#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB4	5244	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	87051507	87051507	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr7:87051507T>A	ENST00000265723.4	-	18	2357	c.2246A>T	c.(2245-2247)cAg>cTg	p.Q749L	ABCB4_ENST00000358400.3_Missense_Mutation_p.Q749L|ABCB4_ENST00000359206.3_Missense_Mutation_p.Q749L|ABCB4_ENST00000545634.1_Missense_Mutation_p.Q749L|ABCB4_ENST00000453593.1_Missense_Mutation_p.Q749L	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	749	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	GTTGCACTTCTGCTGCTTCAC	0.358																																					p.Q749L		.											.	ABCB4	96	0			c.A2246T						.						58.0	57.0	58.0					7																	87051507		2203	4300	6503	SO:0001583	missense	5244	exon18			CACTTCTGCTGCT	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2246A>T	7.37:g.87051507T>A	ENSP00000265723:p.Gln749Leu	Somatic	249.0	1.0		WXS	Illumina HiSeq	Phase_I	543.0	80.0	NM_018850	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.888117	0.52014	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51	6.17	3.75	0.43078	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.658974	0.16388	N	0.216565	D	0.87970	0.6312	M	0.71581	2.175	0.39833	D	0.973007	B;B;B	0.26318	0.017;0.12;0.146	B;B;B	0.32289	0.026;0.127;0.143	D	0.83539	0.0095	10	0.48119	T	0.1	-4.0E-4	9.5378	0.39233	0.0:0.14:0.0:0.86	.	749;749;749	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	L	749	ENSP00000352135:Q749L;ENSP00000351172:Q749L;ENSP00000265723:Q749L;ENSP00000392983:Q749L;ENSP00000437465:Q749L	ENSP00000265723:Q749L	Q	-	2	0	ABCB4	86889443	0.907000	0.30839	1.000000	0.80357	0.967000	0.64934	1.020000	0.30027	0.533000	0.28675	0.533000	0.62120	CAG	.		0.358	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
ABCB1	5243	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	87170675	87170675	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr7:87170675G>T	ENST00000265724.3	-	19	2734	c.2317C>A	c.(2317-2319)Cag>Aag	p.Q773K	ABCB1_ENST00000543898.1_Missense_Mutation_p.Q709K	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	773	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ACATTTACCTGAAGGAAAAAT	0.303																																					p.Q773K		.											.	ABCB1	582	0			c.C2317A						.						58.0	59.0	59.0					7																	87170675		2203	4299	6502	SO:0001583	missense	5243	exon19			TTACCTGAAGGAA	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2317C>A	7.37:g.87170675G>T	ENSP00000265724:p.Gln773Lys	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	4.0	NM_000927	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.745809	0.89663	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.89875	-2.58;-2.58	5.65	5.65	0.86999	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.604000	0.16281	N	0.221352	D	0.95223	0.8451	M	0.88181	2.935	0.80722	D	1	D;D	0.63880	0.993;0.985	P;P	0.61658	0.653;0.892	D	0.95258	0.8366	10	0.72032	D	0.01	-13.8647	19.668	0.95900	0.0:0.0:1.0:0.0	.	709;773	B5AK60;P08183	.;MDR1_HUMAN	K	554;773;709	ENSP00000265724:Q773K;ENSP00000444095:Q709K	ENSP00000265724:Q773K	Q	-	1	0	ABCB1	87008611	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.125000	0.71627	2.811000	0.96726	0.655000	0.94253	CAG	.		0.303	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
AGFG1	3267	broad.mit.edu;bcgsc.ca	37	2	228389469	228389487	+	Splice_Site	DEL	GGTTTGTAGTCCCCAGTTG	GGTTTGTAGTCCCCAGTTG	-			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	GGTTTGTAGTCCCCAGTTG	GGTTTGTAGTCCCCAGTTG	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr2:228389469_228389487delGGTTTGTAGTCCCCAGTTG	ENST00000310078.8	+	5	800_810	c.540_550delGGTTTGTAGTCCCCAGTTG	c.(538-552)caggtttgtagtccc>cacc	p.QVCSP180fs	AGFG1_ENST00000486932.1_3'UTR|AGFG1_ENST00000409171.1_Splice_Site_p.QVCSP180fs|AGFG1_ENST00000373671.3_Splice_Site_p.QVCSP180fs|AGFG1_ENST00000409315.1_Splice_Site_p.QVCSP180fs|AGFG1_ENST00000409979.2_Splice_Site_p.QVCSP180fs	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	180					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						GTTAATATGTGGTTTGTAGTCCCCAGTTGTAGGTCGTTC	0.406																																					p.181_184del		.											.	AGFG1	228	0			c.541_550del						.																																			SO:0001630	splice_region_variant	3267	exon5			ATATGTGGTTTGT		CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.541-1GGTTTGTAGTCCCCAGTTG>-	2.37:g.228389469_228389487delGGTTTGTAGTCCCCAGTTG		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	9.0	NM_004504	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Frame_Shift_Del	DEL	ENST00000310078.8	37	CCDS2467.1																																																																																			.		0.406	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2	NM_004504	Frame_Shift_Del
ANKRD30A	91074	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	37442511	37442511	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr10:37442511G>A	ENST00000602533.1	+	13	1650	c.1551G>A	c.(1549-1551)gaG>gaA	p.E517E	ANKRD30A_ENST00000361713.1_Silent_p.E517E|ANKRD30A_ENST00000374660.1_Silent_p.E517E			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	573					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GTCTCTGTGAGACTGTTTCAC	0.269																																					p.E517E		.											.	ANKRD30A	161	0			c.G1551A						.						104.0	106.0	106.0					10																	37442511		1794	4063	5857	SO:0001819	synonymous_variant	91074	exon13			CTGTGAGACTGTT	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1551G>A	10.37:g.37442511G>A		Somatic	886.0	0.0		WXS	Illumina HiSeq	Phase_I	900.0	66.0	NM_052997	Q5W025	Silent	SNP	ENST00000602533.1	37																																																																																				.		0.269	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
ARHGEF6	9459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135863020	135863020	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chrX:135863020C>T	ENST00000250617.6	-	1	1227	c.22G>A	c.(22-24)Gtg>Atg	p.V8M		NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	8	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					AGCCATGTCACGATTTGTTCT	0.463																																					p.V8M		.											.	ARHGEF6	227	0			c.G22A						.						91.0	80.0	84.0					X																	135863020		2203	4300	6503	SO:0001583	missense	9459	exon1			ATGTCACGATTTG	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.22G>A	X.37:g.135863020C>T	ENSP00000250617:p.Val8Met	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	25.0	NM_004840	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	37	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.334154	0.81801	.	.	ENSG00000129675	ENST00000250617	D	0.95171	-3.63	6.03	6.03	0.97812	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97545	0.9196	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97880	1.0291	10	0.87932	D	0	.	19.4624	0.94922	0.0:1.0:0.0:0.0	.	8	Q15052	ARHG6_HUMAN	M	8	ENSP00000250617:V8M	ENSP00000250617:V8M	V	-	1	0	ARHGEF6	135690686	1.000000	0.71417	0.998000	0.56505	0.902000	0.53008	7.487000	0.81328	2.550000	0.86006	0.506000	0.49869	GTG	.		0.463	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840	
ARHGEF7	8874	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	111811416	111811416	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:111811416A>G	ENST00000375741.2	+	3	545	c.295A>G	c.(295-297)Acc>Gcc	p.T99A	ARHGEF7_ENST00000375736.4_Intron|ARHGEF7_ENST00000544132.1_Intron|ARHGEF7_ENST00000375739.2_Intron|ARHGEF7_ENST00000218789.5_Intron|ARHGEF7_ENST00000317133.5_Intron|ARHGEF7_ENST00000370623.3_Intron	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	99	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			tctggtaaccaccattctctt	0.458																																					p.T99A		.											.	ARHGEF7	232	0			c.A295G						.						257.0	222.0	233.0					13																	111811416		692	1591	2283	SO:0001583	missense	8874	exon3			GTAACCACCATTC	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.295A>G	13.37:g.111811416A>G	ENSP00000364893:p.Thr99Ala	Somatic	136.0	2.0		WXS	Illumina HiSeq	Phase_I	109.0	40.0	NM_001113511	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	ENST00000375741.2	37	CCDS45068.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.455500	0.01071	.	.	ENSG00000102606	ENST00000375741	T	0.49720	0.77	1.07	-0.111	0.13576	Calponin homology domain (4);	0.706882	0.10093	U	0.716944	T	0.21062	0.0507	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19516	-1.0303	10	0.20519	T	0.43	.	2.7616	0.05308	0.6668:0.0:0.3332:0.0	.	99	Q14155	ARHG7_HUMAN	A	99	ENSP00000364893:T99A	ENSP00000364893:T99A	T	+	1	0	ARHGEF7	110609417	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.261000	0.08694	-0.047000	0.13423	0.533000	0.62120	ACC	.		0.458	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
ARID3A	1820	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	932472	932472	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:932472G>C	ENST00000263620.3	+	3	750	c.423G>C	c.(421-423)gaG>gaC	p.E141D		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	141	Acidic.|Glu-rich.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aggatgaggaggaggaggagg	0.662																																					p.E141D	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A	90	0			c.G423C						.						14.0	12.0	13.0					19																	932472		2189	4272	6461	SO:0001583	missense	1820	exon3			TGAGGAGGAGGAG	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.423G>C	19.37:g.932472G>C	ENSP00000263620:p.Glu141Asp	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	13.0	NM_005224	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	ENST00000263620.3	37	CCDS12050.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.713060	0.30413	.	.	ENSG00000116017	ENST00000263620	T	0.17528	2.27	3.66	1.25	0.21368	.	0.809613	0.10420	U	0.676796	T	0.09730	0.0239	L	0.29908	0.895	0.25290	N	0.989363	B	0.06786	0.001	B	0.04013	0.001	T	0.40117	-0.9580	10	0.13853	T	0.58	.	3.683	0.08317	0.2274:0.0:0.5806:0.1919	.	141	Q99856	ARI3A_HUMAN	D	141	ENSP00000263620:E141D	ENSP00000263620:E141D	E	+	3	2	ARID3A	883472	0.039000	0.19947	0.423000	0.26634	0.846000	0.48090	-1.707000	0.01893	0.701000	0.31803	0.457000	0.33378	GAG	.		0.662	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARID5B	84159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	63851583	63851583	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr10:63851583C>A	ENST00000279873.7	+	10	2771	c.2361C>A	c.(2359-2361)agC>agA	p.S787R	ARID5B_ENST00000309334.5_Missense_Mutation_p.S544R	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	787					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					ACCGCTGCAGCTTCTCCAAGC	0.502																																					p.S787R		.											.	ARID5B	94	0			c.C2361A						.						93.0	95.0	94.0					10																	63851583		2203	4300	6503	SO:0001583	missense	84159	exon10			CTGCAGCTTCTCC	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.2361C>A	10.37:g.63851583C>A	ENSP00000279873:p.Ser787Arg	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	16.0	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392859	0.25118	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.43688	0.95;0.94	5.87	2.68	0.31781	.	0.509120	0.25783	N	0.028325	T	0.27798	0.0684	L	0.34521	1.04	0.18873	N	0.999986	B	0.33448	0.412	B	0.31614	0.133	T	0.13818	-1.0495	10	0.46703	T	0.11	-4.3184	7.1541	0.25626	0.0:0.566:0.0:0.434	.	787	Q14865	ARI5B_HUMAN	R	787;544	ENSP00000279873:S787R;ENSP00000308862:S544R	ENSP00000279873:S787R	S	+	3	2	ARID5B	63521589	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	0.770000	0.26618	0.827000	0.34685	0.655000	0.94253	AGC	.		0.502	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
BEND3	57673	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	107391665	107391665	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr6:107391665G>A	ENST00000369042.1	-	4	920	c.730C>T	c.(730-732)Cct>Tct	p.P244S	BEND3_ENST00000429433.2_Missense_Mutation_p.P244S			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	244	BEN 1. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						TGGTACTCAGGGGGCGGCTGG	0.637																																					p.P244S		.											.	BEND3	71	0			c.C730T						.						48.0	42.0	44.0					6																	107391665		2203	4300	6503	SO:0001583	missense	57673	exon5			ACTCAGGGGGCGG	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.730C>T	6.37:g.107391665G>A	ENSP00000358038:p.Pro244Ser	Somatic	136.0	1.0		WXS	Illumina HiSeq	Phase_I	145.0	72.0	NM_001080450	A2RRH2|Q9HCL9	Missense_Mutation	SNP	ENST00000369042.1	37	CCDS34507.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476022	0.63737	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	5.32	5.32	0.75619	BEN domain (1);	0.000000	0.85682	D	0.000000	T	0.68568	0.3015	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	T	0.66380	-0.5938	9	0.45353	T	0.12	-0.8159	19.1834	0.93632	0.0:0.0:1.0:0.0	.	244	Q5T5X7	BEND3_HUMAN	S	244	.	ENSP00000358038:P244S	P	-	1	0	BEND3	107498358	1.000000	0.71417	0.893000	0.35052	0.918000	0.54935	7.190000	0.77755	2.774000	0.95407	0.561000	0.74099	CCT	.		0.637	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913	
BRCA2	675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	32914479	32914479	+	Missense_Mutation	SNP	C	C	G	rs80358834		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:32914479C>G	ENST00000380152.3	+	11	6220	c.5987C>G	c.(5986-5988)gCa>gGa	p.A1996G	BRCA2_ENST00000544455.1_Missense_Mutation_p.A1996G			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1996					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTACAAAACGCAAGACAAGTG	0.378			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.A1996G	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	3153	0			c.C5987G						.						64.0	69.0	67.0					13																	32914479		2202	4298	6500	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	AAAACGCAAGACA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.5987C>G	13.37:g.32914479C>G	ENSP00000369497:p.Ala1996Gly	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	22.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598770	0.87055	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.82344	-1.6;-1.6	5.72	5.72	0.89469	.	0.086607	0.50627	D	0.000120	D	0.91236	0.7238	M	0.75264	2.295	0.50813	D	0.999898	D	0.89917	1.0	D	0.72338	0.977	D	0.91407	0.5148	10	0.72032	D	0.01	.	19.8965	0.96963	0.0:1.0:0.0:0.0	.	1996	P51587	BRCA2_HUMAN	G	1996	ENSP00000369497:A1996G;ENSP00000439902:A1996G	ENSP00000369497:A1996G	A	+	2	0	BRCA2	31812479	1.000000	0.71417	0.973000	0.42090	0.975000	0.68041	6.118000	0.71583	2.717000	0.92951	0.655000	0.94253	GCA	.		0.378	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
C17orf64	124773	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58503178	58503178	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr17:58503178G>A	ENST00000269127.4	+	2	170	c.86G>A	c.(85-87)aGc>aAc	p.S29N		NM_181707.2	NP_859058.2	Q86WR6	CQ064_HUMAN	chromosome 17 open reading frame 64	29										breast(2)|large_intestine(1)|lung(3)	6	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			ACAAGCTCCAGCGCCAGCCCT	0.607																																					p.S29N		.											.	C17orf64	271	0			c.G86A						.						55.0	55.0	55.0					17																	58503178		692	1591	2283	SO:0001583	missense	124773	exon2			GCTCCAGCGCCAG	BC048806	CCDS32698.2	17q23.2	2005-12-16			ENSG00000141371	ENSG00000141371			26990	protein-coding gene	gene with protein product						12477932	Standard	NM_181707		Approved		uc002iyq.3	Q86WR6	OTTHUMG00000157171	ENST00000269127.4:c.86G>A	17.37:g.58503178G>A	ENSP00000269127:p.Ser29Asn	Somatic	88.0	1.0		WXS	Illumina HiSeq	Phase_I	92.0	29.0	NM_181707	Q8IY87	Missense_Mutation	SNP	ENST00000269127.4	37	CCDS32698.2	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482467	0.44147	.	.	ENSG00000141371	ENST00000428000;ENST00000269127	.	.	.	5.8	3.78	0.43462	.	0.391660	0.24678	N	0.036492	T	0.19927	0.0479	L	0.29908	0.895	0.18873	N	0.999989	P	0.38922	0.651	B	0.32677	0.15	T	0.12656	-1.0539	9	0.09843	T	0.71	-0.8455	9.2283	0.37421	0.0781:0.1456:0.7763:0.0	.	29	Q86WR6	CQ064_HUMAN	N	23;29	.	ENSP00000269127:S29N	S	+	2	0	C17orf64	55857960	0.000000	0.05858	0.017000	0.16124	0.008000	0.06430	0.665000	0.25083	0.773000	0.33404	0.655000	0.94253	AGC	.		0.607	C17orf64-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000347743.1	NM_181707	
C1orf110	339512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	162824806	162824806	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:162824806C>A	ENST00000367910.1	-	4	778	c.658G>T	c.(658-660)Ggg>Tgg	p.G220W	C1orf110_ENST00000367911.2_Intron|C1orf110_ENST00000524691.1_Intron|C1orf110_ENST00000367912.2_Intron	NM_178550.4	NP_848645.3	Q86UF4	CA110_HUMAN	chromosome 1 open reading frame 110	220										endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	12						CCAGTGTTCCCATCTGGCTTT	0.463																																					p.G220W		.											.	.	.	0			c.G658T						.						165.0	153.0	157.0					1																	162824806		1951	4166	6117	SO:0001583	missense	339512	exon4			TGTTCCCATCTGG	BC040018	CCDS44269.1	1q23.3	2012-06-26			ENSG00000185860	ENSG00000185860			28736	protein-coding gene	gene with protein product						12477932	Standard	NM_178550		Approved	MGC48998	uc001gck.2	Q86UF4	OTTHUMG00000034421	ENST00000367910.1:c.658G>T	1.37:g.162824806C>A	ENSP00000356886:p.Gly220Trp	Somatic	247.0	0.0		WXS	Illumina HiSeq	Phase_I	258.0	28.0	NM_178550	Q5JSG1|Q6ZW57	Missense_Mutation	SNP	ENST00000367910.1	37	CCDS44269.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.609365	0.28623	.	.	ENSG00000185860	ENST00000367910	.	.	.	4.09	-4.94	0.03057	.	1.631300	0.03254	N	0.182241	T	0.06962	0.0177	L	0.27053	0.805	0.32358	N	0.557544	B	0.09022	0.002	B	0.10450	0.005	T	0.16364	-1.0405	8	0.37606	T	0.19	2.7745	0.7306	0.00956	0.2174:0.182:0.1615:0.4392	.	220	Q86UF4	CA110_HUMAN	W	220	.	ENSP00000356886:G220W	G	-	1	0	C1orf110	161091430	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.775000	0.26689	-0.804000	0.04410	-0.181000	0.13052	GGG	.		0.463	C1orf110-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083211.2	NM_178550	
C20orf196	149840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	5843711	5843711	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr20:5843711G>A	ENST00000303142.6	+	3	307	c.220G>A	c.(220-222)Gct>Act	p.A74T		NM_152504.2	NP_689717.2	Q8IYI0	CT196_HUMAN	chromosome 20 open reading frame 196	74										endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	9						CTCCTGGACCGCTGAGAACTT	0.413																																					p.A74T		.											.	C20orf196	90	0			c.G220A						.						54.0	59.0	57.0					20																	5843711		2203	4300	6503	SO:0001583	missense	149840	exon3			TGGACCGCTGAGA	AK057796	CCDS13091.1	20p12.3	2006-07-07			ENSG00000171984	ENSG00000171984			26318	protein-coding gene	gene with protein product						12477932	Standard	NM_152504		Approved	FLJ25067	uc002wmf.3	Q8IYI0	OTTHUMG00000031813	ENST00000303142.6:c.220G>A	20.37:g.5843711G>A	ENSP00000305875:p.Ala74Thr	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	9.0	NM_152504	A8K9J3|Q5TGA9|Q96LU1	Missense_Mutation	SNP	ENST00000303142.6	37	CCDS13091.1	.	.	.	.	.	.	.	.	.	.	T	6.629	0.484505	0.12641	.	.	ENSG00000171984	ENST00000303142;ENST00000378971;ENST00000445603;ENST00000442185	T;T;T	0.44881	0.91;0.91;0.91	5.64	1.84	0.25277	.	0.896271	0.09593	N	0.781229	T	0.17323	0.0416	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.20806	-1.0264	10	0.66056	D	0.02	-10.2391	4.9941	0.14230	0.3636:0.0:0.2744:0.362	.	74	Q8IYI0	CT196_HUMAN	T	74;74;74;121	ENSP00000305875:A74T;ENSP00000399331:A74T;ENSP00000410534:A121T	ENSP00000305875:A74T	A	+	1	0	C20orf196	5791711	0.366000	0.25014	0.033000	0.17914	0.002000	0.02628	1.084000	0.30828	0.073000	0.16731	-1.207000	0.01640	GCT	.		0.413	C20orf196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077882.2	NM_152504	
C5orf42	65250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	37176032	37176032	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr5:37176032T>C	ENST00000508244.1	-	30	6050	c.5957A>G	c.(5956-5958)gAt>gGt	p.D1986G	C5orf42_ENST00000425232.2_Missense_Mutation_p.D1986G|C5orf42_ENST00000274258.7_Missense_Mutation_p.D866G			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1986						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TGAACTCGTATCTACTTGCAT	0.348																																					p.D1986G		.											.	C5orf42	94	0			c.A5957G						.						195.0	207.0	203.0					5																	37176032		2203	4300	6503	SO:0001583	missense	65250	exon31			CTCGTATCTACTT		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.5957A>G	5.37:g.37176032T>C	ENSP00000421690:p.Asp1986Gly	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	21.0	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	17.83	3.486665	0.63962	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.28666	1.62;1.62;1.6;1.6	5.77	5.77	0.91146	.	0.077668	0.45126	D	0.000397	T	0.46288	0.1385	L	0.48642	1.525	0.30868	N	0.7328	D;D	0.76494	0.999;0.996	D;D	0.67382	0.951;0.929	T	0.50154	-0.8861	10	0.40728	T	0.16	.	13.4698	0.61276	0.0:0.0:0.0:1.0	.	1986;866	E9PH94;Q9H799	.;CE042_HUMAN	G	1986;1986;866;1034;866	ENSP00000421690:D1986G;ENSP00000389014:D1986G;ENSP00000274258:D866G;ENSP00000424223:D1034G	ENSP00000274258:D866G	D	-	2	0	C5orf42	37211789	0.998000	0.40836	0.920000	0.36463	0.099000	0.18886	4.272000	0.58908	2.203000	0.70933	0.533000	0.62120	GAT	.		0.348	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	181725193	181725193	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:181725193delC	ENST00000367573.2	+	29	4091	c.4091delC	c.(4090-4092)accfs	p.T1364fs	CACNA1E_ENST00000357570.5_Frame_Shift_Del_p.T1315fs|CACNA1E_ENST00000360108.3_Frame_Shift_Del_p.T1345fs|CACNA1E_ENST00000358338.5_Frame_Shift_Del_p.T1296fs|CACNA1E_ENST00000367567.4_Frame_Shift_Del_p.T971fs|CACNA1E_ENST00000526775.1_Frame_Shift_Del_p.T1345fs|CACNA1E_ENST00000367570.1_Frame_Shift_Del_p.T1364fs	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1364					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCCCTGCTGACCCTCTTCACC	0.522																																					p.T1364fs		.											.	CACNA1E	95	0			c.4091delC						.						68.0	70.0	69.0					1																	181725193		2053	4216	6269	SO:0001589	frameshift_variant	777	exon29			TGCTGACCCTCTT	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4091delC	1.37:g.181725193delC	ENSP00000356545:p.Thr1364fs	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	62.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Frame_Shift_Del	DEL	ENST00000367573.2	37	CCDS55664.1																																																																																			.		0.522	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CAND2	23066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	12859283	12859283	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr3:12859283G>T	ENST00000456430.2	+	10	2893	c.2852G>T	c.(2851-2853)gGc>gTc	p.G951V	CAND2_ENST00000295989.5_Missense_Mutation_p.G858V	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	951					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GCTGAGGAGGGCACCCGGGGG	0.672																																					p.G951V	GBM(43;676 868 1633 6395 37496)	.											.	CAND2	72	0			c.G2852T						.						63.0	75.0	71.0					3																	12859283		2038	4177	6215	SO:0001583	missense	23066	exon10			AGGAGGGCACCCG		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.2852G>T	3.37:g.12859283G>T	ENSP00000387641:p.Gly951Val	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	10.0	NM_001162499	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	37	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.864563	0.71949	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.56611	0.45;0.45	4.64	4.64	0.57946	Armadillo-like helical (1);Armadillo-type fold (1);	0.067453	0.64402	D	0.000018	T	0.78259	0.4255	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.83210	-0.0074	10	0.52906	T	0.07	-39.1272	15.364	0.74507	0.0:0.0:1.0:0.0	.	951;858	O75155;O75155-2	CAND2_HUMAN;.	V	858;951	ENSP00000295989:G858V;ENSP00000387641:G951V	ENSP00000295989:G858V	G	+	2	0	CAND2	12834283	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	9.618000	0.98365	2.289000	0.77006	0.561000	0.74099	GGC	.		0.672	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
CELSR1	9620	broad.mit.edu;bcgsc.ca	37	22	46772959	46772959	+	Splice_Site	SNP	G	G	A	rs533045376	byFrequency	TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr22:46772959G>A	ENST00000262738.3	-	24	7582	c.7583C>T	c.(7582-7584)cCg>cTg	p.P2528L		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2528					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGGCCATACCGGGTTTTCCGT	0.607													G|||	2	0.000399361	0.0	0.0	5008	,	,		16878	0.0		0.0	False		,,,				2504	0.002				p.P2528L		.											.	CELSR1	525	0			c.C7583T						.						50.0	40.0	44.0					22																	46772959		2203	4299	6502	SO:0001630	splice_region_variant	9620	exon24			CATACCGGGTTTT	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.7584+1C>T	22.37:g.46772959G>A		Somatic	77.0	1.0		WXS	Illumina HiSeq	Phase_I	59.0	28.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455454	0.43634	.	.	ENSG00000075275	ENST00000262738	T	0.42900	0.96	4.67	3.63	0.41609	GPCR, family 2-like (1);	0.286388	0.26731	U	0.022797	T	0.60805	0.2297	M	0.75085	2.285	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70716	0.97;0.946	T	0.62501	-0.6841	10	0.56958	D	0.05	.	11.061	0.47946	0.0:0.0:0.663:0.3369	.	849;2528	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	L	2528	ENSP00000262738:P2528L	ENSP00000262738:P2528L	P	-	2	0	CELSR1	45151623	1.000000	0.71417	1.000000	0.80357	0.123000	0.20343	2.520000	0.45554	0.939000	0.37446	-0.515000	0.04445	CCG	.		0.607	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	Missense_Mutation
CHUK	1147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	101953098	101953098	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr10:101953098C>T	ENST00000370397.7	-	19	2151	c.2065G>A	c.(2065-2067)Gaa>Aaa	p.E689K	CHUK_ENST00000590930.1_5'UTR|RP11-316M21.7_ENST00000443919.1_RNA	NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	689					anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TGATCATGTTCTGCTGAAGTC	0.473																																					p.E689K	Ovarian(159;52 1904 10536 35305 37148)	.											.	CHUK	961	0			c.G2065A						.						127.0	109.0	115.0					10																	101953098		2203	4300	6503	SO:0001583	missense	1147	exon19			CATGTTCTGCTGA	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.2065G>A	10.37:g.101953098C>T	ENSP00000359424:p.Glu689Lys	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	24.0	NM_001278	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	37	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	C	8.738	0.918202	0.17982	.	.	ENSG00000213341	ENST00000370397	T	0.71103	-0.54	5.73	4.82	0.62117	.	0.692508	0.15390	N	0.264899	T	0.57051	0.2027	L	0.36672	1.1	0.26122	N	0.980533	B	0.17667	0.023	B	0.14578	0.011	T	0.39702	-0.9601	10	0.06236	T	0.91	-8.2869	12.3854	0.55328	0.0:0.8127:0.1873:0.0	.	689	O15111	IKKA_HUMAN	K	689	ENSP00000359424:E689K	ENSP00000359424:E689K	E	-	1	0	CHUK	101943088	1.000000	0.71417	0.993000	0.49108	0.946000	0.59487	2.494000	0.45329	1.391000	0.46566	0.650000	0.86243	GAA	.		0.473	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278	
CLEC16A	23274	ucsc.edu;bcgsc.ca;mdanderson.org	37	16	11114147	11114147	+	Silent	SNP	C	C	T	rs80034801	byFrequency	TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr16:11114147C>T	ENST00000409790.1	+	12	1631	c.1401C>T	c.(1399-1401)gcC>gcT	p.A467A	CLEC16A_ENST00000409552.3_Silent_p.A449A	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						AGAAAAGCGCCGCCGCCACCT	0.622													c|||	38	0.00758786	0.0257	0.0043	5008	,	,		19963	0.0		0.0	False		,,,				2504	0.001				p.A467A		.											.	CLEC16A	92	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1401T						.	T		69,3929		0,69,1930	22.0	27.0	25.0		1401	-8.1	0.0	16	dbSNP_132	25	1,8351		0,1,4175	no	coding-synonymous	CLEC16A	NM_015226.2		0,70,6105	TT,TC,CC		0.012,1.7259,0.5668		467/1054	11114147	70,12280	1999	4176	6175	SO:0001819	synonymous_variant	23274	exon11			AAGCGCCGCCGCC	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.1401C>T	16.37:g.11114147C>T		Somatic	154.0	1.0		WXS	Illumina HiSeq	.	187.0	72.0	NM_015226		Silent	SNP	ENST00000409790.1	37	CCDS45409.1																																																																																			C|0.989;T|0.011		0.622	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226	
CLPTM1	1209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45488541	45488541	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:45488541G>A	ENST00000337392.5	+	6	802	c.652G>A	c.(652-654)Gcg>Acg	p.A218T	CLPTM1_ENST00000541297.2_Missense_Mutation_p.A204T|CLPTM1_ENST00000589158.1_3'UTR|CLPTM1_ENST00000546079.1_Missense_Mutation_p.A116T	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	218					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		AGAGACAGAAGCGGACCCAGA	0.532																																					p.A218T		.											.	CLPTM1	91	0			c.G652A						.						104.0	99.0	100.0					19																	45488541		2203	4300	6503	SO:0001583	missense	1209	exon6			ACAGAAGCGGACC	AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.652G>A	19.37:g.45488541G>A	ENSP00000336994:p.Ala218Thr	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	27.0	NM_001294	B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Missense_Mutation	SNP	ENST00000337392.5	37	CCDS12651.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587693	0.66105	.	.	ENSG00000104853	ENST00000546079;ENST00000541297;ENST00000337392;ENST00000347493	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.50667	0.1629	L	0.39633	1.23	0.80722	D	1	P;B;B	0.37276	0.589;0.444;0.444	B;B;B	0.39027	0.259;0.288;0.288	T	0.44174	-0.9345	9	0.19147	T	0.46	-14.6335	16.3245	0.82970	0.0:0.0:1.0:0.0	.	204;218;218	F5H8J3;B3KQH2;O96005	.;.;CLPT1_HUMAN	T	116;204;218;218	.	ENSP00000336994:A218T	A	+	1	0	CLPTM1	50180381	1.000000	0.71417	0.998000	0.56505	0.895000	0.52256	8.519000	0.90563	2.450000	0.82876	0.650000	0.86243	GCG	.		0.532	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453267.1	NM_001294	
CLTC	1213	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	57754422	57754422	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr17:57754422C>T	ENST00000269122.3	+	17	2943	c.2669C>T	c.(2668-2670)cCg>cTg	p.P890L	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.P890L|CLTC_ENST00000579815.1_3'UTR	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	890	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					AATAACAACCCGGAGAGATTT	0.463			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.P890L		.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	835	0			c.C2669T						.						83.0	87.0	86.0					17																	57754422		2203	4300	6503	SO:0001583	missense	1213	exon17			ACAACCCGGAGAG	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2669C>T	17.37:g.57754422C>T	ENSP00000269122:p.Pro890Leu	Somatic	107.0	1.0		WXS	Illumina HiSeq	Phase_I	105.0	37.0	NM_004859	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	C	34	5.332953	0.95758	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.11277	2.79;2.79	5.45	5.45	0.79879	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.46737	0.1408	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.97110	1.0;0.967	T	0.60601	-0.7231	10	0.87932	D	0	.	19.2912	0.94100	0.0:1.0:0.0:0.0	.	890;890	Q00610;Q00610-2	CLH1_HUMAN;.	L	890	ENSP00000269122:P890L;ENSP00000376763:P890L	ENSP00000269122:P890L	P	+	2	0	CLTC	55109204	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.726000	0.84824	2.569000	0.86673	0.557000	0.71058	CCG	.		0.463	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
CRBN	51185	broad.mit.edu;bcgsc.ca	37	3	3221334	3221334	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr3:3221334T>C	ENST00000231948.4	-	1	60	c.38A>G	c.(37-39)aAc>aGc	p.N13S	CRBN_ENST00000432408.2_Missense_Mutation_p.N13S	NM_016302.3	NP_057386.2	Q96SW2	CRBN_HUMAN	cereblon	13					negative regulation of ion transmembrane transport (GO:0034766)|negative regulation of protein homooligomerization (GO:0032463)|positive regulation of protein homodimerization activity (GO:0090073)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP-dependent peptidase activity (GO:0004176)			endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	11				Epithelial(13;0.00244)|OV - Ovarian serous cystadenocarcinoma(96;0.00617)|all cancers(10;0.0079)	Lenalidomide(DB00480)|Pomalidomide(DB08910)|Thalidomide(DB01041)	GTTGCCCATGTTGTGCGCAGC	0.672																																					p.N13S		.											.	CRBN	91	0			c.A38G						.						40.0	37.0	38.0					3																	3221334		2202	4299	6501	SO:0001583	missense	51185	exon1			CCCATGTTGTGCG	BC017419	CCDS2562.1, CCDS54547.1	3p26.3	2014-05-27			ENSG00000113851	ENSG00000113851			30185	protein-coding gene	gene with protein product		609262	"""mental retardation, non-syndromic, autosomal recessive, 2A"""	MRT2A		15557513	Standard	NM_016302		Approved	MRT2	uc003bpq.3	Q96SW2	OTTHUMG00000090261	ENST00000231948.4:c.38A>G	3.37:g.3221334T>C	ENSP00000231948:p.Asn13Ser	Somatic	166.0	2.0		WXS	Illumina HiSeq	Phase_I	182.0	69.0	NM_001173482	B2R6H4|C9IZA9|C9JAH6|Q6AI62|Q6NVZ0|Q9UHW4	Missense_Mutation	SNP	ENST00000231948.4	37	CCDS2562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.05|17.05	3.290972|3.290972	0.59976|0.59976	.|.	.|.	ENSG00000113851|ENSG00000113851	ENST00000231948;ENST00000432408|ENST00000424814;ENST00000450014	.|.	.|.	.|.	3.43|3.43	3.43|3.43	0.39272|0.39272	.|.	0.120923|.	0.53938|.	U|.	0.000050|.	T|T	0.59569|0.59569	0.2203|0.2203	L|L	0.51422|0.51422	1.61|1.61	0.43377|0.43377	D|D	0.995472|0.995472	B;B|.	0.32507|.	0.373;0.256|.	B;B|.	0.27608|.	0.081;0.037|.	T|T	0.57370|0.57370	-0.7823|-0.7823	9|5	0.62326|.	D|.	0.03|.	-5.9713|-5.9713	11.5158|11.5158	0.50520|0.50520	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	13;13|.	Q96SW2-2;Q96SW2|.	.;CRBN_HUMAN|.	S|A	13|9	.|.	ENSP00000231948:N13S|.	N|T	-|-	2|1	0|0	CRBN|CRBN	3196334|3196334	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.909000|0.909000	0.53808|0.53808	5.753000|5.753000	0.68736|0.68736	1.537000|1.537000	0.49254|0.49254	0.455000|0.455000	0.32223|0.32223	AAC|ACA	.		0.672	CRBN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206579.3	NM_016302	
CRNN	49860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152382192	152382192	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:152382192C>G	ENST00000271835.3	-	3	1428	c.1366G>C	c.(1366-1368)Gac>Cac	p.D456H	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	456					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGCCCTGGTCCAGCCTGAGG	0.557																																					p.D456H		.											.	CRNN	93	0			c.G1366C						.						190.0	146.0	161.0					1																	152382192		2203	4300	6503	SO:0001583	missense	49860	exon3			CCTGGTCCAGCCT	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1366G>C	1.37:g.152382192C>G	ENSP00000271835:p.Asp456His	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	321.0	33.0	NM_016190	B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	37	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756006	0.49362	.	.	ENSG00000143536	ENST00000271835	T	0.18338	2.22	4.92	4.01	0.46588	.	0.365222	0.23528	N	0.047203	T	0.19927	0.0479	M	0.64170	1.965	0.23845	N	0.996686	D	0.71674	0.998	D	0.62955	0.909	T	0.03524	-1.1028	10	0.87932	D	0	.	9.3273	0.38001	0.0:0.9023:0.0:0.0977	.	456	Q9UBG3	CRNN_HUMAN	H	456	ENSP00000271835:D456H	ENSP00000271835:D456H	D	-	1	0	CRNN	150648816	0.006000	0.16342	0.068000	0.19968	0.005000	0.04900	0.880000	0.28159	1.282000	0.44496	0.650000	0.86243	GAC	.		0.557	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190	
PIEZO1	9780	ucsc.edu;bcgsc.ca	37	16	88780118	88780118	+	IGR	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr16:88780118A>G	ENST00000301015.9	-	0	8072				MIR4722_ENST00000578292.1_RNA|CTU2_ENST00000312060.5_Missense_Mutation_p.K313E|CTU2_ENST00000453996.2_Missense_Mutation_p.K313E|CTU2_ENST00000567949.1_Missense_Mutation_p.K384E|CTU2_ENST00000378384.3_Missense_Mutation_p.K226E	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CCACACCCTGAAGGAGGTCGC	0.647																																					p.K313E		.											.	CTU2	23	0			c.A937G						.						101.0	94.0	96.0					16																	88780118		2195	4298	6493	SO:0001628	intergenic_variant	348180	exon9			ACCCTGAAGGAGG	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776		16.37:g.88780118A>G		Somatic	169.0	2.0		WXS	Illumina HiSeq	.	168.0	65.0	NM_001012759	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.575283	0.86645	.	.	ENSG00000174177	ENST00000378384;ENST00000312060;ENST00000453996	T;T;T	0.46063	0.88;0.88;0.88	4.66	4.66	0.58398	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.64405	0.2595	M	0.77406	2.37	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.999	T	0.68914	-0.5283	10	0.62326	D	0.03	.	13.374	0.60728	1.0:0.0:0.0:0.0	.	226;313;313	Q2VPK5-3;Q2VPK5-5;Q2VPK5	.;.;CTU2_HUMAN	E	226;313;313	ENSP00000367635:K226E;ENSP00000308617:K313E;ENSP00000388320:K313E	ENSP00000308617:K313E	K	+	1	0	CTU2	87307619	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.247000	0.89830	1.873000	0.54277	0.533000	0.62120	AAG	.		0.647	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
CWF19L1	55280	ucsc.edu;bcgsc.ca	37	10	101996663	101996663	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr10:101996663C>T	ENST00000354105.4	-	12	1404	c.1318G>A	c.(1318-1320)Gca>Aca	p.A440T	RP11-316M21.6_ENST00000444359.1_RNA|SNORA12_ENST00000391162.1_RNA|CWF19L1_ENST00000370379.1_Intron|CWF19L1_ENST00000478047.1_5'UTR	NM_018294.4	NP_060764.3	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control (S. pombe)	440							catalytic activity (GO:0003824)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|stomach(2)	17		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		TGCTCCTGTGCCTGGGTAATG	0.483																																					p.A440T		.											.	CWF19L1	90	0			c.G1318A						.						202.0	188.0	192.0					10																	101996663		2203	4300	6503	SO:0001583	missense	55280	exon12			CCTGTGCCTGGGT	AK001860	CCDS7489.1	10q24.31	2008-11-24			ENSG00000095485	ENSG00000095485			25613	protein-coding gene	gene with protein product						14702039	Standard	NM_018294		Approved	FLJ10998	uc001kqq.1	Q69YN2	OTTHUMG00000018901	ENST00000354105.4:c.1318G>A	10.37:g.101996663C>T	ENSP00000326411:p.Ala440Thr	Somatic	187.0	2.0		WXS	Illumina HiSeq	.	172.0	19.0	NM_018294	B4DHX1|D3DR66|Q5W0I3|Q96HC3|Q9H865|Q9NV13	Missense_Mutation	SNP	ENST00000354105.4	37	CCDS7489.1	.	.	.	.	.	.	.	.	.	.	C	31	5.094540	0.94149	.	.	ENSG00000095485	ENST00000354105	T	0.21734	1.99	5.28	5.28	0.74379	Histidine triad motif (1);	0.000000	0.85682	D	0.000000	T	0.52613	0.1745	M	0.88450	2.955	0.80722	D	1	D;D	0.67145	0.994;0.996	P;D	0.68621	0.891;0.959	T	0.60747	-0.7202	10	0.59425	D	0.04	-12.2848	16.4131	0.83725	0.0:1.0:0.0:0.0	.	144;440	Q69YN2-2;Q69YN2	.;C19L1_HUMAN	T	440	ENSP00000326411:A440T	ENSP00000326411:A440T	A	-	1	0	CWF19L1	101986653	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.484000	0.81180	2.471000	0.83476	0.655000	0.94253	GCA	.		0.483	CWF19L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018294	
DCHS1	8642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6650989	6650989	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:6650989T>C	ENST00000299441.3	-	11	5360	c.4949A>G	c.(4948-4950)cAg>cGg	p.Q1650R	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1650	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCCTGCTGCTGGAAAGTAGG	0.652																																					p.Q1650R		.											.	DCHS1	73	0			c.A4949G						.						40.0	41.0	41.0					11																	6650989		2201	4296	6497	SO:0001583	missense	8642	exon11			TGCTGCTGGAAAG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.4949A>G	11.37:g.6650989T>C	ENSP00000299441:p.Gln1650Arg	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	9.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	T	4.728	0.135420	0.09032	.	.	ENSG00000166341	ENST00000299441	T	0.01705	4.68	5.25	-0.211	0.13172	Cadherin (2);Cadherin-like (1);	0.544274	0.15628	N	0.252516	T	0.01870	0.0059	L	0.33339	1.005	0.23739	N	0.996971	B	0.18166	0.026	B	0.20184	0.028	T	0.44112	-0.9349	10	0.19147	T	0.46	.	14.6338	0.68676	0.0:0.0:0.488:0.512	.	1650	Q96JQ0	PCD16_HUMAN	R	1650	ENSP00000299441:Q1650R	ENSP00000299441:Q1650R	Q	-	2	0	DCHS1	6607565	0.758000	0.28405	0.997000	0.53966	0.048000	0.14542	0.832000	0.27490	0.083000	0.17047	-0.460000	0.05396	CAG	.		0.652	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
DEDD	9191	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161091967	161091967	+	Silent	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:161091967C>G	ENST00000368006.3	-	6	1141	c.927G>C	c.(925-927)ctG>ctC	p.L309L	DEDD_ENST00000392188.1_Silent_p.L339L|NIT1_ENST00000368008.1_Intron|DEDD_ENST00000545495.1_Silent_p.L309L|DEDD_ENST00000458050.2_Silent_p.L309L|DEDD_ENST00000368005.1_Silent_p.L339L|DEDD_ENST00000489249.1_5'UTR|DEDD_ENST00000490843.2_Silent_p.L309L	NM_032998.2	NP_127491.1	O75618	DEDD_HUMAN	death effector domain containing	309					decidualization (GO:0046697)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|regulation of apoptotic process (GO:0042981)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)			cervix(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|skin(1)	10	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TCAAGTTCCTCAGGAGTTTCT	0.527																																					p.L309L		.											.	DEDD	90	0			c.G927C						.						115.0	110.0	112.0					1																	161091967		2203	4300	6503	SO:0001819	synonymous_variant	9191	exon5			GTTCCTCAGGAGT	AF043733	CCDS1219.1	1q23.1	2008-02-05	2002-01-14		ENSG00000158796	ENSG00000158796			2755	protein-coding gene	gene with protein product		606841	"""death effector domain-containing"""			9774341, 9832420	Standard	XM_005245597		Approved	DEFT, FLDED1, CASP8IP1, KE05, DEDD1	uc001fxz.3	O75618	OTTHUMG00000033104	ENST00000368006.3:c.927G>C	1.37:g.161091967C>G		Somatic	220.0	1.0		WXS	Illumina HiSeq	Phase_I	212.0	69.0	NM_001039711	D3DVF5|O60737	Silent	SNP	ENST00000368006.3	37	CCDS1219.1																																																																																			.		0.527	DEDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080582.1	NM_004216	
DHX9	1660	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	182852766	182852766	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:182852766G>A	ENST00000367549.3	+	26	3366	c.3256G>A	c.(3256-3258)Gac>Aac	p.D1086N	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	1086					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GCTTGTAGATGACTGGTATGG	0.383																																					p.D1086N	Colon(69;210 1162 3697 13559 39565)	.											.	DHX9	92	0			c.G3256A						.						89.0	83.0	84.0					1																	182852766		1831	4082	5913	SO:0001583	missense	1660	exon26			GTAGATGACTGGT	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.3256G>A	1.37:g.182852766G>A	ENSP00000356520:p.Asp1086Asn	Somatic	118.0	1.0		WXS	Illumina HiSeq	Phase_I	111.0	31.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.131971	0.37630	.	.	ENSG00000135829	ENST00000367549	T	0.60424	0.19	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	L	0.39898	1.24	0.58432	D	0.999999	B;B	0.23650	0.049;0.089	B;B	0.27887	0.062;0.084	T	0.45760	-0.9239	10	0.08599	T	0.76	.	18.7749	0.91907	0.0:0.0:1.0:0.0	.	365;1086	B3KU66;Q08211	.;DHX9_HUMAN	N	1086	ENSP00000356520:D1086N	ENSP00000356520:D1086N	D	+	1	0	DHX9	181119389	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.863000	0.92288	2.506000	0.84524	0.655000	0.94253	GAC	.		0.383	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
DISC1	27185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	231858293	231858293	+	Silent	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:231858293A>G	ENST00000317586.4	+	3	1109	c.1056A>G	c.(1054-1056)ccA>ccG	p.P352P	DISC1_ENST00000537876.1_Intron|DISC1_ENST00000366637.3_Intron|DISC1_ENST00000439617.2_Intron|DISC1_ENST00000539444.1_Intron|DISC1_ENST00000535983.1_Intron|DISC1_ENST00000366636.4_Intron|TSNAX-DISC1_ENST00000602962.1_Intron|DISC1_ENST00000602281.1_Intron|DISC1_ENST00000366633.3_Intron|DISC1_ENST00000602873.1_Intron	NM_001012958.1	NP_001012976.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	352	Interaction with TRAF3IP1.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				AGCTGGAACCAATTGCTTTGG	0.398																																					p.N418D		.											.	DISC1	91	0			c.A1252G						.						114.0	105.0	108.0					1																	231858293		2203	4300	6503	SO:0001819	synonymous_variant	27185	exon5			GGAACCAATTGCT	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000317586.4:c.1056A>G	1.37:g.231858293A>G		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	12.0	NM_001164550	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	ENST00000317586.4	37	CCDS31056.1	.	.	.	.	.	.	.	.	.	.	A	8.375	0.836251	0.16891	.	.	ENSG00000162946	ENST00000366632	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	T	0.64929	0.2643	.	.	.	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.64321	0.924;0.924	T	0.60707	-0.7210	7	0.17832	T	0.49	.	11.08	0.48053	1.0:0.0:0.0:0.0	.	418;376	C4P0D2;C4P0D0	.;.	D	227	.	ENSP00000355592:N227D	N	+	1	0	DISC1	229924916	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.627000	0.24506	1.820000	0.53075	0.528000	0.53228	AAT	.		0.398	DISC1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000092355.2	NM_018662	
ECEL1	9427	ucsc.edu;bcgsc.ca	37	2	233348748	233348748	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr2:233348748A>T	ENST00000304546.1	-	7	1580	c.1370T>A	c.(1369-1371)tTt>tAt	p.F457Y	ECEL1_ENST00000409941.1_Missense_Mutation_p.F457Y	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	457					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CTCATGTACAAAGAGGGCGCC	0.622																																					p.F457Y		.											.	ECEL1	90	0			c.T1370A						.						93.0	100.0	98.0					2																	233348748		2203	4300	6503	SO:0001583	missense	9427	exon7			TGTACAAAGAGGG	Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.1370T>A	2.37:g.233348748A>T	ENSP00000302051:p.Phe457Tyr	Somatic	378.0	2.0		WXS	Illumina HiSeq	.	439.0	152.0	NM_004826	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	ENST00000304546.1	37	CCDS2493.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.759813	0.69763	.	.	ENSG00000171551	ENST00000304546;ENST00000409941	T;T	0.71934	-0.61;-0.61	5.33	5.33	0.75918	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77485	0.4137	L	0.38692	1.165	0.80722	D	1	P;D	0.69078	0.517;0.997	B;D	0.79108	0.267;0.992	T	0.77925	-0.2405	10	0.45353	T	0.12	-21.6729	15.2947	0.73894	1.0:0.0:0.0:0.0	.	457;457	O95672-2;O95672	.;ECEL1_HUMAN	Y	457	ENSP00000302051:F457Y;ENSP00000386333:F457Y	ENSP00000302051:F457Y	F	-	2	0	ECEL1	233056992	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	9.315000	0.96313	2.025000	0.59659	0.455000	0.32223	TTT	.		0.622	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826	
ENKD1	84080	ucsc.edu;bcgsc.ca	37	16	67697652	67697652	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr16:67697652G>A	ENST00000243878.4	-	5	972	c.651C>T	c.(649-651)tcC>tcT	p.S217S	ENKD1_ENST00000602644.1_Intron|ENKD1_ENST00000602409.1_5'Flank|ACD_ENST00000219251.8_5'Flank	NM_032140.1	NP_115516.1	Q9H0I2	ENKD1_HUMAN	enkurin domain containing 1	217						cytoplasmic microtubule (GO:0005881)|microtubule cytoskeleton (GO:0015630)											GCAGTGAGCAGGAATGCCTCC	0.622																																					p.S217S		.											.	.	.	0			c.C651T						.						49.0	42.0	45.0					16																	67697652		2198	4300	6498	SO:0001819	synonymous_variant	84080	exon5			TGAGCAGGAATGC	BC008284	CCDS10844.1	16q22.1	2012-10-09	2012-10-09	2012-10-09	ENSG00000124074	ENSG00000124074			25246	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 48"""	C16orf48		11230166	Standard	NM_032140		Approved	DKFZP434A1319	uc002etw.1	Q9H0I2	OTTHUMG00000137550	ENST00000243878.4:c.651C>T	16.37:g.67697652G>A		Somatic	148.0	2.0		WXS	Illumina HiSeq	.	130.0	44.0	NM_032140	Q6UWD7	Silent	SNP	ENST00000243878.4	37	CCDS10844.1																																																																																			.		0.622	ENKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268884.1	NM_032140	
EP400	57634	hgsc.bcm.edu;broad.mit.edu	37	12	132547099	132547099	+	Silent	SNP	G	G	A	rs145603866		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr12:132547099G>A	ENST00000333577.4	+	48	8404	c.8295G>A	c.(8293-8295)caG>caA	p.Q2765Q	EP400_ENST00000330386.6_Silent_p.Q2648Q|EP400_ENST00000332482.4_Silent_p.Q2692Q|EP400_ENST00000389562.2_Silent_p.Q2728Q|EP400_ENST00000389561.2_Silent_p.Q2729Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2765	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		aacaacagcagcagcagcagc	0.577																																					p.Q2729Q		.											.	EP400	520	0			c.G8187A						.						23.0	28.0	26.0					12																	132547099		2139	4139	6278	SO:0001819	synonymous_variant	57634	exon47			ACAGCAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8295G>A	12.37:g.132547099G>A		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	14.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				G|0.997;A|0.003		0.577	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
FAM205A	259308	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	34724216	34724216	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:34724216C>G	ENST00000378788.3	-	4	3060	c.3021G>C	c.(3019-3021)atG>atC	p.M1007I		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	1007						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						GAACACAAGGCATGTGGGCCT	0.562																																					p.M1007I		.											.	.	.	0			c.G3021C						.						45.0	36.0	39.0					9																	34724216		692	1591	2283	SO:0001583	missense	259308	exon4			ACAAGGCATGTGG		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.3021G>C	9.37:g.34724216C>G	ENSP00000417711:p.Met1007Ile	Somatic	225.0	1.0		WXS	Illumina HiSeq	Phase_I	314.0	79.0	NM_001141917	A8MVW7	Missense_Mutation	SNP	ENST00000378788.3	37	CCDS55305.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.482523	0.26598	.	.	ENSG00000205108	ENST00000378788	T	0.22539	1.95	3.74	2.83	0.33086	.	.	.	.	.	T	0.15435	0.0372	L	0.36672	1.1	0.22511	N	0.999037	B	0.25955	0.138	B	0.15870	0.014	T	0.16748	-1.0392	9	0.52906	T	0.07	.	7.4035	0.26977	0.0:0.8763:0.0:0.1237	.	1007	Q6ZU69	F205A_HUMAN	I	1007	ENSP00000417711:M1007I	ENSP00000417711:M1007I	M	-	3	0	RP11-195F19.10	34714216	0.039000	0.19947	1.000000	0.80357	0.682000	0.39822	-0.542000	0.06091	0.903000	0.36546	0.650000	0.86243	ATG	.		0.562	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	
FAT3	120114	ucsc.edu;mdanderson.org	37	11	92531022	92531022	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:92531022A>T	ENST00000298047.6	+	9	4860	c.4843A>T	c.(4843-4845)Aag>Tag	p.K1615*	FAT3_ENST00000409404.2_Nonsense_Mutation_p.K1615*|FAT3_ENST00000525166.1_Nonsense_Mutation_p.K1465*			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1615	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GAACATGTTTAAGATCGAACC	0.403										TCGA Ovarian(4;0.039)																											p.K1615X		.											.	FAT3	73	0			c.A4843T						.						99.0	95.0	96.0					11																	92531022		1963	4158	6121	SO:0001587	stop_gained	120114	exon9			ATGTTTAAGATCG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4843A>T	11.37:g.92531022A>T	ENSP00000298047:p.Lys1615*	Somatic	212.0	2.0		WXS	Illumina HiSeq	.	177.0	42.0	NM_001008781	B5MDB0|Q96AU6	Nonsense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	A	42	9.453415	0.99175	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1671	0.81777	1.0:0.0:0.0:0.0	.	.	.	.	X	1615;1615;1465	.	ENSP00000298047:K1615X	K	+	1	0	FAT3	92170670	1.000000	0.71417	1.000000	0.80357	0.128000	0.20619	4.740000	0.62087	2.224000	0.72417	0.528000	0.53228	AAG	.		0.403	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FN1	2335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	216249663	216249663	+	Missense_Mutation	SNP	G	G	T	rs202245868		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr2:216249663G>T	ENST00000359671.1	-	28	4641	c.4376C>A	c.(4375-4377)gCg>gAg	p.A1459E	FN1_ENST00000356005.4_Missense_Mutation_p.A1459E|FN1_ENST00000357009.2_Missense_Mutation_p.A1459E|FN1_ENST00000345488.5_Missense_Mutation_p.A1459E|FN1_ENST00000357867.4_Missense_Mutation_p.A1459E|FN1_ENST00000446046.1_Missense_Mutation_p.A1459E|FN1_ENST00000443816.1_Missense_Mutation_p.A1459E|FN1_ENST00000346544.3_Missense_Mutation_p.A1459E|FN1_ENST00000421182.1_Missense_Mutation_p.A1459E|FN1_ENST00000354785.4_Missense_Mutation_p.A1550E|FN1_ENST00000323926.6_Missense_Mutation_p.A1550E|FN1_ENST00000432072.2_Missense_Mutation_p.A1550E|FN1_ENST00000490833.1_5'Flank|FN1_ENST00000336916.4_Missense_Mutation_p.A1459E			P02751	FINC_HUMAN	fibronectin 1	1459	Cell-attachment.|Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GGTGGGGGTCGCAGCAACAAC	0.433																																					p.A1550E		.											.	FN1	584	0			c.C4649A						.						58.0	59.0	59.0					2																	216249663		2203	4300	6503	SO:0001583	missense	2335	exon29			GGGGTCGCAGCAA		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.4376C>A	2.37:g.216249663G>T	ENSP00000352696:p.Ala1459Glu	Somatic	377.0	0.0		WXS	Illumina HiSeq	Phase_I	348.0	42.0	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	G	16.09	3.024409	0.54683	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43	6.02	6.02	0.97574	.	0.690178	0.14110	N	0.340748	T	0.46814	0.1412	N	0.17278	0.47	0.22581	N	0.998968	B;B;B;B;B;B;B;B;B;B	0.34241	0.264;0.033;0.237;0.066;0.444;0.003;0.31;0.171;0.096;0.033	B;B;B;B;B;B;B;B;B;B	0.37508	0.106;0.045;0.131;0.066;0.252;0.007;0.17;0.106;0.066;0.066	T	0.51529	-0.8694	10	0.66056	D	0.02	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	1550;1550;1459;1459;1459;1459;1460;1459;1459;1550	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	E	1459;1550;1459;1459;1550;1460;1459;1459;1459;1459;1459;1459;1550;1459;266	ENSP00000394423:A1459E;ENSP00000323534:A1550E;ENSP00000338200:A1459E;ENSP00000350534:A1459E;ENSP00000346839:A1550E;ENSP00000352696:A1459E;ENSP00000265312:A1459E;ENSP00000273049:A1459E;ENSP00000349509:A1459E;ENSP00000410422:A1459E;ENSP00000415018:A1459E;ENSP00000399538:A1550E;ENSP00000348285:A1459E;ENSP00000416139:A266E	ENSP00000265313:A1460E	A	-	2	0	FN1	215957908	0.997000	0.39634	0.009000	0.14445	0.298000	0.27526	7.628000	0.83189	2.865000	0.98341	0.655000	0.94253	GCG	G|0.999;A|0.000		0.433	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
GALNT12	79695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	101608380	101608380	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:101608380A>G	ENST00000375011.3	+	9	1580	c.1580A>G	c.(1579-1581)gAg>gGg	p.E527G	RP11-92C4.3_ENST00000589257.1_RNA|RP11-92C4.3_ENST00000433997.1_RNA	NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	527	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				ACTGCCCCAGAGAATCAGAAG	0.502																																					p.E527G		.											.	GALNT12	92	0			c.A1580G						.						140.0	128.0	132.0					9																	101608380		2203	4300	6503	SO:0001583	missense	79695	exon9			CCCCAGAGAATCA	AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.1580A>G	9.37:g.101608380A>G	ENSP00000364150:p.Glu527Gly	Somatic	257.0	0.0		WXS	Illumina HiSeq	Phase_I	252.0	44.0	NM_024642	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	ENST00000375011.3	37	CCDS6737.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.296467	0.23650	.	.	ENSG00000119514	ENST00000375011	T	0.28069	1.63	5.93	5.93	0.95920	Ricin B-related lectin (1);Ricin B lectin (3);	0.348674	0.34178	N	0.004194	T	0.35364	0.0929	L	0.39692	1.235	0.46954	D	0.999265	P	0.49559	0.925	P	0.49922	0.626	T	0.03212	-1.1060	10	0.33141	T	0.24	.	14.3318	0.66561	1.0:0.0:0.0:0.0	.	527	Q8IXK2	GLT12_HUMAN	G	527	ENSP00000364150:E527G	ENSP00000364150:E527G	E	+	2	0	GALNT12	100648201	1.000000	0.71417	0.349000	0.25694	0.161000	0.22273	2.696000	0.47052	2.271000	0.75665	0.533000	0.62120	GAG	.		0.502	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053382.1	NM_024642	
GLYATL1	92292	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58722261	58722261	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:58722261G>A	ENST00000317391.4	+	6	545	c.205G>A	c.(205-207)Gat>Aat	p.D69N	GLYATL1_ENST00000300079.5_Missense_Mutation_p.D100N|RP11-142C4.6_ENST00000533954.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	69						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	TGATGACATGGATTCATACAC	0.363																																					p.D100N		.											.	GLYATL1	91	0			c.G298A						.						94.0	88.0	90.0					11																	58722261		2201	4295	6496	SO:0001583	missense	92292	exon5			GACATGGATTCAT	AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.205G>A	11.37:g.58722261G>A	ENSP00000322223:p.Asp69Asn	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	35.0	NM_080661	A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	ENST00000317391.4	37	CCDS55768.1	.	.	.	.	.	.	.	.	.	.	.	12.76	2.036001	0.35893	.	.	ENSG00000166840	ENST00000526351;ENST00000317391;ENST00000532726;ENST00000300079	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	2.37	0.244	0.15507	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, N-terminal (1);	0.680488	0.12904	U	0.429543	T	0.29976	0.0750	M	0.83223	2.63	0.09310	N	0.999999	B;B	0.30033	0.17;0.266	B;B	0.25506	0.015;0.061	T	0.27191	-1.0081	10	0.46703	T	0.11	.	3.6059	0.08042	0.1662:0.2604:0.5733:0.0	.	100;69	Q969I3-2;Q969I3	.;GLYL1_HUMAN	N	92;69;69;100	ENSP00000434652:D92N;ENSP00000322223:D69N;ENSP00000436116:D69N;ENSP00000300079:D100N	ENSP00000300079:D100N	D	+	1	0	GLYATL1	58478837	0.404000	0.25328	0.000000	0.03702	0.038000	0.13279	1.183000	0.32041	-0.073000	0.12842	0.195000	0.17529	GAT	.		0.363	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393783.1	NM_080661	
GPRC6A	222545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	117113958	117113958	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr6:117113958T>C	ENST00000310357.3	-	6	2149	c.2128A>G	c.(2128-2130)Act>Gct	p.T710A	GPRC6A_ENST00000368549.3_Missense_Mutation_p.T639A|GPRC6A_ENST00000530250.1_Missense_Mutation_p.T535A	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	710					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		CCCGTGCAAGTGAAGATAATA	0.438																																					p.T710A		.											.	GPRC6A	96	0			c.A2128G						.						81.0	76.0	77.0					6																	117113958		2203	4300	6503	SO:0001583	missense	222545	exon6			TGCAAGTGAAGAT	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.2128A>G	6.37:g.117113958T>C	ENSP00000309493:p.Thr710Ala	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	15.0	NM_148963	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	T	2.357	-0.347610	0.05208	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.87029	-2.2;-2.2;-2.2	4.61	2.14	0.27477	GPCR, family 3, C-terminal (2);	0.224010	0.31312	N	0.007873	T	0.53658	0.1810	N	0.12831	0.26	0.09310	N	1	B;P;B	0.44090	0.151;0.826;0.259	B;B;B	0.40101	0.052;0.319;0.186	T	0.55755	-0.8091	10	0.27082	T	0.32	.	5.1681	0.15096	0.2764:0.0776:0.0:0.646	.	639;535;710	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	A	710;639;535	ENSP00000309493:T710A;ENSP00000357537:T639A;ENSP00000433465:T535A	ENSP00000309493:T710A	T	-	1	0	GPRC6A	117220651	0.017000	0.18338	0.015000	0.15790	0.005000	0.04900	0.397000	0.20883	0.265000	0.21872	-0.353000	0.07706	ACT	.		0.438	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2		
GREB1	9687	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	11752722	11752722	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr2:11752722G>A	ENST00000381486.2	+	19	3408	c.3108G>A	c.(3106-3108)ggG>ggA	p.G1036G	GREB1_ENST00000234142.5_Silent_p.G1036G|GREB1_ENST00000396123.1_Silent_p.G34G	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1036						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		ACCCGCATGGGGAGTCCTTGC	0.612																																					p.G1036G	Ovarian(39;850 945 2785 23371 33093)	.											.	GREB1	91	0			c.G3108A						.						104.0	103.0	103.0					2																	11752722		1962	4144	6106	SO:0001819	synonymous_variant	9687	exon19			GCATGGGGAGTCC		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3108G>A	2.37:g.11752722G>A		Somatic	199.0	1.0		WXS	Illumina HiSeq	Phase_I	174.0	39.0	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Silent	SNP	ENST00000381486.2	37	CCDS42655.1																																																																																			.		0.612	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
KIAA1211	57482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	57164398	57164398	+	Start_Codon_SNP	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:57164398G>A	ENST00000504228.1	+	2	108	c.3G>A	c.(1-3)atG>atA	p.M1I	KIAA1211_ENST00000264229.6_Start_Codon_SNP_p.M1I|KIAA1211_ENST00000541073.1_5'UTR			Q6ZU35	K1211_HUMAN	KIAA1211	1										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					ACTATTCTATGGGAACCCGGG	0.418																																					p.M1I		.											.	KIAA1211	70	0			c.G3A						.						92.0	87.0	89.0					4																	57164398		1805	4086	5891	SO:0001582	initiator_codon_variant	57482	exon4			TTCTATGGGAACC	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3G>A	4.37:g.57164398G>A	ENSP00000423366:p.Met1Ile	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	12.0	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318908	0.60524	.	.	ENSG00000109265	ENST00000264229;ENST00000504228	T;T	0.13901	2.55;2.55	5.18	5.18	0.71444	.	.	.	.	.	T	0.30696	0.0773	.	.	.	0.80722	D	1	D	0.55800	0.973	P	0.53593	0.73	T	0.02093	-1.1215	8	0.87932	D	0	-28.4395	18.8905	0.92399	0.0:0.0:1.0:0.0	.	1	Q6ZU35	K1211_HUMAN	I	1	ENSP00000264229:M1I;ENSP00000423366:M1I	ENSP00000264229:M1I	M	+	3	0	KIAA1211	56859155	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.141000	0.64814	2.707000	0.92482	0.655000	0.94253	ATG	.		0.418	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	Missense_Mutation
KIAA1211	57482	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	57181429	57181429	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:57181429G>A	ENST00000504228.1	+	6	1866	c.1761G>A	c.(1759-1761)tcG>tcA	p.S587S	KIAA1211_ENST00000264229.6_Silent_p.S587S|KIAA1211_ENST00000541073.1_Silent_p.S580S			Q6ZU35	K1211_HUMAN	KIAA1211	587										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CCCTACCGTCGTCCCTGAGCG	0.677																																					p.S587S		.											.	KIAA1211	70	0			c.G1761A						.						17.0	24.0	22.0					4																	57181429		2047	4179	6226	SO:0001819	synonymous_variant	57482	exon8			ACCGTCGTCCCTG	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1761G>A	4.37:g.57181429G>A		Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	14.0	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	37	CCDS43230.1																																																																																			.		0.677	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
HPSE	10855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	84222134	84222134	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:84222134C>T	ENST00000405413.2	-	12	1587	c.1451G>A	c.(1450-1452)gGa>gAa	p.G484E	HPSE_ENST00000311412.5_Missense_Mutation_p.G484E|HPSE_ENST00000513463.1_Missense_Mutation_p.G426E|HPSE_ENST00000512196.1_Missense_Mutation_p.G410E	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	484					carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	TCCATGAGGTCCCAAAGGTCT	0.368																																					p.G484E		.											.	HPSE	227	0			c.G1451A						.						102.0	104.0	103.0					4																	84222134		2203	4299	6502	SO:0001583	missense	10855	exon11			TGAGGTCCCAAAG	AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.1451G>A	4.37:g.84222134C>T	ENSP00000384262:p.Gly484Glu	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	15.0	NM_001098540	A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Missense_Mutation	SNP	ENST00000405413.2	37	CCDS3602.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906633	0.33628	.	.	ENSG00000173083	ENST00000311412;ENST00000405413;ENST00000512196;ENST00000513463	T;T;T;T	0.46451	0.87;0.87;0.93;0.92	4.55	3.69	0.42338	.	0.159887	0.56097	D	0.000033	T	0.58409	0.2120	M	0.69463	2.115	0.24690	N	0.993311	D;D;D;P	0.89917	1.0;0.969;0.982;0.928	D;P;P;P	0.85130	0.997;0.52;0.713;0.52	T	0.46289	-0.9202	10	0.54805	T	0.06	-14.6443	10.1559	0.42823	0.0:0.9007:0.0:0.0993	.	410;426;426;484	E9PCA9;A9JIG7;E9PGR1;Q9Y251	.;.;.;HPSE_HUMAN	E	484;484;410;426	ENSP00000308107:G484E;ENSP00000384262:G484E;ENSP00000423265:G410E;ENSP00000421365:G426E	ENSP00000308107:G484E	G	-	2	0	HPSE	84441158	0.848000	0.29623	0.377000	0.26055	0.306000	0.27790	3.052000	0.49893	2.513000	0.84729	0.650000	0.86243	GGA	.		0.368	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252812.2	NM_006665	
KIF16B	55614	broad.mit.edu;bcgsc.ca	37	20	16410519	16410523	+	Frame_Shift_Del	DEL	ATAAG	ATAAG	-	rs372531250		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	ATAAG	ATAAG	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr20:16410519_16410523delATAAG	ENST00000354981.2	-	13	1564_1568	c.1407_1411delCTTAT	c.(1405-1413)atcttatatfs	p.LY470fs	KIF16B_ENST00000378003.2_5'UTR|KIF16B_ENST00000355755.3_Frame_Shift_Del_p.LY470fs|KIF16B_ENST00000408042.1_Frame_Shift_Del_p.LY470fs	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	470					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						TTTAAATGATATAAGATGATTCCAG	0.346																																					p.469_471del		.											.	KIF16B	291	0			c.1407_1411del						.																																			SO:0001589	frameshift_variant	55614	exon13			AATGATATAAGAT	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.1407_1411delCTTAT	20.37:g.16410519_16410523delATAAG	ENSP00000347076:p.Leu470fs	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	7.0	NM_001199865	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Frame_Shift_Del	DEL	ENST00000354981.2	37	CCDS13122.1																																																																																			.		0.346	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
KLRK1	22914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	10531200	10531200	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr12:10531200T>C	ENST00000240618.6	-	6	522	c.382A>G	c.(382-384)Atg>Gtg	p.M128V	RP11-277P12.20_ENST00000500682.1_RNA|KLRC4-KLRK1_ENST00000539300.1_3'UTR|KLRK1_ENST00000540818.1_Missense_Mutation_p.M128V	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	128	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TTTTGAGACATACAAGAAGCC	0.368																																					p.M128V		.											.	.	.	0			c.A382G						.						93.0	97.0	95.0					12																	10531200		2203	4300	6503	SO:0001583	missense	0	exon11			GAGACATACAAGA	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.382A>G	12.37:g.10531200T>C	ENSP00000240618:p.Met128Val	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	23.0	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	37	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.219305	0.00286	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.62498	0.02;0.02	5.96	-10.6	0.00265	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.711003	0.13304	N	0.398000	T	0.24774	0.0601	N	0.10664	0.02	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.12156	0.007;0.002	T	0.39563	-0.9608	10	0.02654	T	1	.	7.2069	0.25911	0.0964:0.5271:0.1015:0.275	.	109;128	Q1HEA1;P26718	.;NKG2D_HUMAN	V	128	ENSP00000240618:M128V;ENSP00000446003:M128V	ENSP00000240618:M128V	M	-	1	0	KLRK1	10422467	0.001000	0.12720	0.000000	0.03702	0.028000	0.11728	-0.835000	0.04386	-1.503000	0.01812	-1.127000	0.01993	ATG	.		0.368	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
LAMTOR5	10542	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	110950487	110950487	+	5'Flank	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:110950487A>G	ENST00000602318.1	-	0	0				LAMTOR5-AS1_ENST00000610148.1_RNA|LAMTOR5-AS1_ENST00000608253.1_RNA|LAMTOR5-AS1_ENST00000608067.1_RNA|LAMTOR5-AS1_ENST00000608486.1_RNA|LAMTOR5-AS1_ENST00000590826.1_RNA|LAMTOR5-AS1_ENST00000609709.1_RNA|LAMTOR5-AS1_ENST00000609512.1_RNA|LAMTOR5-AS1_ENST00000598454.1_RNA|LAMTOR5-AS1_ENST00000457535.1_RNA|LAMTOR5-AS1_ENST00000609244.1_RNA|LAMTOR5_ENST00000474861.2_5'Flank|LAMTOR5_ENST00000483260.1_5'Flank|LAMTOR5-AS1_ENST00000608602.1_RNA|LAMTOR5-AS1_ENST00000590413.1_RNA|LAMTOR5-AS1_ENST00000608499.1_RNA|LAMTOR5-AS1_ENST00000587691.1_RNA|LAMTOR5_ENST00000256644.4_Start_Codon_SNP_p.M1T|LAMTOR5_ENST00000602858.1_5'Flank			O43504	LTOR5_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 5						cellular response to amino acid stimulus (GO:0071230)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)|response to virus (GO:0009615)|viral genome replication (GO:0019079)	cytosol (GO:0005829)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)											ACCTGGCTCCATGGCGGAACC	0.607																																					p.M1T		.											.	.	.	0			c.T2C						.						23.0	24.0	24.0					1																	110950487		2202	4300	6502	SO:0001631	upstream_gene_variant	10542	exon1			GGCTCCATGGCGG	AF029890	CCDS824.1	1p12	2012-09-24	2012-09-24	2012-09-24	ENSG00000134248	ENSG00000134248			17955	protein-coding gene	gene with protein product	"""HBx-interacting protein"", ""hepatitis B virus x-interacting protein (9.6kD)"""	608521	"""hepatitis B virus x interacting protein"""	HBXIP		9499022, 22980980	Standard	NM_006402		Approved	XIP, MGC71071	uc001dzr.3	O43504	OTTHUMG00000011568		1.37:g.110950487A>G	Exception_encountered	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	28.0	NM_006402	Q6IBD8	Missense_Mutation	SNP	ENST00000602318.1	37		.	.	.	.	.	.	.	.	.	.	A	8.799	0.932524	0.18131	.	.	ENSG00000134248	ENST00000256644	.	.	.	2.79	-1.36	0.09085	.	.	.	.	.	T	0.25158	0.0611	.	.	.	0.40597	D	0.981544	.	.	.	.	.	.	T	0.23511	-1.0186	4	.	.	.	12.3757	2.9096	0.05732	0.2253:0.4913:0.0:0.2833	.	.	.	.	T	1	.	.	M	-	2	0	HBXIP	110752010	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.177000	0.03096	-0.282000	0.09128	-0.656000	0.03901	ATG	.		0.607	LAMTOR5-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467909.1	NM_006402	
LHCGR	3973	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	48925801	48925801	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr2:48925801C>T	ENST00000294954.7	-	9	840	c.819G>A	c.(817-819)ttG>ttA	p.L273L	STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000403273.1_Silent_p.L273L|LHCGR_ENST00000344775.3_Intron|LHCGR_ENST00000401907.1_Silent_p.L273L|LHCGR_ENST00000405626.1_Silent_p.L273L	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	273					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TGGGGTAAGTCAACGTGGCCT	0.433																																					p.L273L		.											.	LHCGR	589	0			c.G819A						.						107.0	107.0	107.0					2																	48925801		2203	4300	6503	SO:0001819	synonymous_variant	3973	exon9			GTAAGTCAACGTG		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.819G>A	2.37:g.48925801C>T		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	5.0	NM_000233	Q14751|Q15996|Q9UEW9	Silent	SNP	ENST00000294954.7	37	CCDS1842.1																																																																																			.		0.433	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
LMO7	4008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	76381696	76381696	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:76381696C>A	ENST00000321797.8	+	8	1299	c.578C>A	c.(577-579)aCt>aAt	p.T193N	LMO7_ENST00000357063.3_Missense_Mutation_p.T478N|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000377534.3_Missense_Mutation_p.T478N|LMO7_ENST00000341547.4_Intron|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000465261.2_Missense_Mutation_p.T193N			Q8WWI1	LMO7_HUMAN	LIM domain 7	478					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		ATTGATCCCACTTCTGGCCCA	0.468																																					p.T193N		.											.	LMO7	586	0			c.C578A						.						102.0	90.0	94.0					13																	76381696		1568	3582	5150	SO:0001583	missense	4008	exon7			ATCCCACTTCTGG	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.578C>A	13.37:g.76381696C>A	ENSP00000317802:p.Thr193Asn	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	39.0	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.514042|4.514042	0.85389|0.85389	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000447038|ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261;ENST00000526528	.|T;T;T;T	.|0.56275	.|0.47;0.47;0.47;0.47	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.055457	.|0.64402	.|D	.|0.000001	T|T	0.72145|0.72145	0.3424|0.3424	M|M	0.66939|0.66939	2.045|2.045	0.54753|0.54753	D|D	0.999988|0.999988	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.69307	.|0.963;0.963	T|T	0.73382|0.73382	-0.4000|-0.4000	5|10	.|0.72032	.|D	.|0.01	-17.5198|-17.5198	19.8807|19.8807	0.96899|0.96899	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|478;193	.|Q8WWI1;E9PLH4	.|LMO7_HUMAN;.	Q|N	101|478;478;193;193;99	.|ENSP00000349571:T478N;ENSP00000366757:T478N;ENSP00000317802:T193N;ENSP00000433352:T193N	.|ENSP00000317802:T193N	H|T	+|+	3|2	2|0	LMO7|LMO7	75279697|75279697	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.921000|0.921000	0.55340|0.55340	7.206000|7.206000	0.77891|0.77891	2.698000|2.698000	0.92095|0.92095	0.655000|0.655000	0.94253|0.94253	CAC|ACT	.		0.468	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
LPHN1	22859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14274081	14274081	+	Missense_Mutation	SNP	G	G	A	rs369670781		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:14274081G>A	ENST00000340736.6	-	6	844	c.547C>T	c.(547-549)Cgc>Tgc	p.R183C	LPHN1_ENST00000361434.3_Missense_Mutation_p.R178C|LPHN1_ENST00000591528.1_5'UTR|CTB-55O6.12_ENST00000588387.1_RNA|CTB-55O6.12_ENST00000592086.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	183	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GTGTCCGTGCGGTAGGGGATC	0.657																																					p.R183C		.											.	LPHN1	523	0			c.C547T						.	G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	86.0	65.0	72.0		547,532	4.0	1.0	19		72	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LPHN1	NM_001008701.2,NM_014921.4	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	183/1475,178/1470	14274081	1,13005	2203	4300	6503	SO:0001583	missense	22859	exon6			CCGTGCGGTAGGG	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.547C>T	19.37:g.14274081G>A	ENSP00000340688:p.Arg183Cys	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	37.0	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427192	0.83667	0.0	1.16E-4	ENSG00000072071	ENST00000340736;ENST00000361434	D;D	0.89343	-2.5;-2.5	5.06	3.98	0.46160	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.94656	0.8277	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	D	0.95163	0.8283	10	0.87932	D	0	.	12.7117	0.57094	0.0:0.0:0.8356:0.1644	.	178;183	O94910-2;O94910	.;LPHN1_HUMAN	C	183;178	ENSP00000340688:R183C;ENSP00000355328:R178C	ENSP00000340688:R183C	R	-	1	0	LPHN1	14135081	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.219000	0.72231	2.347000	0.79759	0.655000	0.94253	CGC	.		0.657	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
LPHN3	23284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	62599267	62599267	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:62599267G>T	ENST00000514591.1	+	7	1519	c.1190G>T	c.(1189-1191)aGa>aTa	p.R397I	LPHN3_ENST00000514996.1_Missense_Mutation_p.R397I|LPHN3_ENST00000511324.1_Missense_Mutation_p.R465I|LPHN3_ENST00000506720.1_Missense_Mutation_p.R465I|LPHN3_ENST00000514157.1_Missense_Mutation_p.R397I|LPHN3_ENST00000545650.1_Missense_Mutation_p.R397I|LPHN3_ENST00000507625.1_Missense_Mutation_p.R465I|LPHN3_ENST00000508946.1_Missense_Mutation_p.R397I|LPHN3_ENST00000506746.1_Missense_Mutation_p.R465I|LPHN3_ENST00000509896.1_Missense_Mutation_p.R465I|LPHN3_ENST00000507164.1_Missense_Mutation_p.R465I|LPHN3_ENST00000504896.1_Missense_Mutation_p.R397I|LPHN3_ENST00000506700.1_Missense_Mutation_p.R397I|LPHN3_ENST00000508693.1_Missense_Mutation_p.R465I|LPHN3_ENST00000512091.2_Missense_Mutation_p.R397I			Q9HAR2	LPHN3_HUMAN	latrophilin 3	397					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CTGGATAGTAGATCAGGTAAG	0.353																																					p.R397I		.											.	LPHN3	508	0			c.G1190T						.						34.0	32.0	33.0					4																	62599267		1832	4090	5922	SO:0001583	missense	23284	exon5			ATAGTAGATCAGG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1190G>T	4.37:g.62599267G>T	ENSP00000422533:p.Arg397Ile	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	13.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028304	0.35797	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.70749	-0.48;-0.47;-0.5;-0.5;-0.48;-0.47;-0.5;-0.49;-0.49;-0.47;-0.47;-0.48;-0.5;-0.51;-0.48	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.51856	0.1699	N	0.19112	0.55	0.80722	D	1	B;P;P	0.38020	0.244;0.543;0.615	B;B;B	0.29785	0.107;0.096;0.107	T	0.58956	-0.7544	10	0.56958	D	0.05	.	11.4352	0.50064	0.0827:0.0:0.9173:0.0	.	397;465;397	E9PE04;E7EN28;Q9HAR2-2	.;.;.	I	397;397;465;465;397;397;397;397;397;465;465;465;397;397;397;465;465;397	ENSP00000423388:R397I;ENSP00000422533:R397I;ENSP00000423787:R465I;ENSP00000425033:R465I;ENSP00000424120:R397I;ENSP00000439831:R397I;ENSP00000421476:R465I;ENSP00000424030:R465I;ENSP00000421372:R465I;ENSP00000425201:R397I;ENSP00000423434:R397I;ENSP00000421627:R397I;ENSP00000420931:R465I;ENSP00000425884:R465I;ENSP00000424258:R397I	ENSP00000280009:R397I	R	+	2	0	LPHN3	62281862	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.469000	0.73555	2.471000	0.83476	0.557000	0.71058	AGA	.		0.353	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
LRIT1	26103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	86001094	86001094	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr10:86001094C>A	ENST00000372105.3	-	1	123	c.102G>T	c.(100-102)atG>atT	p.M34I		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	34	LRRNT.					integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						TGCCATCACCCATGATATGGA	0.642																																					p.M34I		.											.	LRIT1	90	0			c.G102T						.						35.0	35.0	35.0					10																	86001094		2203	4298	6501	SO:0001583	missense	26103	exon1			ATCACCCATGATA	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.102G>T	10.37:g.86001094C>A	ENSP00000361177:p.Met34Ile	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	181.0	70.0	NM_015613	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	37	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474448	0.26423	.	.	ENSG00000148602	ENST00000372105	T	0.34072	1.38	4.31	3.36	0.38483	Leucine-rich repeat-containing N-terminal (1);	0.172115	0.39834	N	0.001256	T	0.17152	0.0412	N	0.14661	0.345	0.22754	N	0.99877	B	0.02656	0.0	B	0.01281	0.0	T	0.12016	-1.0564	10	0.17832	T	0.49	.	6.0871	0.19973	0.0:0.5717:0.3174:0.1109	.	34	Q9P2V4	LRIT1_HUMAN	I	34	ENSP00000361177:M34I	ENSP00000361177:M34I	M	-	3	0	LRIT1	85991074	0.974000	0.33945	1.000000	0.80357	0.851000	0.48451	0.272000	0.18644	2.205000	0.71048	0.491000	0.48974	ATG	.		0.642	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613	
MAN2C1	4123	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75652525	75652525	+	Missense_Mutation	SNP	G	G	A	rs377316574		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr15:75652525G>A	ENST00000267978.5	-	14	1658	c.1612C>T	c.(1612-1614)Cgg>Tgg	p.R538W	MAN2C1_ENST00000563539.1_5'Flank|MAN2C1_ENST00000569482.1_Missense_Mutation_p.R538W|MAN2C1_ENST00000563622.1_Missense_Mutation_p.R439W|MAN2C1_ENST00000565683.1_Missense_Mutation_p.R538W	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	538					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						TGCAGGATCCGCTCACATTCC	0.612																																					p.R538W		.											.	MAN2C1	90	0			c.C1612T						.	G	TRP/ARG	0,4394		0,0,2197	139.0	147.0	144.0		1612	4.8	1.0	15		144	1,8587	1.2+/-3.3	0,1,4293	no	missense	MAN2C1	NM_006715.2	101	0,1,6490	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	538/1041	75652525	1,12981	2197	4294	6491	SO:0001583	missense	4123	exon14			GGATCCGCTCACA	AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1612C>T	15.37:g.75652525G>A	ENSP00000267978:p.Arg538Trp	Somatic	101.0	1.0		WXS	Illumina HiSeq	Phase_I	72.0	30.0	NM_001256494	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	ENST00000267978.5	37	CCDS32298.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.037248	0.35893	0.0	1.16E-4	ENSG00000140400	ENST00000267978	D	0.83837	-1.77	4.79	4.79	0.61399	Glycoside hydrolase, family 38, central domain (2);	0.763776	0.12622	N	0.452904	D	0.84973	0.5591	L	0.54323	1.7	0.34479	D	0.703622	D;B;B	0.63046	0.992;0.075;0.075	P;B;B	0.50192	0.634;0.041;0.041	D	0.87121	0.2191	10	0.38643	T	0.18	-25.6334	16.8213	0.85747	0.0:0.0:1.0:0.0	.	320;538;538	B4DVP6;Q68EM8;Q9NTJ4	.;.;MA2C1_HUMAN	W	538	ENSP00000267978:R538W	ENSP00000267978:R538W	R	-	1	2	MAN2C1	73439578	0.996000	0.38824	1.000000	0.80357	0.892000	0.51952	1.723000	0.38053	2.216000	0.71823	0.462000	0.41574	CGG	.		0.612	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419965.1		
MAP2	4133	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	210574887	210574887	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr2:210574887G>A	ENST00000360351.4	+	12	5488	c.4982G>A	c.(4981-4983)cGg>cAg	p.R1661Q	MAP2_ENST00000199940.6_Missense_Mutation_p.R362Q|MAP2_ENST00000447185.1_Missense_Mutation_p.R1657Q|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000392194.1_Missense_Mutation_p.R305Q|MAP2_ENST00000361559.4_Missense_Mutation_p.R305Q	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1661					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAGCAGCTTCGGCTTATTAAC	0.493																																					p.R1661Q	Pancreas(27;423 979 28787 29963)	.											.	MAP2	591	0			c.G4982A						.						76.0	65.0	69.0					2																	210574887		2203	4300	6503	SO:0001583	missense	4133	exon12			AGCTTCGGCTTAT		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4982G>A	2.37:g.210574887G>A	ENSP00000353508:p.Arg1661Gln	Somatic	171.0	1.0		WXS	Illumina HiSeq	Phase_I	150.0	21.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399641	0.62177	.	.	ENSG00000078018	ENST00000199940;ENST00000360351;ENST00000361559;ENST00000392194;ENST00000447185	D;D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96;-2.96	5.6	5.6	0.85130	.	0.000000	0.51477	D	0.000095	D	0.92747	0.7694	L	0.35414	1.06	0.53688	D	0.999975	D;D;D;D;P	0.89917	1.0;0.998;0.999;0.998;0.776	D;P;D;D;B	0.85130	0.997;0.852;0.986;0.947;0.312	D	0.87466	0.2411	10	0.02654	T	1	-3.8948	19.6088	0.95594	0.0:0.0:1.0:0.0	.	1657;305;306;1661;362	P11137-3;P11137-2;Q59FX9;P11137;Q8IUX2	.;.;.;MAP2_HUMAN;.	Q	362;1661;305;305;1657	ENSP00000199940:R362Q;ENSP00000353508:R1661Q;ENSP00000355290:R305Q;ENSP00000376032:R305Q;ENSP00000392164:R1657Q	ENSP00000199940:R362Q	R	+	2	0	MAP2	210283132	1.000000	0.71417	1.000000	0.80357	0.208000	0.24298	5.187000	0.65087	2.636000	0.89361	0.467000	0.42956	CGG	.		0.493	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
METTL21C	196541	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	103339396	103339396	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:103339396delC	ENST00000267273.6	-	3	299	c.294delG	c.(292-294)ttgfs	p.L98fs		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	98					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						AGTATTGACACAAAGCCATAG	0.393																																					p.L98fs		.											.	METTL21C	90	0			c.294delG						.						72.0	70.0	70.0					13																	103339396		2203	4300	6503	SO:0001589	frameshift_variant	196541	exon3			TTGACACAAAGCC		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.294delG	13.37:g.103339396delC	ENSP00000267273:p.Leu98fs	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	10.0	NM_001010977		Frame_Shift_Del	DEL	ENST00000267273.6	37	CCDS32003.1																																																																																			.		0.393	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
MMP2	4313	broad.mit.edu;bcgsc.ca	37	16	55513476	55513476	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr16:55513476G>A	ENST00000219070.4	+	1	594	c.85G>A	c.(85-87)Gcc>Acc	p.A29T	MMP2_ENST00000437642.2_5'Flank|MMP2_ENST00000543485.1_5'Flank|MMP2_ENST00000570308.1_Intron	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	29					angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	CCACGCCGCCGCCGCGCCGTC	0.687																																					p.A29T		.											.	MMP2	1149	0			c.G85A						.						19.0	19.0	19.0					16																	55513476		2192	4295	6487	SO:0001583	missense	4313	exon1			GCCGCCGCCGCGC		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.85G>A	16.37:g.55513476G>A	ENSP00000219070:p.Ala29Thr	Somatic	74.0	1.0		WXS	Illumina HiSeq	Phase_I	68.0	5.0	NM_004530	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	ENST00000219070.4	37	CCDS10752.1	.	.	.	.	.	.	.	.	.	.	g	19.76	3.887917	0.72410	.	.	ENSG00000087245	ENST00000219070	T	0.16457	2.34	4.9	3.95	0.45737	.	0.216848	0.47852	D	0.000219	T	0.18299	0.0439	M	0.71206	2.165	0.80722	D	1	B	0.29612	0.251	B	0.11329	0.006	T	0.02625	-1.1132	10	0.44086	T	0.13	.	10.6405	0.45590	0.0894:0.0:0.9106:0.0	.	29	P08253	MMP2_HUMAN	T	29	ENSP00000219070:A29T	ENSP00000219070:A29T	A	+	1	0	MMP2	54070977	1.000000	0.71417	0.118000	0.21660	0.803000	0.45373	7.018000	0.76406	1.064000	0.40671	-0.266000	0.10368	GCC	.		0.687	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3		
MON2	23041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	62926222	62926222	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr12:62926222G>T	ENST00000393632.2	+	12	1796	c.1405G>T	c.(1405-1407)Gaa>Taa	p.E469*	MON2_ENST00000552115.1_Nonsense_Mutation_p.E469*|MON2_ENST00000552738.1_Nonsense_Mutation_p.E469*|MON2_ENST00000393630.3_Nonsense_Mutation_p.E469*|MON2_ENST00000546600.1_Nonsense_Mutation_p.E469*|MON2_ENST00000393629.2_Nonsense_Mutation_p.E469*|MON2_ENST00000280379.6_Nonsense_Mutation_p.E469*	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	469					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTTCAGCTTAGAAATGTTGGA	0.328																																					p.E469X		.											.	MON2	514	0			c.G1405T						.						97.0	84.0	89.0					12																	62926222		2203	4300	6503	SO:0001587	stop_gained	23041	exon12			AGCTTAGAAATGT		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.1405G>T	12.37:g.62926222G>T	ENSP00000377252:p.Glu469*	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	19.0	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Nonsense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	G	41	8.997676	0.99031	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	.	.	.	5.4	4.51	0.55191	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.3575	14.2964	0.66316	0.072:0.0:0.928:0.0	.	.	.	.	X	469;469;469;469;397;469;469;469	.	.	E	+	1	0	MON2	61212489	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.869000	0.99810	1.259000	0.44117	0.563000	0.77884	GAA	.		0.328	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
MRPL32	64983	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	42976921	42976921	+	Splice_Site	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr7:42976921A>G	ENST00000223324.2	+	3	500	c.313A>G	c.(313-315)Aac>Gac	p.N105D	MRPL32_ENST00000496564.1_Intron	NM_031903.2	NP_114109.1	Q9BYC8	RM32_HUMAN	mitochondrial ribosomal protein L32	105					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)	10						TGTTTTAAAGAACAACATAGA	0.368																																					p.N105D		.											.	MRPL32	90	0			c.A313G						.						125.0	117.0	119.0					7																	42976921		2203	4300	6503	SO:0001630	splice_region_variant	64983	exon3			TTAAAGAACAACA	AB051343	CCDS5468.1	7p14	2012-09-13			ENSG00000106591	ENSG00000106591		"""Mitochondrial ribosomal proteins / large subunits"""	14035	protein-coding gene	gene with protein product		611839				11543634	Standard	NM_031903		Approved	HSPC283, L32mt, MRP-L32, bMRP-59b	uc003tia.3	Q9BYC8	OTTHUMG00000155180	ENST00000223324.2:c.313-1A>G	7.37:g.42976921A>G		Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	251.0	67.0	NM_031903	Q96Q68|Q9P098	Missense_Mutation	SNP	ENST00000223324.2	37	CCDS5468.1	.	.	.	.	.	.	.	.	.	.	A	10.20	1.285418	0.23478	.	.	ENSG00000106591	ENST00000223324	.	.	.	5.9	0.948	0.19561	.	0.698413	0.15874	N	0.240395	T	0.27629	0.0679	L	0.27053	0.805	0.33983	D	0.648258	B	0.17852	0.024	B	0.18871	0.023	T	0.18840	-1.0324	8	.	.	.	-6.3114	4.1015	0.10015	0.5604:0.2598:0.0651:0.1147	.	105	Q9BYC8	RM32_HUMAN	D	105	.	.	N	+	1	0	MRPL32	42943446	0.961000	0.32948	0.958000	0.39756	0.561000	0.35649	1.973000	0.40550	0.135000	0.18707	0.528000	0.53228	AAC	.		0.368	MRPL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338669.1	NM_031903	Missense_Mutation
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9060557	9060557	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:9060557G>A	ENST00000397910.4	-	3	27092	c.26889C>T	c.(26887-26889)tcC>tcT	p.S8963S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8965	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGTCACTTTGGATGGCTCTG	0.453																																					p.S8963S		.											.	MUC16	566	0			c.C26889T						.						205.0	191.0	195.0					19																	9060557		1974	4164	6138	SO:0001819	synonymous_variant	94025	exon3			CACTTTGGATGGC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.26889C>T	19.37:g.9060557G>A		Somatic	308.0	0.0		WXS	Illumina HiSeq	Phase_I	305.0	65.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	108127246	108127246	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr3:108127246T>G	ENST00000273353.3	-	33	4617	c.4561A>C	c.(4561-4563)Att>Ctt	p.I1521L		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1521						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						AGATTAGAAATCTCTTCTGGA	0.413																																					p.I1521L		.											.	MYH15	73	0			c.A4561C						.						120.0	108.0	112.0					3																	108127246		1850	4096	5946	SO:0001583	missense	22989	exon33			TAGAAATCTCTTC	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4561A>C	3.37:g.108127246T>G	ENSP00000273353:p.Ile1521Leu	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	25.0	NM_014981		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	T	18.45	3.627648	0.66901	.	.	ENSG00000144821	ENST00000273353	T	0.79141	-1.24	5.56	1.82	0.25136	Myosin tail (1);	.	.	.	.	T	0.73837	0.3638	L	0.49571	1.57	0.34368	D	0.691686	B	0.29481	0.245	B	0.37550	0.253	T	0.74417	-0.3672	9	0.62326	D	0.03	.	9.4452	0.38693	0.0:0.1906:0.0:0.8094	.	1521	Q9Y2K3	MYH15_HUMAN	L	1521	ENSP00000273353:I1521L	ENSP00000273353:I1521L	I	-	1	0	MYH15	109609936	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	2.129000	0.42055	0.073000	0.16731	0.533000	0.62120	ATT	.		0.413	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
MYOM1	8736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	3083787	3083787	+	Splice_Site	SNP	T	T	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr18:3083787T>A	ENST00000356443.4	-	33	4817	c.4484A>T	c.(4483-4485)aAt>aTt	p.N1495I	MYOM1_ENST00000400569.3_Splice_Site_p.N1495I|MYOM1_ENST00000261606.7_Splice_Site_p.N1399I	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1495					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						ATTTACTTACTTGTGGGACCA	0.483																																					p.N1495I		.											.	MYOM1	94	0			c.A4484T						.						59.0	56.0	57.0					18																	3083787		1872	4099	5971	SO:0001630	splice_region_variant	8736	exon33			ACTTACTTGTGGG	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4484+1A>T	18.37:g.3083787T>A		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	9.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.758566	0.89843	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.42131	0.98;0.98;0.98	5.84	5.84	0.93424	Immunoglobulin-like fold (1);	0.044427	0.85682	D	0.000000	T	0.57286	0.2043	L	0.51422	1.61	0.80722	D	1	P;P	0.51057	0.941;0.492	P;P	0.62649	0.905;0.467	T	0.53380	-0.8447	9	.	.	.	.	16.2302	0.82332	0.0:0.0:0.0:1.0	.	1399;1495	P52179-2;P52179	.;MYOM1_HUMAN	I	1495;1495;1399	ENSP00000348821:N1495I;ENSP00000383413:N1495I;ENSP00000261606:N1399I	.	N	-	2	0	MYOM1	3073787	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.040000	0.89188	2.228000	0.72767	0.533000	0.62120	AAT	.		0.483	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	Missense_Mutation
OCA2	4948	broad.mit.edu;ucsc.edu	37	15	28230305	28230305	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr15:28230305C>T	ENST00000354638.3	-	13	1424	c.1269G>A	c.(1267-1269)tgG>tgA	p.W423*	OCA2_ENST00000353809.5_Nonsense_Mutation_p.W399*|OCA2_ENST00000382996.2_Nonsense_Mutation_p.W423*	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	423					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TGATCATGGCCCACACCCGTC	0.577									Oculocutaneous Albinism																												p.W423X		.											.	OCA2	135	0			c.G1269A						.						130.0	94.0	106.0					15																	28230305		2203	4300	6503	SO:0001587	stop_gained	4948	exon13	Familial Cancer Database		CATGGCCCACACC		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1269G>A	15.37:g.28230305C>T	ENSP00000346659:p.Trp423*	Somatic	146.0	1.0		WXS	Illumina HiSeq	Phase_I	126.0	58.0	NM_000275	Q15211|Q15212|Q96EN1|Q9UMI5	Nonsense_Mutation	SNP	ENST00000354638.3	37	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	C	40	7.948272	0.98577	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.2203	18.4183	0.90577	0.0:1.0:0.0:0.0	.	.	.	.	X	423;399;423	.	ENSP00000261276:W399X	W	-	3	0	OCA2	25903900	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.083000	0.76859	2.646000	0.89796	0.655000	0.94253	TGG	.		0.577	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275	
OR51G1	79324	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4945247	4945247	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:4945247G>T	ENST00000321961.2	-	1	390	c.323C>A	c.(322-324)aCc>aAc	p.T108N	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGAAGACAAGGTGTGGATGAA	0.517																																					p.T108N		.											.	OR51G1	70	0			c.C323A						.						97.0	91.0	93.0					11																	4945247		2201	4298	6499	SO:0001583	missense	79324	exon1			GACAAGGTGTGGA	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.323C>A	11.37:g.4945247G>T	ENSP00000322546:p.Thr108Asn	Somatic	100.0	1.0		WXS	Illumina HiSeq	Phase_I	88.0	42.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	37	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.269704	0.23221	.	.	ENSG00000176879	ENST00000321961	T	0.03094	4.05	4.2	3.23	0.37069	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40469	U	0.001097	T	0.11196	0.0273	M	0.69358	2.11	0.09310	N	1	D	0.59357	0.985	P	0.58660	0.843	T	0.05801	-1.0863	10	0.31617	T	0.26	.	12.7001	0.57026	0.0:0.2711:0.7289:0.0	.	108	Q8NGK1	O51G1_HUMAN	N	108	ENSP00000322546:T108N	ENSP00000322546:T108N	T	-	2	0	OR51G1	4901823	0.000000	0.05858	0.997000	0.53966	0.492000	0.33523	-0.282000	0.08445	2.169000	0.68431	0.557000	0.71058	ACC	.		0.517	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
OTUD5	55593	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	48814825	48814825	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chrX:48814825A>G	ENST00000156084.4	-	1	68	c.8T>C	c.(7-9)aTa>aCa	p.I3T	OTUD5_ENST00000376488.3_Missense_Mutation_p.I3T|OTUD5_ENST00000484499.1_5'Flank|OTUD5_ENST00000396743.3_Missense_Mutation_p.I3T|OTUD5_ENST00000428668.2_Intron|RNU6-722P_ENST00000411377.1_RNA	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	3					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						TTTGGGGAGTATAGTCATGGC	0.731																																					p.I3T		.											.	OTUD5	541	0			c.T8C						.						1.0	2.0	1.0					X																	48814825		652	1617	2269	SO:0001583	missense	55593	exon1			GGGAGTATAGTCA		CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.8T>C	X.37:g.48814825A>G	ENSP00000156084:p.Ile3Thr	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	43.0	NM_001136157	B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Missense_Mutation	SNP	ENST00000156084.4	37	CCDS14313.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.857657	0.51376	.	.	ENSG00000068308	ENST00000396743;ENST00000453548;ENST00000156084;ENST00000376488	.	.	.	3.19	3.19	0.36642	.	0.000000	0.64402	D	0.000007	T	0.53594	0.1806	N	0.24115	0.695	0.45250	D	0.998251	P;D	0.54772	0.947;0.968	D;D	0.72625	0.95;0.978	T	0.56214	-0.8016	9	0.87932	D	0	8.2187	7.1699	0.25712	1.0:0.0:0.0:0.0	.	3;3	Q96G74;G5E9D7	OTUD5_HUMAN;.	T	3	.	ENSP00000156084:I3T	I	-	2	0	OTUD5	48699769	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	5.576000	0.67437	1.500000	0.48636	0.416000	0.27883	ATA	.		0.731	OTUD5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000060799.1	NM_017602	
PCDH17	27253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	58206732	58206732	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:58206732C>A	ENST00000377918.3	+	1	78	c.52C>A	c.(52-54)Ctc>Atc	p.L18I		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	18	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TGCCCTCACTCTCAAGAACCT	0.612																																					p.L18I	Melanoma(72;952 1291 1619 12849 33676)	.											.	PCDH17	97	0			c.C52A						.						48.0	44.0	46.0					13																	58206732		2203	4300	6503	SO:0001583	missense	27253	exon1			CTCACTCTCAAGA	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.52C>A	13.37:g.58206732C>A	ENSP00000367151:p.Leu18Ile	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	23.0	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.070716	0.36566	.	.	ENSG00000118946	ENST00000377918	T	0.15487	2.42	5.55	4.7	0.59300	Cadherin (2);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.34861	0.0912	M	0.76328	2.33	0.42050	D	0.991119	D;D	0.57571	0.972;0.98	P;P	0.59643	0.861;0.729	T	0.11275	-1.0594	9	.	.	.	.	10.0683	0.42317	0.0:0.7905:0.1386:0.0709	.	18;18	O14917-2;O14917	.;PCD17_HUMAN	I	18	ENSP00000367151:L18I	.	L	+	1	0	PCDH17	57104733	0.804000	0.28969	0.984000	0.44739	0.843000	0.47879	1.364000	0.34171	1.570000	0.49709	0.655000	0.94253	CTC	.		0.612	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
PCDHGA5	56110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140745937	140745937	+	Silent	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr5:140745937C>A	ENST00000518069.1	+	1	2040	c.2040C>A	c.(2038-2040)acC>acA	p.T680T	PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	680	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTATCAAGACCCCCATTGACC	0.602																																					p.T680T		.											.	PCDHGA5	35	0			c.C2040A						.						293.0	309.0	303.0					5																	140745937		2201	4299	6500	SO:0001819	synonymous_variant	56110	exon1			CAAGACCCCCATT	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.2040C>A	5.37:g.140745937C>A		Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	40.0	NM_032054	Q2M3F5|Q9Y5D2	Silent	SNP	ENST00000518069.1	37	CCDS54925.1																																																																																			.		0.602	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
PI4KA	5297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	21153477	21153477	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr22:21153477G>A	ENST00000572273.1	-	16	1964	c.1734C>T	c.(1732-1734)ccC>ccT	p.P578P	PI4KA_ENST00000255882.6_Silent_p.P636P			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	578					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TCTGCAGAATGGGCTCCATGA	0.557																																					p.P636P	GBM(136;1332 1831 3115 23601 50806)	.											.	PI4KA	454	0			c.C1908T						.						93.0	80.0	84.0					22																	21153477		2203	4300	6503	SO:0001819	synonymous_variant	5297	exon16			CAGAATGGGCTCC	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.1734C>T	22.37:g.21153477G>A		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	17.0	NM_058004	Q7Z625|Q9UPG2	Silent	SNP	ENST00000572273.1	37																																																																																				.		0.557	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
PKP1	5317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201291111	201291111	+	Silent	SNP	G	G	A	rs376484047		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:201291111G>A	ENST00000352845.3	+	9	1416	c.1416G>A	c.(1414-1416)gtG>gtA	p.V472V	PKP1_ENST00000263946.3_Silent_p.V472V|PKP1_ENST00000367324.3_Silent_p.V451V			Q13835	PKP1_HUMAN	plakophilin 1	472					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						CCCAGTCTGTGGAAAACTGCA	0.622																																					p.V472V		.											.	PKP1	92	0			c.G1416A						.	G	,	1,4405	2.1+/-5.4	0,1,2202	118.0	94.0	102.0		1416,1353	5.4	1.0	1		102	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PKP1	NM_000299.3,NM_001005337.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	472/748,451/727	201291111	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5317	exon9			GTCTGTGGAAAAC	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1416G>A	1.37:g.201291111G>A		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	18.0	NM_000299	O00645|Q14CA0|Q15152	Silent	SNP	ENST00000352845.3	37	CCDS30966.1																																																																																			.		0.622	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	
PRRC2B	84726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	134363453	134363453	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:134363453C>T	ENST00000357304.4	+	27	6250	c.6195C>T	c.(6193-6195)gcC>gcT	p.A2065A	PRRC2B_ENST00000405995.1_Silent_p.A1371A|SNORD62B_ENST00000426867.1_RNA|PRRC2B_ENST00000372249.1_Silent_p.A162A|PRRC2B_ENST00000458550.1_Silent_p.A1371A|SNORD62A_ENST00000428514.1_RNA	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	2065							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GCCTGGGTGCCTCCCAGATGT	0.587																																					p.A2065A		.											.	PRRC2B	24	0			c.C6195T						.						24.0	26.0	26.0					9																	134363453		1970	4140	6110	SO:0001819	synonymous_variant	84726	exon27			GGGTGCCTCCCAG	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.6195C>T	9.37:g.134363453C>T		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	14.0	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	ENST00000357304.4	37	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.287123	0.23478	.	.	ENSG00000130723	ENST00000320547	.	.	.	4.82	3.91	0.45181	.	.	.	.	.	T	0.62048	0.2396	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59867	-0.7373	4	.	.	.	-23.7936	11.898	0.52667	0.0:0.9144:0.0:0.0856	.	.	.	.	F	72	.	.	L	+	1	0	PRRC2B	133353274	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	1.153000	0.31676	2.382000	0.81193	0.561000	0.74099	CTC	.		0.587	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PSG8	440533	ucsc.edu;bcgsc.ca	37	19	43259369	43259369	+	Silent	SNP	C	C	T	rs144938138		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:43259369C>T	ENST00000306511.4	-	4	856	c.759G>A	c.(757-759)gaG>gaA	p.E253E	PSG8_ENST00000404209.4_Silent_p.E253E|PSG8_ENST00000600709.1_Intron|PSG8_ENST00000401467.2_Silent_p.E160E|PSG8_ENST00000406636.3_Silent_p.E131E	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	253	Ig-like C2-type 2.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				CATCCTTATTCTCCCTGGGTT	0.478																																					p.E253E		.											.	PSG8	90	0			c.G759A						.						214.0	207.0	209.0					19																	43259369		2202	4299	6501	SO:0001819	synonymous_variant	440533	exon4			CTTATTCTCCCTG	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.759G>A	19.37:g.43259369C>T		Somatic	132.0	2.0		WXS	Illumina HiSeq	.	121.0	36.0	NM_001130167	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Silent	SNP	ENST00000306511.4	37	CCDS33037.1																																																																																			C|1.000;G|0.000		0.478	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
PTPRM	5797	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	8143667	8143667	+	Silent	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr18:8143667C>G	ENST00000332175.8	+	14	3227	c.2190C>G	c.(2188-2190)gtC>gtG	p.V730V	PTPRM_ENST00000400053.4_Silent_p.V668V|PTPRM_ENST00000444013.1_Silent_p.V517V|PTPRM_ENST00000400060.4_Silent_p.V730V|PTPRM_ENST00000580170.1_Silent_p.V730V	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	730					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CGAAACCAGTCCCAGAACCCG	0.423																																					p.V730V		.											.	PTPRM	228	0			c.C2190G						.						112.0	112.0	112.0					18																	8143667		2203	4300	6503	SO:0001819	synonymous_variant	5797	exon14			ACCAGTCCCAGAA	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2190C>G	18.37:g.8143667C>G		Somatic	146.0	2.0		WXS	Illumina HiSeq	Phase_I	128.0	73.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Silent	SNP	ENST00000332175.8	37	CCDS11840.1																																																																																			.		0.423	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PTPRN2	5799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	157959802	157959802	+	Missense_Mutation	SNP	G	G	A	rs139278439		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr7:157959802G>A	ENST00000389418.4	-	6	740	c.731C>T	c.(730-732)gCg>gTg	p.A244V	PTPRN2_ENST00000389416.4_Missense_Mutation_p.A227V|PTPRN2_ENST00000389413.3_Missense_Mutation_p.A244V|PTPRN2_ENST00000404321.2_Missense_Mutation_p.A267V|PTPRN2_ENST00000409483.1_Missense_Mutation_p.A206V	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	244					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ACTGAGGGCCGCCATCAGATG	0.672																																					p.A244V		.											.	PTPRN2	295	0			c.C731T						.		VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	31.0	26.0	28.0		731,680,731	4.8	0.0	7	dbSNP_134	28	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PTPRN2	NM_002847.3,NM_130842.2,NM_130843.2	64,64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	244/1016,227/999,244/987	157959802	1,13005	2203	4300	6503	SO:0001583	missense	5799	exon6			AGGGCCGCCATCA	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.731C>T	7.37:g.157959802G>A	ENSP00000374069:p.Ala244Val	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	34.0	NM_130843	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	37	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564206	0.65651	0.0	1.16E-4	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.04317	3.7;3.65;3.69;3.71;3.68	4.8	4.8	0.61643	.	0.311853	0.20376	N	0.093551	T	0.11239	0.0274	L	0.29908	0.895	0.09310	N	1	D;D;D;D;D	0.71674	0.998;0.996;0.998;0.996;0.996	D;P;D;P;P	0.64042	0.921;0.835;0.921;0.835;0.835	T	0.06625	-1.0816	10	0.62326	D	0.03	.	13.4359	0.61084	0.0:0.0:1.0:0.0	.	267;206;244;227;244	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	V	206;244;227;244;267	ENSP00000387114:A206V;ENSP00000374064:A244V;ENSP00000374067:A227V;ENSP00000374069:A244V;ENSP00000385464:A267V	ENSP00000374064:A244V	A	-	2	0	PTPRN2	157652563	0.028000	0.19301	0.014000	0.15608	0.019000	0.09904	1.960000	0.40422	2.221000	0.72209	0.555000	0.69702	GCG	G|0.999;T|0.000		0.672	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1		
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	40980875	40980875	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr20:40980875G>C	ENST00000373187.1	-	10	1610	c.1611C>G	c.(1609-1611)agC>agG	p.S537R	PTPRT_ENST00000373190.1_Missense_Mutation_p.S537R|PTPRT_ENST00000373201.1_Missense_Mutation_p.S537R|PTPRT_ENST00000373193.3_Missense_Mutation_p.S537R|PTPRT_ENST00000356100.2_Missense_Mutation_p.S537R|PTPRT_ENST00000373184.1_Missense_Mutation_p.S537R|PTPRT_ENST00000373198.4_Missense_Mutation_p.S537R			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	537	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCCCCCTCTGGCTCGAGAGGT	0.527																																					p.S537R		.											.	PTPRT	664	0			c.C1611G						.						78.0	83.0	81.0					20																	40980875		1957	4137	6094	SO:0001583	missense	11122	exon10			CCTCTGGCTCGAG	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1611C>G	20.37:g.40980875G>C	ENSP00000362283:p.Ser537Arg	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	15.0	NM_007050	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919965	0.52653	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32;1.32;1.32	5.88	4.93	0.64822	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.097628	0.64402	D	0.000001	T	0.17916	0.0430	N	0.02765	-0.5	0.41397	D	0.987659	B;B	0.32731	0.382;0.302	B;B	0.36766	0.149;0.232	T	0.08722	-1.0708	10	0.48119	T	0.1	.	9.3838	0.38329	0.0716:0.0:0.7841:0.1443	.	537;537	O14522-1;O14522	.;PTPRT_HUMAN	R	537	ENSP00000362286:S537R;ENSP00000362283:S537R;ENSP00000362289:S537R;ENSP00000348408:S537R;ENSP00000362294:S537R;ENSP00000362280:S537R;ENSP00000362297:S537R	ENSP00000348408:S537R	S	-	3	2	PTPRT	40414289	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.924000	0.40065	2.777000	0.95525	0.551000	0.68910	AGC	.		0.527	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
RALYL	138046	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	85799965	85799965	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr8:85799965C>T	ENST00000521268.1	+	8	1917	c.812C>T	c.(811-813)aCa>aTa	p.T271I	RALYL_ENST00000521376.1_Intron|RALYL_ENST00000522455.1_Missense_Mutation_p.T271I|RALYL_ENST00000517638.1_Missense_Mutation_p.T284I|RALYL_ENST00000518566.1_Missense_Mutation_p.T260I|RALYL_ENST00000523850.1_Missense_Mutation_p.T198I|RALYL_ENST00000521695.1_Missense_Mutation_p.T271I	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	271							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						GAAGAGATGACAGATGGGATA	0.483																																					p.T284I		.											.	RALYL	23	0			c.C851T						.						155.0	159.0	157.0					8																	85799965		2011	4174	6185	SO:0001583	missense	138046	exon8			AGATGACAGATGG		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.812C>T	8.37:g.85799965C>T	ENSP00000430367:p.Thr271Ile	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	278.0	18.0	NM_001100391	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	ENST00000521268.1	37	CCDS55253.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.554996	0.86231	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850	T;T;T;T;T;T	0.15718	2.81;2.81;2.81;2.8;2.8;2.4	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.41119	0.1145	M	0.63428	1.95	0.80722	D	1	D;D;D;D	0.76494	0.995;0.999;0.999;0.995	D;D;D;D	0.80764	0.979;0.994;0.994;0.979	T	0.10222	-1.0639	10	0.44086	T	0.13	-7.1315	18.7753	0.91908	0.0:1.0:0.0:0.0	.	260;198;284;271	B3KT61;Q86SE5-2;G3V129;Q86SE5	.;.;.;RALYL_HUMAN	I	271;271;271;260;284;198	ENSP00000430394:T271I;ENSP00000428667:T271I;ENSP00000430367:T271I;ENSP00000430065:T260I;ENSP00000430128:T284I;ENSP00000428807:T198I	ENSP00000430128:T284I	T	+	2	0	RALYL	85962520	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.474000	0.73578	2.445000	0.82738	0.561000	0.74099	ACA	.		0.483	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1		
RALYL	138046	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	85799990	85799990	+	Silent	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr8:85799990T>C	ENST00000521268.1	+	8	1942	c.837T>C	c.(835-837)gaT>gaC	p.D279D	RALYL_ENST00000521376.1_Intron|RALYL_ENST00000522455.1_Silent_p.D279D|RALYL_ENST00000517638.1_Silent_p.D292D|RALYL_ENST00000518566.1_Silent_p.D268D|RALYL_ENST00000523850.1_Silent_p.D206D|RALYL_ENST00000521695.1_Silent_p.D279D	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	279							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						AGGACTTCGATGAAGATGGGG	0.463																																					p.D292D		.											.	RALYL	23	0			c.T876C						.						139.0	143.0	142.0					8																	85799990		2001	4168	6169	SO:0001819	synonymous_variant	138046	exon8			CTTCGATGAAGAT		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.837T>C	8.37:g.85799990T>C		Somatic	109.0	1.0		WXS	Illumina HiSeq	Phase_I	229.0	37.0	NM_001100391	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Silent	SNP	ENST00000521268.1	37	CCDS55253.1																																																																																			.		0.463	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1		
ROR1	4919	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	64624861	64624861	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:64624861G>T	ENST00000371079.1	+	8	1747	c.1372G>T	c.(1372-1374)Gca>Tca	p.A458S	ROR1_ENST00000545203.1_5'UTR|RP11-24J23.2_ENST00000424995.1_RNA	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	458					peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						AATGCTGAATGCATATAAACC	0.448																																					p.A458S		.											.	ROR1	1536	0			c.G1372T						.						157.0	138.0	145.0					1																	64624861		2203	4300	6503	SO:0001583	missense	4919	exon8			CTGAATGCATATA	M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.1372G>T	1.37:g.64624861G>T	ENSP00000360120:p.Ala458Ser	Somatic	120.0	1.0		WXS	Illumina HiSeq	Phase_I	97.0	43.0	NM_005012	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.271130	0.40194	.	.	ENSG00000185483	ENST00000371079;ENST00000544776	T	0.75050	-0.9	5.77	5.77	0.91146	.	0.000000	0.42821	D	0.000660	T	0.47783	0.1464	N	0.19112	0.55	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.43909	-0.9362	10	0.17369	T	0.5	.	18.5273	0.90976	0.0:0.0:1.0:0.0	.	458	Q01973	ROR1_HUMAN	S	458;461	ENSP00000360120:A458S	ENSP00000360120:A458S	A	+	1	0	ROR1	64397449	1.000000	0.71417	0.985000	0.45067	0.939000	0.58152	4.682000	0.61671	2.890000	0.99128	0.650000	0.86243	GCA	.		0.448	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
SATB1	6304	ucsc.edu;bcgsc.ca	37	3	18390856	18390856	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr3:18390856G>C	ENST00000338745.6	-	11	3832	c.2098C>G	c.(2098-2100)Ctc>Gtc	p.L700V	TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Missense_Mutation_p.L700V|SATB1_ENST00000417717.2_Missense_Mutation_p.L732V	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	700					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						TGGTGCTTGAGATAGTACCGC	0.507																																					p.L732V		.											.	SATB1	228	0			c.C2194G						.						211.0	207.0	209.0					3																	18390856		2203	4300	6503	SO:0001583	missense	6304	exon12			GCTTGAGATAGTA		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.2098C>G	3.37:g.18390856G>C	ENSP00000341024:p.Leu700Val	Somatic	175.0	2.0		WXS	Illumina HiSeq	.	183.0	31.0	NM_001195470	B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	37	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.602345	0.00849	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717	D;D;D	0.96136	-3.92;-3.92;-3.92	5.5	5.5	0.81552	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.125508	0.53938	D	0.000052	D	0.85592	0.5732	N	0.02539	-0.55	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.12156	0.002;0.007	T	0.81837	-0.0749	10	0.02654	T	1	-25.0875	15.7196	0.77697	0.0:0.1367:0.8633:0.0	.	732;700	Q01826-2;Q01826	.;SATB1_HUMAN	V	700;700;732	ENSP00000341024:L700V;ENSP00000399708:L700V;ENSP00000399518:L732V	ENSP00000341024:L700V	L	-	1	0	SATB1	18365860	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.870000	0.56070	2.586000	0.87340	0.655000	0.94253	CTC	.		0.507	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
SACM1L	22908	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45754687	45754687	+	Splice_Site	SNP	A	A	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr3:45754687A>T	ENST00000389061.5	+	6	746	c.542A>T	c.(541-543)gAg>gTg	p.E181V	SACM1L_ENST00000418611.1_Splice_Site_p.E78V|SACM1L_ENST00000541314.1_Splice_Site_p.E120V	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	181	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		GCACAGCCAGAGGTAATGTAC	0.358																																					p.E181V		.											.	SACM1L	91	0			c.A542T						.						73.0	74.0	73.0					3																	45754687		2203	4300	6503	SO:0001630	splice_region_variant	22908	exon6			AGCCAGAGGTAAT	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.543+1A>T	3.37:g.45754687A>T		Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	7.0	NM_014016	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	ENST00000389061.5	37	CCDS33745.1	.	.	.	.	.	.	.	.	.	.	A	30	5.055486	0.93793	.	.	ENSG00000211456	ENST00000418611;ENST00000389061;ENST00000541314	T;T;T	0.58358	0.34;0.34;0.34	5.79	5.79	0.91817	Synaptojanin, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.66147	0.2760	L	0.56340	1.77	0.80722	D	1	D;P	0.59767	0.986;0.885	D;P	0.64144	0.922;0.566	T	0.63817	-0.6551	10	0.35671	T	0.21	-20.9518	16.1323	0.81449	1.0:0.0:0.0:0.0	.	120;181	B4DK71;Q9NTJ5	.;SAC1_HUMAN	V	78;181;120	ENSP00000396387:E78V;ENSP00000373713:E181V;ENSP00000443373:E120V	ENSP00000373713:E181V	E	+	2	0	SACM1L	45729691	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.833000	0.92089	2.223000	0.72356	0.454000	0.30748	GAG	.		0.358	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	NM_014016	Missense_Mutation
SCN8A	6334	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	52115518	52115518	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr12:52115518C>T	ENST00000354534.6	+	12	2002	c.1824C>T	c.(1822-1824)cgC>cgT	p.R608R	SCN8A_ENST00000550891.1_Silent_p.R608R|SCN8A_ENST00000545061.1_Silent_p.R608R	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	608					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TCCGGGCCCGCGAGCGCCGGA	0.697																																					p.R608R		.											.	SCN8A	29	0			c.C1824T						.						7.0	12.0	10.0					12																	52115518		1967	4093	6060	SO:0001819	synonymous_variant	6334	exon12			GGCCCGCGAGCGC	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.1824C>T	12.37:g.52115518C>T		Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	9.0	NM_014191	B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	ENST00000354534.6	37	CCDS44891.1																																																																																			.		0.697	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
SETD1B	23067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	122252796	122252796	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr12:122252796C>T	ENST00000604567.1	+	7	2743	c.2675C>T	c.(2674-2676)gCc>gTc	p.A892V	SETD1B_ENST00000542440.1_Missense_Mutation_p.A892V|SETD1B_ENST00000267197.5_Missense_Mutation_p.A892V			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	892	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GCTTTCCGGGCCTTTGACGAG	0.637																																					p.A892V		.											.	SETD1B	86	0			c.C2675T						.						86.0	78.0	80.0					12																	122252796		692	1591	2283	SO:0001583	missense	23067	exon6			TCCGGGCCTTTGA	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.2675C>T	12.37:g.122252796C>T	ENSP00000474253:p.Ala892Val	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	30.0	NM_015048	F6MFW1	Missense_Mutation	SNP	ENST00000604567.1	37		.	.	.	.	.	.	.	.	.	.	C	14.58	2.577164	0.45902	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	D;D	0.95069	-3.6;-3.6	4.78	4.78	0.61160	.	.	.	.	.	D	0.95790	0.8630	M	0.65498	2.005	0.48696	D	0.999695	D	0.60575	0.988	P	0.54759	0.76	D	0.96261	0.9191	9	0.66056	D	0.02	.	17.8046	0.88598	0.0:1.0:0.0:0.0	.	892	Q9UPS6	SET1B_HUMAN	V	892	ENSP00000442924:A892V;ENSP00000267197:A892V	ENSP00000267197:A892V	A	+	2	0	SETD1B	120737179	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.936000	0.70153	2.181000	0.69327	0.561000	0.74099	GCC	.		0.637	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
SLC14A1	6563	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	43310324	43310324	+	Silent	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr18:43310324C>A	ENST00000321925.4	+	3	271	c.39C>A	c.(37-39)ccC>ccA	p.P13P	SLC14A1_ENST00000502059.2_Intron|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A1_ENST00000436407.3_Silent_p.P69P|SLC14A1_ENST00000402943.2_Intron|SLC14A1_ENST00000415427.3_Silent_p.P69P|SLC14A1_ENST00000589700.1_Silent_p.P13P|SLC14A1_ENST00000535474.1_Intron|RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000591943.1_3'UTR|SLC14A1_ENST00000586142.1_Silent_p.P13P	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	13					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						TGGACAGCCCCACTATGGTTA	0.517																																					p.P69P		.											.	SLC14A1	515	0			c.C207A						.						112.0	100.0	104.0					18																	43310324		2203	4300	6503	SO:0001819	synonymous_variant	6563	exon2			CAGCCCCACTATG	BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.39C>A	18.37:g.43310324C>A		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	12.0	NM_001146037	A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Silent	SNP	ENST00000321925.4	37	CCDS11925.1																																																																																			.		0.517	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865	
SLC35F2	54733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	107663412	107663412	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:107663412T>C	ENST00000525815.1	-	8	1474	c.1054A>G	c.(1054-1056)Agc>Ggc	p.S352G	SLC35F2_ENST00000375682.4_Missense_Mutation_p.S305G|SLC35F2_ENST00000429869.1_Missense_Mutation_p.S352G|SLC35F2_ENST00000525071.1_Silent_p.P349P|SLC35F2_ENST00000265836.7_Missense_Mutation_p.S204G	NM_017515.4	NP_059985.2	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	352					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		ATCCCAATGCTGGTGACTGGA	0.592																																					p.S352G		.											.	SLC35F2	90	0			c.A1054G						.						56.0	61.0	59.0					11																	107663412		1996	4181	6177	SO:0001583	missense	54733	exon8			CAATGCTGGTGAC		CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000525815.1:c.1054A>G	11.37:g.107663412T>C	ENSP00000436785:p.Ser352Gly	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	20.0	NM_017515	Q14963|Q5JPA8|Q6ZRQ3|Q9H947	Missense_Mutation	SNP	ENST00000525815.1	37	CCDS41709.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.601920	0.46423	.	.	ENSG00000110660	ENST00000525815;ENST00000265836;ENST00000375682;ENST00000429869	.	.	.	5.13	-0.488	0.12056	.	0.648971	0.16728	N	0.201974	T	0.29556	0.0737	L	0.43152	1.355	0.26718	N	0.970839	B	0.22080	0.064	B	0.30943	0.122	T	0.22208	-1.0223	9	0.28530	T	0.3	.	3.3906	0.07287	0.2951:0.1757:0.0:0.5292	.	352	Q8IXU6	S35F2_HUMAN	G	352;204;305;352	.	ENSP00000265836:S204G	S	-	1	0	SLC35F2	107168622	0.965000	0.33210	0.980000	0.43619	0.782000	0.44232	-0.021000	0.12504	-0.235000	0.09767	-0.336000	0.08194	AGC	.		0.592	SLC35F2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389417.1	NM_017515	
SPAG17	200162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	118629516	118629516	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:118629516C>A	ENST00000336338.5	-	11	1540	c.1475G>T	c.(1474-1476)tGt>tTt	p.C492F		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	492						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTCTGAGAGACAGAGTGAGGG	0.488																																					p.C492F		.											.	SPAG17	158	0			c.G1475T						.						130.0	124.0	126.0					1																	118629516		2203	4300	6503	SO:0001583	missense	200162	exon11			GAGAGACAGAGTG		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.1475G>T	1.37:g.118629516C>A	ENSP00000337804:p.Cys492Phe	Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	25.0	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.503450	0.64298	.	.	ENSG00000155761	ENST00000336338	T	0.18960	2.18	5.32	5.32	0.75619	.	0.540233	0.21061	N	0.080831	T	0.33235	0.0856	M	0.73962	2.25	0.31059	N	0.714391	D	0.69078	0.997	D	0.66497	0.944	T	0.12268	-1.0554	10	0.54805	T	0.06	.	13.077	0.59093	0.0:0.7916:0.2084:0.0	.	492	Q6Q759	SPG17_HUMAN	F	492	ENSP00000337804:C492F	ENSP00000337804:C492F	C	-	2	0	SPAG17	118431039	0.998000	0.40836	0.998000	0.56505	0.976000	0.68499	1.903000	0.39858	2.655000	0.90218	0.655000	0.94253	TGT	.		0.488	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
ST8SIA4	7903	ucsc.edu;bcgsc.ca	37	5	100191909	100191909	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr5:100191909C>A	ENST00000231461.5	-	4	1005	c.695G>T	c.(694-696)gGa>gTa	p.G232V		NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	232					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		CTTCTCTCCTCCTTTGACCAT	0.418																																					p.G232V		.											.	ST8SIA4	153	0			c.G695T						.						194.0	173.0	180.0					5																	100191909		2203	4300	6503	SO:0001583	missense	7903	exon4			TCTCCTCCTTTGA	L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.695G>T	5.37:g.100191909C>A	ENSP00000231461:p.Gly232Val	Somatic	214.0	2.0		WXS	Illumina HiSeq	.	144.0	56.0	NM_005668	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	ENST00000231461.5	37	CCDS4091.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.312768	0.81358	.	.	ENSG00000113532	ENST00000231461	T	0.32515	1.45	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.48295	0.1492	M	0.73962	2.25	0.80722	D	1	P	0.52692	0.955	P	0.54629	0.757	T	0.32295	-0.9912	10	0.16420	T	0.52	-14.9479	18.1509	0.89674	0.0:1.0:0.0:0.0	.	232	Q92187	SIA8D_HUMAN	V	232	ENSP00000231461:G232V	ENSP00000231461:G232V	G	-	2	0	ST8SIA4	100219808	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.619000	0.83057	2.751000	0.94390	0.591000	0.81541	GGA	.		0.418	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	NM_005668	
STRADA	92335	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	61791458	61791458	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr17:61791458G>A	ENST00000336174.6	-	5	246	c.134C>T	c.(133-135)gCg>gTg	p.A45V	STRADA_ENST00000579340.1_5'UTR|STRADA_ENST00000392950.4_Missense_Mutation_p.A8V|STRADA_ENST00000245865.5_5'UTR|STRADA_ENST00000582137.1_Missense_Mutation_p.A16V|STRADA_ENST00000580039.1_Intron|STRADA_ENST00000447001.3_Intron|STRADA_ENST00000375840.4_5'UTR|RP11-51F16.8_ENST00000580553.1_3'UTR	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	45					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.A45V(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						CTCTGAGCTCGCATCATTGGT	0.473																																					p.A45V		.											.	STRADA	547	1	Substitution - Missense(1)	kidney(1)	c.C134T						.						117.0	98.0	104.0					17																	61791458		2203	4300	6503	SO:0001583	missense	92335	exon5			GAGCTCGCATCAT	AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.134C>T	17.37:g.61791458G>A	ENSP00000336655:p.Ala45Val	Somatic	106.0	1.0		WXS	Illumina HiSeq	Phase_I	132.0	64.0	NM_001003787	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	ENST00000336174.6	37	CCDS32703.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961836	0.53400	.	.	ENSG00000125695	ENST00000336174;ENST00000392950;ENST00000245865	T;T	0.56103	0.54;0.48	5.66	5.66	0.87406	Protein kinase-like domain (1);	0.140365	0.48767	D	0.000164	T	0.43389	0.1245	N	0.24115	0.695	0.80722	D	1	P;P;P;P	0.49253	0.555;0.921;0.456;0.555	B;B;B;B	0.40256	0.08;0.324;0.118;0.08	T	0.48281	-0.9049	10	0.59425	D	0.04	.	19.7543	0.96284	0.0:0.0:1.0:0.0	.	16;8;8;45	B4DW17;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;STRAA_HUMAN	V	45;8;7	ENSP00000336655:A45V;ENSP00000376677:A8V	ENSP00000245865:A7V	A	-	2	0	STRADA	59145190	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.567000	0.73983	2.680000	0.91292	0.561000	0.74099	GCG	.		0.473	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1		
TACR3	6870	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	104511152	104511152	+	Splice_Site	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:104511152C>G	ENST00000304883.2	-	5	1226		c.e5-1		RP11-297P16.3_ENST00000512401.1_RNA|RP11-297P16.3_ENST00000502936.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3						aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		AGCTCGAAATCTGAGGAAAAG	0.418																																					.		.											.	TACR3	525	0			c.1086-1G>C						.						47.0	47.0	47.0					4																	104511152		2203	4300	6503	SO:0001630	splice_region_variant	6870	exon6			CGAAATCTGAGGA	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1086-1G>C	4.37:g.104511152C>G		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	14.0	NM_001059	Q0P510	Splice_Site	SNP	ENST00000304883.2	37	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.342453	0.81911	.	.	ENSG00000169836	ENST00000304883	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0794	0.93175	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TACR3	104730601	1.000000	0.71417	0.996000	0.52242	0.888000	0.51559	7.356000	0.79445	2.746000	0.94184	0.591000	0.81541	.	.		0.418	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	Intron
TARS2	80222	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150461451	150461451	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:150461451C>G	ENST00000369064.3	+	3	309	c.275C>G	c.(274-276)gCa>gGa	p.A92G	TARS2_ENST00000438568.2_Missense_Mutation_p.A92G|TARS2_ENST00000606933.1_Missense_Mutation_p.A92G|TARS2_ENST00000369054.2_Missense_Mutation_p.A92G	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	92					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	TCAACACTGGCAGATACTGCA	0.453																																					p.A92G		.											.	TARS2	91	0			c.C275G						.						134.0	146.0	142.0					1																	150461451		2203	4300	6503	SO:0001583	missense	80222	exon3			CACTGGCAGATAC	BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.275C>G	1.37:g.150461451C>G	ENSP00000358060:p.Ala92Gly	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	17.0	NM_001271896	Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	37	CCDS952.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752192	0.69533	.	.	ENSG00000143374	ENST00000438568;ENST00000369054;ENST00000369064;ENST00000369053	.	.	.	5.05	5.05	0.67936	TGS-like (1);TGS (1);Beta-grasp fold, ferredoxin-type (1);	0.066074	0.64402	D	0.000011	T	0.73345	0.3575	M	0.78344	2.41	0.45634	D	0.998568	D;D	0.69078	0.995;0.997	D;D	0.65773	0.932;0.938	T	0.74396	-0.3679	8	.	.	.	0.9546	15.9261	0.79618	0.0:1.0:0.0:0.0	.	92;92	Q9H9V2;Q9BW92	.;SYTM_HUMAN	G	92	.	.	A	+	2	0	TARS2	148728075	0.998000	0.40836	1.000000	0.80357	0.908000	0.53690	4.021000	0.57196	2.614000	0.88457	0.555000	0.69702	GCA	.		0.453	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150	
TEAD1	7003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	12958680	12958680	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:12958680G>A	ENST00000526600.1	+	8	1127	c.904G>A	c.(904-906)Gaa>Aaa	p.E302K	TEAD1_ENST00000361985.2_Missense_Mutation_p.E398K|TEAD1_ENST00000527636.1_Missense_Mutation_p.E398K|TEAD1_ENST00000361905.4_Missense_Mutation_p.E383K|TEAD1_ENST00000527575.1_Missense_Mutation_p.E340K|TEAD1_ENST00000334310.6_Missense_Mutation_p.E329K			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	398	Transcriptional activation. {ECO:0000255}.				gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGATACACAAGAAACTCTACT	0.353																																					p.E398K		.											.	TEAD1	90	0			c.G1192A						.						97.0	90.0	92.0					11																	12958680		2200	4294	6494	SO:0001583	missense	7003	exon13			ACACAAGAAACTC	X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000526600.1:c.904G>A	11.37:g.12958680G>A	ENSP00000435393:p.Glu302Lys	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	23.0	NM_021961	A4FUP2|E7EV65	Missense_Mutation	SNP	ENST00000526600.1	37		.	.	.	.	.	.	.	.	.	.	G	26.4	4.736256	0.89482	.	.	ENSG00000187079	ENST00000361905;ENST00000527636;ENST00000527575;ENST00000334310;ENST00000361985;ENST00000526600	T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.68109	0.2965	M	0.93507	3.425	0.52501	D	0.999956	D;D;D	0.89917	0.978;0.999;1.0	D;D;D	0.91635	0.966;0.998;0.999	T	0.76838	-0.2811	10	0.87932	D	0	-5.4151	19.2947	0.94117	0.0:0.0:1.0:0.0	.	329;302;398	A4FUP2;E9PKB7;P28347	.;.;TEAD1_HUMAN	K	383;398;340;329;398;302	ENSP00000355332:E383K;ENSP00000435233:E398K;ENSP00000435977:E340K;ENSP00000334754:E329K;ENSP00000354588:E398K;ENSP00000435393:E302K	ENSP00000334754:E329K	E	+	1	0	TEAD1	12915256	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.803000	0.99136	2.652000	0.90054	0.650000	0.86243	GAA	.		0.353	TEAD1-007	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000387220.1	NM_021961	
TMEM2	23670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	74355033	74355033	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:74355033A>G	ENST00000377044.4	-	5	1689	c.1150T>C	c.(1150-1152)Tat>Cat	p.Y384H	TMEM2_ENST00000377066.5_Missense_Mutation_p.Y384H	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	384					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TCCACAGTATAAAATTCTCTT	0.408																																					p.Y384H		.											.	TMEM2	92	0			c.T1150C						.						111.0	107.0	108.0					9																	74355033		2203	4300	6503	SO:0001583	missense	23670	exon5			CAGTATAAAATTC		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.1150T>C	9.37:g.74355033A>G	ENSP00000366243:p.Tyr384His	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	21.0	NM_001135820	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	A	7.603	0.673129	0.14776	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.72942	-0.7;-0.59	5.65	3.26	0.37387	.	0.522566	0.22405	N	0.060494	T	0.43166	0.1235	N	0.11427	0.14	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.09574	-1.0668	10	0.15066	T	0.55	.	3.445	0.07477	0.5441:0.2613:0.0689:0.1257	.	384;384	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	H	384	ENSP00000366243:Y384H;ENSP00000366266:Y384H	ENSP00000366243:Y384H	Y	-	1	0	TMEM2	73544853	0.999000	0.42202	0.996000	0.52242	0.957000	0.61999	0.876000	0.28092	0.402000	0.25451	0.402000	0.26972	TAT	.		0.408	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
TLR4	7099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	120475751	120475751	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:120475751C>T	ENST00000355622.6	+	3	1446	c.1345C>T	c.(1345-1347)Ctc>Ttc	p.L449F	TLR4_ENST00000394487.4_Missense_Mutation_p.L409F|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	449					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ACTCAGAAACCTCATTTACCT	0.393																																					p.L449F		.											.	TLR4	577	0			c.C1345T						.						97.0	96.0	97.0					9																	120475751		2203	4300	6503	SO:0001583	missense	7099	exon3			AGAAACCTCATTT	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1345C>T	9.37:g.120475751C>T	ENSP00000363089:p.Leu449Phe	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	11.0	NM_138554	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524352	0.64747	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.06294	3.32;3.32	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000010	T	0.38585	0.1046	M	0.93763	3.455	0.44221	D	0.997058	D	0.89917	1.0	D	0.97110	1.0	T	0.48151	-0.9060	10	0.87932	D	0	.	20.3213	0.98679	0.0:1.0:0.0:0.0	.	449	O00206	TLR4_HUMAN	F	409;449	ENSP00000377997:L409F;ENSP00000363089:L449F	ENSP00000363089:L449F	L	+	1	0	TLR4	119515572	0.981000	0.34729	0.099000	0.21106	0.834000	0.47266	2.744000	0.47450	2.810000	0.96702	0.650000	0.86243	CTC	.		0.393	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554	
TOX	9760	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	59750851	59750851	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr8:59750851C>T	ENST00000361421.1	-	5	933	c.713G>A	c.(712-714)cGg>cAg	p.R238Q		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	238						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				AGAGGCAGGCCGCTTCTCTCC	0.433																																					p.R238Q	Pancreas(161;610 1969 17913 21374 22725)	.											.	TOX	227	0			c.G713A						.						54.0	63.0	60.0					8																	59750851		2199	4298	6497	SO:0001583	missense	9760	exon5			GCAGGCCGCTTCT		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.713G>A	8.37:g.59750851C>T	ENSP00000354842:p.Arg238Gln	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	5.0	NM_014729	Q96AV5	Missense_Mutation	SNP	ENST00000361421.1	37	CCDS34897.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454202	0.84209	.	.	ENSG00000198846	ENST00000361421	T	0.16324	2.35	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.25975	0.0633	L	0.52206	1.635	0.58432	D	0.999994	D	0.57899	0.981	P	0.47603	0.551	T	0.00289	-1.1844	9	.	.	.	.	20.0368	0.97565	0.0:1.0:0.0:0.0	.	238	O94900	TOX_HUMAN	Q	238	ENSP00000354842:R238Q	.	R	-	2	0	TOX	59913405	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.727000	0.93392	0.591000	0.81541	CGG	.		0.433	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7577082	7577082	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr17:7577082C>T	ENST00000269305.4	-	8	1045	c.856G>A	c.(856-858)Gaa>Aaa	p.E286K	TP53_ENST00000420246.2_Missense_Mutation_p.E286K|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.E286K|TP53_ENST00000359597.4_Missense_Mutation_p.E286K|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.E286K	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	286	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11023613, ECO:0000269|PubMed:8316628}.|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:8829627}.|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E286K(58)|p.E286*(22)|p.0?(8)|p.E286Q(5)|p.?(2)|p.E286fs*59(2)|p.E286fs*17(2)|p.R283fs*16(2)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.R283fs*56(1)|p.E285fs*13(1)|p.G279fs*59(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGATTCTCTTCCTCTGTGCGC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E286K	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	112	Substitution - Missense(63)|Substitution - Nonsense(22)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	lung(18)|upper_aerodigestive_tract(13)|breast(10)|large_intestine(9)|urinary_tract(9)|skin(9)|oesophagus(9)|haematopoietic_and_lymphoid_tissue(8)|liver(7)|central_nervous_system(6)|bone(4)|ovary(3)|stomach(2)|vulva(1)|soft_tissue(1)|eye(1)|biliary_tract(1)|endometrium(1)	c.G856A	GRCh37	CM076567	TP53	M		.						95.0	81.0	86.0					17																	7577082		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TCTCTTCCTCTGT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.856G>A	17.37:g.7577082C>T	ENSP00000269305:p.Glu286Lys	Somatic	91.0	1.0		WXS	Illumina HiSeq	Phase_I	107.0	66.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.310731	0.81358	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	4.99	4.99	0.66335	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92077	3.27	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.77557	0.983;0.985;0.982;0.99	D	0.96355	0.9261	10	0.87932	D	0	-23.2961	15.807	0.78520	0.0:1.0:0.0:0.0	.	286;286;286;286	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	286;286;286;286;286;275;154	ENSP00000352610:E286K;ENSP00000269305:E286K;ENSP00000398846:E286K;ENSP00000391127:E286K;ENSP00000391478:E286K;ENSP00000425104:E154K	ENSP00000269305:E286K	E	-	1	0	TP53	7517807	1.000000	0.71417	0.972000	0.41901	0.455000	0.32408	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAA	.		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRAM1L1	133022	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	118005773	118005789	+	Frame_Shift_Del	DEL	CAAGATAAACACAATGG	CAAGATAAACACAATGG	-			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	CAAGATAAACACAATGG	CAAGATAAACACAATGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:118005773_118005789delCAAGATAAACACAATGG	ENST00000310754.4	-	1	947_963	c.761_777delCCATTGTGTTTATCTTG	c.(760-777)gccattgtgtttatcttgfs	p.AIVFIL254fs		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	254	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						CAAGTCTACCCAAGATAAACACAATGGCCCACAGAGA	0.415																																					p.254_259del		.											.	TRAM1L1	90	0			c.761_777del						.																																			SO:0001589	frameshift_variant	133022	exon1			TCTACCCAAGATA	AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.761_777delCCATTGTGTTTATCTTG	4.37:g.118005773_118005789delCAAGATAAACACAATGG	ENSP00000309402:p.Ala254fs	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	14.0	NM_152402	Q8N2L7	Frame_Shift_Del	DEL	ENST00000310754.4	37	CCDS3707.1																																																																																			.		0.415	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1	NM_152402	
TRH	7200	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	129695783	129695783	+	Silent	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr3:129695783G>T	ENST00000302649.3	+	3	980	c.453G>T	c.(451-453)cgG>cgT	p.R151R	TRH_ENST00000507066.1_Silent_p.R147R	NM_007117.3	NP_009048.1	P20396	TRH_HUMAN	thyrotropin-releasing hormone	151					adult walking behavior (GO:0007628)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|histamine metabolic process (GO:0001692)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of feeding behavior (GO:2000252)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of insulin secretion (GO:0032024)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	thyrotropin-releasing hormone activity (GO:0008437)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	14						TCCCGAAGCGGCAGCACCCAG	0.587																																					p.R151R	Esophageal Squamous(60;321 1330 17401 41911)	.											.	TRH	91	0			c.G453T						.						44.0	43.0	44.0					3																	129695783		2203	4300	6503	SO:0001819	synonymous_variant	7200	exon3			GAAGCGGCAGCAC		CCDS3066.1	3q13.3-q21	2013-02-28				ENSG00000170893		"""Endogenous ligands"""	12298	protein-coding gene	gene with protein product	"""prothyroliberin"""	613879				2126343, 1900134	Standard	NM_007117		Approved		uc003enc.4	P20396		ENST00000302649.3:c.453G>T	3.37:g.129695783G>T		Somatic	131.0	1.0		WXS	Illumina HiSeq	Phase_I	142.0	50.0	NM_007117	B2R8R1|Q2TB83	Silent	SNP	ENST00000302649.3	37	CCDS3066.1																																																																																			.		0.587	TRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356592.1	NM_007117	
TRIP11	9321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	92470462	92470462	+	Silent	SNP	C	C	T	rs35798420	byFrequency	TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr14:92470462C>T	ENST00000267622.4	-	11	4231	c.3858G>A	c.(3856-3858)caG>caA	p.Q1286Q		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1286					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		GTGCTAATTCCTGCCCAAAAT	0.378			T	PDGFRB	AML								c|||	21	0.00419329	0.0159	0.0	5008	,	,		21391	0.0		0.0	False		,,,				2504	0.0				p.Q1286Q	Ovarian(84;609 1888 9852 42686)	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	TRIP11	1400	0			c.G3858A						.	C		71,4333	63.5+/-100.7	0,71,2131	55.0	56.0	56.0		3858	2.4	1.0	14	dbSNP_126	56	0,8600		0,0,4300	no	coding-synonymous	TRIP11	NM_004239.3		0,71,6431	TT,TC,CC		0.0,1.6122,0.546		1286/1980	92470462	71,12933	2202	4300	6502	SO:0001819	synonymous_variant	9321	exon11			TAATTCCTGCCCA	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.3858G>A	14.37:g.92470462C>T		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	18.0	NM_004239	B2RUT2|O14689|O15154|O95949	Silent	SNP	ENST00000267622.4	37	CCDS9899.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	C	0.093	-1.163647	0.01673	0.016122	0.0	ENSG00000100815	ENST00000554357	.	.	.	5.24	2.4	0.29515	.	.	.	.	.	T	0.36799	0.0980	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35748	-0.9776	4	.	.	.	.	5.957	0.19279	0.1307:0.6087:0.0:0.2606	rs35798420	.	.	.	R	1002	.	.	G	-	1	0	TRIP11	91540215	0.973000	0.33851	0.982000	0.44146	0.430000	0.31655	0.215000	0.17562	1.203000	0.43233	0.455000	0.32223	GGA	C|0.996;T|0.004		0.378	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
TXNDC2	84203	hgsc.bcm.edu;broad.mit.edu	37	18	9887134	9887134	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr18:9887134A>T	ENST00000306084.6	+	2	857	c.658A>T	c.(658-660)Aag>Tag	p.K220*	TXNDC2_ENST00000357775.5_Nonsense_Mutation_p.K153*|TXNDC2_ENST00000536353.2_Intron	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	220	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CATCCAGCCCAAGCTGGGCAA	0.557																																					p.K220X		.											.	TXNDC2	92	0			c.A658T						.						132.0	135.0	134.0					18																	9887134		2203	4300	6503	SO:0001587	stop_gained	84203	exon2			CAGCCCAAGCTGG	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.658A>T	18.37:g.9887134A>T	ENSP00000304908:p.Lys220*	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	7.0	NM_001098529	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Nonsense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	.	.	.	.	.	.	.	.	.	.	a	32	5.105591	0.94292	.	.	ENSG00000168454	ENST00000357775;ENST00000306084;ENST00000426718	.	.	.	3.17	3.17	0.36434	.	1.422770	0.04949	N	0.459936	.	.	.	.	.	.	0.32652	N	0.51932	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.3162	9.811	0.40824	1.0:0.0:0.0:0.0	.	.	.	.	X	153;220;220	.	.	K	+	1	0	TXNDC2	9877134	0.000000	0.05858	0.055000	0.19348	0.237000	0.25408	0.195000	0.17155	1.484000	0.48361	0.519000	0.50382	AAG	.		0.557	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
UBAC2	337867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	100020041	100020041	+	Splice_Site	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:100020041G>A	ENST00000403766.3	+	8	943	c.808G>A	c.(808-810)Gga>Aga	p.G270R	UBAC2_ENST00000460562.1_3'UTR|UBAC2_ENST00000376440.2_Splice_Site_p.G235R	NM_001144072.1	NP_001137544.1	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2	270					protein localization to endoplasmic reticulum (GO:0070972)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)	10	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CTCTTTTTAGGGAGGAATGAT	0.458																																					p.G270R		.											.	UBAC2	91	0			c.G808A						.						140.0	123.0	129.0					13																	100020041		2203	4300	6503	SO:0001630	splice_region_variant	337867	exon8			TTTTAGGGAGGAA	AK055110	CCDS9490.1, CCDS45064.1	13q32.3	2012-02-01	2007-04-20	2007-04-20	ENSG00000134882	ENSG00000134882			20486	protein-coding gene	gene with protein product			"""phosphoglycerate dehydrogenase like 1"""	PHGDHL1			Standard	NM_177967		Approved	FLJ30548, RP11-178C10.1	uc001voa.4	Q8NBM4	OTTHUMG00000017267	ENST00000403766.3:c.808-1G>A	13.37:g.100020041G>A		Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	45.0	NM_001144072	B3KNV7|Q0VAB5|Q5W0W6|Q5W0W9|Q6GQR2|Q6P4B0|Q8N2E8|Q96NW2	Missense_Mutation	SNP	ENST00000403766.3	37	CCDS45064.1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867522	0.72065	.	.	ENSG00000134882	ENST00000403766;ENST00000355700;ENST00000376440	.	.	.	5.56	3.83	0.44106	.	0.328328	0.34628	N	0.003816	T	0.68192	0.2974	M	0.65975	2.015	0.43517	D	0.995789	B;D;D;P	0.69078	0.214;0.997;0.979;0.828	B;D;P;B	0.64410	0.062;0.925;0.606;0.223	T	0.66156	-0.5994	8	.	.	.	-15.2089	8.4545	0.32890	0.179:0.0:0.821:0.0	.	200;235;270;270	B7Z6T7;Q8NBM4-2;A8K2S7;Q8NBM4	.;.;.;UBAC2_HUMAN	R	270;136;235	.	.	G	+	1	0	UBAC2	98818042	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.457000	0.66672	0.709000	0.31976	0.561000	0.74099	GGA	.		0.458	UBAC2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045588.1	NM_177967	Missense_Mutation
USH2A	7399	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216173842	216173842	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:216173842T>C	ENST00000307340.3	-	33	6774	c.6388A>G	c.(6388-6390)Aac>Gac	p.N2130D	USH2A_ENST00000366943.2_Missense_Mutation_p.N2130D	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2130	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAGGAACTGTTTGTACAGCCC	0.453										HNSCC(13;0.011)																											p.N2130D		.											.	USH2A	115	0			c.A6388G						.						130.0	115.0	120.0					1																	216173842		2203	4300	6503	SO:0001583	missense	7399	exon33			AACTGTTTGTACA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6388A>G	1.37:g.216173842T>C	ENSP00000305941:p.Asn2130Asp	Somatic	161.0	1.0		WXS	Illumina HiSeq	Phase_I	174.0	22.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.655409	0.88056	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53206	0.63;0.63	5.8	5.8	0.92144	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.47852	D	0.000207	T	0.57607	0.2065	L	0.58925	1.835	0.50467	D	0.999876	D	0.76494	0.999	P	0.57620	0.824	T	0.52975	-0.8503	10	0.12430	T	0.62	.	16.1459	0.81569	0.0:0.0:0.0:1.0	.	2130	O75445	USH2A_HUMAN	D	2130	ENSP00000305941:N2130D;ENSP00000355910:N2130D	ENSP00000305941:N2130D	N	-	1	0	USH2A	214240465	1.000000	0.71417	0.976000	0.42696	0.970000	0.65996	2.721000	0.47260	2.221000	0.72209	0.528000	0.53228	AAC	.		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USH2A	7399	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	216373074	216373074	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:216373074C>G	ENST00000307340.3	-	17	4092	c.3706G>C	c.(3706-3708)Gtg>Ctg	p.V1236L	USH2A_ENST00000366942.3_Missense_Mutation_p.V1236L|USH2A_ENST00000366943.2_Missense_Mutation_p.V1236L|RP5-1099E6.3_ENST00000420867.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1236	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCTGTGGTCACTGTAATGGGC	0.493										HNSCC(13;0.011)																											p.V1236L		.											.	USH2A	115	0			c.G3706C						.						92.0	89.0	90.0					1																	216373074		2203	4300	6503	SO:0001583	missense	7399	exon17			TGGTCACTGTAAT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3706G>C	1.37:g.216373074C>G	ENSP00000305941:p.Val1236Leu	Somatic	108.0	1.0		WXS	Illumina HiSeq	Phase_I	99.0	41.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.570408	0.45798	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.56103	0.48;0.54;0.54	5.61	4.68	0.58851	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.190911	0.24970	N	0.034153	T	0.47985	0.1475	M	0.77616	2.38	0.35866	D	0.827849	B;P	0.43287	0.372;0.802	B;B	0.31016	0.093;0.123	T	0.64188	-0.6466	10	0.40728	T	0.16	.	12.8746	0.57984	0.0:0.8718:0.0:0.1282	.	1236;1236	O75445-2;O75445	.;USH2A_HUMAN	L	1236	ENSP00000305941:V1236L;ENSP00000355910:V1236L;ENSP00000355909:V1236L	ENSP00000305941:V1236L	V	-	1	0	USH2A	214439697	0.027000	0.19231	0.961000	0.40146	0.892000	0.51952	0.173000	0.16724	2.793000	0.96121	0.655000	0.94253	GTG	.		0.493	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
VEZF1	7716	hgsc.bcm.edu;ucsc.edu	37	17	56056622	56056622	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr17:56056622C>T	ENST00000581208.1	-	5	1069	c.1029G>A	c.(1027-1029)caG>caA	p.Q343Q	VEZF1_ENST00000584396.1_Silent_p.Q334Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	343	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gctgctgctgctgctgctgct	0.453																																					p.Q343Q		.											.	VEZF1	136	0			c.G1029A						.																																			SO:0001819	synonymous_variant	7716	exon5			CTGCTGCTGCTGC	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1029G>A	17.37:g.56056622C>T		Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	244.0	34.0	NM_007146		Silent	SNP	ENST00000581208.1	37	CCDS32687.1																																																																																			.		0.453	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
VN1R4	317703	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	53770602	53770602	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:53770602A>C	ENST00000311170.4	-	1	370	c.317T>G	c.(316-318)gTg>gGg	p.V106G	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	106					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		GACCGTGATCACCTGGAAGAC	0.498										HNSCC(26;0.072)																											p.V106G		.											.	VN1R4	92	0			c.T317G						.						31.0	26.0	27.0					19																	53770602		2203	4298	6501	SO:0001583	missense	317703	exon1			GTGATCACCTGGA	AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.317T>G	19.37:g.53770602A>C	ENSP00000310856:p.Val106Gly	Somatic	340.0	1.0		WXS	Illumina HiSeq	Phase_I	334.0	42.0	NM_173857	Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Missense_Mutation	SNP	ENST00000311170.4	37	CCDS33099.1	.	.	.	.	.	.	.	.	.	.	A	7.564	0.665394	0.14710	.	.	ENSG00000228567	ENST00000311170	T	0.37752	1.18	2.28	-0.0905	0.13664	GPCR, rhodopsin-like superfamily (1);	0.774402	0.10538	N	0.663084	T	0.40171	0.1106	L	0.59436	1.845	0.27492	N	0.952252	P	0.48998	0.918	P	0.52627	0.704	T	0.33803	-0.9854	10	0.87932	D	0	.	2.7634	0.05313	0.3833:0.2487:0.3679:0.0	.	106	Q7Z5H5	VN1R4_HUMAN	G	106	ENSP00000310856:V106G	ENSP00000310856:V106G	V	-	2	0	VN1R4	58462414	0.000000	0.05858	0.709000	0.30452	0.503000	0.33858	-0.415000	0.07106	0.038000	0.15604	0.445000	0.29226	GTG	.		0.498	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464287.1	NM_173857	
ZBTB43	23099	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	129595854	129595854	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:129595854G>A	ENST00000373464.4	+	3	1330	c.1066G>A	c.(1066-1068)Ggg>Agg	p.G356R	ZBTB43_ENST00000373457.1_Missense_Mutation_p.G356R|ZBTB43_ENST00000449886.1_Missense_Mutation_p.G356R	NM_014007.3	NP_054726.1	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43	356					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						AATGGTAACAGGGATTAAAGA	0.473																																					p.G356R		.											.	ZBTB43	91	0			c.G1066A						.						75.0	79.0	77.0					9																	129595854		2203	4300	6503	SO:0001583	missense	23099	exon2			GTAACAGGGATTA	AF049907	CCDS6867.1	9q33.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000169155	ENSG00000169155		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	17908	protein-coding gene	gene with protein product			"""zinc finger protein 297B"""	ZNF297B			Standard	NM_014007		Approved	KIAA0414, ZNF-X, FLJ22470, ZBTB22B	uc010mxf.3	O43298	OTTHUMG00000020693	ENST00000373464.4:c.1066G>A	9.37:g.129595854G>A	ENSP00000362563:p.Gly356Arg	Somatic	55.0	1.0		WXS	Illumina HiSeq	Phase_I	55.0	14.0	NM_001135776	Q5JU96	Missense_Mutation	SNP	ENST00000373464.4	37	CCDS6867.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824680	0.71143	.	.	ENSG00000169155	ENST00000449886;ENST00000373464;ENST00000373457	T;T;T	0.10960	2.82;2.82;2.82	5.51	5.51	0.81932	.	0.064462	0.64402	D	0.000009	T	0.20007	0.0481	L	0.29908	0.895	0.54753	D	0.999988	D	0.62365	0.991	D	0.63597	0.916	T	0.04870	-1.0921	10	0.11794	T	0.64	.	19.7779	0.96402	0.0:0.0:1.0:0.0	.	356	O43298	ZBT43_HUMAN	R	356	ENSP00000390344:G356R;ENSP00000362563:G356R;ENSP00000362556:G356R	ENSP00000362556:G356R	G	+	1	0	ZBTB43	128635675	1.000000	0.71417	0.983000	0.44433	0.981000	0.71138	5.202000	0.65169	2.748000	0.94277	0.462000	0.41574	GGG	.		0.473	ZBTB43-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054124.1	NM_001135776	
ZNF214	7761	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7021610	7021610	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:7021610A>T	ENST00000278314.4	-	3	1619	c.1304T>A	c.(1303-1305)gTg>gAg	p.V435E	ZNF214_ENST00000531083.1_5'Flank|ZNF214_ENST00000536068.1_Missense_Mutation_p.V435E	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	435					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TCCTGTATGCACTCTCTGATG	0.413																																					p.V435E	Ovarian(22;251 657 736 21522 46864)	.											.	ZNF214	91	0			c.T1304A						.						105.0	110.0	108.0					11																	7021610		2201	4296	6497	SO:0001583	missense	7761	exon3			GTATGCACTCTCT	AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.1304T>A	11.37:g.7021610A>T	ENSP00000278314:p.Val435Glu	Somatic	118.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	30.0	NM_013249	B2R8Q1	Missense_Mutation	SNP	ENST00000278314.4	37	CCDS31418.1	.	.	.	.	.	.	.	.	.	.	A	14.95	2.688372	0.48097	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.01025	5.43;5.43	3.95	3.95	0.45737	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.500352	0.15531	N	0.257489	T	0.01905	0.0060	L	0.50847	1.595	0.25416	N	0.988314	D	0.53462	0.96	P	0.51895	0.683	T	0.47947	-0.9077	10	0.87932	D	0	.	6.1332	0.20217	0.8875:0.0:0.1125:0.0	.	435	Q9UL59	ZN214_HUMAN	E	435	ENSP00000278314:V435E;ENSP00000445373:V435E	ENSP00000278314:V435E	V	-	2	0	ZNF214	6978186	0.000000	0.05858	0.998000	0.56505	0.998000	0.95712	0.788000	0.26872	2.005000	0.58758	0.459000	0.35465	GTG	.		0.413	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385349.1		
ZNF280B	140883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	22843682	22843682	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr22:22843682C>T	ENST00000406426.1	-	4	784	c.42G>A	c.(40-42)caG>caA	p.Q14Q	ZNF280B_ENST00000360412.2_Silent_p.Q14Q			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	14					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GTATGTTCTTCTGTGGTTCAG	0.388																																					p.Q14Q		.											.	ZNF280B	70	0			c.G42A						.						141.0	124.0	129.0					22																	22843682		2203	4300	6503	SO:0001819	synonymous_variant	140883	exon4			GTTCTTCTGTGGT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.42G>A	22.37:g.22843682C>T		Somatic	316.0	0.0		WXS	Illumina HiSeq	Phase_I	293.0	45.0	NM_080764		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																			.		0.388	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
ZNF43	7594	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	22002022	22002022	+	Splice_Site	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:22002022C>A	ENST00000354959.4	-	2	174	c.5G>T	c.(4-6)gGa>gTa	p.G2V	ZNF43_ENST00000598381.1_5'UTR|ZNF43_ENST00000594012.1_5'UTR|ZNF43_ENST00000598288.1_5'UTR|ZNF43_ENST00000595461.1_5'UTR	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TGTCAATGGTCCCTAAAAAAA	0.388																																					p.G11V		.											.	ZNF43	154	0			c.G32T						.						66.0	70.0	69.0					19																	22002022		2203	4300	6503	SO:0001630	splice_region_variant	7594	exon2			AATGGTCCCTAAA	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.4-1G>T	19.37:g.22002022C>A		Somatic	122.0	2.0		WXS	Illumina HiSeq	Phase_I	118.0	48.0	NM_001256653	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	37	CCDS12413.2	.	.	.	.	.	.	.	.	.	.	C	12.04	1.817544	0.32145	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.00873	5.59	0.225	0.225	0.15325	Krueppel-associated box (1);	.	.	.	.	T	0.02929	0.0087	M	0.85777	2.775	0.52099	D	0.999944	D	0.58268	0.982	P	0.55824	0.785	T	0.52682	-0.8543	9	0.46703	T	0.11	.	3.8647	0.09012	1.0E-4:0.5249:0.4748:1.0E-4	.	2	P17038	ZNF43_HUMAN	V	1;2	ENSP00000347045:G2V	ENSP00000347045:G2V	G	-	2	0	ZNF43	21793862	0.001000	0.12720	0.391000	0.26233	0.392000	0.30506	-0.714000	0.05002	0.300000	0.22699	0.305000	0.20034	GGA	.		0.388	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423	Missense_Mutation
ZNF727	442319	broad.mit.edu;bcgsc.ca	37	7	63538068	63538068	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr7:63538068A>T	ENST00000550760.3	+	4	820	c.641A>T	c.(640-642)aAc>aTc	p.N214I	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						AAGTTCTCAAACCTTACTGAA	0.368																																					p.N214I		.											.	.	.	0			c.A641T						.						25.0	25.0	25.0					7																	63538068		692	1591	2283	SO:0001583	missense	442319	exon4			TCTCAAACCTTAC			7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.641A>T	7.37:g.63538068A>T	ENSP00000447987:p.Asn214Ile	Somatic	65.0	1.0		WXS	Illumina HiSeq	Phase_I	80.0	52.0	NM_001159522		Missense_Mutation	SNP	ENST00000550760.3	37	CCDS55113.1	.	.	.	.	.	.	.	.	.	.	A	3.628	-0.076209	0.07184	.	.	ENSG00000257482	ENST00000550760	T	0.22539	1.95	1.02	-1.03	0.10102	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21227	0.0511	L	0.41573	1.285	0.09310	N	1	D	0.55172	0.97	P	0.52598	0.703	T	0.12734	-1.0536	8	.	.	.	.	4.3187	0.11005	0.7474:0.0:0.2526:0.0	.	214	A8MUV8	ZN727_HUMAN	I	214	ENSP00000447987:N214I	.	N	+	2	0	ZNF727	63175503	0.000000	0.05858	0.033000	0.17914	0.032000	0.12392	0.025000	0.13577	-0.480000	0.06803	-0.483000	0.04790	AAC	.		0.368	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001159522	
ZNF791	163049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12739344	12739344	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:12739344G>A	ENST00000343325.4	+	4	1163	c.1001G>A	c.(1000-1002)gGg>gAg	p.G334E	AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000540038.1_Missense_Mutation_p.G225E|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000446165.1_3'UTR|ZNF791_ENST00000458122.3_Missense_Mutation_p.G302E	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	334					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						AAAGAATGTGGGAAATCTTTC	0.403																																					p.G334E		.											.	ZNF791	92	0			c.G1001A						.						50.0	55.0	53.0					19																	12739344		2203	4300	6503	SO:0001583	missense	163049	exon4			AATGTGGGAAATC	AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1001G>A	19.37:g.12739344G>A	ENSP00000342974:p.Gly334Glu	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	20.0	NM_153358	B7Z586|Q8NC99	Missense_Mutation	SNP	ENST00000343325.4	37	CCDS12273.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357771	0.61403	.	.	ENSG00000173875	ENST00000343325;ENST00000393303;ENST00000458122;ENST00000540038	T;T;T	0.58210	0.35;0.35;0.35	1.83	1.83	0.25207	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.63058	0.2479	M	0.61703	1.905	0.38136	D	0.938308	D	0.71674	0.998	D	0.65140	0.932	T	0.65602	-0.6128	9	0.49607	T	0.09	.	9.2247	0.37398	0.0:0.0:1.0:0.0	.	334	Q3KP31	ZN791_HUMAN	E	334;316;302;225	ENSP00000342974:G334E;ENSP00000441761:G302E;ENSP00000441038:G225E	ENSP00000342974:G334E	G	+	2	0	ZNF791	12600344	1.000000	0.71417	0.586000	0.28679	0.918000	0.54935	4.460000	0.60108	1.007000	0.39238	0.491000	0.48974	GGG	.		0.403	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358	
THEMIS	387357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	128135050	128135051	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr6:128135050_128135051GG>TT	ENST00000368248.2	-	4	883_884	c.735_736CC>AA	c.(733-738)ctCCcc>ctAAcc	p.P246T	THEMIS_ENST00000368250.1_Missense_Mutation_p.P167T|THEMIS_ENST00000537166.1_Missense_Mutation_p.P211T|THEMIS_ENST00000543064.1_Missense_Mutation_p.P246T	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	246	CABIT 1.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						TCTAGACTGGGGAGGATGCGGA	0.351																																					p.P246T		.											.	.	.	0			.						.																																			SO:0001583	missense	387357	.			GACTGGGGAGGAT	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.735_736delinsTT	6.37:g.128135050_128135051delinsTT	ENSP00000357231:p.Pro246Thr	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	16.0	.	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	DNP	ENST00000368248.2	37	CCDS34534.1																																																																																			.		0.351	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
