168	ENSP00000156626:G168V;ENSP00000351991:G168V	ENSP00000156626:G168V	G	-	2	0	ST6GALNAC1	72137017	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-1.400000	0.02504	-0.747000	0.04759	-0.339000	0.08088	GGG	.		0.582	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450974.1	NM_018414	
SUPT16H	11198	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	21821900	21821902	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr14:21821900_21821902delTCC	ENST00000216297.2	-	24	3218_3220	c.2880_2882delGGA	c.(2878-2883)gaggac>gac	p.E960del		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	960	Glu-rich (acidic).				DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TTCATCACTGTCCTCCTCTTCCT	0.409																																					p.960_961del		.											.	SUPT16H	90	0			c.2880_2882del						.																																			SO:0001651	inframe_deletion	11198	exon24			TCACTGTCCTCCT	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.2880_2882delGGA	14.37:g.21821903_21821905delTCC	ENSP00000216297:p.Glu960del	Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	248.0	39.0	NM_007192	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	In_Frame_Del	DEL	ENST00000216297.2	37	CCDS9569.1																																																																																			.		0.409	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074025.2		
TARBP1	6894	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	234536930	234536930	+	Silent	SNP	T	T	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:234536930T>A	ENST00000040877.1	-	25	4067	c.4068A>T	c.(4066-4068)ctA>ctT	p.L1356L	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1356					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TACTCACCTCTAGACAATAAT	0.348																																					p.L1356L		.											.	TARBP1	93	0			c.A4068T						.						96.0	89.0	91.0					1																	234536930		2203	4300	6503	SO:0001819	synonymous_variant	6894	exon25			CACCTCTAGACAA		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4068A>T	1.37:g.234536930T>A		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	46.0	NM_005646	Q9H581	Silent	SNP	ENST00000040877.1	37	CCDS1601.1																																																																																			.		0.348	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646	
TENM4	26011	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	78380618	78380618	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr11:78380618C>T	ENST00000278550.7	-	32	7234	c.6772G>A	c.(6772-6774)Gat>Aat	p.D2258N		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2258					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										AGGAAGCCATCCTCATCCATC	0.577																																					p.D2258N		.											.	.	.	0			c.G6772A						.						167.0	172.0	170.0					11																	78380618		2173	4266	6439	SO:0001583	missense	26011	exon32			AGCCATCCTCATC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6772G>A	11.37:g.78380618C>T	ENSP00000278550:p.Asp2258Asn	Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	244.0	15.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.567626	0.86439	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89681	-2.55;0.99	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.93703	0.7988	M	0.67953	2.075	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.92953	0.6382	9	.	.	.	.	18.8078	0.92045	0.0:1.0:0.0:0.0	.	2258	Q6N022	TEN4_HUMAN	N	2258;722	ENSP00000278550:D2258N;ENSP00000431711:D722N	.	D	-	1	0	ODZ4	78058266	1.000000	0.71417	0.999000	0.59377	0.933000	0.57130	7.651000	0.83577	2.677000	0.91161	0.655000	0.94253	GAT	.		0.577	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
TFDP1	7027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	114277525	114277525	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr13:114277525C>T	ENST00000375370.5	+	4	322	c.110C>T	c.(109-111)tCc>tTc	p.S37F	TFDP1_ENST00000538138.1_5'UTR|TFDP1_ENST00000465174.1_3'UTR|TFDP1_ENST00000544902.1_5'UTR	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1	37					anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			GTTCACCCCTCCACCGTCAAC	0.562										TSP Lung(29;0.18)																											p.S37F		.											.	TFDP1	416	0			c.C110T						.						98.0	74.0	82.0					13																	114277525		2202	4300	6502	SO:0001583	missense	7027	exon4			ACCCCTCCACCGT	BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.110C>T	13.37:g.114277525C>T	ENSP00000364519:p.Ser37Phe	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	53.0	NM_007111	B4DLQ9|Q5JSB4|Q8IZL5	Missense_Mutation	SNP	ENST00000375370.5	37	CCDS9538.1	.	.	.	.	.	.	.	.	.	.	C	10.08	1.253504	0.22965	.	.	ENSG00000198176	ENST00000375370;ENST00000408980;ENST00000453989	T;T;T	0.34472	1.77;1.38;1.36	4.65	3.81	0.43845	.	0.247570	0.42294	D	0.000735	T	0.33059	0.0850	L	0.58101	1.795	0.80722	D	1	B;P;P	0.43431	0.075;0.807;0.807	B;B;B	0.36504	0.028;0.226;0.226	T	0.19844	-1.0293	10	0.56958	D	0.05	.	12.6444	0.56725	0.0:0.9193:0.0:0.0807	.	37;37;37	Q5JSB5;Q5JSB6;Q14186	.;.;TFDP1_HUMAN	F	37	ENSP00000364519:S37F;ENSP00000386145:S37F;ENSP00000401389:S37F	ENSP00000364519:S37F	S	+	2	0	TFDP1	113325526	0.999000	0.42202	0.071000	0.20095	0.096000	0.18686	4.600000	0.61083	0.950000	0.37743	0.491000	0.48974	TCC	.		0.562	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045918.3	NM_007111	
TGIF2	60436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	35219383	35219383	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr20:35219383C>T	ENST00000373874.2	+	3	462	c.263C>T	c.(262-264)cCt>cTt	p.P88L	TGIF2_ENST00000373872.4_Missense_Mutation_p.P88L|RP5-977B1.11_ENST00000561134.1_RNA|TGIF2-C20orf24_ENST00000558530.1_Intron	NM_001199514.1|NM_001199515.1	NP_001186443.1|NP_001186444.1	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	88					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway (GO:0038092)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GGCAAAGACCCTAATCAGTTT	0.567																																					p.P88L		.											.	TGIF2	92	0			c.C263T						.						117.0	132.0	127.0					20																	35219383		2203	4300	6503	SO:0001583	missense	60436	exon3			AAGACCCTAATCA	AB042646	CCDS13278.1	20q11.23	2012-12-12	2007-02-07		ENSG00000118707	ENSG00000118707		"""Homeoboxes / TALE class"""	15764	protein-coding gene	gene with protein product		607294	"""TGFB-induced factor 2 (TALE family homeobox)"""			11006116	Standard	NM_021809		Approved		uc021wcv.1	Q9GZN2	OTTHUMG00000172332	ENST00000373874.2:c.263C>T	20.37:g.35219383C>T	ENSP00000362981:p.Pro88Leu	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	47.0	NM_021809	B2R9U3|E1P5T9|H0YNI0	Missense_Mutation	SNP	ENST00000373874.2	37	CCDS13278.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458391	0.84317	.	.	ENSG00000118707	ENST00000373874;ENST00000373872	D;D	0.83250	-1.7;-1.7	5.71	4.74	0.60224	Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.89125	0.6626	L	0.58583	1.82	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89794	0.3970	10	0.62326	D	0.03	-17.9974	14.9153	0.70792	0.144:0.856:0.0:0.0	.	88	Q9GZN2	TGIF2_HUMAN	L	88	ENSP00000362981:P88L;ENSP00000362979:P88L	ENSP00000362979:P88L	P	+	2	0	TGIF2	34652797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.440000	0.80464	1.348000	0.45733	0.561000	0.74099	CCT	.		0.567	TGIF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079004.2	NM_021809	
TIAM2	26230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155504406	155504406	+	Missense_Mutation	SNP	G	G	T	rs76467763		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr6:155504406G>T	ENST00000461783.3	+	16	4109	c.2836G>T	c.(2836-2838)Ggg>Tgg	p.G946W	TIAM2_ENST00000360366.4_Missense_Mutation_p.G970W|TIAM2_ENST00000529824.2_Missense_Mutation_p.G946W|TIAM2_ENST00000318981.5_Missense_Mutation_p.G946W|TIAM2_ENST00000456144.1_Missense_Mutation_p.G946W|TIAM2_ENST00000528391.2_Missense_Mutation_p.G282W|TIAM2_ENST00000367174.2_Missense_Mutation_p.G322W|TIAM2_ENST00000456877.2_Missense_Mutation_p.G258W			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	946	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GACCTTAAATGGGGAAGCTGT	0.468																																					p.G946W		.											.	TIAM2	93	0			c.G2836T						.						91.0	94.0	93.0					6																	155504406		2203	4300	6503	SO:0001583	missense	26230	exon13			TTAAATGGGGAAG		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.2836G>T	6.37:g.155504406G>T	ENSP00000437188:p.Gly946Trp	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	28.0	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200618	0.79015	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391	T;T;T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9	5.67	5.67	0.87782	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.65015	0.2651	M	0.84683	2.71	0.53688	D	0.999975	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.70063	-0.4975	10	0.87932	D	0	.	17.9536	0.89061	0.0:0.0:1.0:0.0	.	282;946;970;946	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	W	946;1192;946;946;946;322;970;946;258;282	ENSP00000437188:G946W;ENSP00000434901:G946W;ENSP00000407746:G946W;ENSP00000327315:G946W;ENSP00000356142:G322W;ENSP00000353528:G970W;ENSP00000433348:G946W;ENSP00000407183:G258W;ENSP00000435335:G282W	ENSP00000327315:G946W	G	+	1	0	TIAM2	155546098	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.749000	0.62155	2.677000	0.91161	0.655000	0.94253	GGG	.		0.468	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
TMEM132D	121256	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	129559354	129559354	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr12:129559354C>T	ENST00000422113.2	-	9	2692	c.2366G>A	c.(2365-2367)gGa>gAa	p.G789E	TMEM132D_ENST00000389441.4_Missense_Mutation_p.G327E	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	789					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GTTTGCCGTTCCAACAGCTAA	0.478																																					p.G789E		.											.	TMEM132D	106	0			c.G2366A						.						190.0	155.0	167.0					12																	129559354		2203	4300	6503	SO:0001583	missense	121256	exon9			GCCGTTCCAACAG	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2366G>A	12.37:g.129559354C>T	ENSP00000408581:p.Gly789Glu	Somatic	371.0	0.0		WXS	Illumina HiSeq	Phase_I	323.0	25.0	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.268332	0.40095	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.13657	2.57;2.57	4.2	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.44371	0.1290	M	0.88450	2.955	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.81914	0.989;0.995	T	0.56444	-0.7978	9	.	.	.	-25.8194	16.8845	0.86072	0.0:1.0:0.0:0.0	.	789;327	Q14C87;Q14C87-2	T132D_HUMAN;.	E	327;789	ENSP00000374092:G327E;ENSP00000408581:G789E	.	G	-	2	0	TMEM132D	128125307	1.000000	0.71417	0.045000	0.18777	0.030000	0.12068	5.735000	0.68587	2.033000	0.60031	0.462000	0.41574	GGA	.		0.478	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
TMEM181	57583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	159029441	159029441	+	Silent	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr6:159029441C>T	ENST00000367090.3	+	9	1172	c.1161C>T	c.(1159-1161)ttC>ttT	p.F387F		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	387					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		AGTCCATGTTCCTGTGCGCCC	0.602																																					p.F387F		.											.	TMEM181	70	0			c.C1161T						.						143.0	140.0	141.0					6																	159029441		2135	4267	6402	SO:0001819	synonymous_variant	57583	exon9			CATGTTCCTGTGC	AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.1161C>T	6.37:g.159029441C>T		Somatic	366.0	0.0		WXS	Illumina HiSeq	Phase_I	315.0	141.0	NM_020823	Q5VTU1	Silent	SNP	ENST00000367090.3	37	CCDS43520.1																																																																																			.		0.602	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042873.1	NM_020823	
TNS3	64759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	47384383	47384383	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr7:47384383T>A	ENST00000398879.1	-	20	2986	c.2620A>T	c.(2620-2622)Agc>Tgc	p.S874C	TNS3_ENST00000311160.9_Missense_Mutation_p.S874C|TNS3_ENST00000355730.3_Missense_Mutation_p.S634C			Q68CZ2	TENS3_HUMAN	tensin 3	874					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						CTGGCTGGGCTGCTCAGCGGG	0.617																																					p.S874C		.											.	TNS3	94	0			c.A2620T						.						40.0	48.0	46.0					7																	47384383		1954	4147	6101	SO:0001583	missense	64759	exon20			CTGGGCTGCTCAG	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.2620A>T	7.37:g.47384383T>A	ENSP00000381854:p.Ser874Cys	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	32.0	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	37	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	T	10.55	1.380436	0.24944	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000545849;ENST00000457718	D;D;D;D	0.94280	-2.96;-2.96;-3.39;-3.07	5.43	-1.98	0.07480	.	1.316600	0.04948	N	0.459690	D	0.85600	0.5734	N	0.17082	0.46	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.73642	-0.3918	10	0.62326	D	0.03	-3.4579	4.9134	0.13833	0.0:0.2763:0.2842:0.4395	.	874	Q68CZ2	TENS3_HUMAN	C	874;984;874;634;330;977	ENSP00000312143:S874C;ENSP00000381854:S874C;ENSP00000347968:S634C;ENSP00000414358:S977C	ENSP00000312143:S874C	S	-	1	0	TNS3	47350908	0.010000	0.17322	0.001000	0.08648	0.363000	0.29612	0.195000	0.17155	-0.205000	0.10219	0.379000	0.24179	AGC	.		0.617	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
TP53	7157	hgsc.bcm.edu;bcgsc.ca	37	17	7579380	7579380	+	Frame_Shift_Del	DEL	A	A	-			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr17:7579380delA	ENST00000269305.4	-	4	496	c.307delT	c.(307-309)tacfs	p.Y103fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.Y103fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.Y103fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.Y103fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.Y103fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.Y103fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	103	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Y103fs*19(3)|p.K101_Y103>N(3)|p.Q100fs*37(3)|p.G59fs*23(3)|p.V73fs*9(1)|p.W91fs*13(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCCCTGGTAGGTTTTCTGG	0.637		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y103fs	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,+2	TP53	70225	25	Deletion - Frameshift(14)|Whole gene deletion(8)|Complex - deletion inframe(3)	central_nervous_system(5)|bone(4)|upper_aerodigestive_tract(3)|ovary(3)|prostate(3)|lung(2)|breast(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)	c.307delT						.						53.0	53.0	53.0					17																	7579380		2203	4300	6503	SO:0001589	frameshift_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CCTGGTAGGTTTT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.307delT	17.37:g.7579380delA	ENSP00000269305:p.Tyr103fs	Somatic	153.0	2.0		WXS	Illumina HiSeq	Phase_I	86.0	73.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.637	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRPA1	8989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	72967815	72967815	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr8:72967815C>A	ENST00000262209.4	-	12	1592	c.1385G>T	c.(1384-1386)tGt>tTt	p.C462F	RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	462					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GAGCCTCTGACAGGTATTGAT	0.398																																					p.C462F		.											.	TRPA1	230	0			c.G1385T						.						52.0	54.0	53.0					8																	72967815		2203	4296	6499	SO:0001583	missense	8989	exon12			CTCTGACAGGTAT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1385G>T	8.37:g.72967815C>A	ENSP00000262209:p.Cys462Phe	Somatic	320.0	0.0		WXS	Illumina HiSeq	Phase_I	345.0	74.0	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141239	0.77775	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.63744	-0.06;-0.06	5.27	5.27	0.74061	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.80076	0.4557	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82206	-0.0572	10	0.72032	D	0.01	-16.8115	18.8668	0.92294	0.0:1.0:0.0:0.0	.	462	O75762	TRPA1_HUMAN	F	314;462	ENSP00000428151:C314F;ENSP00000262209:C462F	ENSP00000262209:C462F	C	-	2	0	TRPA1	73130369	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.187000	0.77730	2.452000	0.82932	0.557000	0.71058	TGT	.		0.398	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
TRPV5	56302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	142625797	142625797	+	Missense_Mutation	SNP	C	C	T	rs377425606		TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr7:142625797C>T	ENST00000265310.1	-	6	1099	c.751G>A	c.(751-753)Ggt>Agt	p.G251S	TRPV5_ENST00000442623.1_Missense_Mutation_p.G251S	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	251					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					ACAGTGTTACCCTCCACTCCA	0.587																																					p.G251S		.											.	TRPV5	177	0			c.G751A						.	C	SER/GLY	1,4405	2.1+/-5.4	0,1,2202	87.0	80.0	82.0		751	4.1	1.0	7		82	0,8600		0,0,4300	no	missense	TRPV5	NM_019841.4	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	251/730	142625797	1,13005	2203	4300	6503	SO:0001583	missense	56302	exon6			TGTTACCCTCCAC	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.751G>A	7.37:g.142625797C>T	ENSP00000265310:p.Gly251Ser	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	12.0	NM_019841	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	ENST00000265310.1	37	CCDS5875.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378337	0.82682	2.27E-4	0.0	ENSG00000127412	ENST00000265310;ENST00000439304;ENST00000442623	D;T;D	0.90955	-2.76;0.35;-2.76	4.09	4.09	0.47781	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.96337	0.8805	M	0.93763	3.455	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.80764	0.936;0.994	D	0.97376	0.9979	10	0.72032	D	0.01	-14.0059	15.8322	0.78764	0.0:1.0:0.0:0.0	.	251;251	E9PBZ6;Q9NQA5	.;TRPV5_HUMAN	S	251;245;251	ENSP00000265310:G251S;ENSP00000406361:G245S;ENSP00000406572:G251S	ENSP00000265310:G251S	G	-	1	0	TRPV5	142335919	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	7.434000	0.80377	2.278000	0.76064	0.462000	0.41574	GGT	.		0.587	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841	
UFD1L	7353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	19463069	19463069	+	Silent	SNP	G	G	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr22:19463069G>C	ENST00000263202.10	-	2	189	c.60C>G	c.(58-60)tcC>tcG	p.S20S	UFD1L_ENST00000360834.4_Silent_p.S20S|UFD1L_ENST00000399523.1_Silent_p.S20S|UFD1L_ENST00000484101.1_5'UTR	NM_001035247.2|NM_005659.6	NP_001030324.2|NP_005650.2	Q92890	UFD1_HUMAN	ubiquitin fusion degradation 1 like (yeast)	20					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			large_intestine(3)|upper_aerodigestive_tract(1)	4	Colorectal(54;0.0993)					GGTACTGTGTGGAGAAGCGGT	0.438																																					p.S20S		.											.	UFD1L	227	0			c.C60G						.						137.0	124.0	129.0					22																	19463069		2203	4300	6503	SO:0001819	synonymous_variant	7353	exon2			CTGTGTGGAGAAG	AJ239058	CCDS13761.1, CCDS33600.1, CCDS33600.2	22q11.2	2014-05-02	2005-10-10		ENSG00000070010	ENSG00000070010			12520	protein-coding gene	gene with protein product		601754	"""ubiquitin fusion degradation 1-like"""			9063746	Standard	NM_005659		Approved	UFD1	uc002zpm.2	Q92890	OTTHUMG00000150130	ENST00000263202.10:c.60C>G	22.37:g.19463069G>C		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	22.0	NM_005659	A8MW31|Q9Y5N0	Silent	SNP	ENST00000263202.10	37	CCDS13761.1																																																																																			.		0.438	UFD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316460.6		
UFL1	23376	hgsc.bcm.edu;broad.mit.edu	37	6	96997391	96997391	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr6:96997391G>A	ENST00000369278.4	+	14	1690	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	542					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										GGACTTGCAAGAAGAAGTTTC	0.348																																					p.E542K		.											.	.	.	0			c.G1624A						.						67.0	64.0	65.0					6																	96997391		2203	4298	6501	SO:0001583	missense	23376	exon14			TTGCAAGAAGAAG	BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.1624G>A	6.37:g.96997391G>A	ENSP00000358283:p.Glu542Lys	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	6.0	NM_015323	A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Missense_Mutation	SNP	ENST00000369278.4	37	CCDS5034.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.944818	0.92593	.	.	ENSG00000014123	ENST00000369278	T	0.42513	0.97	5.64	5.64	0.86602	.	0.044345	0.85682	D	0.000000	T	0.41419	0.1158	M	0.71296	2.17	0.80722	D	1	P	0.52577	0.954	P	0.47673	0.554	T	0.21143	-1.0254	10	0.28530	T	0.3	-26.5139	18.6746	0.91524	0.0:0.0:1.0:0.0	.	542	O94874	UFL1_HUMAN	K	542	ENSP00000358283:E542K	ENSP00000358283:E542K	E	+	1	0	KIAA0776	97104112	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.755000	0.91646	2.646000	0.89796	0.650000	0.86243	GAA	.		0.348	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041557.1	NM_015323	
UGT1A4	54657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234628158	234628158	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr2:234628158A>G	ENST00000373409.3	+	1	735	c.692A>G	c.(691-693)tAt>tGt	p.Y231C	UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A6_ENST00000480628.1_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	231					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	TCTGCCCCTTATGCAAGTCTT	0.498																																					p.Y231C	Melanoma(99;1011 1962 13201 26492)	.											.	UGT1A4	2	0			c.A692G						.						238.0	225.0	230.0					2																	234628158		2203	4300	6503	SO:0001583	missense	54657	exon1			CCCCTTATGCAAG	M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.692A>G	2.37:g.234628158A>G	ENSP00000362508:p.Tyr231Cys	Somatic	289.0	0.0		WXS	Illumina HiSeq	Phase_I	299.0	85.0	NM_007120	B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	ENST00000373409.3	37	CCDS33405.1	.	.	.	.	.	.	.	.	.	.	A	12.85	2.062683	0.36373	.	.	ENSG00000244474	ENST00000373409	T	0.62639	0.01	4.49	0.06	0.14334	.	.	.	.	.	T	0.81735	0.4885	M	0.93978	3.48	0.09310	N	1	D;D	0.89917	1.0;0.998	D;D	0.79108	0.992;0.976	T	0.70945	-0.4734	9	0.87932	D	0	.	10.6371	0.45571	0.5786:0.0:0.0:0.4214	.	231;231	B8K288;P22310	.;UD14_HUMAN	C	231	ENSP00000362508:Y231C	ENSP00000362508:Y231C	Y	+	2	0	UGT1A4	234292897	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-2.217000	0.01220	0.081000	0.16988	0.402000	0.26972	TAT	.		0.498	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130984.1	NM_007120	
USP7	7874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	9000399	9000399	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr16:9000399G>A	ENST00000344836.4	-	13	1510	c.1312C>T	c.(1312-1314)Caa>Taa	p.Q438*	USP7_ENST00000535863.1_Nonsense_Mutation_p.Q339*|USP7_ENST00000381886.4_Nonsense_Mutation_p.Q422*	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	438	USP.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						TCTGTTTTTTGCAAAAATTCA	0.323																																					p.Q438X		.											.	USP7	661	0			c.C1312T						.						76.0	77.0	77.0					16																	9000399		2197	4300	6497	SO:0001587	stop_gained	7874	exon13			TTTTTTGCAAAAA	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.1312C>T	16.37:g.9000399G>A	ENSP00000343535:p.Gln438*	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	22.0	NM_003470	A6NMY8|B7Z815|H0Y3G8	Nonsense_Mutation	SNP	ENST00000344836.4	37	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	G	39	7.318442	0.98207	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549;ENST00000542333	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	19.0925	0.93233	0.0:0.0:1.0:0.0	.	.	.	.	X	438;446;339;339;380	.	ENSP00000343535:Q438X	Q	-	1	0	USP7	8907900	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.751000	0.98889	2.509000	0.84616	0.561000	0.74099	CAA	.		0.323	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		
VPS8	23355	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	184711798	184711798	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr3:184711798G>C	ENST00000437079.3	+	43	3784	c.3613G>C	c.(3613-3615)Gga>Cga	p.G1205R	VPS8_ENST00000446204.2_Missense_Mutation_p.G1113R|VPS8_ENST00000287546.4_Missense_Mutation_p.G1205R|VPS8_ENST00000436792.2_Missense_Mutation_p.G1203R	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1205							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AGGAAAACTTGGAGAAATCCA	0.299																																					p.G1205R		.											.	VPS8	91	0			c.G3613C						.						60.0	55.0	57.0					3																	184711798		1793	4060	5853	SO:0001583	missense	23355	exon42			AAACTTGGAGAAA	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3613G>C	3.37:g.184711798G>C	ENSP00000397879:p.Gly1205Arg	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	5.0	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616400	0.87359	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.21191	2.02;2.02;2.02;2.03	5.83	5.83	0.93111	.	0.220796	0.46442	D	0.000286	T	0.42698	0.1214	L	0.49126	1.545	0.46437	D	0.999046	D;D;D	0.89917	1.0;0.972;0.997	D;P;D	0.71184	0.963;0.861;0.972	T	0.02173	-1.1201	10	0.35671	T	0.21	-28.8427	20.1099	0.97909	0.0:0.0:1.0:0.0	.	1205;1113;1203	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	R	1205;1205;1203;1113	ENSP00000287546:G1205R;ENSP00000397879:G1205R;ENSP00000404704:G1203R;ENSP00000405483:G1113R	ENSP00000287546:G1205R	G	+	1	0	VPS8	186194492	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.985000	0.76193	2.753000	0.94483	0.585000	0.79938	GGA	.		0.299	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
VWA7	80737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31742377	31742377	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr6:31742377C>T	ENST00000375688.4	-	5	837	c.637G>A	c.(637-639)Gag>Aag	p.E213K	VWA7_ENST00000375686.3_Missense_Mutation_p.E213K|VWA7_ENST00000447450.1_Missense_Mutation_p.E213K|VWA7_ENST00000467576.1_5'UTR			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	213						extracellular region (GO:0005576)											CTCAACTCCTCGCAATCGGAG	0.572																																					p.E213K		.											.	.	.	0			c.G637A						.						66.0	57.0	60.0					6																	31742377		1511	2707	4218	SO:0001583	missense	80737	exon5			ACTCCTCGCAATC		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.637G>A	6.37:g.31742377C>T	ENSP00000364840:p.Glu213Lys	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	18.0	NM_025258	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	C	2.625	-0.287659	0.05605	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.29917	2.76;2.54;1.55	5.51	3.71	0.42584	.	0.582575	0.18142	N	0.150398	T	0.06234	0.0161	L	0.29908	0.895	0.09310	N	1	P	0.50710	0.938	B	0.39840	0.311	T	0.13764	-1.0497	10	0.09843	T	0.71	-8.3979	7.4193	0.27063	0.1646:0.7501:0.0:0.0853	.	213	Q9Y334	G7C_HUMAN	K	213	ENSP00000364840:E213K;ENSP00000364838:E213K;ENSP00000390554:E213K	ENSP00000364838:E213K	E	-	1	0	C6orf27	31850356	0.001000	0.12720	0.030000	0.17652	0.030000	0.12068	0.417000	0.21214	0.774000	0.33427	-0.126000	0.14955	GAG	.		0.572	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
ZFYVE9	9372	hgsc.bcm.edu;bcgsc.ca	37	1	52761566	52761566	+	Splice_Site	SNP	G	G	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr1:52761566G>T	ENST00000371591.1	+	11	3381		c.e11-1		ZFYVE9_ENST00000357206.2_Splice_Site|ZFYVE9_ENST00000287727.3_Splice_Site	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9						endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						CATTTCCATAGTTTATCCATG	0.333																																					.		.											.	ZFYVE9	230	0			c.3074-1G>T						.						145.0	134.0	138.0					1																	52761566		2203	4300	6503	SO:0001630	splice_region_variant	9372	exon11			TCCATAGTTTATC	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3251-1G>T	1.37:g.52761566G>T		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	5.0	NM_007324	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Splice_Site	SNP	ENST00000371591.1	37	CCDS563.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.821726	0.71028	.	.	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2263	0.89918	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZFYVE9	52534154	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.520000	0.98027	2.607000	0.88179	0.585000	0.79938	.	.		0.333	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	Intron
ZNF335	63925	broad.mit.edu;bcgsc.ca	37	20	44588920	44588920	+	Silent	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr20:44588920G>A	ENST00000322927.2	-	14	2047	c.1947C>T	c.(1945-1947)ttC>ttT	p.F649F	ZNF335_ENST00000426788.1_Silent_p.F494F	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	649					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				AGCTGCATTTGAAGGGCTTGT	0.542																																					p.F649F		.											.	ZNF335	94	0			c.C1947T						.						120.0	113.0	115.0					20																	44588920		2203	4300	6503	SO:0001819	synonymous_variant	63925	exon14			GCATTTGAAGGGC	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1947C>T	20.37:g.44588920G>A		Somatic	173.0	1.0		WXS	Illumina HiSeq	Phase_I	180.0	10.0	NM_022095	B4DLG7|Q548D0|Q9H684	Silent	SNP	ENST00000322927.2	37	CCDS13389.1																																																																																			.		0.542	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
ZNF469	84627	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	88498400	88498400	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr16:88498400T>C	ENST00000437464.1	+	2	4438	c.4438T>C	c.(4438-4440)Tcc>Ccc	p.S1480P	ZNF469_ENST00000565624.1_Missense_Mutation_p.S1508P	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1480	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						TGAGGAAGTATCCCCGATGCT	0.607																																					p.S1480P		.											.	.	.	0			c.T4438C						.						146.0	114.0	124.0					16																	88498400		692	1591	2283	SO:0001583	missense	84627	exon2			GAAGTATCCCCGA	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.4438T>C	16.37:g.88498400T>C	ENSP00000402343:p.Ser1480Pro	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	7.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	T	1.131	-0.652279	0.03480	.	.	ENSG00000225614	ENST00000437464	T	0.11821	2.74	4.25	-3.16	0.05217	.	.	.	.	.	T	0.06050	0.0157	N	0.12182	0.205	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.34825	-0.9813	9	0.87932	D	0	.	2.0529	0.03574	0.1331:0.1723:0.4086:0.286	.	1480	Q96JG9	ZN469_HUMAN	P	1480	ENSP00000402343:S1480P	ENSP00000402343:S1480P	S	+	1	0	ZNF469	87025901	0.000000	0.05858	0.006000	0.13384	0.096000	0.18686	-0.291000	0.08343	-1.169000	0.02772	-1.614000	0.00798	TCC	.		0.607	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF490	57474	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12692141	12692141	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:12692141A>T	ENST00000311437.6	-	5	870	c.748T>A	c.(748-750)Tat>Aat	p.Y250N	CTD-2192J16.20_ENST00000593682.1_5'Flank|ZNF490_ENST00000465656.1_5'Flank	NM_020714.2	NP_065765.1	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	18						TTACATTCATAGGGTGTCTCT	0.418																																					p.Y250N		.											.	ZNF490	90	0			c.T748A						.						84.0	82.0	83.0					19																	12692141		2203	4300	6503	SO:0001583	missense	57474	exon5			ATTCATAGGGTGT	AB033024	CCDS12272.1	19p13.2	2013-01-08			ENSG00000188033	ENSG00000188033		"""Zinc fingers, C2H2-type"", ""-"""	23705	protein-coding gene	gene with protein product							Standard	NM_020714		Approved	KIAA1198	uc002mtz.2	Q9ULM2	OTTHUMG00000156398	ENST00000311437.6:c.748T>A	19.37:g.12692141A>T	ENSP00000311521:p.Tyr250Asn	Somatic	75.0	1.0		WXS	Illumina HiSeq	Phase_I	63.0	20.0	NM_020714		Missense_Mutation	SNP	ENST00000311437.6	37	CCDS12272.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.646537	0.67358	.	.	ENSG00000188033	ENST00000311437	T	0.25749	1.78	0.996	0.996	0.19844	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50137	0.1598	M	0.89785	3.06	0.18873	N	0.999987	D	0.71674	0.998	D	0.70935	0.971	T	0.30031	-0.9992	9	0.87932	D	0	.	4.2319	0.10608	0.7824:0.0:0.2176:0.0	.	250	Q9ULM2	ZN490_HUMAN	N	250	ENSP00000311521:Y250N	ENSP00000311521:Y250N	Y	-	1	0	ZNF490	12553141	0.007000	0.16637	0.206000	0.23566	0.919000	0.55068	2.410000	0.44592	0.702000	0.31825	0.402000	0.26972	TAT	.		0.418	ZNF490-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344073.1	NM_020714	
ZNF584	201514	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58929119	58929119	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:58929119G>A	ENST00000306910.4	+	4	1757	c.1234G>A	c.(1234-1236)Gac>Aac	p.D412N	CTD-2619J13.16_ENST00000596296.1_lincRNA|ZNF584_ENST00000593920.1_Missense_Mutation_p.D367N|ZNF584_ENST00000599238.1_3'UTR	NM_173548.1	NP_775819.1	Q8IVC4	ZN584_HUMAN	zinc finger protein 584	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		GCGTCAGGAGGACAGGGCACA	0.502																																					p.D412N		.											.	ZNF584	90	0			c.G1234A						.						82.0	82.0	82.0					19																	58929119		2203	4300	6503	SO:0001583	missense	201514	exon4			CAGGAGGACAGGG	AK097218	CCDS12979.1	19q13.43	2013-01-08			ENSG00000171574	ENSG00000171574		"""Zinc fingers, C2H2-type"", ""-"""	27318	protein-coding gene	gene with protein product							Standard	NM_173548		Approved	FLJ39899	uc002qsp.3	Q8IVC4		ENST00000306910.4:c.1234G>A	19.37:g.58929119G>A	ENSP00000306756:p.Asp412Asn	Somatic	168.0	2.0		WXS	Illumina HiSeq	Phase_I	249.0	33.0	NM_173548	A8K203	Missense_Mutation	SNP	ENST00000306910.4	37	CCDS12979.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.199365	0.38806	.	.	ENSG00000171574	ENST00000306910	T	0.06218	3.33	4.54	-3.23	0.05109	.	.	.	.	.	T	0.04092	0.0114	L	0.36672	1.1	0.09310	N	1	B	0.29432	0.244	B	0.24006	0.05	T	0.42344	-0.9457	9	0.87932	D	0	.	1.2592	0.01998	0.195:0.1314:0.3782:0.2955	.	412	Q8IVC4	ZN584_HUMAN	N	412	ENSP00000306756:D412N	ENSP00000306756:D412N	D	+	1	0	ZNF584	63620931	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.015000	0.12634	-0.230000	0.09840	-0.500000	0.04577	GAC	.		0.502	ZNF584-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467022.1	NM_173548	
ZNF705A	440077	broad.mit.edu;mdanderson.org	37	12	8329947	8329947	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr12:8329947G>A	ENST00000359286.4	+	5	760	c.671G>A	c.(670-672)gGa>gAa	p.G224E	FAM66C_ENST00000544214.1_RNA|FAM66C_ENST00000456135.2_RNA|FAM66C_ENST00000454799.2_RNA|FAM66C_ENST00000541558.1_RNA	NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		ACTCACACGGGAGAGAGACCA	0.413																																					p.G224E		.											.	ZNF705A	90	0			c.G671A						.						20.0	20.0	20.0					12																	8329947		2019	4083	6102	SO:0001583	missense	440077	exon5			ACACGGGAGAGAG	AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.671G>A	12.37:g.8329947G>A	ENSP00000352233:p.Gly224Glu	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	9.0	NM_001004328		Missense_Mutation	SNP	ENST00000359286.4	37	CCDS31737.1	.	.	.	.	.	.	.	.	.	.	.	14.08	2.427209	0.43122	.	.	ENSG00000196946	ENST00000359286	T	0.25749	1.78	1.35	1.35	0.21983	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43144	0.1234	M	0.62723	1.935	0.26545	N	0.974018	D	0.89917	1.0	D	0.79784	0.993	T	0.12889	-1.0530	8	.	.	.	.	8.6607	0.34091	0.0:0.0:1.0:0.0	.	224	Q6ZN79	Z705A_HUMAN	E	224	ENSP00000352233:G224E	.	G	+	2	0	ZNF705A	8221214	0.994000	0.37717	0.026000	0.17262	0.011000	0.07611	2.223000	0.42936	1.078000	0.41014	0.400000	0.26472	GGA	.		0.413	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400449.1	NM_001004328	
ZNF721	170960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	438107	438107	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr4:438107C>A	ENST00000338977.5	-	2	161	c.113G>T	c.(112-114)aGg>aTg	p.R38M	ZNF721_ENST00000511833.2_Missense_Mutation_p.R50M|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721	38					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						ACAGCCTTTCCTTAATTGTAA	0.343																																					p.W50L		.											.	ZNF721	47	0			c.G149T						.						61.0	68.0	66.0					4																	438107		2115	4273	6388	SO:0001583	missense	170960	exon3			CCTTTCCTTAATT	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.113G>T	4.37:g.438107C>A	ENSP00000340524:p.Arg38Met	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	23.0	NM_133474	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	37		.	.	.	.	.	.	.	.	.	.	C	9.822	1.186023	0.21870	.	.	ENSG00000182903	ENST00000338977;ENST00000511833;ENST00000505900	T;T;T	0.06768	3.26;3.29;5.94	1.03	1.03	0.20045	.	.	.	.	.	T	0.09113	0.0225	M	0.67397	2.05	0.09310	N	1	B;B;B	0.27594	0.114;0.114;0.182	B;B;B	0.21708	0.016;0.016;0.036	T	0.28170	-1.0052	9	0.54805	T	0.06	.	4.203	0.10476	0.3959:0.6041:0.0:0.0	.	38;50;50	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	M	38;50;82	ENSP00000340524:R38M;ENSP00000428878:R50M;ENSP00000421325:R82M	ENSP00000340524:R38M	R	-	2	0	ZNF721	428107	0.000000	0.05858	0.003000	0.11579	0.114000	0.19823	-0.455000	0.06762	0.486000	0.27676	0.195000	0.17529	AGG	.		0.343	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
ZNF776	284309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58264871	58264871	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:58264871G>A	ENST00000317178.5	+	3	636	c.373G>A	c.(373-375)Gac>Aac	p.D125N	AC003006.7_ENST00000594684.1_Missense_Mutation_p.D125N	NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	125					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		AAAATTGGATGACGATGCAAA	0.428																																					p.D125N		.											.	ZNF776	91	0			c.G373A						.						90.0	84.0	86.0					19																	58264871		2203	4300	6503	SO:0001583	missense	284309	exon3			TTGGATGACGATG	AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.373G>A	19.37:g.58264871G>A	ENSP00000321812:p.Asp125Asn	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	20.0	NM_173632	Q6ZS36|Q8N968	Missense_Mutation	SNP	ENST00000317178.5	37	CCDS12962.2	.	.	.	.	.	.	.	.	.	.	G	5.507	0.278589	0.10403	.	.	ENSG00000152443	ENST00000317178	T	0.06768	3.26	1.5	-2.99	0.05497	.	.	.	.	.	T	0.05364	0.0142	L	0.52573	1.65	0.09310	N	1	P;B	0.46020	0.871;0.43	B;B	0.34180	0.177;0.065	T	0.34527	-0.9825	9	0.23302	T	0.38	.	5.0607	0.14555	0.0:0.1443:0.3998:0.4559	.	125;125	Q68DI1;B4DSC6	ZN776_HUMAN;.	N	125	ENSP00000321812:D125N	ENSP00000321812:D125N	D	+	1	0	ZNF776	62956683	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-3.658000	0.00401	-0.759000	0.04684	0.313000	0.20887	GAC	.		0.428	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346722.2	NM_173632	
ZNF776	284309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58265306	58265306	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr19:58265306G>A	ENST00000317178.5	+	3	1071	c.808G>A	c.(808-810)Gat>Aat	p.D270N		NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		TGGACAATGTGATGAATCATT	0.388																																					p.D270N		.											.	ZNF776	91	0			c.G808A						.						91.0	83.0	85.0					19																	58265306		2203	4300	6503	SO:0001583	missense	284309	exon3			CAATGTGATGAAT	AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.808G>A	19.37:g.58265306G>A	ENSP00000321812:p.Asp270Asn	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	10.0	NM_173632	Q6ZS36|Q8N968	Missense_Mutation	SNP	ENST00000317178.5	37	CCDS12962.2	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935238	0.92458	.	.	ENSG00000152443	ENST00000317178	T	0.04083	3.71	1.79	1.79	0.24919	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06462	0.0166	L	0.41027	1.25	0.80722	D	1	P;P	0.44429	0.835;0.811	P;B	0.44732	0.459;0.313	T	0.38757	-0.9646	9	0.72032	D	0.01	.	10.5453	0.45056	0.0:0.0:1.0:0.0	.	270;270	Q68DI1;B4DSC6	ZN776_HUMAN;.	N	270	ENSP00000321812:D270N	ENSP00000321812:D270N	D	+	1	0	ZNF776	62957118	1.000000	0.71417	0.020000	0.16555	0.900000	0.52787	4.772000	0.62324	0.992000	0.38840	0.305000	0.20034	GAT	.		0.388	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346722.2	NM_173632	
LRRTM3	347731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	68687250	68687251	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr10:68687250_68687251GA>TT	ENST00000361320.4	+	2	1154_1155	c.576_577GA>TT	c.(574-579)cgGAtc>cgTTtc	p.I193F	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	193					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						GATATAACCGGATCCGAAGTTT	0.47																																					p.I193F		.											.	.	.	0			.						.																																			SO:0001583	missense	347731	.			TAACCGGATCCGA	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		Exception_encountered	10.37:g.68687250_68687251delinsTT	ENSP00000355187:p.Ile193Phe	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	.	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	DNP	ENST00000361320.4	37	CCDS7270.1																																																																																			.		0.470	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011	
XPO1	7514	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	61726908	61726909	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-FV-A496-01A-11D-A25V-10	TCGA-FV-A496-10A-01D-A25V-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e6ad1a2-f1eb-44d1-9852-f5752afcf5eb	b736880f-ab1f-41fa-8776-38421620f821	g.chr2:61726908_61726909TC>AT	ENST00000401558.2	-	7	1256_1257	c.529_530GA>AT	c.(529-531)GAa>ATa	p.E177I	XPO1_ENST00000406957.1_Missense_Mutation_p.E177I|XPO1_ENST00000404992.2_Missense_Mutation_p.E177I	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	177	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			ATCAAATACTTCTTCACTCAAG	0.327			Mis		CLL																																p.E177I		.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	.	.	0			.						.																																			SO:0001583	missense	7514	.			AATACTTCTTCAC	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.529_530delinsAT	2.37:g.61726908_61726909delinsAT	ENSP00000384863:p.Glu177Ile	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	6.0	.	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	DNP	ENST00000401558.2	37	CCDS33205.1																																																																																			.		0.327	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
